|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 278, Issue 46, 45171-45181, November 14, 2003
Regulation of Mre11/Rad50 by Nbs1EFFECTS ON NUCLEOTIDE-DEPENDENT DNA BINDING AND ASSOCIATION WITH ATAXIA-TELANGIECTASIA-LIKE DISORDER MUTANT COMPLEXES*![]() ![]() ||**
From the
Received for publication, August 6, 2003 , and in revised form, September 3, 2003.
The Mre11/Rad50 complex is a critical component of the cellular response to DNA double-strand breaks, in organisms ranging from archaebacteria to humans. In mammalian cells, Mre11/Rad50 (M/R) associates with a third component, Nbs1, that regulates its activities and is targeted by signaling pathways that initiate DNA damage-induced checkpoint responses. Mutations in the genes that encode Nbs1 and Mre11 are responsible for the human radiation sensitivity disorders Nijmegen breakage syndrome (NBS) and ataxia-telangiectasia-like disorder (ATLD), respectively, which are characterized by defective checkpoint responses and high levels of chromosomal abnormalities. Here we demonstrate nucleotide-dependent DNA binding by the human M/R complex that requires the Nbs1 protein and is specific for double-strand DNA duplexes. Efficient DNA binding is only observed with non-hydrolyzable analogs of ATP, suggesting that ATP hydrolysis normally effects DNA release. The alleles of MRE11 associated with ATLD and the C-terminal Nbs1 polypeptide associated with NBS were expressed with the other components and found to form triple complexes except in the case of ATLD 3/4, which exhibits variability in Nbs1 association. The ATLD 1/2, ATLD 3/4, and p70 M/R/N complexes exhibit nucleotide-dependent DNA binding and exonuclease activity equivalent to the wild-type enzyme, although the ATLD complexes both show reduced activity in endonuclease assays. Sedimentation equilibrium analysis of the recombinant human complexes indicates that Mre11 is a stable dimer, Mre11 and Nbs1 form a 1:1 complex, and both M/R and M/R/N form large multimeric assemblies of 1.2 MDa. Models of M/R/N stoichiometry in light of this and previous data are discussed.
The mre11 and rad50 mutants in Saccharomyces cerevisiae were originally named for the deficiencies in meiotic recombination and ionizing radiation survival observed in mutant strains (1, 2). We now know that the protein products of these two genes associate together with a third component, Xrs2, in budding yeast, and that the complex plays important roles in homologous recombination, non-homologous end-joining, telomere maintenance, S-phase checkpoint control, and meiotic recombination (315). Homologs of Mre11 and Rad50 have been identified in every organism that has been genetically characterized, as well as some bacteriophage, indicating that the functions of the complex are fundamental to DNA transactions. Proteins analogous to the Xrs2 component have not been identified in prokaryotes or archaebacteria, however, suggesting that this part of the complex is unique to eukaryotic cells. In mammals, the Mre11 and Rad50 proteins associate with a protein called Nbs1 (also nibrin and p95) (16) into a large complex, Mre11/Rad50/Nbs1 (M/R/N).1
Nbs1 has little if any sequence similarity to Xrs2, but has clinical significance because mutations in the NBS1 gene have been identified as causal factors in the human autosomal recessive genetic disorder Nijmegen breakage syndrome (NBS) (17). Patients with NBS exhibit radiation sensitivity, immune system deficiency, and a high rate of malignancy (18). At the cellular level, abnormalities include a defective S-phase checkpoint response and an elevated rate of chromosomal breakage and translocations, although few overt deficiencies in DNA repair are found. It was recently demonstrated that the most common NBS allele, 657del5, can generate a C-terminal polypeptide through the use of an internal ribosome entry site upstream of the 5-nucleotide deletion (19). This translation product (p70) is capable of binding Mre11; thus, the 657del5 NBS allele is very likely a hypomorphic allele that can supply a subset of the normal functions of Nbs1. The clinical presentation of NBS patients constitutes a subset of the phenotype of patients with ataxia-telangiectasia (A-T), a related radiation sensitivity disorder. A-T is caused by mutations in the A-T-mutated gene (ATM), which encodes a large protein kinase that initiates DNA damage signaling in response to DNA double-strand breaks in eukaryotic cells. A biochemical connection between the two disorders was established with the demonstration that the ATM protein kinase phosphorylates the Nbs1 protein, in addition to many other targets, and that Nbs1 phosphorylation by ATM is essential for a normal S-phase checkpoint response (2023). An additional connection between M/R/N and ATM arose with the identification of two families with A-T-like disorder (ATLD), clinically identical to A-T, yet caused by mutations in the MRE11 gene (24). The two known ATLD mutations are quite different; the ATLD 1/2 allele contains a premature stop codon resulting in a truncation of the C-terminal domain, whereas the ATLD 3/4 allele contains a missense mutation within the nuclease domain in the N terminus. The biochemical basis of the abnormalities seen in ATLD patients has not yet been elucidated. Using a recombinant baculovirus system, we have expressed the human Mre11, Rad50, and Nbs1 proteins together and found that they form a large protein complex that exhibits several distinct enzymatic activities on DNA substrates. The Mre11 protein contains highly conserved phosphoesterase motifs that are responsible for the manganese-dependent nuclease activities of M/R/N. By itself and in association with Rad50 and Nbs1, Mre11 exhibits a distributive, 3' to 5' exonuclease activity on blunt and 3' recessed ends (25, 26), as well as a weak endonuclease activity on distorted DNA substrates such as hairpin structures. Association of Nbs1 with Mre11 stimulates the endonuclease function to act on hairpin structures and on 3' overhangs (27), although Nbs1 itself has no apparent enzymatic activities. The Rad50 protein contains conserved Walker A and Walker B ATPase motifs that are closely related to the ABC transporter family of membrane-associated ATPases. A long coiled-coil region separates the N-terminal and C-terminal ATP binding domains, which are thought to associate with each other via intramolecular, antiparallel association of the coiled-coil region along its length, a hypothesis supported by microscopy data and by analogy with the SMC family of related coiled-coil proteins (2830). M/R can catalyze a limited DNA unwinding reaction on DNA ends that is stimulated by ATP and also requires Nbs1 (27). Crystal structures of the catalytic cores of Mre11 and Rad50 homologs from the archaebacterium Pyrococcus furiosus illuminate the essential components of the active sites for both the phosphoesterase and the ATPase (31, 32). Biochemical studies with the P. furiosus Rad50 protein also indicated that ATP binding induced dimerization of the Walker A/Walker B catalytic unit, and that this dimerization interface promoted ATP-dependent DNA binding by the protein. S. cerevisiae Rad50 had previously been shown to exhibit nucleotide-dependent binding to DNA as well (33). Mutations in the ATP-binding motifs of Rad50 in budding yeast have been shown to be equivalent to null mutations with respect to meiotic recombination, mitotic recombination, and growth rate (3), so ATP binding (and likely also hydrolysis) is essential to Rad50 function.
In this study, we have investigated the nucleotide-dependent biochemical properties of the human M/R/N complex, focusing on the role of the Nbs1 protein. Nbs1 stimulates nucleotide-dependent DNA binding by Mre11/Rad50 (M/R), and these complexes are promoted and stabilized by the presence of non-hydrolyzable ATP analogs. Nucleotide-bound M/R/N binds specifically to double-stranded DNA duplexes, but does not show an obvious preference for DNA ends. Association of Nbs1 with the rest of the complex is destabilized in one of the ATLD M/R/N complexes (ATLD 3/4) but not in the other (ATLD 1/2), but both ATLD complexes show reduced levels of endonuclease activity compared with the wild-type enzyme. The M/R/N(p70) complex exhibits enzymatic activities essentially equivalent to the wild-type enzyme. Finally, sedimentation equilibrium analysis of the complex shows that Mre11 is clearly a dimer in solution, whereas both M/R and M/R/N are extremely large protein assemblies of
Plasmid Expression ConstructsBaculovirus expression constructs for human Mre11, Rad50, and Nbs1 have been described previously (25, 27): pTP17, pTP11, and pTP36, respectively. The ATLD 1/2 allele of Mre11 was generated by PCR from pTP17, generating a 6-histidine tag and stop codon at arginine 633, to form pTP219. A bacmid was made from this plasmid using the Bac-to-Bac system (Invitrogen), to form pTP221. The ATLD 3/4 allele of Mre11 was generated using the QuikChange system (Stratagene), introducing the N117S mutation into pTP17 to make pTP131 and subsequently the bacmid form, pTP133. The S1202R version of Rad50 was also generated using QuikChange in the hRad50 gene in pFastBac1 to make pTP140, and the bacmid version, pTP141. The p70 version of Nbs1 was constructed in two steps. First, a 5-nucleotide deletion was made at position 657 in the Nbs1 gene using QuikChange to re-create the 657del5 Nbs1 allele. Second, an N-terminal truncated version of this allele was generated by PCR, using the ATG at position 602 of the original gene as the initiator codon. This version of Nbs1 was cloned into pFastBac1 (Invitrogen) without an affinity tag, generating pTP270 and the bacmid form, pTP271. GST-Nbs1 was constructed by insertion of the glutathione S-transferase gene from pGEX-4T-1 (Amersham Biosciences) into pTP36 (27) to create a fusion protein with GST at the N terminus of Nbs1. All of the alleles generated by PCR were sequenced in their entirety. Each of the bacmids was used to make recombinant baculovirus according to the instructions from the manufacturer.
Substrate DNAThe substrate in the gel mobility shift assays and in the 3' overhang cutting assay consisted of TP423 (CTGCAGGGTTTTTGTTCCAGTCTGTAGCACTGTGTAAGACAGGCCAGATC) annealed to TP424 (CACAGTGCTACAGACTGGAACAAAAACCCTGCAGTACTCTACTCATCTC). TP423 was labeled with 32P at the 5' end for the gel mobility shift assays, or at the 3' end for the 3' overhang cutting assay. Labeling was performed with T4 polynucleotide kinase on the 5' end (New England Biolabs) using [
ProteinsM/R/N complexes were purified as previously described (25). The mutant M/R/N complexes were purified using the same protocol as with the wild-type complex. All of the Mre11 proteins and Rad50 contain a C-terminal histidine tag. Nbs1 (wild-type and p70) expressed with Mre11 or with both Mre11 and Rad50 did not contain an affinity tag. GST-Nbs1 was expressed by itself in the baculovirus system and purified over a glutathione-Sepharose column, followed by ion exchange chromatography on Q Sepharose (Amersham Biosciences). GST-Nbs1 eluted from the Q Sepharose at 0.2 M NaCl. Protein concentrations were determined by Bradford assay (Pierce) and confirmed by comparison with protein standards in Coomassie-stained SDS-PAGE gels. Western blotting of Mre11, Rad50, and Nbs1 was performed with antibodies PC388 (Oncogene), MS-RAD10 (Genetex), and MS-NBS10 (Genetex), respectively, on polyvinylidene difluoride membrane (Millipore) using standard immunoblotting techniques. Assay ConditionsGel mobility shift assays were performed in a volume of 10 µl with 25 mM MOPS, pH 7.0, 50 mM NaCl, 1 mM dithiothreitol, 0.1% Tween 20, 100 µg/ml bovine serum albumin, 5 mM magnesium chloride, 0.5 mM AMP-PNP or ATP as indicated, and 1 nM oligonucleotide substrate, with M/R/N complex added as indicated in the figure legends (between 20 and 120 ng, which is 1.710 nM assuming 1.2 x 106 g/mol for M/R/N). In Fig. 2 (B and C), unlabeled plasmid DNA or single-stranded DNA (TP423) was added to the reaction before the addition of protein. M/R/N was incubated with the DNA and other reaction components for 15 min at room temperature before the addition of 1 µl of 50% glycerol and separation on a 0.7% agarose, 0.5x Tris borate-EDTA (TBE) gel at 5.7 V/cm for 100 min. Gels were dried and analyzed using a phosphorimager (Amersham Biosciences). In the competitor assays, the amount of complex formed by M/R/N in the absence of competitor was considered 100%, and the decreases in complex formation relative to that amount were determined by quantitative phosphorimager analysis. Nuclease assays were performed in a volume of 10 µl with 25 mM MOPS (pH 7.0), 50 mM NaCl, 1 mM dithiothreitol, 1 mM manganese chloride, 1 nM oligonucleotide substrate, with M/R/N complex added as indicated at 2025 nM (hairpin and 3' overhang assays) or 2.02.5 nM (exonuclease assays). M/R/N was incubated with the DNA and other reaction components at 37 °C for 90 min (hairpin and 3' overhang assays) or 1530 min (exonuclease assays) before the addition of 1 µl of 2% SDS, 0.1 M EDTA. ATP (0.5 mM) was included in the 3' overhang nuclease assays as indicated in Fig. 5C. Reactions were lyophilized, resuspended in 7 µl of formamide loading buffer, separated on a denaturing, 20% polyacrylamide sequencing gel, and analyzed by phosphorimager.
Analytical UltracentrifugationMre11, Rad50, and Nbs1 protein complexes were dialyzed overnight against buffer A (50 mM NaCl, 25 mM Tris, pH 8.0, and 5 mM 2-mercaptoethanol) (Mre11) or buffer B (100 mM NaCl, 25 mM Tris, pH 8.0, 5 mM 2-mercaptoethanol, and 5% (v/v) glycerol) (Mre11/Rad50, Mre11 ATLD 1/2/Nbs1 and Mre11/Rad50/Nbs1) at 4 °C. Samples were loaded and studied at nominal loading concentrations of 0.35 (Mre11), 0.11 (Mre11/Rad50), 0.31 (Mre11 ATLD1/2/Nbs1), and 0.080.20 (Mre11/Rad50/Nbs1) A280. In the case of the double (Mre11/Rad50) and triple complexes loaded at 0.11 and 0.08 A280, respectively, data were also collected at shorter wavelengths of 230 and 225 nm.
Sedimentation equilibrium experiments were conducted at 4.0 °C on a Beckman Optima XL-A analytical ultracentrifuge. Mre11 samples were studied at 6,000, 8,000, and 10,000 rpm. Complexes of Mre11 with Rad50 and with both Nbs1 and Rad50 were studied at rotor speeds of 3,000, 3,500, and 4,000 rpm, whereas complexes of Mre11 ATLD1/2 with Nbs1 were studied at rotor speeds of 6,000, 7,000, and 8,000 rpm. Data were acquired as an average of eight absorbance measurements at 280 nm and a radial spacing of 0.001 cm. Scans were collected at 6-h intervals until equilibrium was reached. Data were analyzed in terms of a single ideal solute to obtain the buoyant molecular mass, M1(1 v
Nucleotide-dependent DNA Binding by M/R/NThe crystallographic structure of the P. furiosus Rad50 enzyme suggested that heterodimeric Rad50 catalytic domains further dimerize into a tetrameric unit in the presence of ATP (31). This change in multimeric state, stabilized by ATP, was hypothesized to facilitate DNA binding by the enzyme. Rad50 from S. cerevisiae has also been reported to bind DNA in an ATP-dependent manner (33). Despite this compelling evidence, we have not observed any significant ATP dependence in DNA binding by the human M/R/N enzyme (Fig. 1A, lanes 4 and 5 and data not shown).
When we measured DNA binding by wild-type M/R/N in the presence of magnesium and the non-hydrolyzable ATP analog AMP-PNP, however, we observed 2040-fold higher levels of DNA binding compared with reactions with ATP or without added nucleotides (Fig. 1A, lanes 6 and 7). The protein concentrations used here are 23-fold lower than the concentrations previously used to demonstrate M/R/N binding of DNA in the absence of nucleotides (27). We have also observed a similar phenomenon with the non-hydrolyzable ATP analog ATP S, and in each case, magnesium is absolutely required for formation of the protein-DNA complex (data not shown). We also tested subcomplexes of M/R/N for AMP-PNP-dependent DNA binding and found that Mre11/Rad50 (M/R) was incapable of binding DNA under these conditions, suggesting that the presence of Nbs1 in the complex is necessary for nucleotide-dependent DNA binding (Fig. 1B). We confirmed this to be the case by performing DNA-binding assays with M/R plus varying amounts of GST-Nbs1, which was expressed and purified in the absence of Mre11 and Rad50. As shown in Fig. 1C, the addition of GST-Nbs1 restored AMP-PNP-dependent DNA binding to the M/R complex (Fig. 1C, lanes 5 and 6), yet did not exhibit any DNA-binding capability alone (lane 7). The Rad50 protein is the only component of the complex that contains ATP-binding motifs and is therefore the likely source of nucleotide-dependent DNA binding by M/R/N. To confirm this, we expressed a mutant form of Rad50 containing a single amino acid change (S1202R) that is equivalent to the mutation made in the P. furiosus enzyme (S793R), which was previously shown to abolish ATP-driven dimerization of the ATP-binding domain (31). The S1202R Rad50 mutant in association with wild-type Mre11 and Nbs1 failed to bind DNA in the presence of AMP-PNP, verifying that the ATP-binding domain of the Rad50 protein is required for the protein-DNA complex observed with the wild-type enzyme (Fig. 1D).
The AMP-PNP-dependent M/R/N complex is only formed on double-stranded DNA duplexes and not on single-stranded oligonucleotides, as shown in Fig. 2A. Addition of increasing amounts of M/R/N to the labeled double-stranded DNA in the presence of magnesium and AMP-PNP actually generates two types of protein-DNA complex; the low mobility species previously indicated (complex I), and a higher mobility species that migrates close to the unbound DNA (complex II). Formation of each complex is highly cooperative, normally appearing at a threshold of Competition studies with M/R/N on DNA duplexes indicated that both linear and uncut plasmid DNA could compete effectively with short DNA duplexes for M/R/N binding in complex I (Fig. 2B). Thus, DNA ends are not essential for nucleotide-dependent binding by M/R/N. Single-stranded oligonucleotide (Fig. 2B) and tRNA (data not shown) did not compete for binding. In contrast, single-stranded DNA was able to partially compete with the double-stranded duplex in complex II (Fig. 2C), indicating that complex II is less specific for duplex DNA. Mre11 protein alone is capable of forming a complex similar to complex II in gel mobility shift assays (27), also suggesting that this complex does not require functional Rad50 protein. We have not observed any sequence specificity of M/R/N binding to DNA substrates, although an exhaustive analysis of this question has not been performed. ATLD Mutant ComplexesMutations in Mre11 have been identified in human patients with the inherited genomic instability syndrome ATLD (24). Two distinct mutations, ATLD 1/2 and ATLD 3/4, were identified in different family groups. The ATLD 1/2 allele contains a premature stop codon, truncating the protein at amino acid 633, and eliminating the last 76 amino acids. The ATLD 3/4 allele contains a missense mutation, N117S, but encodes a polypeptide of normal length. These alleles confer a clinical phenotype virtually identical to A-T. We expressed the R633stop (ATLD1/2) and N117S (ATLD 3/4) alleles of Mre11 together with wild-type Nbs1 and Rad50 and isolated complexes with each protein (Fig. 3A). The R633stop version of Mre11 purified with Nbs1 and Rad50 identically to wild type, yielding a triple complex of similar apparent stoichiometry to the wild-type complex. In contrast, the N117S Mre11 usually failed to bind Nbs1, but did form a complex with Rad50 (Fig. 3A, lane 3, ATLD 3/4). The N117S Mre11 mutant was unusual, however, in that it did retain some Nbs1 binding in some protein preparations, as shown in Fig. 3A, lane 4 (ATLD 3/4(N)). At this point it is not clear what conditions during expression or during purification are responsible for retaining this association. In our experience, wild-type Mre11 has never exhibited this variability in Nbs1 binding. The identity of the R633stop protein and the absence of Nbs1 in the ATLD 3/4 complex was verified by Western blotting, as shown in Fig. 3B.
In the nucleotide-dependent DNA-binding assay, the ATLD 1/2 M/R/N complex bound the DNA fragment similarly to wild type, and the ATLD 3/4 M/R complex did not bind (Fig. 3C), consistent with the requirement for Nbs1 in this assay as demonstrated in Fig. 1. When GST-Nbs1 was added to the ATLD 3/4 complex, however, it induced formation of a protein-DNA association similar to that observed with wild-type M/R in the presence of GST-Nbs1. The ATLD 3/4(N) complex also bound the DNA substrate, but at a reduced level compared with the wild-type complex (Fig. 3C, lanes 46). The reduction in binding is likely the result of the lower levels of Nbs1 in this preparation relative to M/R. The ATLD 3/4 Mre11 mutant is thus capable of binding Nbs1 and forming nucleotide-dependent complexes with DNA, although it is apparently reduced in its affinity for Nbs1 such that it exhibits variability in Nbs1 association. M/R/N(p70) ComplexA large majority of identified NBS patients are homozygous for an allele of the NBS1 gene that contains a 5-nucleotide deletion just downstream of the forkhead and BRCT domains (657del5) (16, 17). This deletion causes a frameshift at codon 219 and a premature stop at codon 233. Petrini and colleagues (19) have observed that, in addition to this truncated product, lymphoblast cells from NBS patients also express a novel C-terminal polypeptide that utilizes either of two alternative initiation codons just upstream of the deletion. This C-terminal protein, p70, is able to bind to Mre11 and was subsequently shown by the same group to support viability in the mouse, in contrast to the lethality caused by null alleles of NBS1 (35). All of the available evidence suggests that the 657del5 mutation creates a hypomorphic allele that can still fulfill the essential functions of the M/R/N complex but lacks other nonessential functions because of the missing N terminus of the protein. To study the biochemical properties of the M/R/N(p70) complex, we expressed a 657del5 allele of NBS1 utilizing the first of the two alternative ATG codons upstream of the deletion (19). This construct generates a polypeptide of 553 amino acids, of which the C-terminal 535 residues are identical to the C terminus of wild-type Nbs1. Co-infection of insect cells with baculovirus containing the p70 construct and wild-type Mre11 and Rad50 yielded a triple complex of all three proteins (Fig. 4A). The p70 band migrates in the SDS gel very close to a polypeptide present in the wild-type preparation that is likely a degradation product of Rad50 (data not shown), but the p70 band is clearly an Nbs1 product based on Western blotting with anti-Nbs1 antibody (Fig. 4B).
M/R/N(p70) complexes are capable of binding DNA in the AMP-PNP-dependent assay, as shown in Fig. 4C. The migration of the protein-DNA complex is very similar to the wild type in this assay (data not shown), suggesting that the overall mass of the p70 M/R/N complex when bound to DNA is similar to the normal complex and that the N terminus of Nbs1 is dispensable for stimulation of Rad50-mediated DNA binding.
Nuclease Activity of ATLD and NBS ComplexesThe M/R/N complex exhibits exonuclease activity on blunt and 3'-recessed double-stranded DNA ends, and endonuclease activity on hairpins and 3' overhangs (2527). The ATLD and p70 mutant M/R/N complexes were analyzed for exonuclease activity as shown in Fig. 5A, and each of the mutant complexes exhibited steady-state levels of activity nearly indistinguishable from the wild-type enzyme. The initial rate of resection on a 50-bp DNA fragment containing a 4-nucleotide recessed 3' strand was examined for each of the complexes, and the ATLD 3/4 and ATLD 1/2 complexes exhibited rates within 510% of wild type, whereas the M/R/N(p70) complex was
The ATLD and p70 mutant complexes were also tested for endonuclease activity on a hairpin substrate (Fig. 5B) and a 3' overhang (Fig. 5C). In comparison to the wild-type enzyme, the ATLD1/2 complex exhibited
Sedimentation Studies of the Mre11/Rad50/Nbs1 Complex The larger of the protein-DNA complexes formed by M/R/N is significantly retarded in mobility compared with the free oligonucleotide DNA, even in the low percentage agarose gels used for the separation of the complexes. To obtain a better estimate of the size and stoichiometry of this complex, we analyzed wild-type M/R/N complexes, as well as Mre11, Mre11/Nbs1 (M/N), and Mre11/Rad50 (M/R) by analytical ultracentrifugation. Sedimentation equilibrium experiments on wild-type Mre11 resulted in the gradual loss of material as a result of sample precipitation; however, the Mre11 mutant H217Y (34) was found to have increased solubility. Studies of H217Y Mre11 show that the sample is monodisperse with an average buoyant molecular mass, M(1 v Mre11 and Rad50 interact to form a large macromolecular complex. Sedimentation equilibrium studies indicate that this complex is monodisperse with a buoyant molecular mass of 318,000 ± 17,000 g mol1. Based on a consensus partial specific molar volume for proteins, this corresponds to a complex molecular mass of (1.24 ± 0.06) x 106 g mol1.
Sedimentation equilibrium studies on the triple complex formed between Mre11, Rad50, and Nbs1 show that these species interact to form a large, discrete, and slightly polydisperse complex. Data analysis in terms of a single ideal solute indicated rotor speed dependence for the buoyant molecular mass, with values ranging from 225,000 to 350,000 g mol1 at speeds of 4,000 and 3,000 rpm, respectively. Average M(1 v We also tested wild-type M/N by sedimentation analysis, but found that the complex precipitated over the course of the experiment, similar to wild-type Mre11 alone. The ATLD1/2 form of Mre11 expressed very well in insect cells, however, so an M/N complex of ATLD1/2 Mre11 and Nbs1 was used for the sedimentation analysis and was found to be stable over long periods in solution. These results show that Mre11 ATLD1/2 and Nbs1 interact to form a discrete 1:1 complex. Sedimentation equilibrium studies show that a solution containing this complex has both low and high molecular mass species. Data analysis in terms of two single and non-interacting solutes return a buoyant molecular mass of 40,260 ± 2,000 g mol1 for the low molecular mass complex. This represents the predominant species (Fig. 6B). The experimental buoyant mass appears to represent the 1:1 sum of the buoyant masses calculated for the Mre11 ATLD1/2 (18,546 g mol1) and Nbs1 (21,387 g mol1) components, indicating a 1:1 stoichiometry for the M/N complex. Based on the buoyant molecular mass, a complex mass of 159,740 ± 7,950 g mol1 is calculated (n = 1.01 ± 0.05). Because ATLD1/2 M/N separates identically to wild-type M/N in gel filtration experiments (data not shown), we conclude that the complex of wild-type Mre11 with Nbs1 is very likely to have 1:1 stoichiometry as well. All of the sedimentation equilibrium results are summarized in Table I.
Sedimentation equilibrium analysis of ATLD1/2 M/N also indicated the presence of a small amount of a high molecular mass species. The preparation of the ATLD1/2 Mre11 complex with Nbs1 came from a preparation of the ATLD1/2 triple complex containing all three recombinant proteins. The M(ATLD1/2)/N was separated from the M(ATLD1/2)/R/N by gel filtration, and a small amount of ATLD1/2 M/R/N was present in the fraction used for the analytical ultracentrifugation (data not shown). The M/R/N in the fraction accounts for the minor species of large complex present, and has a buoyant molecular mass consistent with the presence of an Mre11, Rad50, and Nbs1 triple complex present in small amounts (Fig. 6B).
Nbs1 Regulates Rad50 FunctionThe results shown here suggest that Nbs1 plays an important role in modulating the DNA binding activity and specificity of the Rad50 protein. It was previously demonstrated that Nbs1 association alters the endonuclease specificity of Mre11 (27). Here we show that Nbs1 also alters Rad50 function, such that nucleotide-dependent DNA binding is strongly promoted when Nbs1 is present in the complex. This increased DNA binding activity may explain the previously reported requirement for Nbs1 in DNA unwinding by Mre11/Rad50, an activity that is stimulated by ATP (27). Crystallographic analysis of P. furiosus Rad50 suggested that binding of adenine nucleotides by Rad50 promotes dimerization of the protein and creates a binding site for a DNA helix (31). The sedimentation equilibrium analysis we report here for the human M/R/N complex did not yield any evidence for nucleotide-induced dimerization, but DNA-binding assays in vitro revealed a high affinity protein-DNA complex formed by M/R/N in the presence of non-hydrolyzable ATP analogs. AMP-PNP-dependent binding occurs 2040-fold more efficiently than in the absence of nucleotide, and is much less variable than complexes occasionally observed in the presence of ATP (data not shown). The most straightforward interpretation of these data is that non-hydrolyzable nucleotides facilitate DNA binding by M/R/N but prevent DNA release, thus locking all of the DNA-bound molecules into this state. The similarity between the conformations of the ATP and AMP-PNP-bound Rad50 crystal structures (31) predicts that the AMP-PNP-bound state in M/R/N complexes is simply blocked at the hydrolysis step of catalysis, and is not a fundamentally different protein-DNA interaction compared with the ATP-bound state. The requirement for a non-hydrolyzable ATP analog instead of ATP also suggests that ATP hydrolysis by M/R/N must be very rapid. Although M/R/N forms transient complexes with both single and double-stranded DNA, the nucleotide-dependent DNA binding shown in this work is specific for double-stranded duplexes. The effect of DNA end structure was not assessed in this work, but a recent microscopy study of M/R also showed that AMP-PNP altered the specificity of DNA binding to favor 3' overhang structures (38). Nbs1 C Terminus Is Sufficient for Stimulation of M/R Enzymatic FunctionsNBS homozygotes have no full-length Nbs1 protein (16), but some tissues in NBS patients contain a C-terminal Nbs1 protein generated from an alternative start site (19). This truncated Nbs1 protein, p70, is sufficient for association with Mre11, and the data presented here indicate that this region is also sufficient for the stimulation of Mre11 endonuclease activity as well as for the nucleotide-dependent binding by Rad50. Although the exact biochemical activities of M/R/N are still under investigation, our analysis shows that every enzymatic function we can measure in vitro is essentially unchanged in a M/R/N(p70) mutant compared with the wild-type complex. This observation is not unexpected, considering that NBS cells have no overt defects in DNA repair but primarily exhibit deficiencies in checkpoint-related DNA damage responses (18). Other studies have also demonstrated that the N terminus of Nbs1 that includes the forkhead and BRCT domains is necessary and sufficient for focus formation at sites of DNA damage, but that the C terminus is required for survival of cells following ionizing radiation treatment (3943). Regulatory interactions between the C terminus of Nbs1 and Mre11/Rad50 are likely to be necessary for the DNA repair carried out by the complex and are therefore necessary for cell survival. ATLD Mutant ComplexesThe most obvious difference between the ATLD mutant M/R/N complexes and the wild-type enzyme is seen with ATLD 3/4, which exhibits a high degree of variability in Nbs1 binding. As shown here and in previous work (27), the degree of Nbs1 association affects both nucleotide-dependent DNA binding as well as endonuclease activity of Mre11. Immunoprecipitations of the ATLD 3/4 Mre11 protein by Stewart et al. (24) show that relatively little Nbs1 protein associates with ATLD 3/4 Mre11, and would thus suggest that the Nbs1-dependent enzymatic functions of the mutant complexes are likely to be compromised in these cells. In contrast to ATLD 3/4, the C-terminal truncation mutation in ATLD 1/2 has no apparent effect on Nbs1 binding in our recombinant expression system. Neither of the ATLD mutant M/R/N complexes shows any significant reduction in nucleotide-dependent DNA binding, although the ability of ATLD 3/4 to bind DNA was affected by the level of Nbs1 association. The exonuclease activities of the ATLD complexes are similarly unaffected compared with the wild-type enzyme, although both mutant complexes exhibit a significant reduction in endonuclease function. ATLD cells, like A-T cells, do not show an overt defect in DNA repair (24), although a partial loss in endonuclease function could result in repair deficiencies that would be difficult to assess using assays for whole-genome recovery. Indirect support for a repair deficiency in ATLD cells comes from a recent observation that ATLD3 cells are deficient in processing of adenovirus genome intermediates, an activity that is postulated to occur via Mre11 endonuclease activity (44). Stoichiometry of the M/R/N ComplexMre11 shows the ability to interact with itself in two-hybrid assays (45), suggesting that it forms a multimeric complex in vivo. The sedimentation equilibrium analysis of a nuclease-deficient mutant of Mre11 (H217Y) performed in this study indicates that this mutant Mre11 is clearly a dimer in solution. Wild-type Mre11 was not soluble over the long time required for equilibrium centrifugation (several days), but separates identically to the H217Y protein during gel filtration over a Superdex 200 column; thus, wild-type Mre11 is very likely a stable dimer in solution. Our sedimentation analysis of the Mre11(ATLD1/2) complex with Nbs1 indicates that M/N has a 1:1 stoichiometry in solution, because the mutant and wild-type M/N complexes also separate identically in gel filtration. Nbs1 binding to Mre11 is therefore mutually exclusive with Mre11 dimer formation, either because Nbs1 binding occurs via the same interface, or because Nbs1 causes a conformational change in Mre11 that inhibits dimer formation. By analogy with the SMC family of coiled-coil ATPases (29, 30) and microscopy analysis of the human M/R complex (28, 46), it is likely that each Rad50 molecule folds back on itself to form an antiparallel coiled-coil within a monomer unit. The central region of the Rad50 coiled coil has recently been shown to form a zinc-mediated hook structure that can associate with another zinc hook (46); thus, Rad50 is predicted to form dimers connected between their hook domains. Mre11 binds to Rad50 at the base of the coiled-coil region (36, 47), and thus the M/R complex would be expected to contain two Rad50 molecules and four Mre11 molecules (assuming a dimer of Mre11 bound to each Rad50 protein). Support for this type of configuration also comes from electron microscopy studies of yeast M/R (36) and Escherichia coli SbcC/SbcD (48). All of these complexes have been observed to form extended, dumbbell-like shapes with globular domains at the ends. The mass of M/R in solution as determined in this work by equilibrium sedimentation was 1.24 ± 0.06 MDa, however, which is significantly larger than a M4R2 configuration. A stoichiometry of M4R2 would yield a complex of 630 kDa, approximately half of the observed value. One possibility is that the stoichiometry is simply (M4R2)2, which would contain M4R2 complexes held together along the length of the coiled-coils, or associated at the globular domains with the zinc hooks on the outside (Fig. 7B). Both of these configurations have been observed for human M/R by electron microscopy (46). A recent study of human M/R by scanning force microscopy also visualized complexes with a very large globular domain at the center with arms (coiled-coils) extending outward (28), supporting the head-to-head model of Mre11 and Rad50 interactions.
Our expectation in analyzing the mass of M/R and M/R/N complexes was that the mass of M/R/N would be larger than that of M/R, and that the difference between the values would be a consequence of Nbs1 association. The unexpected conclusion from our studies, however, is that the mass of the triple complex of human M/R/N is not significantly larger than that of M/R within the limits of our assay, but exhibits a polydisperse character suggesting a heterogeneous collection of protein complexes. One explanation for this result is that varying numbers of Mre11 and Nbs1 are associated with each Rad50 dimer (or pair of dimers) such that M/R/N may in fact consist of a heterogeneous group of assemblies (two of the most plausible possibilities are shown in Fig. 7C). Our finding of a 1:1 stoichiometry of Mre11 with Nbs1 would suggest that the models that maintain a 1:1 ratio of these proteins would be more likely to be correct, assuming that M/N associates as a unit with Rad50 molecules. Further experiments are clearly necessary to determine which, if any, of the proposed models for the M/R/N triple complex are correct, and whether the stoichiometry is altered under different conditions.
* This work was supported by the Kimmel Cancer Foundation and by National Institutes of Health Grant CA940008 [GenBank] -01. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ** To whom correspondence should be addressed: Dept. of Molecular Genetics and Microbiology, University of Texas, 1 University Station, A4800, Austin, TX 78712. Tel.: 512-232-7802; Fax: 512-232-3432; E-mail: tpaull{at}icmb.utexas.edu.
1 The abbreviations used are: M, Mre11; R, Rad50; N, Nbs1; NBS, Nijmegen breakage syndrome; A-T, ataxia-telangiectasia; ATLD, ataxia-telangiectasia-like disorder; ATM, ataxia-telangiectasia-mutated gene; MOPS, 4-morpholinepropanesulfonic acid; GST, glutathione S-transferase; AMP-PNP, adenosine 5'-(
We thank Martin Gellert and members of the Paull laboratory for helpful comments on the manuscript.
This article has been cited by other articles:
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||