JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M307424200 on September 2, 2003

J. Biol. Chem., Vol. 278, Issue 46, 45603-45610, November 14, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
278/46/45603    most recent
M307424200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ludewig, U.
Right arrow Articles by Frommer, W. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ludewig, U.
Right arrow Articles by Frommer, W. B.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Homo- and Hetero-oligomerization of Ammonium Transporter-1 Uniporters*

Uwe Ludewig{ddagger}, Stephanie Wilken§, Binghua Wu{ddagger}, Wolfgang Jost{ddagger}, Petr Obrdlik{ddagger}, Mohamed El Bakkoury¶, Anne-Marie Marini¶, Bruno André¶, Tanja Hamacher||, Eckhard Boles||, Nicolaus von Wirén§**, and Wolf B. Frommer{ddagger}{ddagger}{ddagger}§§

From the {ddagger}Zentrum für Molekularbiologie der Pflanzen, Pflanzenphysiologie, Universität Tübingen, Auf der Morgenstelle 1, 72076 Tübingen, Germany, §Institut für Pflanzenernährung, Universität Hohenheim, Fruwirthstrasse 20, 70599 Stuttgart, Germany, Laboratoire de Physiologie Cellulaire, Institut de Biologie et de Médecine Moléculaires, Université Libre de Bruxelles, P. O. Box 300, Rue des Professeurs Jeener et Brachet 12, 6041 Gosselies, Belgium, ||Institut für Mikrobiologie, Biozentrum, Marie-Curie-Strasse 9, 60054 Frankfurt/Main, Germany, and {ddagger}{ddagger}Carnegie Institution, Stanford, California 94305

Received for publication, July 10, 2003 , and in revised form, September 2, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In most organisms, high affinity ammonium uptake is catalyzed by members of the ammonium transporter family (AMT/MEP/Rh). A single point mutation (G458D) in the cytosolic C terminus of the plasma membrane transporter LeAMT1;1 from tomato leads to loss of function, although mutant and wild type proteins show similar localization when expressed in yeast or plant protoplasts. Co-expression of LeAMT1;1 and mutant in Xenopus oocytes inhibited ammonium transport in a dominant negative manner, suggesting homo-oligomerization. In vivo interaction between LeAMT1;1 proteins was confirmed by the split ubiquitin yeast two-hybrid system. LeAMT1;1 is isolated from root membranes as a high molecular mass oligomer, converted to a ~35-kDa polypeptide by denaturation. To investigate interactions with the LeAMT1;2 paralog, co-localizing with LeAMT1;1 in root hairs, LeAMT1;2 was characterized as a lower affinity uniporter. Co-expression of wild types with the respective G458D/G465D mutants inhibited ammonium transport in a dominant negative manner, supporting the formation of heteromeric complexes in oocytes. Thus, in yeast, oocytes, and plants, ammonium transporters are able to oligomerize, which may be relevant for regulation of ammonium uptake.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Ammonium transporters (AMTs)1 of the AMT/MEP/Rh protein family have been identified in all domains of life, including plants, bacteria, archea, yeast, and animals (1, 2). AMT/MEP/Rh proteins are highly hydrophobic membrane proteins with a predicted molecular mass of ~45-55 kDa and 11 or 12 putative transmembrane spans. Initially AMT/MEP/Rh ammonium transporters from yeast and plants were identified molecularly by functional complementation of a yeast mutant defective in ammonium uptake (3-5). Later, homologs were isolated from bacteria (6) and animals (Caenorhabditis elegans), and phylogenetic analysis showed that mammalian Rh (rhesus) blood group polypeptides belong to the same super-family (7). Heterologously expressed RhAG and a homolog from kidney (RhGK = RhCG) were also shown to function as ammonium transporters (8, 9).

Plants require transporters for acquisition from a wide range of external concentrations and are able to concentrate and transiently accumulate in the cytosol before being metabolized or further compartmentalized (10). Ammonium transport across root plasma membranes is biphasic, consisting of a high-affinity and a low-affinity nonsaturating component (11, 12). The high-affinity transport system, which operates predominantly at low external ammonium concentrations, is energized by the membrane potential. In tomato, the -uniporter LeAMT1;1 encodes a component of the high-affinity transport system that depends on the membrane potential (13). The molecular identity of the low-affinity transport system, however, is less clear. It contributes significantly to overall uptake at higher external ammonium concentrations (>1 mM) and may have a distinct transport mechanism, because uncharged NH3 or charged may be the substrate (11, 12, 14, 15). Because /NH3 are in aqueous solution always in a pH-dependent equilibrium with a pKa of 9.25, most of the ammonium ({approx}98%) is at physiological pH in its charged form. To differentiate the species, the chemical symbols ( or NH3) will be used to discriminate between the two molecules, whereas the term ammonium is used for both forms.

Three ammonium transporters from tomato have been isolated and functionally expressed in yeast. Although LeAMT1;3 is expressed mainly in shoots, transcripts of LeAMT1;1 and LeAMT1;2 (75.6% identical at the protein level) have been detected both in roots and shoots and particularly in root hairs (16, 17). LeAMT1;1 was shown to be up-regulated under nitrogen deficiency, whereas LeAMT1;2 was induced upon addition of its substrate. To verify whether LeAMT1;2 might provide different biochemical transport properties, which might be related to its physiological role, and to verify its transport mechanism, LeAMT1;2 was expressed heterologously in Xenopus frog oocytes and characterized functionally by two-electrode voltage clamp.

Oligomerization of transporter subunits appears to be a typical feature of secondary active transporters and channels (18-20). A molecular mass estimation of native AmtB proteins from Escherichia coli by density ultracentrifugation, and a polypeptide mass determination in denaturing SDS-PAGE suggested that bacterial AmtB form trimers (21), whereas the more distant Rh polypeptides appear to form hetero-oligomeric tetramers (22). The Saccharomyces cerevisiae yeast genome encodes three high-affinity ammonium transporters (MEP1-3), which mediate ammonium uptake when expressed individually in a null background, but circumstantial evidence for the interaction between different MEP homologs has been provided (23). Indications of such an interaction came from a detailed analysis of a mep1-1 mep-2 yeast mutant initially used to isolate ammonium transporters (3). The mutant carried a deletion in the MEP2 gene, whereas the MEP3 genomic sequence was present and unchanged compared with wild type. A single point mutation (G413D) in the MEP1 gene inactivated both MEP1 and MEP3 simultaneously (23), which may support the idea of direct interaction of MEP proteins. However, because the inhibitory effect of the MEP1-G413D mutant was studied in S. cerevisiae, endogenous interacting factors and indirect effects could not be ruled out. Highly similar results were obtained for ammonium transporters from Aspergillus, where the corresponding mutation in the endogenous ammonium transporter inhibited wild type ammonium transporters when introduced in Aspergillus (24).

Taken together, the dominant negative effect of yeast ammonium transporter mutants together with the identification of oligomerization of AMT-related proteins may suggest that a single AMT/MEP/Rh polypeptide may be the catalytic unit of transport that can assemble with variable stoichiometry. We, therefore, addressed the question whether functional plant AMT1 transporters form oligomeric complexes by three independent methods: co-expression in Xenopus oocytes, analysis in the split ubiquitin system, and protein gel blotting of plant membrane proteins. The results indicate that plant AMT1 transporters can form oligomers, and the functionally distinct LeAMT1;1 and LeAMT1;2 may form either homo- or heteromers.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid Constructs for Oocyte and Yeast Expression—LeAMT1;2 (17) was amplified by PCR and ligated into the oocyte expression vector pOO2 (13).2 Mutant G458D (exchange of glycine at position 458 by aspartate) in LeAMT1;1-pOO2 (13) and G465D in LeAMT1;2-pOO2 were constructed using the QuikChange kit from Stratagene. Constructs were verified by sequencing. Another mutant (G421R, glycine 421 to arginine in LeAMT1;2) yielded currents identical to wild type and served as control. The amino acid transporter AtAAP6 was also expressed from the pOO2 plasmid (25). Capped cRNA was transcribed by SP6 RNA polymerase in vitro using mMessage mMachine (Ambion Inc., Austin, TX), after linearization of the plasmids with MluI. At least two independent cRNA preparations were used for each construct. LeAMT1;1-GFP wild type and mutant translational fusions were constructed by PCR, ligated into the yeast plasmids pDR196, and sequenced. Yeast strain 31019b (MATa, ura3, mep1{Delta}, mep2{Delta}::LEU2, mep3{Delta}::kanMX2) was transformed, and single colonies were restreaked on fresh plates of YNB (yeast nitrogen base)-Glc medium containing 1 mM ammonium as the sole nitrogen source (7).

Preparation, Injection, and Electrophysiology of Oocytes—Xenopus oocytes were removed from adult female frogs by surgery and manually dissected. Oocytes (Dumont stage V or VI) were defolliculated using collagenase 10 mg/ml (Roche Applied Science) and trypsin inhibitor (Sigma) for 1 h and injected with 50 nl of cRNA diluted in diethyl pyrocarbonate-treated water ({approx}6-50 ng/oocyte). For co-expression experiments, oocytes were injected with low (6-12 ng/nl) concentrations of cRNA to avoid expression saturation effects due to limiting translation and processing of heterologously expressed AMT proteins in oocytes. These cRNA concentrations allowed a linear increase of transporter activity with cRNA amount injected. Each coinjection experiment was repeated multiple times, and 4-15 oocytes were measured for each construct. After injection oocytes were kept for 2-5 days at 16 °C in ND96 (in mM: 96 NaCl, 2 KCl, 1.8 CaCl2, 1 MgCl2, 5 Hepes (pH 7.4), and gentamycin (20 µg/ml) with added Na-pyruvate (2.5 mM). Total data were collected from more than 10 batches of oocytes from different frogs. Electrophysiological measurements were done as described (13). Standard bath solutions contained (in mM): 100 NaCl, 2 CaCl2, 2 MgCl2, and 4 Tris, pH adjusted to 7.5 with MES.

Data Analysis—All data are given as means ± S.D. The concentration dependence of ammonium-induced current at each voltage was fitted using Equation 1,

(Eq. 1)
where Imax is maximal current at saturating ammonium concentration, Km is substrate concentration permitting half-maximal currents, and c is experimentally used concentration. For the co-injections, Equation 2 was used.

(Eq. 2)
Voltage dependence of Km was fitted with Equation 3,

(Eq. 3)
where {delta} is fractional electrical distance, e is elementary charge, V is membrane potential, k is Boltzmann's constant, and T is absolute temperature. Statistical significance was evaluated by using a paired t test. A p value < 0.05 was considered significant.

Interaction Tests with Split Ubiquitin—LeAMT1;1 (X92854 [GenBank] ), AtKAT1 (At5g46240), and AtSUC2 (At1g22710) were amplified by standard PCR procedures using gene-specific forward primers flanked by a B1-linker (acaagtttgtacaaaaaagcaggctctccaaccaccATGxxx-5'-strand cDNA) and gene-specific reverse primers flanked by B2-linker (tccgccaccaccaaccactttgtacaagaaagctgggtaxxx-3'-strand cDNA deleting the stop codon). The vector X-NubWTgate was derived from the vector XNgate according to the QuikChange protocol (Stratagene) by site-directed mutagenesis using the forward primer 5'-ctttgaccggtaaaaccataacattggaagttgaatc and the reverse primer 5'-gaaactggccattttggtattgtaaccttcaacttag. The vectors metYCgate and XNgate, yeast strains THY.AP4 and THY.AP5, and the cloning of PCR products by recombinational in vivo cloning has been described elsewhere (26).3 For the construction of NubG and NubWT fusions, the split ubiquitin vectors XNgate and X-NubWTgate were cleaved with EcoRI/SmaI and used with the PCR products to transform THY.AP5 yeast strain (MAT{alpha} URA3 leu2-3,112 trp1-289 his3-{Delta}1 ade2{Delta}::loxP). Transformants were selected on full synthetic media lacking tryptophan and uracil. For Cub fusions, the vector metYCgate was cleaved with PstI/HindIII and used with the PCR products to transform yeast strain THY.AP4 (MATa leu2-3,112 ura3-52 trp1-289 lexA::HIS3 lexA::ADE2 lexA::lacZ). Transformants were selected on full synthetic media lacking leucine.

Approximately 50 clones from each THY.AP5 and THY.AP4 transformation were mixed and incubated in appropriate selective synthetic media with and without G418. Cultures were grown to the lag phase, harvested, resuspended in YPD medium (yeast-peptone-dextrose), and used for the mating approach. For mating, 10 µl of THY.AP4 (Cub constructs) and 10 µl of THY.AP5 suspension (NubG or NubWT constructs) were mixed and plated on YPD. After a 6-8-h incubation at 28 °C, diploid cells were selected by replica plating on full synthetic medium lacking tryptophan, leucine, and uracil at 28 °C for 2-3 days. Diploid cells were plated on synthetic minimal media supplemented with different concentrations of methionine and grown for 3 days.

Isolation and Fractionation of Membrane Proteins—Tomato plants were grown hydroponically and precultured under nitrogen deficiency for 3 days (17, 47). Total microsomal membrane fractions were isolated according to von Wirén et al. (1997), with all operations conducted at 4 °C. Tomato roots were homogenized by a Waring blender in a buffer containing 50 mM bis-Tris-propane (adjusted to pH 7.8 by dry MES), 250 mM sucrose, 2 mM EGTA (pH 7.8), 10% w/v glycerol, 2 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride (added after filtration of the homogenate), 2 mM MgSO4, and 5 mM {beta}-mercaptoethanol. The final ratio of medium to roots was 3 ml g-1 fresh weight. The homogenate was filtered through two layers of crosswise placed cheesecloth, and the filtrate was centrifuged at 26,000 x g for 25 min. The supernatant was filtered through gauze (58 µm) and recentrifuged at 85,000 x g for 30 min. The drained pellet was resuspended in 250 mM sucrose, 5 mM K2PO4/K2HPO4 (pH 7.8), and 3 mM KCl (7 ml mg-1 protein) and gently homogenized in a potter. For preparation of microsomal membrane fractions, the homogenate was pelleted and resuspended in conservation buffer (5 mM bis-Tris-propane, MES, pH 6.5, 250 mM sorbitol, 20% w/v glycerol, 1 mM dithiothreitol, 2 mM phenylmethylsulfonyl fluoride).

Protein Gel Blot Analysis—A peptide representing the C terminus of LeAMT1;1 (NH2-YHEEDPKLGMQMRRIEPTTST-COOH) was synthesized and conjugated to KLH, and a polyclonal antibody was raised (Biotrend, Koeln, Germany). Pre- and postimmune sera were collected and analyzed by protein gel dot blot. The antisera were affinity-purified by binding the peptide to a nitrocellulose membrane (Protran, Schleicher & Schüll, Dassel, Germany), blocking the membranes in TBS (20 mM Tris-HCL, 150 mM NaCl, pH 7.6) with 1% BSA for 1 h at room temperature under gentle agitation, washing in TBS for 5 min, and incubating the membranes in serum for 2-3 h at room temperature. Membranes were rinsed four times in TBS-T (TBS including 0.1% Tween 20) and washed twice in TBS. Antibody was eluted in 0.1 M glycine, pH 2.5, for 1 min and neutralized immediately with 1 N NaOH. 12 mg ml-1 BSA and 0.01% sodium azide were added for stabilization. Antibody samples were concentrated using Vivaspin 20 (Mr 10,000 polyethersulfone, Sartorius, Germany). Protein content was determined according to Bradford and adjusted for equal loading by Coomassie colloidal staining of SDS-polyacrylamide gels.

Microsomal membrane proteins were suspended in sample buffer (62.5 mM Tris, pH 6.8, 10% v/v glycerol, 2% w/v SDS, 2.5% v/v 2-{beta}-mercaptoethanol, 0.01% w/v bromphenol blue, 1% proteinase inhibitor mix (0.1 M phenylmethylsulfonyl fluoride, 0.25 M p-aminobenzamidine), incubated at 40 °C for 30 min, separated by SDS-PAGE (according to Laemmli) on a 10% gel and transferred to a PVDF membrane Immobilon-P (Millipore, Bedford, MA) by electroblotting. Proteins were fixed to the membrane according to the manufacturer's protocol, stained using Ponceau S, and blocked in TBS-T, 5% skim milk powder, 1% BSA for 2-3 h at room temperature under gentle agitation. The blots were rinsed briefly in TBS-T three times and twice in TBS before incubation with the primary antibody in TBS, 3% BSA overnight at 4 °C. Membranes were washed in TBS-T four times for 5 min and four times in TBS for 5 min. Blots were then incubated with a secondary antibody (goat anti-rabbit IgG, alkaline phosphatase-conjugated (Sigma) using a 1:5000 dilution in TBS, 3% BSA) for 2 h at room temperature. Membranes were washed in TBS-T and TBS and rinsed for 1 min in alkaline phosphatase buffer (100 mM NaCl, 5 mM MgCl2, 100 mM Tris, pH 9.5) with NBT-BCIP (nitro blue tetrazolium-bromo-chloro-indoyl phosphate, Roche Applied Science) according to the manufacturer's protocol. The alkaline phosphatase reaction was stopped by rinsing the membrane in distilled water.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Generation of an Inactive LeAMT1;1 Mutant—A mutation in the C-terminal cytosolic domain of fungal ammonium transporters led to a strong reduction in transport activity (23, 24), when a conserved glycine was replaced by an aspartate residue (G458D). To test whether the mutation of the corresponding glycine in the plant -transporter LeAMT1;1 has a similar effect, the mutation was introduced into the LeAMT1;1 gene, and wild type and mutant genes were expressed in the ammonium uptake-defective yeast strain 31019b. Although wild type LeAMT1;1 restored the growth defect of 31019b on medium containing ammonium as the sole nitrogen source, the mutant was unable to mediate efficient uptake (Fig. 1A). GFP fusions of wild type and mutant LeAMT1;1 forms showed similar localization when expressed in 31019b (Fig. 1B). To analyze the subcellular distribution in plant cells, the fusion constructs were expressed in plant protoplasts. Both wild type and mutant forms localized predominantly as a peripheral ring consistent with plasma membrane localization (Fig. 1C). Thus, the tomato ammonium transporter LeAMT1;1 functions as a plasma membrane transport system.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 1.
Plasma membrane localization of LeAMT1;1-GFP and LeAMT1;1/G458D-GFP fusions in yeast and plant protoplasts. Wild type and mutant LeAMT1;1-GFP fusions were expressed in the ammonium transport-deficient yeast strain 31019b. A, only cells expressing wild type LeAMT1;1-GFP grew on selective medium containing 1 mM ammonium as sole nitrogen source. B, GFP fluorescence of wild type (middle lane) and mutant LeAMT1;1 (lower lane) show staining of intracellular structures and the plasma membrane. C, expression of wild type and mutant LeAMT1;1 in plant protoplasts. Fluorescent images were taken with a confocal laser scanning microscope (left); middle, bright field; right, merged image.

 
To analyze the functionality of the mutant in more detail, wild type and mutant forms were expressed in Xenopus oocytes. induced significant currents in LeAMT1;1-expressing oocytes, whereas the mutant permitted no detectable ammonium-induced currents above background when expressed at different cRNA concentrations in oocytes (n = 3 batches of oocytes, Fig. 2). Thus, the mutant seemed fully inactive, supporting the notion that also in planta the conserved glycine is crucial for function.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 2.
LeAMT1;1 mutant G458D is nonfunctional and specifically inhibits wild type expression. A, linear expression range for LeAMT1;1. Twice the cRNA amount injected per oocyte duplicated the currents induced by LeAMT1;1. Co-expression of wild type with mutant G458D in a 1:1 ratio reduced currents significantly, but co-expression in a 1:0.2 ratio did not reduce currents significantly. The mutant was nonfunctional when expressed alone. Glutamine-induced currents by amino acid transporter AtAAP6 (pH 5.5) were unaffected by co-expression of mutant G458D. All currents were measured at -100 mV. Identical results were obtained in three independent batches of oocytes. The inset shows schematically the site of the mutation. B, alignment of the homologous region around the mutation.

 
Specific Inhibition of LeAMT1;1 Ammonium Transport by the Point Mutant G458D—The mutated plant transporter was used as a tool to study whether AMT transporters exist as oligomers in a heterologous system, which might lack other proteins potentially required to mediate interaction between ammonium transporters. To be able to evaluate possible interactions between mutant and wild type ammonium transporters, it was necessary to measure transport under conditions in which expression levels of the transporters correlate with activity. Increasing amounts of cRNA injected per oocyte led to larger ammonium currents, but the maximum current obtained saturated with {approx}50 ng cRNA. Such saturation is a typical feature of oocyte expression of a variety of channels and transporters (e.g. Ref. 48). At low amounts of cRNA injected per oocyte ({approx}6-12 ng), ammonium currents increased linearly with the amount of injected cRNA (Fig. 2). The linear correlation between functional LeAMT1;1-mediated ammonium transport and cRNA concentration (Fig. 2) allowed direct quantitative analysis of co-expressed mutant and wild type polypeptides in oocytes. Co-expression of equal amounts of wild type and mutant cRNA led to a dramatic decrease of ammonium transport to {approx}12% (Fig. 2). Protein biosynthesis was not saturated in oocytes, as twice the amount of wild type LeAMT1;1 led to a doubling of ammonium currents (Fig. 2). Lower amounts of co-injected mutant cRNA led to lower inhibition of wild type-dependent ammonium transport (Fig. 2).

To exclude the possibility that the inhibition was due to indirect effects, the LeAMT1;1 mutant G458D was co-expressed with the structurally unrelated amino acid transporter AtAAP6 (25). Co-expression of equal amounts of mutant LeAMT1;1 cRNA with AtAAP6 did not influence amino acid currents (Fig. 2). Thus, the LeAMT1;1-G458D mutant protein specifically inhibited ammonium conductance. The dominant negative effect of a plant ammonium transporter mutant expressed heterologously in animal cells is indicative of a direct interaction between mutant and wild type polypeptides.

LeAMT1;1 Interactions Detected by an Optimized Split Ubiquitin System—To test whether LeAMT1;1 can interact with itself directly, an optimized yeast split ubiquitin system, developed for large scale proteome analysis of membrane protein interactions was used.3 The split ubiquitin system allows detection of interactions between membrane proteins in vivo. The new system allows in vivo cloning of PCR products by recombination into expression vectors, mating-based detection of the interactions, and improved selection of interacting fusions on media lacking histidine and adenine (26, 28). In addition to this, fine-tuning of relative expression levels via methionine-dependent promoters improves detection limits.

Protein fusions to the mutated N-terminal half, NubG, and the C-terminal half, Cub, of ubiquitin were constructed, and the interaction of membrane protein partners was then monitored by the release of the artificial transcription factor PLV activating lexA-driven reporter genes in the nucleus (29). Weak interactions were observed between LeAMT1;1 (Fig. 3). LeAMT1;1 did not interact with other plasma membrane proteins, such as the potassium channel AtKAT1 or the sucrose transporter AtSUC2. As expected, interactions were observed between the AtKAT1 subunits themselves, shaker-like channel polypeptides known to form tetramers (30, 31). If the wild type N-terminal half (NubWT) does not harbor a mutation, it interacts strongly with the C-terminal half Cub of ubiquitin. Thus, soluble NubWT and LeAMT1;1 fused to NubWT served as positive controls. The interaction of LeAMT1;1-Cub with LeAMT1;1-ubG was too weak to be detected by measuring {beta}-galactosidase activity of LacZ (data not shown). Results obtained with the novel split ubiquitin system showed weak but significant interaction of LeAMT1;1 with itself and provided independent evidence that LeAMT1;1 polypeptides are capable of co-assembling in a homomeric protein complex.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 3.
Homo-oligomerization of LeAMT1;1 and also AtKAT1 in split ubiquitin assay. Interactions among different NubG, NubWT, and Cub fusions were detected via growth assay on a synthetic minimal medium lacking adenine and histidine but supplemented with 0.075 mM methionine. The empty Cub vector was used as a negative control. The potassium channel, KAT1 (GenBankTM accession no. At5g46240), and sucrose transporter, SUC2 (At1g22710), are from Arabidopsis thaliana.

 
LeAMT1;1 Complex in Plants—To test whether the interaction of ammonium transporters found by oocyte expression studies and the split ubiquitin system can also be observed in planta, a polyclonal antibody raised against the C terminus of LeAMT1;1 was used. The antibody specifically detected LeAMT1;1 when microsomal membrane fractions from yeast transformants expressing either of the three known LeAMT1 proteins were analyzed (see supplemental figure).

In microsomal membrane fractions from plant roots, the antibody recognized polypeptides with a molecular mass of ~140 kDa. However, heat treatment of the protein extracts converted the high molecular mass complex into a polypeptide of ~35 kDa, consistent with the expected value for the monomeric form (Fig. 4). The calculated molecular mass of monomeric AMT/MEP/Rh proteins is around 45-55 kDa, considering that all reported AMT/MEP/Rh proteins migrate faster than calculated ({approx}30-50kDa) in SDS-PAGE (21, 22, 32-34). Identical results were obtained when plasma membranes were purified and used for protein gel blot analysis (data not shown). The presence of LeAMT1;1 as a high-molecular mass complex is consistent with oligomerization of ammonium transporters in the plant plasma membrane.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 4.
SDS-PAGE and Western blotting of LeAMT1;1. An antibody raised against LeAMT1;1 recognized a high molecular mass complex (~140 kDa) in a microsomal fraction from tomato roots when samples were preincubated at low temperatures (left lane). Incubation of protein samples at 95 °C for 1 min (right lane) led to detection of the LeAMT1;1 protein at ~35 kDa.

 
LeAMT1;2 Possesses a Lower Affinity Than LeAMT1;1—Because LeAMT1;1 is co-expressed in the same cell type as the ammonium transporter LeAMT1;2, the ability of LeAMT1;1 to form homo-oligomers raised the question whether co-localized LeAMT1;1 and LeAMT1;2 might co-assemble and form functionally distinct hetero-oligomers. Furthermore, ammonium uptake into plant roots is known to consist of complex biphasic kinetics, and thus LeAMT1;2 might be a candidate for the second kinetic component. When functionally expressed in oocytes, LeAMT1;2 yielded reversible inward currents of a size similar to those of LeAMT1;1 (100 µM ammonium or 100 µM methlyammonium at -70 mV; Fig. 5). No currents were observed in water-injected control oocytes. Because high (millimolar) ammonium concentrations are known to induce endogenous currents in uninjected oocytes (13, 35, 36), only ammonium concentrations below 1 mM were used. Ammonium-induced currents by LeAMT1;2 were time-independent (data not shown) and were analyzed over a broad range of voltages and concentrations (Fig. 6A). Currents were inwardly rectifying and increased with hyperpolarization and ammonium concentration (Fig. 6A). LeAMT1;2 currents were not affected by changes in the external proton concentrations between pH 5.5 and 8.5 (Fig. 6B) when the proton concentration changed 1000-fold. The total current magnitude induced by 100 µM ammonium was almost unchanged in individual oocytes (Fig. 6C).



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 5.
Ammonium and methylammonium-induced currents by LeAMT1;1 and LeAMT1;2 in oocytes. Currents were obtained at -70 mV in standard solution. The addition of ammonium (100 µM, indicated by the black bars, valid for all three traces) reversibly induced inward currents of similar size by LeAMT1;1 or LeAMT1;2 cRNA. Methylammonium (100 µM)-induced currents were significantly smaller. In water-injected control oocytes, currents were unaffected by superfusing oocytes with the same solutions.

 



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 6.
LeAMT1;2-mediated ammonium currents are concentration- and voltage-dependent but pH-independent. A, current-voltage relations of ammonium induced currents from a representative LeAMT1;2 expressing oocyte. Voltages were applied from -160 mV to +40 mV. B, -currents are pH-independent. Currents from a single oocyte injected with a small amount of LeAMT1;2 cRNA. C, current magnitude induced by 100 µM ammonium at -100 mV at different pH. The ammonium-elicited currents of each oocyte were normalized to the current at pH 5.5 (n = 3) to reflect the slightly different expression levels of individual oocytes.

 
LeAMT1;2 currents saturated at higher concentrations of (Fig. 9A). The concentration permitting half-maximal currents (Km) was ~40 µM at -140 mV, a value {approx}6-fold higher than for LeAMT1;1. Similar to LeAMT1;1 (13), the affinity of LeAMT1;2 toward differed over the voltage range tested. At more negative voltages, the affinity of LeAMT1;2 toward ammonium was higher, consistent with external driven into a saturating binding site (Fig. 9B). Assuming a single binding site for , the voltage dependence of binding suggests that the site is situated 30 ± 2% (measured from external side) within the membrane electrical field (Fig. 9B). Thus, LeAMT1;2 represents a functional, pH-independent transporter with an ~6-fold lower affinity than LeAMT1;1 when analyzed in oocytes.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 9.
Co-expression of LeAMT1;1 and LeAMT1;2 leads to superposition of individual properties. Michaelis-Menten kinetics at -140, -100, and -60 mV for LeAMT1;1 (A, n = 5), LeAMT1;2 (B, n = 3), and co-expressed LeAMT1;1 and LeAMT1;2 (C, n = 6), respectively. Solid lines correspond to a fit with two affinities. Note the different x axis scales. D, fitted Km values for each voltage. Open circles, LeAMT1;1; open triangles, LeAMT1;2; both are fitted assuming a single Km. Filled triangles, assuming two Km values for the co-injected LeAMT1;1 and LeAMT1;2. Values were fitted with Equation 1 or Equation 2. The Km for LeAMT1;2 is voltage-dependent with the fractional electrical distance {delta} = 0.30 ± 0.02.

 
Cross-inhibition of LeAMT1;2 by Mutant Transporters—To confirm that the conserved C-terminal glycine is also important for LeAMT1;2 function, the respective mutation was introduced. Similar to the results obtained for other ammonium transporters, exchange of the corresponding residue by asparagine in LeAMT1;2 (G465D) rendered the protein nonfunctional (Fig. 7). As expected from the previous results, co-expression of the LeAMT1;2 (G465D) mutant with wild type LeAMT1;2 inhibited ammonium transport in a dominant negative manner (Fig. 7). Thus, the molecular mechanism for inhibition and oligomer formation is conserved for AMT1/MEP polypeptides.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 7.
Co-expression of LeAMT1;1 and LeAMT1;2 with mutants indicates hetero-oligomerization of transporters. Each individual bar represents currents recorded from a set of >=5 oocytes from the same frog to minimize variability due to different expression levels. Experiments were repeated on at least six different batches of oocytes.

 
To check whether LeAMT1;1 and LeAMT1;2 subunits might interact, the nonfunctional, dominant negative mutants in either LeAMT1;1 or LeAMT1;2 were co-expressed with the respective wild type proteins. If the different plant ammonium transporter polypeptides co-assemble indiscriminately, the co-expressed mutants should inhibit ammonium transport, as was shown e.g. for plant potassium channels (37). Indeed, the LeAMT1;1 mutant G458D, when co-expressed with LeAMT1;2 wild type, reduced LeAMT1;2 currents by ~85% (Fig. 7). Conversely, the corresponding mutant in LeAMT1;2 (G465D) reduced LeAMT1;1 wild type activity by ~90%. The magnitude of dominant negative inhibition was similar for both pairs of constructs, indicating that mutant polypeptides indiscriminately interacted with either LeAMT1;1 or LeAMT1;2 in oocytes (Fig. 7). The cross-inhibition suggests that LeAMT1;1 and LeAMT1;2 polypeptides can co-assemble to form hetero-oligomers.

Individual Properties of LeAMT1;1 and LeAMT1;2 are Unchanged by Co-expression—Because the overall function of LeAMT1;1 and LeAMT1;2 was apparently similar despite their different substrate affinity, we investigated whether LeAMT1 subunits might interact to form novel transport complexes with new characteristics. Using equal amounts of cRNA in co-injections, the total induced currents by 100 µM were similar to a superposition of currents from individual LeAMT1;1- or LeAMT1;2-expressing oocytes (Fig. 8). Similarly, methylammonium-induced current magnitudes (by 500 µM) were essentially additive (Fig. 8). Thus, complex formation did not lead to changes in currents as observed e.g. with co-expressed plant potassium channels (38).



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 8.
Co-expression does not change individual LeAMT1;1 and LeAMT1;2 current magnitudes. Current amplitude at -50 mV from experiments with LeAMT1;1 (column 1) or LeAMT1;2 (column 2) expressed individually or co-expressed (co). Column 1+2 corresponds to the current sum of individual constructs. Left, 100 µM ammonium; right, 500 µM methylammonium (MA+).

 
Saturation kinetics of ammonium-induced currents for oocytes injected with equal amounts of cRNA for both transporters were fitted with two independent components resembling the affinity of individual transporters (Fig. 9). The data can also be described by the kinetics expected for tri- and tetramers, assuming intermediate affinity for the heteromers, although with less confidence. The analysis suggests that no dramatic change in properties occurs in the complex but, at the present time, does not allow discrimination between models in which the individual pores function independently in the complex or are changed to intermediate properties.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
LeAMT1;1 Homo-oligomerization in Vivo—Three lines of evidence support the idea that plant ammonium transporters form oligomers in the plasma membrane of roots. (i) Interactions between LeAMT1;1 proteins were identified using a modified split ubiquitin system, allowing the detection of membrane protein interactions by several markers (ade2, his3, LacZ). Similar results were obtained for the plant potassium channels KAT1 and AKT1 using the same modified split ubiquitin system.3 (ii) The physical interaction between LeAMT1 polypeptides was confirmed in planta. The LeAMT1;1 antibody detected a high molecular mass complex in plant membranes, which could be converted to the monomeric form with ~35 kDa by heat denaturation. The apparent molecular mass of the complex of ~140 kDa, which would be consistent with a tetrameric complex, is, however, also compatible with a trimeric form, such as the bacterial AMTs, which interacts with additional factors (21, 39). If the plant AMTs interact with soluble proteins, the soluble polypeptides in the complex are presumably different from PII, because the plant PII homolog is localized in plastids (40).

Interaction between Wild Type and Mutated LeAMT1;1 in a Heterologous System—Heterologous expression of functional LeAMT1 proteins in oocytes permitted quantitative titration of the transport capacities of wild type AMTs by a co-expressed mutant. Expression in oocytes, as a heterologous host, has the advantage that the probability is low that cytosolic factors mediate the interaction and trans-inactivation. The mutation G458D in LeAMT1;1, corresponding to the mep1-1 mutation G413D that trans-inhibited MEP3 in Saccharomyces (23, 24), inactivated the function of LeAMT1;1 in oocytes. For both LeAMT1;1 and LeAMT1;2, co-expression of the respective mutant with the wild type led to a large reduction in ammonium transport capacity, suggesting direct protein-protein interactions. The inhibition was specific, and the possibility was excluded e.g. that overall protein trafficking to the plasma membrane was blocked by the mutant, because an unrelated amino acid transporter (AtAAP6) was unaffected by co-expression of the mutant LeAMT1;1. The oligomerization is consistent with the finding that bacterial and human homologs also form oligomers (22, 21). It will thus be important to determine the exact composition of AMT complexes in root plasma membranes.

The finding that a mutation in the cytosolic C terminus affects functionality in AMT oligomers may suggest that the C terminus is important for function of the complex. Voltagegated potassium channels are formed by the tetramerization of their {alpha}-subunits in a process that is controlled by their conserved N-terminal T1 domains (41). It will thus be interesting to test whether the comparatively long cytosolic C terminus of the AMTs is important for oligomerization.

The mechanism of inhibition by the mutation in the AMT C terminus is yet unknown. Two major hypotheses may explain the dominant inhibition of wild type by mutant proteins. First, polypeptides may co-assemble with wild type in intracellular membranes as in the case of potassium channels, but the complex containing AMT mutants is retained in the endoplasmic reticulum and does not reach the plasma membrane. Alternatively, the complex of mutant and wild type may be correctly inserted into the plasma membrane and interact, but resulting heteromers are nonfunctional. Because no significant differences in the localization of mutant and wild type protein was detected in yeast or plant protoplasts, it is conceivable that a complex is present at the plasma membrane (Fig. 1), which is inactive in the presence of the mutant form. The dominant negative inhibition of wild type by mutant LeAMT1 may either suggest a common central permeation pathway for ammonium lined by interacting subunits (as in potassium channels) or, more likely, a common "gating" or "activation" mechanism as in two-pore CLC-type chloride channels (42).

The region around Gly458 has been shown to be important for interaction of bacterial AmtB with regulatory PII proteins (39). Interestingly, homology in this region is restricted to AMT/MEP proteins from organisms that accumulate and assimilate ammonium but not to Rh polypeptides. Because the C terminus containing this region is cytoplasmic, one may speculate that the C terminus is not directly involved in ion transport but is important for regulation mediated by interaction of cytosolic factors. Because the mutant suppresses ammonium transport in a dominant negative manner and also affects paralogs, over-expression of the mutant may be used as a novel tool to suppress ammonium transport in transgenic plants to study the physiological function of AMTs. However, the possibility remains that the in planta interaction between subunits is different from that in Xenopus oocytes because of different endogenous lipid and protein environments.

Physiological implications of Uniporter Function and Affinity of LeAMT1;2—When expressed in oocytes, LeAMT1;1 and LeAMT1;2 mediated the membrane potential-driven influx of and methylammonium. Currents were of similar size with equal amounts of injected cRNA. Similar to LeAMT1;1, LeAMT1;2 functioned as a pH-independent transporter but with an {approx}6-fold lower affinity for . The affinity of both transporters to the substrate was voltage-dependent, suggesting a molecularly similar -binding site localized {approx}26-30% inside the electric field across the membrane in both proteins. Both tomato transporters were unaffected by changes in the external proton concentration, excluding NH3 (43) or H+/ co-transport (44) as a transport mechanism and supporting the uniport of charged (13).

Uptake of ammonium by tomato roots grown in 50 µM saturated with a Km of {approx}8.5 µM (45). The affinity determined in plants closely matches that of LeAMT1;1 rather than the {approx}6-fold lower affinity of LeAMT1;2. Thus, at low nitrogen supply, it is most likely that LeAMT1;1 is mainly responsible for ammonium uptake. Indeed, LeAMT1;1 transcripts were up-regulated at low external ammonium supply, whereas the second transporter in tomato roots, LeAMT1;2, with lower affinity, was highly expressed only after receiving a resupply of nitrogen (17). In Arabidopsis, six AMT-type transporters (AtAMT1;1, GenBankTM accession number At4g13510; AtAMT1;2, At1g64780; AtAMT1;3, At3g24300; AtAMT1;4, At4g28700; AtAMT1;5, At3g24290; AtAMT2, At2g38290) have been identified on various chromosomes. According to sequence similarity and transcriptional regulation by nitrogen, AtAMT1;1 seems to be the paralog to LeAMT1;1. An Arabidopsis mutant lacking AtAMT1;1 activity is still able to take up ammonium due to the remaining uptake activity by its paralogs (46).

Interactions between Co-expressed LeAMT1;1 and LeAMT1; 2—All investigated AMT/MEP/Rh proteins form functional ammonium transporters when expressed as individual polypeptides in heterologous systems, where they probably assemble as homo-oligomers. The cross-inhibition of ammonium transporters by different AMT mutants, however, suggests that heterooligomeric complexes can exist, at least in oocytes. Co-expressed LeAMT1;1 and LeAMT1;2 ammonium transporters formed functional hetero-oligomers with intermediate properties, which may be explained by simple superposition of individual transport properties. Although it is still not known whether LeAMT1;1 and LeAMT1;2 co-assemble in vivo in the plant membrane, the co-expression in the same cell types such as root hairs may suggest that they interact to form complexes in plants (17).

The results do not allow discrimination between different roles of the oligomerization. (i) Each subunit may form a pore, thus constituting a functional transport system. In this case oligomerization may play a role in yet unknown regulatory phenomena. (ii) Individual ammonium transporter subunits form a heteromeric protein as suggested for heteromeric sucrose transporters, in which separately expressed halves from different paralogs can reconstitute a functional transporter with intermediate affinity (18). (iii) Oligomers may form one common pore as in the case of potassium channels. In this case also, it is possible that a transport system with intermediate function is generated. Structural analysis, together with dissection of the domains relevant for interaction using the split ubiquitin system, and biochemical analyses will be needed to determine the structure and function of the complexes. However, irrespective of the structure, the results suggest that hetero-oligomers do not create a novel property but rather behave as a superposition of individual transporters.


   FOOTNOTES
 
* This work was supported by the Deutsche Forschungsgemeinschaft Gottfried-Wilhelm Leibniz award and the European Science Award of the Körber Foundation (to W. B. F.), the European Union Project "Associoport" (QLG2-CT-2001-01297), and the project "N-Engineering" funded by Ministerium für Forschung, Wissenschaft, and Kunst, Baden-Württemberg, Germany. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

The on-line version of this article (available at http://www.jbc.org) contains a figure. Back

**To whom correspondence may be addressed. E-mail: vonwiren{at}uni-hohenheim.de. §§To whom correspondence may be addressed. E-mail: frommer{at}andrew2.stanford.edu.

1 The abbreviations used are: AMT, ammonium transporter; MEP, methylammonium permease; TBS, Tris-buffered saline; TBS-T, Trisbuffered saline including 0.1% Tween 20; BSA, bovine serum albumin; GFP, green fluorescent protein; ub, ubiquitin; WT, wild type; MES, 4-morpholineethanesulfonic acid; bis-Tris, 2-[bis(2-hydroxyethyl) amino]-2-(hydroxymethyl)propane-1,3-diol. Back

2 Vector maps and plasmids are available from the authors. Back

3 P. Obrdlik, M. El Bakkoury, T. Hamacher, C. Cappellaro, D. Blaudez, D. Sanders, E. Boles, W. B. Frommer, and B. André, manuscript in preparation. Back


   ACKNOWLEDGMENTS
 
We thank Petra Neumann and Jens Riexinger for technical assistance.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. von Wirén, N., Gazzarrini, S., Gojon, A., and Frommer, W. B. (2000) Curr. Opin. Plant Biol. 3, 254-261[Medline] [Order article via Infotrieve]
  2. Ludewig, U., von Wirén, N., Rentsch, D., and Frommer, W. B. (2001) Genome Biol. 2, 1-5[Medline] [Order article via Infotrieve]
  3. Dubois, E., and Grenson, M. (1979) Mol. Gen. Genet. 175, 67-76[CrossRef][Medline] [Order article via Infotrieve]
  4. Marini, A. M., Vissers, S., Urrestarazu, A., and André, B. (1994) EMBO J. 13, 3456-3463[Medline] [Order article via Infotrieve]
  5. Ninnemann, O., Jauniaux, J. C., and Frommer, W. B. (1994) EMBO J. 13, 3464-3471[Medline] [Order article via Infotrieve]
  6. Siewe, R. M., Weil, B., Burkovski, A., Eikmanns, B. J., Eikmanns, M., and Kramer, R. (1996) J. Biol. Chem. 271, 5398-5403[Abstract/Free Full Text]
  7. Marini, A. M., Urrestarazu, A., Beauwens, R., and André, B. (1997) Trends Biochem. Sci. 22, 460-461[CrossRef][Medline] [Order article via Infotrieve]
  8. Marini, A. M., Matassi, G., Raynal, V., André, B., Cartron, J. P., and Cherif-Zahar, B. (2000) Nat. Genet. 26, 341-344[CrossRef][Medline] [Order article via Infotrieve]
  9. Westhoff, C. M., Ferreri-Jacobia, M., Mak, D. O., and Foskett, J. K. (2002) J. Biol. Chem. 277, 12499-12502[Abstract/Free Full Text]
  10. Gojon, A., Soussana, J. F., Passama, L., and Robin, P. (1986) Plant Physiol. 82, 254-260[Abstract/Free Full Text]
  11. Ullrich, W. R., Larsson, M., Larsson, C. M., Lesch, S., and Novacky, A. (1984) Physiol. Plant. 61, 369-376[CrossRef]
  12. Wang, M. Y., Siddiqi, M. Y., Ruth, T. J., and Glass, A. D. M. (1993) Plant Physiol. 103, 1259-1267[Abstract]
  13. Ludewig, U., von Wirén, N., and Frommer, W. B. (2002) J. Biol. Chem. 277, 13548-13555[Abstract/Free Full Text]
  14. White, P. J. (1996) J. Membr. Biol. 152, 89-99[CrossRef][Medline] [Order article via Infotrieve]
  15. Howitt, S. M., and Udvardi, M. K. (2000) Biochim. Biophys. Acta 1465, 152-170[Medline] [Order article via Infotrieve]
  16. Lauter, F. R., Ninnemann, O., Bucher, M., Riesmeier, J. W., and Frommer, W. B. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 8139-8144[Abstract/Free Full Text]
  17. von Wirén, N., Lauter, F. R., Ninnemann, O., Gillissen, B., Walch-Liu, P., Engels, C., Jost, W., and Frommer, W. B. (2000) Plant J. 21, 167-175[CrossRef][Medline] [Order article via Infotrieve]
  18. Reinders, A., Schulze, W., Kühn, C., Barker, L., Schulz, A., Ward, J. M., and Frommer, W. B. (2002) Plant Cell. 14, 1567-1577[Abstract/Free Full Text]
  19. Veenhoff, L. M., Heuberger, E. H., and Poolman, B. (2002) Trends Biochem. Sci. 27, 242-249[CrossRef][Medline] [Order article via Infotrieve]
  20. Schulze, W. X., Reinders, A., Ward, J., Lalonde, S., and Frommer, W. B. (2003) BMC Biochem. 4, 3[CrossRef][Medline] [Order article via Infotrieve]
  21. Blakey, D., Leech, A., Thomas, G. H., Coutts, G., Findlay, K., and Merrick, M. (2002) Biochem. J. 364, 527-535[CrossRef][Medline] [Order article via Infotrieve]
  22. Hartel-Schenk, S., and Agre, P. (1992) J. Biol. Chem. 267, 5569-5574[Abstract/Free Full Text]
  23. Marini, A. M., Springael, J. Y., Frommer, W. B., and André, B. (2000) Mol. Microbiol. 35, 378-385[CrossRef][Medline] [Order article via Infotrieve]
  24. Brendon, J. M., Unkles, S. E., Tsing, T., Kinghorn, J. R., Hynes, M. J., and Davis, M. A. (2002) Fungal Gen. Biol. 36, 35-46[CrossRef][Medline] [Order article via Infotrieve]
  25. Fischer, W.-N., Loo, D. F., Koch, W., Ludewig, U., Boorer, K. J., Tegeder, M., Rentsch, D., Wright, E. M., and Frommer, W. B. (2002) Plant J. 29, 717-732[CrossRef][Medline] [Order article via Infotrieve]
  26. Fusco, C., Guidotti, E., and Zervos, A. S. (1999) Yeast 15, 715-720[CrossRef][Medline] [Order article via Infotrieve]
  27. Deleted in proof
  28. Uetz, P., Giot, L., Cagney, G., Mansfield, T. A., Judson, R. S., Knight, J. R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P., Qureshi-Emili, A., Li, Y., Godwin, B., Conover, D., Kalbfleisch, T., Vijayadamodar, G., Yang, M., Johnston, M., Fields, S., and Rothberg, J. M. (2000) Nature 403, 623-627[CrossRef][Medline] [Order article via Infotrieve]
  29. Stagljar, I., Korostensky, C., Johnsson, N., and te Heesen, S. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 5187-5192[Abstract/Free Full Text]
  30. Daram, P., Urbach, S., Gaymard, F., Sentenac, H., and Cherel, I. (1997) EMBO J. 16, 3455-3463[CrossRef][Medline] [Order article via Infotrieve]
  31. Pilot, G., Lacombe, B., Gaymard, F., Cherel, I., Boucherez, J., Thibaud, J. B., and Sentenac, H. (2001) J. Biol. Chem. 276, 3215-3221[Abstract/Free Full Text]
  32. Maddy, A. D. (1976) J. Theor. Biol. 62, 315-321[CrossRef][Medline] [Order article via Infotrieve]
  33. Eyers, S. A., Ridgwell, K., Mawby, W. J., and Tanner, M. J. (1994) J. Biol. Chem. 269, 6417-6423[Abstract/Free Full Text]
  34. Marini, A. M., and Andre, B. (2000) Mol. Microbiol. 38, 552-564[CrossRef][Medline] [Order article via Infotrieve]
  35. Cougnon, M., Bouyer, P., Hulin, P., Anagnostpoulos, T., and Planelles, G. (1996) Pflügers Arch. Eur. J. Physiol. 431, 658-667[Medline] [Order article via Infotrieve]
  36. Burckhardt, B. C., and Burckhardt, G. (1997) Pflügers Arch. Eur. J. Physiol. 434, 306-312[CrossRef][Medline] [Order article via Infotrieve]
  37. Baizabal-Aguirre, V. M., Clemens, S., Uozumi, N., and Schroeder, J. I. (1999) J. Membr. Biol. 167, 119-125[CrossRef][Medline] [Order article via Infotrieve]
  38. Dreyer, I., Antunes, S., Hoshi, T., Müller-Röber, B., Palme, K., Pongs, O., Reintanz, B., and Hedrich, R. (1997) Biophys. J. 72, 2143-2150[Abstract/Free Full Text]
  39. Coutts, G., Thomas, G., Blakey, D., and Merrick, M. (2002) EMBO J. 21, 536-545[CrossRef][Medline] [Order article via Infotrieve]
  40. Hsieh, M. H., Lam, H. M., van de Loo, F. J., and Coruzzi, G. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 13965-13970[Abstract/Free Full Text]
  41. Kosolapov, A., and Deutsch, C. (2003) J. Biol. Chem. 278, 4305-4313[Abstract/Free Full Text]
  42. Ludewig, U., Pusch, M., and Jentsch, T. J. (1996) Nature 383, 340-343[CrossRef][Medline] [Order article via Infotrieve]
  43. Soupene, E., Ramirez, R. M., and Kustu, S. (2001) Mol. Cell. Biol. 21, 5733-5741[Abstract/Free Full Text]
  44. Britto, D. T., Glass, A. D., Kronzucker, H. J., and Siddiqi, M. Y. (2001) Plant Physiol. 125, 523-526[Free Full Text]
  45. Smart, D. R., and Bloom, A. J. (1988) Oecologia 76, 336-340[CrossRef]
  46. Kaiser, B. N., Rawat, S. R., Siddiqi, M. Y., Masle, J., and Glass, A. D. (2002) Plant Physiol. 130, 1263-1275[Abstract/Free Full Text]
  47. von Wirén, N., Peltier, J.-B., Rouquié, M., Rossignol, M., and Briat, J.-F. (1997) Plant Physiol. Biochem. 35, 945-950
  48. Steinmeyer, K., Lorenz, C., Pusch, M., Koch, M. C., and Jentsch, T. J. (1994) EMBO J. 13, 737-743[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?