Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M302287200 on September 11, 2003

J. Biol. Chem., Vol. 278, Issue 48, 48283-48291, November 28, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/48/48283    most recent
M302287200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dalen, K. T.
Right arrow Articles by Nebb, H. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dalen, K. T.
Right arrow Articles by Nebb, H. I.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Expression of the Insulin-responsive Glucose Transporter GLUT4 in Adipocytes Is Dependent on Liver X Receptor {alpha}*

Knut Tomas Dalen{ddagger}, Stine Marie Ulven{ddagger}, Krister Bamberg§, Jan-Åke Gustafsson¶, and Hilde I. Nebb{ddagger}||

From the {ddagger}Institute for Nutrition Research, University of Oslo, N-0316 Oslo, Norway, §Molecular Pharmacology, Research Area CV and GI, AstraZeneca Mölndal, S-431 83 Mölndal, Sweden, and the Department of Bioscience and Medical Nutrition, Novum, S-141 86 Huddinge, Sweden

Received for publication, March 5, 2003 , and in revised form, September 10, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The insulin-responsive glucose transporter GLUT4 plays a crucial role in insulin-mediated facilitated glucose uptake into adipose tissue and muscle, and impaired expression of GLUT4 has been linked to obesity and diabetes. In this study, we demonstrate that liver X receptors (LXRs) regulate the expression of GLUT4 through direct interaction with a conserved LXR response element in the GLUT4 promoter. The expression of GLUT4 in WAT is induced by a potent LXR agonist in wild type, LXR{alpha}-/-, and LXR{beta}-/- mice but not in LXR{alpha}-/-{beta}-/- mice, demonstrating that both LXRs are able to mediate ligand activated transcription of the GLUT4 gene. However, basal and insulin stimulated expression of GLUT4 in epididymal WAT is reduced only in mice carrying ablation of the LXR{alpha} isoform. The expression of GLUT4 is furthermore correlated to the induction of LXR{alpha} during mouse and human adipocyte differentiation. LXR{beta} is thus apparently not able to rescue basal expression of GLUT4 in the absence of LXR{alpha}. We have previously demonstrated that LXR{alpha} is down-regulated in animal models of obesity and diabetes, thus revealing a striking correlation between GLUT4 and LXR{alpha} expression in insulin-resistant conditions. This suggests that the LXR{alpha} isoform has a unique role in adipose expression of GLUT4 and suggests that alteration of adipose tissue expression of LXR{alpha} might be a novel tool to normalize the expression of a gene that is dysregulated in diabetic and insulin-resistant conditions.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
One important physiological consequence of obesity is a reduced ability to respond to insulin in peripheral tissues. Untreated, this insulin resistance is associated with increased risk for development of cardiovascular disease and, in later stages, type 2 diabetes. Numerous studies have shown that the effect of insulin to increase glucose uptake is directly dependent on recruitment of GLUT4, a facilitative glucose transporter, from an intracellular vesicle pool to the plasma membrane (reviewed in Refs. 1 and 2). GLUT4 is expressed exclusively in tissues exhibiting insulin-stimulated glucose uptake, such as muscle, heart, and adipose tissue (3). In the basal state, GLUT4 is sorted to an intracellular compartment with a low exocytotic rate, which changes to a high exocytotic rate upon insulin stimulation through activation of intracellular phosphorylation cascades (2). Although this insulin-stimulated translocation of GLUT4 is the main factor that increases glucose uptake, it also depends on the amount of stored GLUT4 in such a compartment. The expression of GLUT4 is reduced in rodent models of insulin deficiency (4, 5) and in adipose tissue of human obese or type 2 diabetic subjects (6, 7), directly linking adipose expression of GLUT4 to insulin resistance. Moreover, recent studies in mice have demonstrated that selective ablation of GLUT4 in adipose tissue leads to decreased whole body glucose tolerance and insulin responsiveness (8), whereas forced overexpression enhances systemic glucose clearance and insulin sensitivity (9). This implies an important role of adipose tissue GLUT4 expression in whole body glucose homeostasis, despite the fact that it is estimated that adipose tissue only accounts for 10% of the insulin-mediated whole body glucose uptake (10).

The differentiation and maintenance of adipose tissue is driven by the transcription factor peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}),1 a member of the nuclear receptor family (11–13). PPAR{gamma} heterodimerizes with retinoid X receptor {alpha} (RXR{alpha}) and controls transcription of target genes by binding to a direct repeat-1 PPAR{gamma} response element located in the promoter of target genes (12–14). Natural high affinity ligands for PPAR{gamma} have not been identified, but endogenous polyunsaturated fatty acids and 15-deoxy-{Delta}12,14-prostaglandin J2 (15-PGJ2) show micromolar affinity for the receptor in line with their serum levels (15, 16). Thiazolidinediones (TZDs), a new class of synthetic antidiabetic drugs, have been characterized as high affinity ligands for PPAR{gamma} (17).

Recently, we suggested that the liver X receptors (LXRs) are involved in the regulation of adipose tissue fatty acid metabolism and triglyceride (TG) storage (18). LXR{alpha} (19, 20) and LXR{beta} (21, 22) heterodimerize with RXR{alpha} and control transcription by binding to a direct repeat type 4 LXR response element (LXRE) located in the promoter of their target genes (20, 23). The LXR{beta} isoform is ubiquitously expressed in adults (21), whereas the expression of LXR{alpha} is predominantly restricted to tissues known to play important roles in lipid metabolism, such as liver, skeletal muscle, adipose tissue, kidney, and small intestine, but a lower expression level is also seen in spleen and pituitary and adrenal glands (19, 20, 24). Naturally occurring oxysterols, mainly derivatives of cholesterol, function as high affinity ligands for LXRs (25, 26), and recently, a synthetic nonsteroidal LXR agonist was described (27).

Several studies have demonstrated the importance of LXRs in cholesterol homeostasis (i.e. by regulating ATP-binding cassette transporters (28, 29), human cholesterol ester transfer protein (30), apolipoprotein E (31), and the rodent cholesterol-7{alpha} hydroxylase gene (26, 32)). In addition, LXRs have been linked to lipid metabolism by their direct regulation of the sterol regulatory element-binding protein 1c (SREBP-1c) (33, 34) and fatty acid synthase (FAS) (35) promoters as well as the observation that insulin-mediated regulation of these lipogenic genes in liver is dependent on LXRs (36). This suggests that the LXRs are important regulators of lipid metabolism, in addition to their roles as regulators of cholesterol homeostasis.

Earlier studies have shown that the transcription of GLUT4 in adipocytes is induced by ligands that activate PPAR{gamma} (37) and that the reduced levels of GLUT4 in adipose tissue in animal models of diabetes is normalized by treatment with PPAR{gamma} activators (38, 39). The exact molecular mechanism responsible for this regulation is, however, not known. We demonstrated recently that the expression of LXR{alpha} is regulated similarly to GLUT4 in adipose tissue by being repressed in a model of obesity, which was normalized by treatment with a potent PPAR{gamma} activator (18). Furthermore, activation of LXRs in adipose tissue increases basal glucose uptake (40) and incorporation of TGs into lipid droplets (18). Since all of these factors pointed to a role of LXRs in the regulation of glucose metabolism, we initiated a study to determine whether genes involved in this pathway are regulated by LXRs.

Here we demonstrate that the adipose tissue expression of GLUT4 is directly regulated by both LXR{alpha} and LXR{beta} upon ligand stimulation but that the basal expression of GLUT4 is selectively dependent on the LXR{alpha} isoform. In view of the recently proposed antidiabetic effects of LXRs (41), this work supports such a role for LXRs, since we now demonstrate a direct link between LXR{alpha} and a gene that is down-regulated in diabetic and insulin-resistant conditions.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—All restriction enzymes were purchased from Promega (Madison, WI). All cell culture plastic ware was obtained from Corning Inc. Media (D6546 and D6421), oligonucleotides, and other chemicals were obtained from Sigma. EMSAs and Northern blots were analyzed by phosphorimaging (ImageQuantTM software; Amersham Biosciences). The pCMX, pCMX-RXR{alpha}, and pCMX-LXR{alpha} expression vectors (29) were a gift from D. J. Mangelsdorf (Dallas, TX). Darglitazone and T0901317 were obtained from AstraZeneca (Mölndal, Sweden).

Culturing of Cells—COS-1 and 3T3-L1 cells (ATCC) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (Integro, Dieren, Holland; lot 5-80301), 2 mM L-glutamine, penicillin (50 units/ml), and streptomycin (50 µg/ml) at 37 °C in 5% CO2. Cells were handled as described (42) and were not allowed to grow confluent prior to experiments.

3T3-L1 cells were differentiated into adipocytes by the addition of adipogenic factors (23) with some adjustments. Preadipocytes were seeded at passage 6–8, grown 1–2 days postconfluence, and exposed to adipogenic medium (0.5 mM isobutylmethylxanthine, 0.1 µM dexamethazone, and 1 µg/ml insulin) for 3 days and then medium containing insulin (1 µg/ml) for 3 days, followed by an additional 7 days with regular medium to obtain mature adipocytes (day 13).

Human (SGBS) cells were cultured and differentiated into adipocytes essentially as described (43). Briefly, cells were subcultured in basal medium (Dulbecco's modified Eagle's medium/nutrient mix F-12 (D6421) supplemented with 4 mg of biotin, 2 g of D-pantothenate, 2 mM L-glutamine, penicillin (100 units/ml), and streptomycin (100 µg/ml) supplemented with 10% noninactivated fetal calf serum (10270-106; Invitrogen). For adipocyte differentiation, cells were seeded at low passage 6–10, grown into confluence, and exposed to adipogenic medium (Quickdiff; 3FC supplemented with 25 nM dexamethazone, 0.5 mM isobutylmethylxanthine, and 2 µM rosiglitazone), followed by continuous culturing in 3FC (basal medium supplemented with 10 µg/ml human transferrin, 20 nM insulin, 100 nM cortisol, and 0.2 nM T3). Cells were given fresh medium twice a week until experiments were started at days 15–17.

Preparation and Analysis of RNA—Total RNA was extracted with TRIZOL® Reagent (Invitrogen), and 10–20 µg of total RNA was used for Northern blotting. Hybridization and stripping of membranes (Hybond-N; Amersham Biosciences) were performed as recommended (PT1200-1; Clontech). Membranes were probed with [{alpha}-32P]dCTP (Amersham Biosciences)-radiolabeled cDNAs synthesized using a multiple DNA labeling system (Amersham Biosciences). Human (h) and mouse (m) probes used were h-GLUT4, h-LXR{alpha}, h-PPAR{gamma}, h-SREBP-1, h-FAS, m-GLUT4, m-aFABP, m-L27, and m-36B4.

Cloning of the GLUT4 cDNA and Probe—The mouse GLUT4 cDNA and the human GLUT4 probe were generated by reverse transcriptase polymerase chain reaction (RT-PCR) from total RNA isolated from differentiated 3T3-L1 and SGBS cells, respectively, using the ImProm-IITM reverse transcription system (Promega) with an oligo(dT)16 primer, followed by a PCR (30 cycles) with Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA). The obtained PCR fragments were cloned into the pPCR-Script vector using the PCR-ScriptTM Amp cloning kit (Stratagene). PCR fragments obtained by a second PCR amplification from these vectors were used for labeling reactions in Northern analysis.

The following primers were used to amplify the mouse GLUT4 CDS (accession number BC014282 [GenBank] , nucleotides 111–1770): 5'-mGLUT4-CDS (5'-TAGAATTCCCCGGACCCTATACCCTATTCATTT-3') and 3'-mGLUT4-CDS (5'-TAGGATCCGCTGTAGAGGAAAGGAGGGAGTCT-G-3') and the human GLUT4 probe 5'-hGLUT4 probe (5'-CCATTGTT-ATCGGCATTCTGATCG-3') and 3'-hGLUT4-probe (5'-ATAGCCTC-CGCAACATACTGGAAAC-3').

Cloning and Mutagenesis of the GLUT4 Promoter—A previously described nucleotide sequence for the human GLUT4 promoter (accession number M61126 [GenBank] ) was used as a bait in a BLAST search against htgs sequences at NCBI to identify a longer 5'-upstream sequence (annealed to accession number AC003688 [GenBank] ). The mouse GLUT4 promoter was identified with the full-length mouse GLUT4 mRNA as bait (accession number BC014282 [GenBank] annealed to accession number AL596185 [GenBank] .8). For both promoters, the promoter sequence spanning 10,000 bp up- and downstream from the transcription start site was extracted and analyzed using a consensus LXRE (DGGTYA HWHW MGKKCA) generated by the GCG program (Wisconsin Package version 10.0, Genetics Computer Group (GCG), Madison, WI) to localize potential LXR response elements.

The full-length GLUT4 promoter was amplified by PCR with Pfu Turbo DNA polymerase (Stratagene) from human genomic DNA (6550-1; Clontech) with primers selected by the Primer3 program (51) (primers were 5'-h-GLUT4-promoter (TAAGATCTCTGTGCTGGAACTCAGGGATCA) and 3'-h-GLUT4-promoter (TAAGATCTTCGGAGCCTATCTGTTGGAAGC)). The promoter was amplified in a 100-µl PCR mixture (100–500 ng of template, 1x cloned Pfu buffer, 200 µM each dNTP, 2.5 units of Pfu Turbo polymerase, and 20 pmol of each primer) in a long cycled PCR (2 min at 95 °C; 1 min at 95 °C, 45 sec at 60 °C (2 min/1000 bp) at 72 °C for 30 cycles; 10 min at 72 °C). The amplified promoter fragment was inserted into the pPCR-Script vector (Stratagene) prior to insertion into the BglII site in the pGL3-Basic luciferase reporter vector (Promega). The GLUT4 SmaI deletion reporter was made by restriction cutting of the full-length reporter with SmaI followed by religation of the vector.

The mutation of the LXRE element in the human GLUT4 reporter was introduced by employing the mutated oligonucleotides used in the EMSA (Fig. 5A) as mutation-targeting primers. 10 ng of the full-length GLUT4 reporter was amplified in a 50-µl PCR mixture (1x cloned Pfu buffer, 200 µM each dNTP, 2.5 units of Pfu Turbo polymerase, and 15 pmol/each mutation oligonucleotide) in a long cycled PCR reaction (2 min at 95 °C; 45 s at 95 °C, 30 s at 55 °C, 15 min at 68 °C for 20 cycles). Following PCR, the PCR mixture was treated with DpnI (1 unit) at 37 °C for 1 h and transformed into supercompetent cells. Positive clones were identified by restriction analysis and verified by sequencing.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 5.
GLUT4 is regulated in vivo by ligand activation of LXRs. Mice were gavage-fed with twice vehicle, darglitazone (Darg; 1 mg/kg), T0901317 (50 mg/kg), or a combination of darglitazone and T0901317, 24 and 8 h prior to being sacrificed. WAT (epididymal) and skeletal muscle (gastrocnemius) were rapidly taken out and subjected to Northern blot analysis. A, expression of GLUT4 mRNA in epididymal WAT. B, the expression of GLUT4 in epididymal WAT correlated against L27 as internal standard. Shown is relative expression of GLUT4 after treatment with darglitazone (n = 5), T0901317 (n = 3), or T0901317 and darglitazone (n = 3) compared with controls (n = 5). C, expression of GLUT4 mRNA in muscle. D, the expression of GLUT4 in muscle correlated against L27 as an internal standard. Shown is relative expression of GLUT4 after treatment with darglitazone (n = 3) or T0901317 (n = 3) compared with controls (n = 3). The result is given as mean ± S.E. p values were determined by one-way analysis of variance; *, p < 0.05; **, p < 0.01.

 
Transfection, Luciferase Assay, and Electrophoretic Mobility Shift Assay—For reporter gene assays, COS-1 cells were transiently transfected in six-well dishes with luciferase reporters (5 µg) and co-transfected with pCMX-RXR{alpha}, pCMX-LXR{alpha} (1 µg each), and pSV-{beta}-galactosidase (3 µg) expression vectors with calcium phosphate precipitation (42). Total DNA concentration was adjusted to 12 µg with corresponding empty expression vectors and pGL3-basic vector. Differentiated human SGBS cells were transfected (12 wells) with reporters (800 ng) and pTK Renilla luciferase (80 ng) with LipofectAMINE Plus reagent (Invitrogen). Total DNA concentration was adjusted to 1.0 µg by the addition of pGL3-basic vector. After 3 h of transfection, medium containing appropriate reagents was added for 48 h. Cells were harvested in 100 µl lysis buffer, and luciferase activities were measured using the dual luciferase assay kit (Promega).

For preparation of nuclear extract, COS-1 cells were transfected in 10-cm dishes with 20 µg of vector mixed with 70 µl of LipofectAMINE (Invitrogen) in 10 ml of serum and antibiotic-free medium for 6 h, followed by 48-h incubation in 20 ml of medium containing serum and antibiotics. Nuclear extracts from 3T3-L1 and transfected cells were isolated according to Ref. 44, except that the proteinase inhibitor phenylmethylsulfonyl fluoride was replaced with 2x Complete (Roche Applied Science). Protein concentrations were measured by a BC assay (Interchim, Montlucon, France).

Unprogrammed reticulocyte lysate and murine RXR{alpha} and human LXR{alpha} proteins were synthesized in vitro from pCMX, pCMX-mRXR{alpha}, and pCMX-hLXR{alpha} expression vectors, respectively, using a TNT-T7 quick coupled transcription/translation system (Promega). The oligonucleotide probes (for sequences, see Fig. 4A) were labeled using T4 polynucleotide kinase (Promega) and [{gamma}-32P]ATP (Amersham Biosciences) and purified on ProbeQuant G50 Micro columns (Amersham Biosciences). Binding reactions and separation of the protein-DNA complexes from free probes were performed by using a modified version of a previously published protocol (26). For in vitro translated proteins, binding reactions were performed in a 20-µl reaction mixture (40 mM KCl, 10 mM Tris-HCl (pH 8.0), 0.2 mM EDTA, 1 mM dithiothreitol, 6% (v/v) glycerol, 0.1% (v/v) Nonidet P-40, 1 µg of single-stranded DNA, and 4 µl of in vitro translated lysate). Nuclear extract binding reactions were performed in a 20-µl reaction mixture (10 mM HEPES (pH 7.9), 20 mM KCl, 4% glycerol, 0.1% Nonidet P-40, 1 mM dithiothreitol, and 4 µl nuclear extract). Binding reactions were preincubated on ice for 15 min before the addition of 1 µl of double-stranded 32P-labeled probe (80–800 fmol; 20,000–100,000 cpm) followed by 20 min of incubation at room temperature. The protein-DNA complexes were resolved on a 4.5% nondenaturing polyacrylamide gel in 1x EMSA buffer (25 mM Trisma base (pH 8.5), 190 mM glycine and 1 mM EDTA) at 180 V for 3.5 h at 4 °C.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 4.
The LXRE in the human and mouse GLUT4 promoters recruits the LXR{alpha}/RXR{alpha} heterodimer. A, the nucleotide sequence for the different oligonucleotides used. Only the upper primer is shown. Each half-site in the DR4 element is indicated in boldface type, and the base substitution in the mutated oligonucleotides is given in the -mut oligonucleotides. B, direct and specific binding of the RXR{alpha}/LXR{alpha} heterodimer to the LXRE in the human GLUT4 promoter. The EMSA was performed with annealed and 32P-labeled h-GLUT4-LXRE oligonucleotides and incubated in the presence of in vitro translated RXR{alpha} and/or LXR{alpha} proteins as indicated. C, direct and specific binding of the RXR{alpha}/LXR{alpha} heterodimer complex to the LXRE in the mouse GLUT4 promoter. D, nuclear extracts (0.5 µg) isolated from COS-1 cells transfected with either RXR{alpha} or LXR{alpha} expression vectors form a strong specific complex with the GLUT4 LXRE only when these extracts are combined. E, nuclear extract (8 µg) isolated from differentiated (day 13) but not from undifferentiated 3T3-L1 cells (day 0) forms a specific complex with the human GLUT4 LXRE with similar molecular weight to the complex formed by in vitro translated RXR{alpha} and LXR{alpha} proteins. For all experiments, the competition was performed using unlabeled oligonucleotides (LXREs and LXRE-mut oligonucleotides) as competitors in 5-, 10-, or 25-fold molar excess.

 
Animal Experiments—All animal use was approved and registered by the Norwegian Animal Research authority and the regional ethical committee for animal experiments in Sweden. Male C57BL/6J mice, 10 weeks of age (25–30 g) (B & K Universal Ltd., Sollentuna, Sweden), LXR{alpha}-/-{beta}+/+, LXR{alpha}+/+{beta}-/-, LXR{alpha}-/-{beta}-/-, and wild-type (LXR{alpha}+/+{beta}+/+) control mice (7–9 weeks) were maintained in a temperature-controlled (22 °C) facility with a strict 12-h light/dark cycle and given free access to food and water. The generation of the LXR{alpha}-/-{beta}+/+ and LXR{alpha}+/+{beta}-/- mice has been described previously (45, 46). All transgenic mice used in this study, LXR{alpha}-/-{beta}+/+, LXR{alpha}+/+{beta}-/-, LXR{alpha}-/-{beta}-/-, and wild-type (LXR{alpha}+/+{beta}+/+) control mice, had mixed genetic backgrounds based on 129/Sv and C57BL/6J strains, backcrossed in C57BL/6J mice for three generations.

In the 24-h feeding experiment, mice were gavage-fed twice (24 and 8 h before the mice were sacrificed) using 50 mg/kg T0901317 or 1 mg/kg darglitazone in a vehicle containing 1% carboxymethyl-cellulose (Sigma). Control mice received vehicle only. In the experiments including insulin injections, the mice were first fed twice with T0901317 (30 mg/kg) as described above and then injected with PBS (as a control) or insulin as a single 0.2-unit injection (intraperitoneally) of Actrapid insulin (Novo Nordisk, Bagsværd, Denmark) 3 h before they were sacrificed. For the 1-week feeding experiment, the mice were fed orally once a day with darglitazone (1 mg/kg) or T0901317 (30 mg/kg). For all in vivo experiments, tissues were rapidly frozen in liquid nitrogen and stored at -70 °C until isolation of total RNA.

Quantitative RT-PCR Analysis—Total RNA was isolated using TRIZOL® Reagent (Invitrogen). DNA was removed from RNA preparations (DNA-free kit; Intermedica AB, Stockholm, Sweden), and first strand synthesis was performed using random primers with the Superscript first strand synthesis system for RT-PCR (Invitrogen). Quantitation of mRNA was performed with a quantitative, real time PCR approach using the ready-to-use assay SYBR green PCR core reagents kit based on the Taqman technology (Applied Biosystems, Stockholm, Sweden). The threshold cycles (Ct) for the GLUT4 and the 36B4 control signals were determined in triplicate experiments, and the relative RNA quantitation was calculated using the comparative Ct method, where {Delta}Ct is CtGLUT4 - Ct36B4. The {Delta}Ct values were used to calculate --{Delta}Ct. GLUT4 and 36B4 control were amplified with similar PCR efficiency using the following primers: GLUT4 fw, 5'-TCATTGTCGGCATGGGTTT-3; GLUT4 rev, 5'-CGGCAAATAGAAGGAAGACGTA-3'; 36B4 fw, 5'-GAGGAATCAGATGAGGATATGGGA-3'; and 36B4 rev, 5'-AAGCAGGCTGACTTGGTTGC-3'.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of GLUT4 during Differentiation of Fibroblasts into Adipocytes—In our previous studies on LXR{alpha} in adipocytes, we have noticed that the induction of this nuclear receptor is delayed during differentiation, although we and others have established this gene as directly regulated by PPAR{gamma} in mature adipocytes (18) and macrophages (47). Interestingly, the GLUT4 transcript has previously been described as a late adipocyte differentiation marker (i.e. induced later than the other characterized PPAR{gamma} target genes) and moreover to be regulated by PPAR{gamma} activators in mature adipocytes (37). Thus, GLUT4 was a proven candidate for further investigation.

To test whether the induction of GLUT4 and LXR{alpha} overlaps during adipocyte differentiation, we cultured mouse 3T3-L1 cells 2 days postconfluence and let them differentiate into adipocytes. Samples were withdrawn each day during the differentiation process (from day -1 until day 7). As described earlier, using this differentiation protocol (18), the PPAR{gamma} transcript was strongly induced from day 2 to 3 during differentiation (Fig. 1A), with an overlapping induction of a set of characterized PPAR{gamma} target genes (i.e. aFABP) (14). However, both the LXR{alpha} and GLUT4 transcripts were induced 1 day later, accompanied by induction of the LXR target gene SREBP-1, as demonstrated previously (18).



View larger version (62K):
[in this window]
[in a new window]
  		FIG. 1.
GLUT4 expression is induced during adipocyte differentiation and by LXR ligand activation in mature adipocytes. A, induction of genes during adipocyte differentiation of mouse 3T3-L1 cells. Day 0 represents 1 day postconfluence and the starting point of the differentiation program. At day 7, lipid droplets are clearly visible in the differentiated adipocytes. The membrane was probed with mGLUT4, h-LXR{alpha}, m-aFABP, and h-PPAR{gamma}. The ribosomal probe m-36B4 was used as an internal control. B, induction of genes during adipocyte differentiation of human SGBS cells. The membrane was probed with h-GLUT4, h-FAS, h-SREBP-1, h-LXR{alpha}, h-PPAR{gamma}, and m-36B4 (internal control). C, expression of GLUT4 mRNA after LXR ligand treatment of differentiated cells for 24 h. 3T3-L1 cells (day 13) and SGBS cells (day 17) were stimulated with 1 and 0.1 µM T0901317, respectively. D, relative expression of GLUT4 in 3T3-L1 and SGBS cells correlated against the 36B4 signal. Control = 1.

 
To test whether this induction sequence also occurred during human adipocyte differentiation, we examined the expression pattern of relevant genes during differentiation of a recently characterized human preadipocyte cell strain (43). This cell strain (termed SGBS) is derived from the stromal cell fraction of subcutaneous adipose tissue of an infant with Simpson-Golabi-Behmel syndrome. Although the biological mechanism behind the prolonged differentiation capacity is still unknown, SGBS adipocytes are morphologically, biochemically, and functionally identical to in vitro differentiated adipocytes from healthy subjects and are therefore an ideal human adipocyte in vitro model system. SGBS cells were grown confluent prior to exposure to adipogenic medium, and samples were withdrawn each day during the differentiation program (from day -1 until day 15) and used for Northern analysis. A low expression level of the PPAR{gamma} transcript was detected already at day -1, but a robust induction of the PPAR{gamma} transcript and the PPAR{gamma} target gene aFABP was observed later around day 3 to 4 (Fig. 1B and data not shown). The expression of LXR{alpha} was also induced at this time point, whereas the GLUT4 transcript was induced much later during the differentiation process. Weak GLUT4 mRNA signals could be detected on day 7, with a stronger induction around day 9. Interestingly, three different characterized LXR target genes, FAS (35), SREBP-1 (33, 34), and LXR{alpha} itself (48) were also induced further at this later time point.

Regulation of GLUT4 mRNA by LXR Activation in Vitro—To test whether activation of LXRs affects the expression of GLUT4 in mature adipocytes, mouse 3T3-L1 cells were differentiated for 13 days and stimulated with the synthetic LXR ligand T0901317 (1 µM) for 24 h, and samples were examined by Northern analysis. Exposure of differentiated 3T3-L1 cells to the LXR ligand induced the level of the GLUT4 mRNA transcript 2.3-fold (Fig. 1, C and D). To examine whether a similar regulation also applies to humans, differentiated SGBS cells were stimulated with T0901317 (0.1 µM) for 24 h. A 1.6-fold induction of GLUT4 expression was observed.

Characterization of the GLUT4 Promoter—To identify potential LXR response elements in the GLUT4 promoter, a previously described part of the human GLUT4 promoter was used as bait to identify a longer form of the GLUT4 promoter by BLAST against nr and htgs sequences at NCBI (accession numbers used and identified are listed under "Experimental Procedures"). The promoter sequence spanning 10,000 bp up- and downstream from the transcription start site was extracted and analyzed by a consensus LXRE (DGGTYA HWHW MGKKCA). By this method, several high score candidate LXREs were identified in the human promoter (Fig. 2A; only the most promising element in the cloned promoter is shown). We next extracted and performed the same analysis of the mouse GLUT4 promoter. Finally, we aligned the human and mouse promoters and identified one of the promising LXREs as evolutionarily conserved (Fig. 2, A and B). Interestingly, this element is located within a region previously determined to be very important for expression of the GLUT4 gene in adipose, skeletal, and heart tissues (49).



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 2.
Characterization of the human and mouse GLUT4 promoters. A, a schematic presentation of the cloned human GLUT4 promoter (nucleotides -2142 to +223) and the corresponding mouse GLUT4 promoter. The transcription start site is marked by +1. The nucleotide position of the black boxes points out the localization of the LXRE. B, sequence alignment and homology between the nucleotides surrounding the human and the mouse GLUT4 LXRE. The two halfsites in the conserved LXRE are encircled by boxes, and conserved nucleotides are indicated by vertical lines.

 
Transfection with the Human GLUT4 Promoter—To examine the validity of the particular LXRE found in the human GLUT4 promoter, we cloned this promoter (sequence spanning from -2142 to +223) and inserted it into the pGL3-basic reporter vector. Transient transfection of this luciferase reporter into COS-1 cells in combination with RXR{alpha} and LXR{alpha} expression vectors and treatment with the RXR ligand 9-cis-retinoic acid (9-cis-RA; 1 µM) and the LXR ligand T0901317 (1 µM), induced the reporter activity (Fig. 3A). A maximal 12-fold increase in reporter activity was observed following the addition of both receptor expression vectors and ligands. Furthermore, transfection experiments with increasing concentrations of T0901317 induced the reporter activity in a dose-dependent manner (Fig. 3B) with an estimated EC50 value well in agreement with previous reports (27).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 3.
Transfection with human GLUT4 promoter reporters shows LXRE dependence. A, transient transfection with the fulllength human GLUT4 luciferase reporter into COS-1 cells. The cells were co-transfected with {beta}-galactosidase expression vector (as an internal control) and RXR{alpha} and/or LXR{alpha} expression vectors as indicated. The medium was supplemented with vehicle (Me2SO; light gray), 9-cis-retinoic acid (9-cis-RA;1 µM; dark gray), T0901317 (1 µM; white), or both ligands (black). B, dose titration curve for T0901317 on the human GLUT4 promoter reporter. C, a schematic presentation of the deletion and the LXRE mutation construct made for the human GLUT4 promoter. The arrow points out the transcription start site. D, transient transfection of full-length, SmaI deletion and LXRE-mut GLUT4 reporters into COS-1 cells. Cells were co-transfected with no expression plasmid (light gray), LXR{alpha} expression plasmid (dark gray), and RXR{alpha} and LXR{alpha} expression plasmids (white and black) and stimulated with vehicle (light gray, dark gray, and white) or T0901317 (1 µM; black). E, reporters used in transfection of human SGBS cells. F, transient transfection of SGBS cells with full-length and LXRE-mut promoter reporters. The cells were incubated in medium containing vehicle (Me2SO; white) or T0901317 (1 µM; black) for 48 h. For all transfections, the result is representative of at least three individual experiments performed in triplicates. Results are given as mean ± S.D.

 
A deletion construct of the promoter lacking the LXRE (GLUT4-SmaI-del), and a full-length construct containing a mutated version of the LXRE (GLUT4-LXRE-mut) (Fig. 3C) were transfected into COS-1 cells in the presence of RXR{alpha} and LXR{alpha} expression vectors and the LXR ligand T0901317 (1 µM) as indicated. In both the GLUT4-SmaI-del and the LXRE-mut deletion reporters, the ability of the RXR{alpha}/LXR{alpha} heterodimer complex to induce transcription of the GLUT4 promoter was significantly reduced (Fig. 3D).

To test the functionality of the identified LXRE in a physiologically more relevant cell strain, SGBS cells were transiently transfected with full-length and LXRE-mut reporters (Fig. 3E) and stimulated with vehicle (Me2SO) or T0901317 (1 µM). As expected, only the wild type reporter responded to the LXR{alpha} agonist (Fig. 3F).

The Human and Mouse LXREs in the GLUT4 Promoter Bind LXR{alpha}—To demonstrate in vitro binding of LXR{alpha} to the identified LXRE, we performed an EMSA with double-stranded oligonucleotides containing the human and mouse LXREs (Fig. 4A, oligonucleotide sequences). A specific protein-DNA complex with the human (Fig. 4B) and mouse (Fig. 4C) GLUT4 LXREs was observed in the presence of in vitro translated RXR{alpha} and LXR{alpha} proteins. These complexes were specific, since the binding was eliminated by excess unlabeled wild type but not mutated oligonucleotides. Similarly, a strong specific binding was observed when nuclear extracts from COS-1 cells transfected with either RXR{alpha} or LXR{alpha} expression vectors were combined (Fig. 4D). A weaker band was observed when only nuclear extract from cells transfected with the LXR{alpha} expression vector was used, suggesting a complex formation between endogenously expressed RXR{alpha} and the exogenous LXR{alpha}. Nuclear extracts from differentiated, but not from undifferentiated, 3T3-L1 cells formed a complex with the GLUT4 LXRE, with identical molecular weight to the heterodimer complex formed by in vitro translated RXR{alpha} and LXR{alpha} proteins (Fig. 4E; only binding to the human element is shown). This suggests that the complex formed by endogenous proteins expressed in differentiated 3T3-L1 cells consists of a heterodimer complex formed by RXR{alpha} and LXR{alpha}.

GLUT4 Expression Is Induced in Vivo by Ligand Activation of LXRs—To examine the role of LXR activation on the expression of GLUT4 in vivo, male mice (10 weeks; 25–30 g) were fed twice (24 and 8 h before they were sacrificed) with the synthetic PPAR{gamma} activator darglitazone (1 mg/kg) and/or the synthetic LXR agonist T0901317 (50 mg/kg). RNA isolated from white adipose tissue (WAT) and skeletal muscle was examined by Northern analysis.

In epididymal WAT, the expression of GLUT4 was induced ~3-fold by T0901317 treatment and 4-fold by combined T0901317 and darglitazone treatment (Fig. 5, A and B). Interestingly, no effect on GLUT4 mRNA was observed by administration of darglitazone alone to these healthy animals, although the well characterized PPAR{gamma} target gene aFABP was up-regulated (data not shown). This result differs from previous observations in vitro, where transcription of GLUT4 in adipocytes was induced by ligands that activated PPAR{gamma} (37). However, since PPAR{gamma} also regulates the expression of LXR{alpha} (18, 42), it could be that this in vitro effect is secondarily mediated through increased LXR{alpha} expression and thus increased potential for activation through LXR{alpha}.

In muscle, only a minor, but statistically significant, 1.5- and 1.6-fold induction of GLUT4 transcript was observed following darglitazone and T0901317 treatment, respectively (Fig. 5, C and D).

Basal and Insulin Regulation of GLUT4 Expression Is Dependent on LXR{alpha}—We recently demonstrated that insulin regulation of several key lipogenic enzymes in liver is dependent on LXRs (36). Since glucose transported through GLUT4 supplies the adipose cell with substrate for fatty acid synthesis, we next investigated whether GLUT4 is regulated by insulin and whether this regulation is dependent on LXRs. Wild type, LXR{alpha}-/, LXR{beta}-/-, and LXR{alpha}-/-{beta}-/- mice were fed twice (24 and 8 h before they were sacrificed) with vehicle or T0901317 (30 mg/kg) and injected with PBS or insulin (0.2 units of Actrapid in PBS) 3 h before they were sacrificed. RNA isolated from epididymal WAT was examined by quantitative RT-PCR analysis.

In wild type mice, the expression of GLUT4 was unchanged by insulin injection alone (Fig. 6A). In contrast, the insulinresponsive transcription factor SREBP-1, was induced severalfold (data not shown), suggesting that GLUT4 is not normally transcriptionally regulated by insulin. Still, a synergistic induction of GLUT4 was observed with combined insulin and T0901317 treatment compared with T0901317 treatment alone. In both LXR{alpha}-/- and LXR{beta}-/- mice, the expression of GLUT4 was induced by T0901317 treatment (Fig. 6, B and C), with no additional effect of insulin injections. As expected, T0901317 treatment had no effect on GLUT4 expression in LXR{alpha}-/-{beta}-/- mice (Fig. 6D), demonstrating that regulation by the LXR activator is dependent on the presence of at least one LXR isoform. The basal GLUT4 expression was slightly lower in LXR{alpha}-/- mice compared with the other animal groups, and the slightly increased GLUT4 expression after insulin treatment was clearly absent in the LXR{alpha}-/- mice compared with the other animal groups (Fig. 6E). This indicates that the LXR{alpha} isoform, but not the LXR{beta} isoform, plays a unique role for basal and insulin-regulated expression of GLUT4 in epididymal WAT.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 6.
Insulin and LXR activators synergistically regulate GLUT4 expression in vivo. Mice were gavage-fed twice with either vehicle or T0901317 (30 mg/kg) prior to injection (intraperitoneally) of PBS or Actrapid (insulin; Ins) and killed 3 h after insulin/PBS injections. Epididymal WAT was rapidly taken out and used for quantitative RT-PCR analysis. The expression of GLUT4 was normalized against 36B4 to determine the relative GLUT4 expression. A, GLUT4 expression in wild-type controls; B, GLUT4 expression in LXR{alpha}-/-{beta}+/+ mice; C, GLUT4 expression in LXR{alpha}+/+{beta}-/- mice; D, GLUT4 expression in LXR{alpha}-/-{beta}-/- mice. Bars represent 2-{Delta}Ct values (see "Experimental Procedures") ± S.E. (n = 4–6). p values were determined by one-way analysis of variance (p < 0.05). Expression different from control is marked with an asterisk. Expression of GLUT4 after combined insulin and T0901317 treatment of wild type mice was significantly higher compared with identical treatment of the three other groups (a; p < 0.05). E, basal GLUT4 expression and expression after insulin stimulation was lower in LXR{alpha}-/-{beta}+/+ mice compared with the other groups (b; p < 0.01).

 
PPAR{gamma} Regulation of GLUT4 in WAT Is Only Visible in the Absence of LXRs—To test whether PPAR{gamma}-mediated regulation of GLUT4 expression is dependent on LXRs, wild type and LXR{alpha}-/-{beta}-/- mice were fed with darglitazone (1 mg/kg) or T0901317 (30 mg/kg) for 7 days, and subcutaneous WAT was examined by Northern analysis. In wild type mice, the GLUT4 expression was not altered by darglitazone treatment, whereas GLUT4 was induced 2-fold by darglitazone treatment in LXR{alpha}-/-{beta}-/- mice (Fig. 7A). A similar 2-fold stimulation with darglitazone treatment also occurred in epididymal WAT in LXR{alpha}-/-{beta}-/- mice (results not shown). In contrast, expression of the well characterized PPAR{gamma} target gene aFABP was increased ~2-fold by darglitazone treatment in both groups (Fig. 7B). The fact that PPAR{gamma} does not regulate GLUT4 expression in normal mice, although aFABP is regulated, argues against GLUT4 being a direct PPAR{gamma} target gene. Still, the PPAR{gamma} activator is able to regulate GLUT4 expression in the absence of LXRs, suggesting that ablation of the LXRs results in an altered phenotype with disruption of a mechanism that normally prevents PPAR{gamma} activation of the GLUT4 promoter in mice with normal insulin levels. Therefore, the LXR{alpha}-/-{beta}-/- mouse is not a suitable tool to determine whether the PPAR{gamma}-LXR{alpha} pathway is important for the PPAR{gamma} ligand-mediated regulation of adipose GLUT4 expression.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 7.
Prolonged treatment with a PPAR{gamma} activator induces adipose expression of GLUT4 in mice lacking LXRs. Wild-type controls (LXR{alpha}+/+{beta}+/+) and LXR{alpha}-/-{beta}-/- mice were gavage-fed with vehicle, darglitazone (Darg; 1 mg/kg), or T0901317 (30 mg/kg) for 7 days and killed 8 h after the last administration of ligands. Subcutaneous WAT was subjected to Northern blot analysis, and equal amounts of total RNA from each animal (n = 4–6) were pooled and applied as two individual samples on the Northern gel. The expression of GLUT4 was normalized against the 36B4 signal. A, relative expression of GLUT4. B, relative expression of aFABP. C, relative expression of SREBP-1.

 
Treatment with the LXR activator T0901317 for 7 days had no effect on subcutaneous GLUT4 expression in wild type mice (Fig. 6A). The induction of GLUT4 expression was also much lower in epididymal WAT after prolonged treatment compared with a shorter 24-h feeding period (Figs. 5 and 6 and data not shown). The LXR target gene SREBP-1 was only induced 2-fold in wild type mice, and, as expected, no regulation was observed in the LXR{alpha}-/-{beta}-/- mice (Fig. 7C). Thus, the initial induction of GLUT4 expression after 24-h activation of LXRs seems to be transient and is no longer observed after prolonged treatment with a potent LXR activator.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Both the reduced amount of GLUT4 in adipose tissue and reduced insulin-mediated recruitment of GLUT4 from intracellular vesicles to the plasma membrane are strongly associated with obesity and type 2 diabetes (4, 50). Accordingly, modulation of pathways involved in this dysregulation may improve insulin sensitivity and reduce the hyperglycemia in type 2 diabetes. In this study, we demonstrate that GLUT4 expression in adipose tissue, and to a lesser extent also in skeletal muscle, is increased by ligand activation of LXRs. We furthermore demonstrate that this regulation is directly mediated by binding of an RXR/LXR heterodimer complex to a conserved DR-4 type LXRE in the GLUT4 promoter. Despite the fact that both LXRs are able to mediate ligand-activated transcription of the GLUT4 gene in vivo, several observations suggest that LXR{alpha} plays a unique role in the basal regulation of adipose GLUT4 expression. Adipose-specific activation of LXR{alpha} might therefore represent a novel tool for increasing insulin-stimulated glucose uptake.

We have recently demonstrated that activation of LXRs increases TG accumulation in adipocytes (18), presumably by direct regulation of lipogenic genes as SREBP-1c (33, 34) and FAS (35). That fits with the finding that LXRs also regulate GLUT4, since increased glucose uptake through GLUT4 increases the substrate availability for TG synthesis. We found that the GLUT4 transcript was absent prior to expression of LXR{alpha} during both mouse and human adipocyte differentiation, suggesting that LXR{alpha} expression is important for the expression of GLUT4 (Fig. 1). Still, adipose expression of GLUT4 is not dependent on LXR{alpha}, since GLUT4 is expressed also in LXR{alpha}-/-{beta}+/+ and LXR{alpha}-/-{beta}-/- mice (Figs. 6 and 7). Rather, it seems that LXR{alpha} functions to increase the basal transcription level of the GLUT4 gene. This transcription is mediated through a typical DR-4 type LXRE, with similar nucleotide sequence and distance from the transcription start site as those found in the FAS and SREBP-1 promoters (33–35). This and the fact that the GLUT4 LXRE is located within a region that is highly conserved between human and mouse GLUT4 promoters (Fig. 2) suggest that regulation through this element is important. Transfection experiments in COS-1 cells and human SGBS adipocytes indeed demonstrate that this element is functional and necessary for LXRs to be able to activate the GLUT4 promoter (Fig. 3). The GLUT4 LXRE also specifically recruits the RXR/LXR heterodimer, as determined by in vitro binding experiments (Fig. 4). The induced GLUT4 expression observed after stimulation with a potent LXR activator, both in vitro in mouse and human adipocytes (Fig. 1) and in whole animals (Figs. 5 and 7), is therefore likely to be mediated through this particular LXRE. Thus, these analyses establish GLUT4 as a novel direct LXR target gene.

We recently demonstrated that insulin regulation of several important lipogenic enzymes in liver is dependent on LXRs, since insulin regulation of several of these genes was impaired in the LXR{alpha}-/-{beta}-/- mice (36). The experiment performed here does not indicate that insulin stimulation alone regulates GLUT4 expression at the transcriptional level in normal mice (Fig. 7A). However, after activation of the LXRs with a potent LXR activator, GLUT4 expression was synergistically induced by insulin. This regulation was abolished in both single knockout mice, but in the absence of both LXRs, GLUT4 transcription was unexpectedly also increased by insulin alone (Fig. 7D). Since the LXR{alpha}-/-{beta}-/- mice, in contrast to wild type mice, also responded to the insulin-sensitizing PPAR{gamma} activator after 1 week of treatment (Fig. 7), the insulin sensitivity of the adipose tissue is apparently altered in the LXR{alpha}-/-{beta}-/- mice. It is therefore difficult to evaluate whether GLUT4 expression is stimulated by insulin. On the other hand, the different effects obtained by removal of the LXRs, suggest a complex regulation of GLUT4 expression, where factors such as insulin, LXRs, and PPAR{gamma} seem to be able to compensate for each other.

Despite the fact that both LXR isoforms generally are believed to compensate for each other and activate transcription of the same set of LXR target genes, the results from the use of single knock-out mice in this study suggest that there are distinct differences between the LXR{alpha} and LXR{beta} isoforms regarding GLUT4 expression. LXR{beta} apparently binds to the GLUT4 promoter and modulates transcription of the GLUT4 gene in the presence of a potent LXR activator (Fig. 6). However, LXR{beta} is not able to rescue the lower basal expression of GLUT4 seen in epididymal WAT in the absence of LXR{alpha}. During adipocyte differentiation, neither GLUT4 nor the LXR target genes SREBP-1 and FAS are induced before the expression of LXR{alpha} is turned on, whereas LXR{beta} is expressed also in undifferentiated fibroblast like cells (Fig. 1 and Ref. 18). Furthermore, only nuclear extracts from differentiated 3T3-L1 cells, where both RXR{alpha} and LXR{alpha} are expressed, are able to form a complex with the GLUT4 LXRE. Similar specific requirement for the LXR{alpha} isoform has also been demonstrated for induction of the rodent cholesterol-7{alpha} hydroxylase gene in liver (32, 45). However, since LXR{beta} fails to activate the LXRE in the murine cholesterol-7{alpha} hydroxylase promoter (26), the selective effects of the LXR isoforms on the cholesterol-7{alpha} hydroxylase promoter are different from what we observe for the basal regulation of the GLUT4 promoter in epididymal WAT.

After 1 week of LXR ligand feeding to wild type mice, GLUT4 expression in either epididymal or subcutaneous WAT was not different from control feed animals (Fig. 7 and results not shown). This suggests that a mechanism exists that prevents prolonged induction of GLUT4 through LXR activation. A similar regulation has also recently been demonstrated for lipogenic genes as FAS and SREBP-1 in liver, which decline to almost normal expression levels after prolonged treatment with LXR activators (35). Interestingly, the expression of LXR{alpha} and SREBP-1 is similarly regulated during prolonged treatment with the LXR activator in adipose tissue,2 directly linking the expression level of LXR{alpha} to the induction level of GLUT4 and SREBP-1 in adipose tissue. Along with our observation of a reduced basal expression of GLUT4 in LXR{alpha}-/- mice, but not in LXR{alpha}-/-{beta}-/- mice, LXR{beta} might prevent prolonged LXR{alpha}-mediated activation, perhaps by binding to and occupying the LXRE elements in the promoter region of LXR{alpha} target genes.

The expression of GLUT4 is reduced in rodent models of insulin deficiency (4, 5) and in adipose tissue of human obese or type 2 diabetic subjects (6, 7), directly linking adipose expression of GLUT4 to insulin resistance. We have previously demonstrated that LXR{alpha} also is down-regulated under such conditions (18), thus revealing a striking correlation between GLUT4 and LXR{alpha} expression in insulin-resistant conditions. Treatment with anti-diabetic TZDs, which are thought to mediate their effect as high affinity ligands for PPAR{gamma} (17), furthermore normalizes the reduced adipose expression of both GLUT4 (38, 39) and LXR{alpha} (18). Since LXR{alpha} is a downstream target gene for PPAR{gamma} (18, 47), the beneficial normalization of GLUT4 expression by TZD treatment might therefore actually be mediated through increased expression and activation of LXR{alpha}. Unfortunately, the altered phenotype obtained by the removal of LXRs makes it difficult to prove this experimentally with the knock-out mice. However, we found no regulation of GLUT4 in subcutaneous WAT after 1 week of treatment with darglitazone, a potent TZD, although the well characterized PPAR{gamma} target gene, aFABP, was induced (Fig. 6). This argues against the notion that GLUT4 is a typical direct PPAR{gamma} target gene and rather suggests that the TZDs modulates GLUT4 expression through a secondary mechanism. For the moment it is unclear whether this regulation mechanism is mediated exclusively through LXRs or whether PPAR{gamma} also regulates GLUT4 expression through another uncharacterized mechanism.

In view of these considerations, LXR{alpha} is an interesting target for a new generation of antidiabetic drugs. Unfortunately, administration of currently available LXR activators increases plasma and liver TG levels in normal as well as diabetic animals, with complications such as hypertriglyceridemia and liver steatosis (27, 41). Nevertheless, our analysis suggests that specific activation of LXR{alpha} selectively in adipose tissue could be a complement or replacement to currently available treatment modalities for reduction of hyperinsulinemia and hyperglycemia in type 2 diabetic subjects.


   FOOTNOTES
 
* This work was funded by grants from University of Oslo, Medical Faculty, AstraZeneca, the Johan Throne Holst Foundation, the Norwegian Council for Cancer Research, the Novo Nordisk Foundation, the Norwegian Research Council, Nordic Academy for advanced study, KaroBio AB, and the Swedish Science Council. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| To whom correspondence should be addressed: Institute for Nutrition Research, University of Oslo, P.O. Box 1046, Blindern, N-0316 Oslo, Norway. Tel.: 47-22851510; Fax: 47-22851398; E-mail: h.i.nebb{at}basalmed.uio.no.

1 The abbreviations used are: PPAR{gamma}, peroxisome proliferator-activated receptor {gamma}; aFABP, adipose type fatty acid-binding protein; TZD, thiazolidinedione; LXR, liver X receptor; TG, triglyceride; RXR, retinoic X receptor; LXRE, LXR response element; SREBP-1c, sterol regulatory element-binding protein 1c; FAS, fatty acid synthase; EMSA, electromagnetic mobility shift assay; WAT, white adipose tissue. Back

2 S. M. Ulven, K. T. Dalen, J.-Å. Gustafsson, and H. I. Nebb, unpublished results. Back


   ACKNOWLEDGMENTS
 
We are very grateful to Dr. Martin Wabitsch (University of Ulm) for providing the SGBS cell strain and Simonetta Westerlund and Ann-Kristin Lidberg for help with RT-PCR analysis.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Suzuki, K., and Kono, T. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 2542-2545[Abstract/Free Full Text]
  2. Simpson, F., Whitehead, J. P., and James, D. E. (2001) Traffic 2, 2-11[CrossRef][Medline] [Order article via Infotrieve]
  3. Kaestner, K. H., Christy, R. J., McLenithan, J. C., Braiterman, L. T., Cornelius, P., Pekala, P. H., and Lane, M. D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3150-3154[Abstract/Free Full Text]
  4. Berger, J., Biswas, C., Vicario, P. P., Strout, H. V., Saperstein, R., and Pilch, P. F. (1989) Nature 340, 70-72[CrossRef][Medline] [Order article via Infotrieve]
  5. Garvey, W. T., Huecksteadt, T. P., and Birnbaum, M. J. (1989) Science 245, 60-63[Abstract/Free Full Text]
  6. Garvey, W. T., Maianu, L., Huecksteadt, T. P., Birnbaum, M. J., Molina, J. M., and Ciaraldi, T. P. (1991) J. Clin. Invest. 87, 1072-1081[Medline] [Order article via Infotrieve]
  7. Garvey, W. T., Maianu, L., Hancock, J. A., Golichowski, A. M., and Baron, A. (1992) Diabetes 41, 465-475[Abstract]
  8. Abel, E. D., Peroni, O., Kim, J. K., Kim, Y. B., Boss, O., Hadro, E., Minnemann, T., Shulman, G. I., and Kahn, B. B. (2001) Nature 409, 729-733[CrossRef][Medline] [Order article via Infotrieve]
  9. Shepherd, P. R., Gnudi, L., Tozzo, E., Yang, H., Leach, F., and Kahn, B. B. (1993) J. Biol. Chem. 268, 22243-22246[Abstract/Free Full Text]
  10. Smith, U. (2002) Int. J. Obes. Relat. Metab. Disord. 26, 897-904[CrossRef][Medline] [Order article via Infotrieve]
  11. Rosen, E. D., Sarraf, P., Troy, A. E., Bradwin, G., Moore, K., Milstone, D. S., Spiegelman, B. M., and Mortensen, R. M. (1999) Mol. Cell 4, 611-617[CrossRef][Medline] [Order article via Infotrieve]
  12. Auwerx, J. (1999) Diabetologia 42, 1033-1049[CrossRef][Medline] [Order article via Infotrieve]
  13. Berger, J., and Moller, D. E. (2002) Annu. Rev. Med. 53, 409-435[CrossRef][Medline] [Order article via Infotrieve]
  14. Tontonoz, P., Hu, E., Graves, R. A., Budavari, A. I., and Spiegelman, B. M. (1994) Genes Dev. 8, 1224-1234[Abstract/Free Full Text]
  15. Xu, H. E., Lambert, M. H., Montana, V. G., Parks, D. J., Blanchard, S. G., Brown, P. J., Sternbach, D. D., Lehmann, J. M., Wisely, G. B., Willson, T. M., Kliewer, S. A., and Milburn, M. V. (1999) Mol. Cell 3, 397-403[CrossRef][Medline] [Order article via Infotrieve]
  16. Forman, B. M., Tontonoz, P., Chen, J., Brun, R. P., Spiegelman, B. M., and Evans, R. M. (1995) Cell 83, 803-812[CrossRef][Medline] [Order article via Infotrieve]
  17. Lehmann, J. M., Moore, L. B., Smith-Oliver, T. A., Wilkison, W. O., Willson, T. M., and Kliewer, S. A. (1995) J. Biol. Chem. 270, 12953-12956[Abstract/Free Full Text]
  18. Juvet, L. K., Andresen, S. M., Schuster, G. U., Dalen, K. T., Tobin, K. A., Hollung, K., Haugen, F., Jacinto, S., Ulven, S. M., Bamberg, K., Gustafsson, J.-Å., and Nebb, H. I. (2003) Mol. Endocrinol. 17, 172-182[Abstract/Free Full Text]
  19. Apfel, R., Benbrook, D., Lernhardt, E., Ortiz, M. A., Salbert, G., and Pfahl, M. (1994) Mol. Cell. Biol. 14, 7025-7035[Abstract/Free Full Text]
  20. Willy, P. J., Umesono, K., Ong, E. S., Evans, R. M., Heyman, R. A., and Mangelsdorf, D. J. (1995) Genes Dev. 9, 1033-1045[Abstract/Free Full Text]
  21. Song, C., Kokontis, J. M., Hiipakka, R. A., and Liao, S. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10809-10813[Abstract/Free Full Text]
  22. Teboul, M., Enmark, E., Li, Q., Wikstrom, A. C., Pelto-Huikko, M., and Gustafsson, J.-Å. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 2096-2100[Abstract/Free Full Text]
  23. Willy, P. J., and Mangelsdorf, D. J. (1997) Genes Dev. 11, 289-298[Abstract/Free Full Text]
  24. Auboeuf, D., Rieusset, J., Fajas, L., Vallier, P., Frering, V., Riou, J. P., Staels, B., Auwerx, J., Laville, M., and Vidal, H. (1997) Diabetes 46, 1319-1327[Abstract]
  25. Janowski, B. A., Willy, P. J., Devi, T. R., Falck, J. R., and Mangelsdorf, D. J. (1996) Nature 383, 728-731[CrossRef][Medline] [Order article via Infotrieve]
  26. Lehmann, J. M., Kliewer, S. A., Moore, L. B., Smith-Oliver, T. A., Oliver, B. B., Su, J. L., Sundseth, S. S., Winegar, D. A., Blanchard, D. E., Spencer, T. A., and Willson, T. M. (1997) J. Biol. Chem. 272, 3137-3140[Abstract/Free Full Text]
  27. Schultz, J. R., Tu, H., Luk, A., Repa, J. J., Medina, J. C., Li, L., Schwendner, S., Wang, S., Thoolen, M., Mangelsdorf, D. J., Lustig, K. D., and Shan, B. (2000) Genes Dev. 14, 2831-2838[Abstract/Free Full Text]
  28. Repa, J. J., Turley, S. D., Lobaccaro, J. A., Medina, J., Li, L., Lustig, K., Shan, B., Heyman, R. A., Dietschy, J. M., and Mangelsdorf, D. J. (2000) Science 289, 1524-1529[Abstract/Free Full Text]
  29. Venkateswaran, A., Repa, J. J., Lobaccaro, J. M., Bronson, A., Mangelsdorf, D. J., and Edwards, P. A. (2000) J. Biol. Chem. 275, 14700-14707[Abstract/Free Full Text]
  30. Luo, Y., and Tall, A. R. (2000) J. Clin. Invest. 105, 513-520[Medline] [Order article via Infotrieve]
  31. Laffitte, B. A., Repa, J. J., Joseph, S. B., Wilpitz, D. C., Kast, H. R., Mangelsdorf, D. J., and Tontonoz, P. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 507-512[Abstract/Free Full Text]
  32. Peet, D. J., Turley, S. D., Ma, W., Janowski, B. A., Lobaccaro, J. M., Hammer, R. E., and Mangelsdorf, D. J. (1998) Cell 93, 693-704[CrossRef][Medline] [Order article via Infotrieve]
  33. Repa, J. J., Liang, G., Ou, J., Bashmakov, Y., Lobaccaro, J. M., Shimomura, I., Shan, B., Brown, M. S., Goldstein, J. L., and Mangelsdorf, D. J. (2000) Genes Dev. 14, 2819-2830[Abstract/Free Full Text]
  34. Yoshikawa, T., Shimano, H., Amemiya-Kudo, M., Yahagi, N., Hasty, A. H., Matsuzaka, T., Okazaki, H., Tamura, Y., Iizuka, Y., Ohashi, K., Osuga, J., Harada, K., Gotoda, T., Kimura, S., Ishibashi, S., and Yamada, N. (2001) Mol. Cell. Biol. 21, 2991-3000[Abstract/Free Full Text]
  35. Joseph, S. B., Laffitte, B. A., Patel, P. H., Watson, M. A., Matsukuma, K. E., Walczak, R., Collins, J. L., Osborne, T. F., and Tontonoz, P. (2002) J. Biol. Chem. 277, 11019-11025[Abstract/Free Full Text]
  36. Tobin, K. A., Ulven, S. M., Schuster, G. U., Steineger, H. H., Andresen, S. M., Gustafsson, J.-Å., and Nebb, H. I. (2002) J. Biol. Chem. 277, 10691-10697[Abstract/Free Full Text]
  37. Wu, Z., Xie, Y., Morrison, R. F., Bucher, N. L., and Farmer, S. R. (1998) J. Clin. Invest. 101, 22-32[Medline] [Order article via Infotrieve]
  38. Hofmann, C., Lorenz, K., and Colca, J. R. (1991) Endocrinology 129, 1915-1925[Abstract/Free Full Text]
  39. Young, P. W., Cawthorne, M. A., Coyle, P. J., Holder, J. C., Holman, G. D., Kozka, I. J., Kirkham, D. M., Lister, C. A., and Smith, S. A. (1995) Diabetes 44, 1087-1092[Abstract]
  40. Ross, S. E., Erickson, R. L., Gerin, I., DeRose, P. M., Bajnok, L., Longo, K. A., Misek, D. E., Kuick, R., Hanash, S. M., Atkins, K. B., Andresen, S. M., Nebb, H. I., Madsen, L., Kristiansen, K., and MacDougald, O. A. (2002) Mol. Cell. Biol. 22, 5989-5999[Abstract/Free Full Text]
  41. Cao, G., Liang, Y., Broderick, C. L., Oldham, B. A., Beyer, T. P., Schmidt, R. J., Zhang, Y., Stayrook, K. R., Suen, C., Otto, K. A., Miller, A. R., Dai, J., Foxworthy, P., Gao, H., Ryan, T. P., Jiang, X. C., Burris, T. P., Eacho, P. I., and Etgen, G. J. (2003) J. Biol. Chem. 278, 1131-1136[Abstract/Free Full Text]
  42. Tobin, K. A., Steineger, H. H., Alberti, S., Spydevold, O., Auwerx, J., Gustafsson, J.-Å., and Nebb, H. I. (2000) Mol. Endocrinol. 14, 741-752[Abstract/Free Full Text]
  43. Wabitsch, M., Brenner, R. E., Melzner, I., Braun, M., Moller, P., Heinze, E., Debatin, K. M., and Hauner, H. (2001) Int. J. Obes. Relat. Metab. Disord. 25, 8-15[CrossRef][Medline] [Order article via Infotrieve]
  44. Caruccio, L., and Banerjee, R. (1999) J. Immunol. Methods 230, 1-10[CrossRef][Medline] [Order article via Infotrieve]
  45. Alberti, S., Schuster, G., Parini, P., Feltkamp, D., Diczfalusy, U., Rudling, M., Angelin, B., Bjorkhem, I., Pettersson, S., and Gustafsson, J.-Å. (2001) J. Clin. Invest. 107, 565-573[Medline] [Order article via Infotrieve]
  46. Schuster, G. U., Parini, P., Wang, L., Alberti, S., Steffensen, K. R., Hansson, G. K., Angelin, B., and Gustafsson, J.-Å. (2002) Circulation 106, 1147-1153[Abstract/Free Full Text]
  47. Chawla, A., Boisvert, W. A., Lee, C. H., Laffitte, B. A., Barak, Y., Joseph, S. B., Liao, D., Nagy, L., Edwards, P. A., Curtiss, L. K., Evans, R. M., and Tontonoz, P. (2001) Mol. Cell 7, 161-171[CrossRef][Medline] [Order article via Infotrieve]
  48. Laffitte, B. A., Joseph, S. B., Walczak, R., Pei, L., Wilpitz, D. C., Collins, J. L., and Tontonoz, P. (2001) Mol. Cell. Biol. 21, 7558-7568[Abstract/Free Full Text]
  49. Charron, M. J., Katz, E. B., and Olson, A. L. (1999) J. Biol. Chem. 274, 3253-3256[Free Full Text]
  50. Ciaraldi, T., and Henry, R. R. (1997) Eur. J. Endocrinol. 137, 610-612[CrossRef][Medline] [Order article via Infotrieve]
  51. Rozen, S., and Skaletsky, H. J. (2000) in Bioinformatics Methods and Protocols: Methods in Molecular Biology (Krawetz, S., and Misener, S., eds) pp. 365-386, Humana Press, Totowa, NJ

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
T.-H. Kim, H. Kim, J.-M. Park, S.-S. Im, J.-S. Bae, M.-Y. Kim, H.-G. Yoon, J.-Y. Cha, K.-S. Kim, and Y.-H. Ahn
Interrelationship between Liver X Receptor {alpha}, Sterol Regulatory Element-binding Protein-1c, Peroxisome Proliferator-activated Receptor {gamma}, and Small Heterodimer Partner in the Transcriptional Regulation of Glucokinase Gene Expression in Liver
J. Biol. Chem., May 29, 2009; 284(22): 15071 - 15083.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
Y. Wei, S. Puzhko, M. Wabitsch, and C. G. Goodyer
Structure and Activity of the Human Growth Hormone Receptor (hGHR) Gene V2 Promoter
Mol. Endocrinol., March 1, 2009; 23(3): 360 - 372.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
C. Gabbi, M. Warner, and J.-A. Gustafsson
Minireview: Liver X Receptor {beta}: Emerging Roles in Physiology and Diseases
Mol. Endocrinol., February 1, 2009; 23(2): 129 - 136.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Madsen, R. K. Petersen, K. R. Steffensen, L. M. Pedersen, P. Hallenborg, T. Ma, L. Froyland, S. O. Doskeland, J.-A. Gustafsson, and K. Kristiansen
Activation of Liver X Receptors Prevents Statin-induced Death of 3T3-L1 Preadipocytes
J. Biol. Chem., August 15, 2008; 283(33): 22723 - 22736.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
S. Lee, J. Lee, S.-K. Lee, and J. W. Lee
Activating Signal Cointegrator-2 Is an Essential Adaptor to Recruit Histone H3 Lysine 4 Methyltransferases MLL3 and MLL4 to the Liver X Receptors
Mol. Endocrinol., June 1, 2008; 22(6): 1312 - 1319.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
H. Wang, Y. Zhang, E. Yehuda-Shnaidman, A. V. Medvedev, N. Kumar, K. W. Daniel, J. Robidoux, M. P. Czech, D. J. Mangelsdorf, and S. Collins
Liver X Receptor {alpha} Is a Transcriptional Repressor of the Uncoupling Protein 1 Gene and the Brown Fat Phenotype
Mol. Cell. Biol., April 1, 2008; 28(7): 2187 - 2200.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. Smoak, J. Madenspacher, S. Jeyaseelan, B. Williams, D. Dixon, K. R. Poch, J. A. Nick, G. S. Worthen, and M. B. Fessler
Effects of Liver X Receptor Agonist Treatment on Pulmonary Inflammation and Host Defense
J. Immunol., March 1, 2008; 180(5): 3305 - 3312.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
B. Herzog, M. Hallberg, A. Seth, A. Woods, R. White, and M. G. Parker
The Nuclear Receptor Cofactor, Receptor-Interacting Protein 140, Is Required for the Regulation of Hepatic Lipid and Glucose Metabolism by Liver X Receptor
Mol. Endocrinol., November 1, 2007; 21(11): 2687 - 2697.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. Nilsson, K. Dahlman-Wright, C. Karelmo, J.-A. Gustafsson, and K. R. Steffensen
Elk1 and SRF transcription factors convey basal transcription and mediate glucose response via their binding sites in the human LXRB gene promoter
Nucleic Acids Res., July 10, 2007; (2007) gkm492v1.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
P. Gupta, S. W. Park, M. Farooqui, and L.-N. Wei
Orphan nuclear receptor TR2, a mediator of preadipocyte proliferation, is differentially regulated by RA through exchange of coactivator PCAF with corepressor RIP140 on a platform molecule GRIP1
Nucleic Acids Res., April 1, 2007; 35(7): 2269 - 2282.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
F. Moloney, S. Toomey, E. Noone, A. Nugent, B. Allan, C. E. Loscher, and H. M. Roche
Antidiabetic Effects of cis-9, trans-11-Conjugated Linoleic Acid May Be Mediated via Anti-Inflammatory Effects in White Adipose Tissue
Diabetes, March 1, 2007; 56(3): 574 - 582.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer
International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor
Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
C. Knauf, J. Rieusset, M. Foretz, P. D. Cani, M. Uldry, M. Hosokawa, E. Martinez, M. Bringart, A. Waget, S. Kersten, et al.
Peroxisome Proliferator-Activated Receptor-{alpha}-Null Mice Have Increased White Adipose Tissue Glucose Utilization, GLUT4, and Fat Mass: Role in Liver and Brain
Endocrinology, September 1, 2006; 147(9): 4067 - 4078.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
H. Zitzer, W. Wente, M. B. Brenner, S. Sewing, K. Buschard, J. Gromada, and A. M. Efanov
Sterol Regulatory Element-Binding Protein 1 Mediates Liver X Receptor-{beta}-Induced Increases in Insulin Secretion and Insulin Messenger Ribonucleic Acid Levels
Endocrinology, August 1, 2006; 147(8): 3898 - 3905.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
K. T. Dalen, S. M. Ulven, B. M. Arntsen, K. Solaas, and H. I. Nebb
PPAR{alpha} activators and fasting induce the expression of adipose differentiation-related protein in liver
J. Lipid Res., May 1, 2006; 47(5): 931 - 943.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
K. A. R. Tobin, N. K. Harsem, K. T. Dalen, A. C. Staff, H. I. Nebb, and A. K. Duttaroy
Regulation of ADRP expression by long-chain polyunsaturated fatty acids in BeWo cells, a human placental choriocarcinoma cell line
J. Lipid Res., April 1, 2006; 47(4): 815 - 823.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
B. Desvergne, L. Michalik, and W. Wahli
Transcriptional Regulation of Metabolism
Physiol Rev, April 1, 2006; 86(2): 465 - 514.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
I. Gerin, V. W. Dolinsky, J. G. Shackman, R. T. Kennedy, S.-H. Chiang, C. F. Burant, K. R. Steffensen, J.-A. Gustafsson, and O. A. MacDougald
LXR{beta} Is Required for Adipocyte Growth, Glucose Homeostasis, and {beta} Cell Function
J. Biol. Chem., June 17, 2005; 280(24): 23024 - 23031.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
E. T. Kase, A. J. Wensaas, V. Aas, K. Hojlund, K. Levin, G. H. Thoresen, H. Beck-Nielsen, A. C. Rustan, and M. Gaster
Skeletal Muscle Lipid Accumulation in Type 2 Diabetes May Involve the Liver X Receptor Pathway
Diabetes, April 1, 2005; 54(4): 1108 - 1115.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
F. Haugen, N. Zahid, K. T. Dalen, K. Hollung, H. I. Nebb, and C. A. Drevon
Resistin expression in 3T3-L1 adipocytes is reduced by arachidonic acid
J. Lipid Res., January 1, 2005; 46(1): 143 - 153.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
K. R Steffensen, S. Y. Neo, T. M Stulnig, V. B Vega, S. S Rahman, G. U Schuster, J.-A. Gustafsson, and E. T Liu
Genome-wide expression profiling; a panel of mouse tissues discloses novel biological functions of liver X receptors in adrenals
J. Mol. Endocrinol., December 1, 2004; 33(3): 609 - 622.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Yue, N. Rasouli, G. Ranganathan, P. A. Kern, and T. Mazzone
Divergent Effects of Peroxisome Proliferator-activated Receptor {gamma} Agonists and Tumor Necrosis Factor {alpha} on Adipocyte ApoE Expression
J. Biol. Chem., November 12, 2004; 279(46): 47626 - 47632.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
S. M. Ulven, K. T. Dalen, J.-A. Gustafsson, and H. I. Nebb
Tissue-specific autoregulation of the LXR{alpha} gene facilitates induction of apoE in mouse adipose tissue
J. Lipid Res., November 1, 2004; 45(11): 2052 - 2062.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
C. G. Bell, M. Benzinou, A. Siddiq, C. Lecoeur, C. Dina, A. Lemainque, K. Clement, A. Basdevant, B. Guy-Grand, C. A. Mein, et al.
Genome-wide Linkage Analysis for Severe Obesity in French Caucasians Finds Significant Susceptibility Locus on Chromosome 19q
Diabetes, July 1, 2004; 53(7): 1857 - 1865.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
K. T. Dalen, K. Schoonjans, S. M. Ulven, M. S. Weedon-Fekjaer, T. G. Bentzen, H. Koutnikova, J. Auwerx, and H. I. Nebb
Adipose Tissue Expression of the Lipid Droplet-Associating Proteins S3-12 and Perilipin Is Controlled by Peroxisome Proliferator-Activated Receptor-{gamma}
Diabetes, May 1, 2004; 53(5): 1243 - 1252.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/48/48283    most recent
M302287200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dalen, K. T.
Right arrow Articles by Nebb, H. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dalen, K. T.
Right arrow Articles by Nebb, H. I.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement