HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 278, Issue 49, 48720-48726, December 5, 2003

This Article Abstract Full Text (PDF) All Versions of this Article: 278/49/48720    most recent M306745200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Allaman-Pillet, N. Articles by Bonny, C. Search for Related Content PubMed PubMed Citation Articles by Allaman-Pillet, N. Articles by Bonny, C. Social Bookmarking                      What's this?

Calcium- and Proteasome-dependent Degradation of the JNK Scaffold Protein Islet-brain 1^*

Nathalie Allaman-Pillet, Joachim Størling¶, Anne Oberson, Raphael Roduit, Stéphanie Negri, Christelle Sauser, Pascal Nicod||, Jacques S. Beckmann, Daniel F. Schorderet, Thomas Mandrup-Poulsen¶**, and Christophe Bonny

From the Division of Medical Genetics and Unit of Molecular Genetics, ^||Department of Internal Medicine, Centre Hospitalier Universitaire Vaudois, CH-1011 Lausanne, Switzerland, ^¶Steno Diabetes Center, DK-2820 Gentofte, Denmark, and ^**Department of Molecular Medicine, Karolinska Institute, SE-171 77 Stockholm, Sweden

Received for publication, June 25, 2003 , and in revised form, September 12, 2003.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
In models of type 1 diabetes, cytokines induce pancreatic -cell death by apoptosis. This process seems to be facilitated by a reduction in the amount of the islet-brain 1/JNK interacting protein 1 (IB1/JIP1), a JNK-scaffold with an anti-apoptotic effect. A point mutation S59N at the N terminus of the scaffold, which segregates in diabetic patients, has the functional consequence of sensitizing cells to apoptotic stimuli. Neither the mechanisms leading to IB1/JIP1 down-regulation by cytokines nor the mechanisms leading to the decreased capacity of the S59N mutation to protect cells from apoptosis are understood. Here, we show that IB1/JIP1 stability is modulated by intracellular calcium. The effect of calcium depends upon JNK activation, which primes the scaffold for ubiquitination-mediated degradation via the proteasome machinery. Furthermore, we observe that the S59N mutation decreases IB1/JIP1 stability by sensitizing IB1/JIP1 to calcium- and proteasome-dependent degradation. These data indicate that calcium influx initiated by cytokines mediates ubiquitination and degradation of IB1/JIP1 and may, therefore, provide a link between calcium influx and JNK-mediated apoptosis in pancreatic -cells.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Type 1 diabetes mellitus is characterized by the selective destruction of pancreatic -cells with preservation of the -cells (glucagon-secreting), -cells (somatostatin-secreting) and pp-cells (pancreatic polypeptide secreting) (1). Accumulating evidence has implicated cytokines as key mediators of -cell killing in rodent models of type 1 diabetes mellitus (2–5) and in human islet preparation (6) by apoptosis. The intra-islet release of IL-1,¹ tumor necrosis factor-, and IFN by activated mononuclear cells recruits into -cells a highly complex network of signaling and effector molecules that have a decisive impact on cell fate. Among the demonstrated signaling molecules that transduce cytokine signaling in cultured -cells, the transcription factor NF-B and the mitogen activated protein kinase c-jun N-terminal kinase (JNK) play a major role in the induction of apoptosis (7–11). Recently it was shown that glucose-induced human -cell apoptosis is blocked by IL-1 receptor antagonist and that the source of IL-1 is the -cell itself, indicating that immunological and metabolic stimuli converge on common effector pathways leading to -cell failure in both main types of diabetes (12).

In -cells, JNK is responsive to cytokines probably through a transduction complex including the upstream mitogen activated protein kinase kinase kinase and mitogen activated protein kinase kinase elements (13). The scaffold protein IB1/JIP1 ensures the formation, compartmentalization, and specificity of this physically ordered signaling module, so that a defined pool of JNK might be recruited by specific physiological stimuli (such as cytokines) but protected from activation by irrelevant ones (14). At the same time, IB1/JIP1 exerts an anti-apoptotic function probably by controlling the access of the activated JNKs to their downstream targets (13). This might be achieved by retaining JNK in specific subcellular localizations (mainly cytoplasmic) and preventing its access to some of its substrates, e.g. the nuclear transcription factor c-Jun or activating transcription factor-2. Indeed, the binding of IB1/JIP1 to JNK through the JNK-binding domain, a domain shared by many other substrates such as IRS-1 or c-Jun (15), is 100 times stronger than the interaction of JNK to its other substrates (16). This strong affinity of IB1/JIP1 for JNK effectively anchors JNK in the cytoplasm and prevents its interaction through the JNK-binding domain with most of its downstream substrates (including cytoplasmic ones) and their subsequent activation. In this model, degradation of IB1/JIP1 would free JNK and allow it both to enter the nucleus and to access its substrates, including c-Jun, activating transcription factor-2, and others. This event would seem to be a prerequisite for JNK-induced apoptosis.

The rapid JNK activation induced by treatment with cytokines is associated with a delayed reduction in the IB1/JIP1 content of -cells, followed by apoptosis (13). The sensitivity of -cells to apoptosis is even increased if IB1/JIP1 is mutated (S59N). This mutation was previously linked to a familial type 2 diabetes (17). These data indicate that the regulation of the IB1/JIP1 level might be important in deciding the cell-death or survival response.

The mechanism leading to a reduction of IB1/JIP1 content in response to cytokines is unclear, but could be linked to calciumentry, as cytokines (IL-1 + IFN) were also shown to mediate a low voltage-activated Ca²⁺ current (18). The objective of this study was to characterize and identify the protease(s) responsible for the cytokine-induced down-regulation of IB1/JIP1 in -cells. Two major proteolytic pathways are known to operate in mammalian cells, the proteasome and the cysteine proteases, including the caspases, the calpains, and the lysosomal acidic cathepsins. Among them, calpains and some caspases are calcium-dependent. Here we show that calcium influx initiates ubiquitination and degradation of IB1/JIP1, and that this process seems to control the sensitivity of pancreatic -cells to apoptotic stimuli. We also observed that the S59N point mutation in IB1/JIP1, linked to type 2 diabetes, sensitizes IB1/JIP1 to the calcium- and proteasome-dependent degradation.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Plasmids, Peptides, and Antibodies—The rat IB1 sequence was cloned into the expression vector pBK (Stratagene, La Jolla, CA), the mutated form (S59N), and the N-terminal isoform (M101) of the protein. Anti-IB1 antibody raised against amino acid 1–280 of the protein has been described (8). Anti-FLAG agarose resin and anti-tubulin antibodies were purchased from Sigma. The JNKI1, mutated JNKI1, and SH3 peptides were designed by us and synthesized by Auspep (Parkville, Australia).

Cell Lines—The HeLa cell line and the insulin-secreting TC-3 cell line were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum, 100 µg/ml streptomycin, 100 units/ml penicillin, 1 mmol/liter sodium pyruvate, and 2 mmol/liter glutamine. The calcium chelator BAPTA/AM was added at a concentration of 10 µM 60 min before the addition of 1 µM calcium ionophore A23187 [GenBank] (Calbiochem, San Diego, CA). Apoptotic cells were counted 20 h after the addition of 1 µM calcium ionophore A23187 [GenBank] by propidium iodide and Hoechst 33342 staining (13, 19). A minimum of 1000 cells were counted in duplicate for each experiment. The calpain inhibitor calpastatin was added at a concentration of 5 µM 60 min before the addition of the cytokines (10 ng/ml of IL-1, 10 ng/ml of tumor necrosis factor-, and 100 units/ml of IFN-) and the proteasome inhibitor lactacystin was added at a concentration of 20 µM 60 min before the addition of the calcium ionophore A23187 [GenBank] .

Transfections and Whole Cell Lysate—3 x 10⁵ cells were transfected with 3 µg of plasmids in 10-cm dishes using DOTAP transfection reagent (Roche, Rotkreuz, Switzerland) following instructions from the manufacturer. After 48 h of transfection, cellular extracts were prepared by scraping cells in lysis buffer (20 mM Tris acetate, pH 7.4, 1 mM EGTA, 1% Triton X-100, 10 mM p-nitrophenyl phosphate, 5 mM sodium pyrophosphate, 10 mM glycerophosphate, 1 mM dithiothreitol, and anti-proteases). Debris was removed by centrifugation for 15 min at 15,000 rpm and 4 °C.

In Vitro Calcium Assay and Western Blotting—Increasing concentrations of CaCl₂ were added to 20 µg of cellular extracts supplemented with 100 mM imidazole, pH 7.5, 5 mM cystein, and 1 mM ATP. After incubation at 30 °C for 30 min, reaction products were separated by SDS-polyacrylamide gel electrophoresis on a denaturing 7.5% polyacrylamide gel and electrotransferred onto a polyvinylidene difluoride membrane. Nonspecific protein binding was blocked by incubating the membrane with a blocking solution (1x phosphate-buffered saline, 0.1% Tween 20, 5% nonfat dried milk powder) for 1 h at room temperature. Immunochemical detection of IB1 protein was performed using purified antiserum at 1:2000 dilution. After rinsing with washing buffer (1x phosphate-buffered saline, 0.1% Tween 20), the immune complex was detected by using a peroxidase-conjugated secondary antibody and the ECL detection kit (Amersham Biosciences), according to the manufacturer's specifications.

Pull-down Experiments—HeLa cells were transiently transfected with the FLAG-IB1 expression vector. After 48 h, cells were lysed, and 500 µg of crude extracts were incubated 60 min with 3 mM CaCl₂. Anti-FLAG agarose affinity resin was added, and incubation was performed 3 h at 4 °C. After five washes, FLAG-IB1 was subjected to SDS-PAGE and immunoblotting with anti-IB1 or anti-ubiquitin antibodies.

PCR Amplification and Coupled Transcription/translation Reaction (TNT)—Amplifications were performed in 100-µl reaction mixtures containing 200 µM dNTP, 1 µM primers, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl₂, 5 units AmpliTaq DNA polymerase (PerkinElmer Life Sciences), and 2% formamide. PCR conditions were as follows: 94 °C for 5 min; 94 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s, x30 cycles; and 72 °C for 10 min. Specific primers were used to amplify rat IB1 (GenBank^TM accession number AF108959 [GenBank] ):

PBKF: TTACGCCAAGCTCGAAATT; IB1 934R: CTCGAGCCGCACAT; IB1 1068R: CCTGCAGTTACAGAGTAAGC; IB1 1402R: GGCCTCCTCATATTCCTCAC; IB1 1570R: ATGCTCCTCCCCATTGA; and IB1 1769R: GCCATGTGCTCAGGC.

³⁵S-radiolabeled full-length or truncated IB1 protein was produced by the TNT system from plasmid DNA (pBK/IB1) or PCR products as described by the manufacturer (Promega, Madison, WI).

Kinase Assay—Activated recombinant JNK2 was added to a radiolabeled TNT product with 20 mM Hepes, pH 7.5, 10 mM MgCl₂, 1 mM dithiothreitol, and 100 µM ATP. The alkaline (0.2 units/µl) and acidic phosphatases (0.5 µg/µl) and the peptides JNKI1 (40 µM), mutated JNKI1 (40 µM), and SH3 (40 µM) were added 15 min before the addition of JNK2. After incubation at 30 °C for 30 min, reaction products were separated by SDS-polyacrylamide gel electrophoresis on a denaturing 10% polyacrylamide gel. The gels were stained with Coomassie Blue to check for equal loading of the samples, dried, and subsequently exposed to x-ray film (Kodak).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Calcium Ionophore-induced IB1/JIP1 Degradation and TC-3 Cell Apoptosis—Cytokines induce pancreatic -cell apoptotic signaling. Chronic exposure to cytokines reduces the level of IB1/JIP1 in the TC-3 cell line and increases the apoptotic rate (13). Exposure to cytokines was shown recently to induce an increase in the basal cytoplasmic free calcium concentration through the low voltage-activated Ca²⁺ channels, which was associated with apoptosis (18). To determine whether increased intracellular calcium concentration and IB1/JIP1 degradation were correlated, we exposed the TC-3 cell line to 1 µM calcium ionophore A23187 [GenBank] for 20 h, after which the IB1/JIP1 content was determined by Western blotting (Fig. 1A). The upper band is the full-length protein and the lower one is most likely the product of a translation beginning at Met-101 (20). Compared with control TC-3 cells, A23187 [GenBank] led to a 10-fold decrease in IB1/JIP1 content (both full-length and Met-101 forms), which is equivalent to the down-regulation induced by a 48-h exposure to cytokines (Fig. 1A).

View larger version (15K): [in this window] [in a new window]   FIG. 1. The calcium ionophore A23187 [GenBank] as well as cytokines induce IB1/JIP1 degradation in TC-3 cells and increase the apoptotic rate. Cells were exposed to 1 µM A23187 [GenBank] (I) for 20 h and cytokines (Cyt) for 48 h. A, cells were then resuspended in lysis buffer and analyzed by SDS-PAGE and Western blotting with the indicated antibodies. -Tub, anti-tubulin antibody; -IB1, anti-IB1 antibody; C, untreated cells. The IB1 levels in TC-3 cells were measured after exposure to A23187 [GenBank] . n = 4; *, p = 0.02 for cytokines and 0.03 for ionophore as compared with untreated cells. B, apoptotic cells were then counted. A minimum of 1000 cells were counted in four separate experiments. p = 0.02 for cytokines (Cyt) and A23187 [GenBank] (I), conditions relative to untreated cells (C).

BAPTA-AM was used to chelate intracellular calcium to confirm that the ionophore-induced degradation of IB1/JIP1 was calcium-dependent. BAPTA-AM is a selective cell-permeable calcium chelator which is a structural analogue of EGTA. When BAPTA-AM enters cells, the four acetoxymethyl ester (-AM) groups are cleaved off by endogenous intracellular esterases, making the BAPTA molecule negatively charged and trapping it intracellularly in the cytosol. Because BAPTA was toxic for TC-3 cells and induced a rapid and massive cell death, we transfected HeLa cells with an expression vector encoding IB1/JIP1. After 24–36 h of transfection, cells were pre-treated for 1 h with BAPTA-AM (10 µM) prior to 20 h of ionophore treatment (1 µM). The 6-fold IB1/JIP1 degradation initiated by ionophore was totally prevented by BAPTA. BAPTA alone even stabilized IB1/JIP1 (Fig. 2).

View larger version (33K): [in this window] [in a new window]   FIG. 2. The IB1/JIP1 degradation induced by calcium ionophore A23187 [GenBank] in HeLa cells can be prevented by BAPTA-AM. IB1/JIP1 transfected HeLa cells were pretreated with 10 µM BAPTA-AM (B) for 1 h and incubated with 1 µM A23187 [GenBank] (I) for 20 h. Cells were then resuspended in lysis buffer and analyzed by SDS-PAGE and Western blotting with the indicated antibodies. -Tub, anti-tubulin antibody; -IB1, anti-IB1 antibody; C, untreated cells. The IB1 levels in TC-3 cells were measured after exposure to A23187 [GenBank] (I) and BAPTA-AM (B). n = 3; *, p = 0.006 for BAPTA and 0.02 for BAPTA+ionophore as compared with ionophore.

Calpains Are Not Involved in Calcium-dependent IB1 Degradation—Several protease families such as calpains and some caspases are calcium-dependent. Calpains are non-lysosomal cystein proteases that catalyze the endoproteolytic cleavage of specific substrates by a calcium-dependent process. As IB1/JIP1 degradation requires calcium, we first investigated whether calpains are the calcium-activated proteases responsible for IB1/JIP1 degradation. We pre-treated TC-3 cells with a specific calpain inhibitor, the calpastatin peptide, before exposure to cytokines. Western blotting showed that a 24-h exposure to cytokines induced the preferential proteolysis of the M101 form of IB1/JIP1, which was not prevented by calpastatin (Fig. 3A), suggesting that calpains are not required for IB1/JIP1 degradation. We also performed in vitro IB1/JIP1 digestion with recombinant calpain II. As predicted by the inhibition experiments with the calpastatin peptide, IB1/JIP1 was not cleaved by calpain II (data not shown). However, these in vitro digestions revealed a mobility shift in IB1/JIP1 migration in the presence of high calcium concentration.

View larger version (35K): [in this window] [in a new window]   FIG. 3. IB1/JIP1 is degraded by endogenous proteases independently of calpain. TC-3 cells were pretreated with 5 µM calpastatin (CP) peptide for 1 h and incubated with cytokines (Cyt) for 24 h. Cells were then resuspended in lysis buffer and analyzed by SDS-PAGE and Western blotting with the indicated antibodies. -Tub, anti-tubulin antibody; -IB1, anti-IB1 antibody; C, untreated cells.

View larger version (42K): [in this window] [in a new window]   FIG. 4. High calcium concentrations induce IB1/JIP1 degradation in TC-3 cellular extracts. A, bTC-3 cell extracts (20 µg) were incubated in the presence of increasing amounts of calcium (0–6 mM) for 30 min at 30 °C. The reaction was stopped by SDS-loading buffer, and the samples were analyzed by SDS-PAGE and Western blotting with the indicated antibodies. -Tub, anti-tubulin antibody; -IB1, anti-IB1 antibody; *, shifted form of IB1. B, TC-3 cell extracts (20 µg) were incubated in the presence (5 mM) or absence of calcium and EGTA (10 mM) for 30 min at 30 °C.

The Proteasome Is Involved in IB1/JIP1 Degradation Mediated by Calcium—The ubiquitin-proteolytic pathway is a major system for selective protein degradation in eukaryotic cells. One of the first steps in the process includes selective modification of lysine residues in the target protein by ubiquitination, which will cause a shift in the migration of the modified protein as observed with IB1/JIP1 (Fig. 4A). The ubiquitin residues target the protein for further degradation by the proteasome complex. We suspected that ubiquitination was the first calcium-dependent step in IB1/JIP1 modification. Because there is no ubiquitin ligase inhibitor available, we used lactacystin, a specific proteasome inhibitor, to block protein degradation. To determine whether ionophore-induced IB1/JIP1 degradation is mediated by the proteasome pathway, HeLa cells were transfected with an expression vector encoding IB1/JIP1. The HeLa cell line was used in this experiment, as lactacystin induced a high apoptotic rate in TC-3 cells. After 24–36 h of transfection, cells were pre-treated for 1 h with 20 µM lactacystin, prior to 20 h of exposure to ionophore. To normalize the transfection rate, HeLa cells were cotransfected with a plasmid encoding the FLAG-tagged EGFP protein. The IB1/JIP1 content, determined by immunoblot analysis using anti-IB1 antibody, was decreased after 20 h of ionophore treatment, and lactacystin partially blocked IB1/JIP1 degradation induced by the ionophore (Fig. 5A). The FLAG-tagged EGFP protein level, examined by immunoblot analysis using an anti-FLAG antibody, remained unchanged (Fig. 5A).

View larger version (25K): [in this window] [in a new window]   FIG. 5. The proteasome is involved in IB1/JIP1 degradation. A, HeLa cells were cotransfected with the pBK/IB1 and pEGFP/FLAG constructs. After 24–36 h of transfection, cells were pretreated with 20 µM lactacystin (L) for 1 h and incubated with 1 µM calcium ionophore A23187 [GenBank] (I) for 20 h. Cells were resuspended in lysis buffer, and extracts (20 µg) were analyzed by SDS-PAGE and Western blotting with the indicated antibodies. -IB1, anti-IB1 antibody; -EGFP, anti-EGFP antibody. Quantification of IB1/JIP1 level in transfected HeLa cells were measured after treatment with ionophore and lactacystin. n = 3; *, p = 0.01 for ionophore+lactacystin as compared with ionophore. B, IB1/JIP1-transfected HeLa cell extracts were incubated in the presence or absence of 3 mM calcium. FLAG-IB1 was pulled down with anti-FLAG agarose resin and immunoblotted with anti-IB1 and anti-ubiquitin antibodies. As a control, non-transfected HeLa cell extract was used in the pull-down and anti-ubiquitin immunoblotting experiments. *, shifted form of IB1; -Ub, anti-ubiquitin antibody; -IB1, anti-IB1 antibody.

Taken together, these data strongly suggest that IB1/JIP1 is ubiquitinated and degraded by the ubiquitin-proteasome pathway.

JNK Targets IB1/JIP1 for Ubiquitination—Because ubiquitination targets IB1/JIP1 to efficient degradation by means of the proteasome pathway, we next investigated which mechanisms marked IB1/JIP1 for a calcium-dependent ubiquitination. IB1/JIP1, which tightly associates with JNK via JNK-binding domain, is phosphorylated at Thr-103 by JNK (21). It was previously demonstrated that the JNK substrates c-Jun as well as activating transcription factor-2, JunB, and p53 are targeted for ubiquitination by their association with JNK (22–25). ³⁵S-radiolabeled IB1/JIP1 produced in a reticulocyte lysate system was subjected to phosphorylation by activated JNK2 in a kinase assay. IB1/JIP1 phosphorylation induced a mobility shift (Fig. 6A) that was inhibited by alkaline phosphatase and JNKI1, a peptide previously described to prevent the interaction of JNK with certain of its targets through JNK-binding domain (11) and, therefore, to inhibit IB1/JIP1 phosphorylation (Fig. 6A). In contrast, mutated JNKI1 and nonspecific inhibitory (SH3) peptides, which do not alter the interaction of JNK with IB1/JIP1, had no effect on IB1/JIP1 degradation. To assess whether phosphorylation affected IB1/JIP1 stability at high calcium concentration in vitro, we performed an in vitro calcium assay with non-phosphorylated and phosphorylated IB1/JIP1. As shown in Fig. 6B, IB1/JIP1 stability was impaired when IB1/JIP1 was phosphorylated before the addition of a high calcium concentration. In the presence of the JNKI1, IB1/JIP1 stability was increased at high calcium concentration (Fig. 6B).

View larger version (32K): [in this window] [in a new window]   FIG. 6. JNK targets IB1/JIP1 for ubiquitination. A, full-length 35S-radiolabeled IB1/JIP1 was produced by TNT, pretreated 15 min with alkaline phosphatase (AP), peptide JNKI1, mutated JNKI1, and SH3, and subjected to phosphorylation by activated JNK2. The reaction was stopped by SDS-loading buffer, and the samples were analyzed by SDS-PAGE. B, full-length IB1/JIP1 produced by TNT was incubated with increasing calcium concentrations after having been incubated with or without active JNK2 in the presence or absence of JNK inhibitor (JNKI1). C, full-length IB1/JIP1 was incubated with the kinases JNK2, ERK2, and cdc2/p34 before exposure to calcium (3 mM).

An Element from Amino Acid 328 to Amino Acid 437 Is Involved in the Ubiquitination Process of IB1/JIP1—We observed that phosphorylation by JNK affected IB1/JIP1 stability at high calcium concentration in vitro. To localize a domain responsible for JNK phosphorylation and/or for calcium-dependent ubiquitination, we produced IB1/JIP1 deletion mutants. IB1/JIP1 mutants truncated at the C terminus to encode residues 1–281, 1–327, 1–438, 1–493, and 1–559 were generated by PCR coupled to a transcription/translation reaction. The truncated proteins were then phosphorylated by JNK2, which induced a mobility shift (Fig. 7) that is in agreement with the recent work of Nihalani et al. (21) showing IB1/JIP1 phosphorylation at Thr-103. The phosphorylated form of the proteins was exposed to increasing calcium concentrations. We observed that amino acid 1–327 was insensitive to calcium-dependent modifications (Fig. 7). In contrast, amino acid 1–438 was normally subjected to ubiquitination. These data strongly suggested that a domain localized between amino acid 328 and amino acid 438 destabilizes IB1/JIP1 at high calcium concentrations and is necessary for IB1/JIP1 ubiquitination.

View larger version (48K): [in this window] [in a new window]   FIG. 7. The amino acid 328–437 sequence is involved in the calcium-dependent ubiquitination of IB1/JIP1. Truncated IB1/JIP1 proteins were produced by TNT, phosphorylated by active JNK2, and exposed to high calcium concentrations.

View larger version (54K): [in this window] [in a new window]   FIG. 8. The first 100 amino acids of IB1/JIP1 confer protection against its calcium-mediated modification. HeLa cells were transfected with the constructs pBK/IB1, pBK/IB1(S59N), and pBK/IB1(M101) for 40 h. Cells were then resuspended in lysis buffer, and extracts were incubated in the presence of increasing amounts of calcium for 30 min at 30 °C. The reaction was stopped by SDS-loading buffer, and the samples were analyzed by SDS-PAGE and Western blotting with the indicated antibodies. -Tub, anti-tubulin antibody; -IB1, anti-IB1 antibody.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

IB1/JIP1, which is highly expressed in pancreatic -cells, plays an anti-apoptotic function in insulin-producing cells by controlling the activity of the JNK signaling pathway (13). This control directly depends upon the amount of IB1/JIP1. The mechanisms that control the IB1 level in pancreatic -cells are, therefore, potentially critical in deciding the cell-death or cell-survival response. Cytokines induce a marked reduction in the IB1/JIP1 content of -cells (8). The basic mechanisms of the proteolytic degradation of IB1/JIP1 are unclear. In this study, we investigated the early events in the cytokine signaling pathway that can trigger the degradation of IB1/JIP1 and observed that intracellular calcium concentrations determine IB1/JIP1 stability. In the TC-3 cell line, a calcium ionophore mimics the cytokine effect by inducing a decrease in IB1/JIP1 content and an increase in apoptotic rate. A correlation between cytokine concentration and intracellular calcium concentration was reported previously. Cytokines were found to induce a low voltage-activated calcium current in mouse TC-3 cells and an increase in intracellular calcium in mouse islet cells that was associated with apoptosis (18). In addition, Calbindin-D_28k, a cytosolic calcium-binding protein, was able to protect TC-3 cells from cytokine-mediated apoptosis when overexpressed (27).

In crude -cell extracts, addition of calcium is responsible for a massive migration shift of IB1/JIP1 on Western blots. At high calcium concentration, modified IB1/JIP1 is even completely degraded. The shift of IB1/JIP1 is clearly reminiscent of ubiquitin modification. The ubiquitin-proteolytic pathway is a major system for selective protein degradation in eukaryotic cells. One of the first steps in the process includes selective modification of lysine residues in the corresponding protein by ubiquitination, which targets the protein for ubiquitin-dependent degradation by the proteasome complex. In TC-3 cells in culture, we observed that lactacystin, a specific 20S proteasome inhibitor with no effect on cysteine and serine proteases, trypsin, and chymotrypsin (28) stabilized IB1/JIP1 after calcium ionophore treatment.

The experiments with lactacystin and BAPTA were conducted on HeLa cells, as both compounds induced a massive death process in TC-3 cells. This high apoptotic rate in TC-3 induced by BAPTA and lactacystin, two chemicals responsible for IB1/JIP1 stabilization (BAPTA and lactacystin) in HeLa cells, is not incompatible with the hypothesis that inhibition of IB1 degradation through the proteasome protects cells from apoptosis. Indeed, both BAPTA and lactacystin were reported to induce apoptosis in some cell types through signal transduction divergence from the JNK pathway. BAPTA was shown to promote apoptosis in MIN6 insulin-secreting cells (29), which are very sensitive to calcium homeostasis like other pancreatic -cells. In MIN6 cells, BAPTA induces depletion of cytosolic and nuclear-free calcium concentrations, which is accompanied by an alteration of Bcl-2 to Bax expression ratio (mRNA and protein) leading to apoptosis (29). The causes of lactacystin-mediated cell death (30, 31) are unknown, but current reports have implicated accumulation of the tumor suppressor p53 (32, 33), heat-shock proteins (34), p27Kip1 (35), proapoptotic proteins Bax (36) and Bid (37), or stabilization of active caspase-3 subunits (38) after proteasome blockade.

The signals that target proteins for ubiquitination are often unclear. In some cases, different patterns of phosphorylation or a partially conserved sequence motif are required. JNK targets its substrate for ubiquitination in a phosphorylation-dependent manner. Phosphorylated forms of the pro-apoptotic factors c-Jun and activating transcription factor-2 were found to be protected against JNK-targeted ubiquitination. As IB1/JIP1 is an anti-apoptotic substrate of JNK, we studied the role of JNK phosphorylation on its degradation. We observed that IB1/JIP1 phosphorylation by JNK is essential for its calcium-induced instability, implying that JNK participates actively in the regulation of IB1/JIP1 stability. After cytokine treatment and concomitant JNK activation, increased intracellular calcium induced ubiquitination of the scaffold.

To localize specific amino acid sequence motifs required for JNK- and calcium-dependent degradation, we produced C terminus deletion in IB1/JIP1. We deduced that amino acid 328–437 contains element(s) responsible for the calcium-dependent ubiquitination. Examination of the amino acid sequences from amino acid 328 to 437 of IB1/JIP1 revealed two 9-amino acid consensus "destruction box" sequences originally described in cyclin molecules (RXALGXIXN) and required for its destruction by the ubiquitin-proteasome pathway (39, 40). Accordingly, we found RGSLGEPPP and RASLSSDTS motifs at positions 357–365 and 368–376, respectively.

Protein destruction by the ubiquitin-proteasome pathway is emerging as an important mechanism for the tight control of diverse cellular processes, including signal transduction from cell-surface receptors (41), gene transcription (42), angiogenesis (43), and cell-cycle progression (39). Aberrations in the proteolytic pathway are implicated in several disease states ranging from Alzheimer's disease (44) to cancer (45). Our data suggest that the proteasome machinery, by controlling the IB1/JIP1 level in -cells, could also be involved in the development of type 1 diabetes. Our results on the point mutation S59N at the N terminus of IB1/JIP1, which has been associated with a familial form of type 2 diabetes (17), revealed that the proteasome could also be engaged in type 2 diabetes. Indeed, our results suggest that the decreased resistance to apoptosis after S59N mutation may be caused by sensitization of IB1/JIP1 to cytokine- and proteasome-dependent degradation. Our hypothesis that IB1/JIP1 degradation through the proteasome pathway might contribute to both types of diabetes (type 1 and 2) needs more investigation. However, increasing numbers of studies demonstrate direct relations between type 1 and type 2 diabetes, such as inflammatory mediators and islet -cell failure (12, 46–51).

IB1/JIP1 acts as an anti-apoptotic protein, whose level seems to influence the -cell death or survival response. Exposure to stress (e.g. by cytokines) induces a large down-regulation of IB1/JIP1 content, with a concomitant increased apoptotic rate (13). -cells can be protected from stress-induced apoptosis by IB1/JIP1 overexpression (13) and by preventing IB1/JIP1 degradation. To learn how to protect IB1/JIP1 from degradation, we propose to determine which mechanisms are responsible for its down-regulation. In this study, we observed that IB1/JIP1 degradation is mediated by the ubiquitin-proteasome machinery. However, two preliminary events are required to prime IB1/JIP1 for ubiquitination: IB1/JIP1 has to be phosphorylated by JNK, and the intracellular calcium concentration has to be increased.

Further studies need to be performed to define more precisely the motif sequence of the destruction box that targets IB1/JIP1 for ubiquitination. This motif could be a good therapeutic target to delay IB1/JIP1 degradation and -cell apoptosis.

	FOOTNOTES

 
^* This work was supported by the Botnar Foundation, Danish Diabetes Association, Novo Nordisk A/S, Grant P-038/02 from the Gebert Rüf Stifstung Fundation, Juvenile Diabetes Research Foundation International Research Center Grant 4-2002-457, and Fonds National Suisse de la Recherche Scientifique Grant 3200-65139.01. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Unit of Molecular Genetics, Service of Medical Genetics, Centre Hospitalier Universitaire Vaudois, CH-1011 Lausanne, Switzerland. Tel.: 41-21-314-3379; Fax: 41-21-314-3385; E-mail: Nathalie.Pillet{at}chuv.hospvd.ch.

¹ The abbreviations used are: IL-1, interleukin-1; NF-B, nuclear factor-B; JNK, c-Jun NH₂-terminal kinase; IB1/JIP1, islet-brain 1/JNK interacting protein 1; TNT, transcription/translation reaction; BAPTA/AM, 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid/acetoxymethyl ester; DOTAP, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate; SH3, Src homology.

	ACKNOWLEDGMENTS

 
We thank Dr. Peter Clarke for helpful comments and for reading the manuscript.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Foulis, A. K., Liddle, C. N., Farquharson, M. A., Richmond, J. A., and Weir, R. S. (1986) Diabetologia 29, 267–274[CrossRef][Medline] [Order article via Infotrieve]
2. Hamaguchi, K., and Leiter, E. H. (1990) Diabetes 39, 415–425[Abstract]
3. Rabinovitch, A., Suarez-Pinzon, W. L., Shi, Y., Morgan, A. R., and Bleackley, R. C. (1994) Diabetologia 37, 733–738[Medline] [Order article via Infotrieve]
4. Iwahashi, H., Hanafusa, T., Eguchi, Y., Nakajima, H., Miyagawa, J., Itoh, N., Tomita, K., Namba, M., Kuwajima, M., Noguchi, T., Tsujimoto, Y., and Matsuzawa, Y. (1996) Diabetologia 39, 530–536[Medline] [Order article via Infotrieve]
5. Dunger, A., Cunningham, J. M., Delaney, C. A., Lowe, J. E., Green, M. H., Bone, A. J., and Green, I. C. (1996) Diabetes 45, 183–189[Abstract]
6. Delaney, C. A., Pavlovic, D., Hoorens, A., Pipeleers, D. G., and Eizirik, D. L. (1997) Endocrinology 138, 2610–2614[Abstract/Free Full Text]
7. Larsen, C. M., Wadt, K. A., Juhl, L. F., Andersen, H. U., Karlsen, A. E., Su, M. S., Seedorf, K., Shapiro, L., Dinarello, C. A., and Mandrup-Poulsen, T. (1998) J. Biol. Chem. 273, 15294–15300[Abstract/Free Full Text]
8. Bonny, C., Nicod, P., and Waeber, G. (1998) J. Biol. Chem. 273, 1843–1846[Abstract/Free Full Text]
9. Ammendrup, A., Maillard, A., Nielsen, K., Aabenhus, A. N., Serup, P., Dragsbaek, M. O., Mandrup-Poulsen, T., and Bonny, C. (2000) Diabetes 49, 1468–1476[Abstract]
10. Negri, S., Oberson, A., Steinmann, M., Sauser, C., Nicod, P., Waeber, G., Schorderet, D. F., and Bonny, C. (2000) Genomics 64, 324–330[CrossRef][Medline] [Order article via Infotrieve]
11. Bonny, C., Oberson, A., Negri, S., Sauser, C., and Schorderet, D. F. (2001) Diabetes 50, 77–82[Abstract/Free Full Text]
12. Maedler, K., Sergeev, P., Ris, F., Oberholzer, J., Joller-Jemelka, H. I., Spinas, G. A., Kaiser, N., Halban, P. A., and Donath, M. Y. (2002) J. Clin. Invest. 110, 851–860[CrossRef][Medline] [Order article via Infotrieve]
13. Bonny, C., Oberson, A., Steinmann, M., Schorderet, D. F., Nicod, P., and Waeber, G. (2000) J. Biol. Chem. 275, 16466–16472[Abstract/Free Full Text]
14. Whitmarsh, A. J., and Davis, R. J. (1998) Trends. Biochem. Sci. 23, 481–485[CrossRef][Medline] [Order article via Infotrieve]
15. Gupta, S., Campbell, D., Derijard, B., and Davis, R. J. (1995) Science 267, 389–393[Abstract/Free Full Text]
16. Dickens, M., Rogers, J. S., Cavanagh, J., Raitano, A., Xia, Z., Halpern, J. R., Greenberg, M. E., Sawyers, C. L., and Davis, R. J. (1997) Science 277, 693–696[Abstract/Free Full Text]
17. Waeber, G., Delplanque, J., Bonny, C., Mooser, V., Steinmann, M., Widmann, C., Maillard, A., Miklossy, J., Dina, C., Hani, E. H., Vionnet, N., Nicod, P., Boutin, P., and Froguel, P. (2000) Nat. Genet. 24, 291–295[CrossRef][Medline] [Order article via Infotrieve]
18. Wang, L., Bhattacharjee, A., Zuo, Z., Hu, F., Honkanen, R. E., Berggren, P. O., and Li, M. (1999) Endocrinology 140, 1200–1204[Abstract/Free Full Text]
19. Hoorens, A., Van de Casteele, M., Kloppel, G., and Pipeleers, D. (1996) J. Clin. Invest. 98, 1568–1574[Medline] [Order article via Infotrieve]
20. Kim, I. J., Lee, K. W., Park, B. Y., Lee, J. K., Park, J., Choi, I. Y., Eom, S. J., Chang, T. S., Kim, M. J., Yeom, Y. I., Chang, S. K., Lee, Y. D., Choi, E. J., and Han, P. L. (1999) J. Neurochem. 72, 1335–1343[CrossRef][Medline] [Order article via Infotrieve]
21. Nihalani, D., Wong, H. N., and Holzman, L. B. (2003) J. Biol. Chem. 278, 28694–28702[Abstract/Free Full Text]
22. Fuchs, S. Y., Dolan, L., Davis, R. J., and Ronai, Z. (1996) Oncogene 13, 1531–1535[Medline] [Order article via Infotrieve]
23. Fuchs, S. Y., Xie, B., Adler, V., Fried, V. A., Davis, R. J., and Ronai, Z. (1997) J. Biol. Chem. 272, 32163–32168[Abstract/Free Full Text]
24. Fuchs, S. Y., Adler, V., Buschmann, T., Yin, Z., Wu, X., Jones, S. N., and Ronai, Z. (1998) Genes Dev. 12, 2658–2663[Abstract/Free Full Text]
25. Fuchs, S. Y., Tappin, I., and Ronai, Z. (2000) J. Biol. Chem. 275, 12560–12564[Abstract/Free Full Text]
26. Eizirik, D. L., and Mandrup-Poulsen, T. (2001) Diabetologia 44, 2115–2133[CrossRef][Medline] [Order article via Infotrieve]
27. Rabinovitch, A., Suarez-Pinzon, W. L., Sooy, K., Strynadka, K., and Christakos, S. (2001) Endocrinology 142, 3649–3655[Abstract/Free Full Text]
28. Fenteany, G., Standaert, R. F., Lane, W. S., Choi, S., Corey, E. J., and Schreiber, S. L. (1995) Science 268, 726–731[Abstract/Free Full Text]
29. Mizuno, N., Yoshitomi, H., Ishida, H., Kuromi, H., Kawaki, J., Seino, Y., and Seino, S. (1998) Endocrinology 139, 1429–1439[Abstract/Free Full Text]
30. Shah, S. A., Potter, M. W., and Callery, M. P. (2001) Surg. Oncol. 10, 43–52[CrossRef][Medline] [Order article via Infotrieve]
31. Almond, J. B., and Cohen, G. M. (2002) Leukemia 16, 433–443[CrossRef][Medline] [Order article via Infotrieve]
32. Lopes, U. G., Erhardt, P., Yao, R., and Cooper, G. M. (1997) J. Biol. Chem. 272, 12893–12896[Abstract/Free Full Text]
33. Wagenknecht, B., Hermisson, M., Eitel, K., and Weller, M. (1999) Cell Physiol. Biochem. 9, 117–125[Medline] [Order article via Infotrieve]
34. Bush, K. T., Goldberg, A. L., and Nigam, S. K. (1997) J. Biol. Chem. 272, 9086–9092[Abstract/Free Full Text]
35. Drexler, H. C. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 855–860[Abstract/Free Full Text]
36. Li, B., and Dou, Q. P. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 3850–3855[Abstract/Free Full Text]
37. Breitschopf, K., Zeiher, A. M., and Dimmeler, S. (2000) J. Biol. Chem. 275, 21648–21652[Abstract/Free Full Text]
38. Chen, L., Smith, L., Wang, Z., and Smith, J. B. (2003) Mol. Pharmacol. 64, 334–345[Abstract/Free Full Text]
39. Glotzer, M., Murray, A. W., and Kirschner, M. W. (1991) Nature 349, 132–138[CrossRef][Medline] [Order article via Infotrieve]
40. King, R. W., Glotzer, M., and Kirschner, M. W. (1996) Mol. Biol. Cell 7, 1343–1357[Abstract]
41. Mimnaugh, E. G., Chavany, C., and Neckers, L. (1996) J. Biol. Chem. 271, 22796–22801[Abstract/Free Full Text]
42. Treier, M., Staszewski, L. M., and Bohmann, D. (1994) Cell 78, 787–798[CrossRef][Medline] [Order article via Infotrieve]
43. Oikawa, T., Sasaki, T., Nakamura, M., Shimamura, M., Tanahashi, N., Omura, S., and Tanaka, K. (1998) Biochem. Biophys. Res. Commun. 246, 243–248[CrossRef][Medline] [Order article via Infotrieve]
44. Kim, T. W., Pettingell, W. H., Hallmark, O. G., Moir, R. D., Wasco, W., and Tanzi, R. E. (1997) J. Biol. Chem. 272, 11006–11010[Abstract/Free Full Text]
45. Spataro, V., Norbury, C., and Harris, A. L. (1998) Br. J. Cancer 77, 448–455[Medline] [Order article via Infotrieve]
46. Donath, M. Y., Storling, J., Maedler, K., and Mandrup-Poulsen, T. (2003) J. Mol. Med. 81, 455–470[CrossRef][Medline] [Order article via Infotrieve]
47. Mathis, D., Vence, L., and Benoist, C. (2001) Nature 414, 792–798[CrossRef][Medline] [Order article via Infotrieve]
48. Pietropaolo, M., Barinas-Mitchell, E., Pietropaolo, S. L., Kuller, L. H., and Trucco, M. (2000) Diabetes 49, 32–38[Abstract]
49. Rowley, M. J., Mackay, I. R., Chen, Q. Y., Knowles, W. J., and Zimmet, P. Z. (1992) Diabetes 41, 548–551[Abstract]
50. Wilkin, T. J. (2001) Diabetologia 44, 914–922[CrossRef][Medline] [Order article via Infotrieve]
51. Maedler, K., Spinas, G. A., Lehmann, R., Sergeev, P., Weber, M., Fontana, A., Kaiser, N., and Donath, M. Y. (2001) Diabetes 50, 1683–1690[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. Y. Donath, J. Storling, L. A. Berchtold, N. Billestrup, and T. Mandrup-Poulsen Cytokines and {beta}-Cell Biology: from Concept to Clinical Translation Endocr. Rev., May 1, 2008; 29(3): 334 - 350. [Abstract] [Full Text] [PDF]

				M. Ferdaoussi, S. Abdelli, J.-Y. Yang, M. Cornu, G. Niederhauser, D. Favre, C. Widmann, R. Regazzi, B. Thorens, G. Waeber, et al. Exendin-4 Protects {beta}-Cells From Interleukin-1{beta}-Induced Apoptosis by Interfering With the c-Jun NH2-Terminal Kinase Pathway Diabetes, May 1, 2008; 57(5): 1205 - 1215. [Abstract] [Full Text] [PDF]

				G. Zhou, J. S. Boomer, and T.-H. Tan Protein Phosphatase 4 Is a Positive Regulator of Hematopoietic Progenitor Kinase 1 J. Biol. Chem., November 19, 2004; 279(47): 49551 - 49561. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 278/49/48720    most recent M306745200v1