Originally published In Press as doi:10.1074/jbc.M308316200 on September 17, 2003
J. Biol. Chem., Vol. 278, Issue 49, 49459-49468, December 5, 2003
Polysialic Acid and Mucin Type O-Glycans on the Neural Cell Adhesion Molecule Differentially Regulate Myoblast Fusion*
Misa Suzuki,
Kiyohiko Angata,
Jun Nakayama
, and
Minoru Fukuda
From the
Glycobiology Program, Cancer Research Center, The Burnham Institute, La Jolla, California 92037 and the
Department of Pathology, Shinshu University School of Medicine, Matsumoto 390-8621, Japan
Received for publication, July 30, 2003
, and in revised form, September 5, 2003.
 |
ABSTRACT
|
|---|
Polysialic acid attached to the neural cell adhesion molecule (NCAM) is thought to play a critical role in development. NCAM in muscle tissue contains a muscle-specific domain (MSD) to which mucin type O-glycans are attached. In the present study, using the C2C12 myoblast system, we show that NCAM containing MSD is increasingly expressed on the cell surface as myotubes form. Polysialic acid is primarily attached to N-glycans of NCAM, and polysialylated NCAM is expressed on the outer surface of myotube bundles. By transfecting cDNAs encoding wild type and mutant forms of NCAM, we found that NCAM containing MSD facilitates myoblast fusion, and this effect is diminished by mutating O-glycosylation sites at MSD. By contrast, forced expression of polysialic acid in early differentiation stages reduces myotube formation and delays the expression of NCAM containing the MSD domain. Strikingly, inhibition of polysialic acid synthesis by antisense DNA approach induced differentiation in both human rhabdomyosarcoma cells, which overexpress polysialic acid, and C2C12 cells. These results indicate that polysialic acid and mucin type O-glycans on NCAM differentially regulate myoblast fusion, playing critical roles in muscle development.
 |
INTRODUCTION
|
|---|
During mammalian embryonic development, muscle development is initiated once mesenchymal cells commit to become myoblasts. Myoblasts then align and fuse, forming multinucleated myotubes, and mature myotubes are bundled together, forming sarcolemma. In parallel, each myotube starts contraction, receives innervation from motor and sensory neurons, and eventually forms muscle tissue. In this process, one of the most intriguing steps is myoblast fusion. Myoblast fusion consists of multiple steps: expression of the fusion competent phenotype, specific myoblast-myoblast recognition and alignment, cell adhesion and electrical coupling, and fusion of lipid bilayer membrane (1). It has been reported that anti-NCAM1 antibody inhibits aggregation of fusion-competent chick embryo myoblasts (2), indicating that cell-cell adhesion via NCAM apparently initiates myoblast fusion. In addition, integrins, N-cadherin, VCAM, and VLA4 are thought to be involved (see Ref. 3 and references herein).
NCAM is found in several isoforms due to alternative mRNA splicing of more than 19 exons. In mammalian brain, the glycosylphosphatidylinositol (GPI)-anchored 120-kDa isoform and transmembrane 140- and 180-kDa isoforms are primarily expressed. In muscles, three isoforms have been reported: a GPI-anchored 125-kDa isoform and transmembrane 140- and 155-kDa isoforms (4). Muscle-specific domain (MSD) was identified in the cDNA of the 125-kDa NCAM isoform obtained from human skeletal muscle (5). MSD is encoded by four different exons, MSD1a, MSD1b, MSD1c, and codon AAG. The full-length MSD sequence consists of 35 amino acids inserted between two fibronectin type III domains of NCAM. MSD insertion is observed only in skeletal muscle and heart and not in other tissues. O-Glycosylation of MSD was shown by peanut agglutinin (PNA) lectin affinity column chromatography and structural analysis (4)
Transfection studies using in vitro myoblast culture systems indicated that NCAM containing MSD promotes myoblast fusion. Dickson et al. transfected GPI-anchored human NCAM with (125 kDa) or without (120 kDa) MSD into C2 myoblast cells and found that 125-kDa NCAM enhanced myoblast fusion, whereas the 120-kDa isoform did not (6). Similarly, in transgenic mice overexpressing the human 125-kDa NCAM that contains MSD, secondary myotube formation is enhanced (7). These results suggest that MSD motif promotes myoblast fusion. However, it is not known whether O-glycans attached to MSD or the amino acid sequence of MSD contribute to this activity.
It has been reported that polysialic acid, another modification of NCAM, plays a critical role in neural development. Polysialic acid is a homopolymer of
2,8-linked sialic acid, which can be extended as many as 60 units in the developing nervous system. Polysialic acid is synthesized by two polysialyltransferases, ST8Sia II and ST8Sia IV (8-13). NCAM is the most prominent acceptor molecule of polysialic acid, and the fifth and sixth N-glycosylation sites in the immunoglobulin-like domain 5 of NCAM are known to be preferentially polysialylated (14-16). Gene inactivation of ST8Sia IV is associated with impaired long term potentiation in Schaffer collateral-CA1 synapses of the adult hippocampus (17). This defect is apparently due to a substantial decrease of polysialic acid in the CA1 region. These and other studies suggest that polysialic acid attenuates NCAM-NCAM homophilic interaction, allowing cells expressing polysialic acid to migrate and/or extend.
In the present study, we employed the C2C12 mouse myoblast culture system to determine the roles of NCAM glycosylation in muscle development. C2C12 cells were derived from so-called satellite muscle cells and can be maintained as myoblast cells. When C2C12 cells are cultured in a low concentration of horse serum, they differentiate and form myotubes within 5-7 days (6). Using this system, we observed that expression of NCAM precedes the expression of polysialic acid. By transfecting various forms of NCAM, we found that NCAM containing MSD in particular facilitates myoblast fusion and that this activity is diminished by mutation of potential O-glycosylation sites within MSD. On the other hand, abolition of N-linked polysialylation sites in NCAM facilitated myoblast fusion, whereas overexpression of polysialic acid inhibited myoblast fusion. These results indicate that the O-glycans on the MSD of NCAM facilitate myoblast fusion, whereas polysialic acid attenuates this process.
 |
EXPERIMENTAL PROCEDURES
|
|---|
AntibodiesAnti-mouse NCAM antibody H.28-123 and anti-skeletal myosin heavy chain antibody MY-32 were purchased from Immunotech and Sigma, respectively. Cyan fluorescence protein (CFP) was detected using anti-GFP peptide antibody (Clontech). Human NCAM was stained with anti-CD56 antibody (ERIC-1, Leinco Technologies), which does not react with mouse NCAM. A hybridoma of anti-polysialic acid antibody 5A5 (18) was purchased from the University of Iowa Hybridoma Bank.
Plasmid Construction and TransfectioncDNA encoding human NCAM containing MSD and NCAM without MSD was cloned into pcDNA3.1 as described previously (19). cDNA encoding GPI anchoring domain was excised from human NCAM 120 in pH
APr-1-neo by KpnI-PvuII digestion and inserted into KpnI-EcoRV sites of pcDNA3.1-NCAM, resulting in pcDNA3.1-NCAM-GPI. The HindIII-EcoRI fragment of NCAM, of which the fourth, fifth, and sixth N-glycosylation site asparagines were mutated to glutamine (15), replaced the corresponding region of pcDNA3.1-NCAM-GPI. By these constructions, we could obtain four isoforms of NCAM (M+N-, M-N-, M+N+, and M-N+). NCAM (M+N+) and NCAM (M-N+) are equivalent to 125- and 120-kDa wild type human NCAM isoforms, respectively.
Mutation of the O-glycosylation site threonine to alanine was introduced by PCR using mutated primers: TA1-forward, TCTGCTAGCTCGTCTGCACCTGTTCCATT; TA2-f, TCTGCTAGCTCGTCTGCACCTGTTCCATTGTCTCCACCAGATGCAACT; TA3-f, TCTGCTAGCTCGTCTGCACCTGTTCCATTGTCTCCACCAGATGCAACTTGGCCTCTTCCTGCCCTTGCAGCCACA (NheI site in boldface type; codon for Ala underlined). GPI-reverse, AAGAGTCACCGCAGAGAAAAGC was used as the 3' primer. The mutated fragment was amplified and introduced into the NheI-KpnI site of pcDNA3-NCAM (M+N-)-GPI.
Cloning of cDNAs encoding human ST8Sia II and ST8Sia IV was described previously (11, 20). cDNA encoding ST8Sia II and ST8Sia IV fused with CFP was constructed as described (21). Briefly, the PstI-AgeI PCR product of ST8Sia IV or ST8Sia II was introduced into the pECFP-N1 vector (Clontech), and then the entire ST8SiaIV-CFP chimera was transferred to pcDNA3. Both immunostaining and immunoblots showed that NCAM was extensively polysialylated by chimeric enzymes, indicating that modification of the C terminus of polysialyltransferases by CFP did not affect their activity as reported for ST8Sia IV-GFP (21).
cDNA encoding ST8Sia IV-CFP was introduced to PstI-NotI sites of the pIND vector of the ecdysone-inducible expression system (Invitrogen).
Antisense DNA of ST8Sia II or ST8Sia IV was amplified by PCR. cDNAs encoding full-length ST8Sia II or ST8Sia IV were flipped, and KpnI and HindIII sites were attached and then ligated to the N terminus of GFP in pcDNA3.1. Primers used for PCR were as follows: hST8SiaIVa-f, CGGGGTACCAACCAGGACTTTCTCGGGCAC; hST8SiaIVa-r, GTGCCCAAGCTTGTGCATATTGTTTGTTTC; hST8SiaIIa-f, CGGGGTACCGGTCCTGGCGGGCGAACCCACCATG; hST8SiaIIa-r, GTGCCCAAGCTTCTACGTGGCCCCATCGCACT. All cDNA sequences were confirmed by sequencing.
Establishment of C2C12 Stable TransfectantsC2C12 cells and rhabdomyosarcoma TE671 and RD cells were obtained from the American Type Culture Collection. C2C12 cells were routinely maintained in DME-high glucose with 20% fetal calf serum. To induce differentiation, the medium was changed to DME-high glucose with 2% horse serum when cells reached confluence, and the medium was changed every day (6).
NCAM or polysialyltransferase plasmids were transfected into C2C12 cells at myoblast stages using LipofectAmine PLUS (Invitrogen) as described previously (20). Stable transfectants of NCAM were selected in hygromycin or G418 (O-glycosylation mutants), and ST8Sia II or ST8Sia IV transfectants were selected by G418. Each stable cell clone apparently exhibited different fusion competency, probably due to difference in the locus of integration of transfected DNA and number of integrated DNA. Also, by immunostaining and immunoblot, we found that expression level of NCAM or polysialic acid varies among clones. We could observe that integrated DNA induced or inhibited fusion depending on transfected cDNAs. To avoid clonal variation, we decided to use a mixture of clones expressing NCAM or polysialic acid.
Transfected cells were detached from dishes by cell dissociation buffer (Specialty Media Inc.), and stained with anti-NCAM (ERIC-1) or anti-polysialic acid (5A5) antibody followed by secondary antibody conjugated with FITC. After staining, cells were incubated in DME medium for 20 min at 37 °C to internalize fluorescence-tagged antibodies into cells. The cells were then washed with PBS, digested with trypsin at 37 °C for 8 min, suspended in sorting buffer (5% dialyzed fetal calf serum, 25 mM Hepes, pH 7.4, in PBS), filtered through 40-µm nylon mesh, and sorted by FACStar (Becton Dickinson). This procedure was necessary, since C2C12 cells dissociated without trypsin tend to aggregate. Expression of transfected proteins on sorted cells was confirmed by immunoblot and immunostaining as described previously (22).
ST8SiaIV-CFP/pIND ecdysone-inducible vector and pVgRXR ecdysone receptor were transfected into C2C12 sequentially according to the manufacturer's protocol (Invitrogen). The ST8Sia IV-positive clone was selected by G418 and Zeocin resistance, and cells were stained with anti-CFP antibody before and after induction to confirm expression of ST8Sia IV-CFP. The expression of ST8Sia IV-CFP was induced by addition of the inducer, ponasterone A.
Cell Fusion AssayFor each NCAM mutant, three or four independent series of transfection, cell sorting, and cell fusion assays were performed. Cells were plated at a density of 8 x 105 cells on coverslips in each well of 6-well plates, and 40 h after plating, medium was changed from growth (20% fetal calf serum in DME) to differentiation (2% horse serum in DME) medium (6). After every 24 h, a coverglass was sampled and fixed in 4% paraformaldehyde. From day 0 to 7, a total of eight coverglasses were collected for each cell line. Cells were permeabilized with 0.5% Triton X-100 in PBS for 2 min and blocked with 1% bovine serum albumin in PBS, and the cells were stained with anti-myosin antibody followed by secondary antibody conjugated to fluorescein isothiocyanate or rhodamine, treated with 0.0005% Hoechst 33258 for 5 min. Staining was analyzed using a Nikon ECLIPSE TE300 microscope connected with a SPOT CCD camera or Bio-Rad MRC 1024 confocal laser-scanning microscope. After counting the number of nuclei in four fields for each coverslip at 40 x 10 magnification (
200 cells in one field), the average ratio (percentage) of nuclei in myosin-positive cells/total nuclei was calculated as a fusion index. The S.D. is shown for a variation among four fields.
ImmunoblottingCells were scraped and lysed in radioimmune precipitation assay buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS in PBS) containing protease inhibitor mixture (Sigma) by trituration through 26G
-gauge needles. Cell lysates were subjected to sonication in ice-cold water for 15 min and left on ice for another 15 min, and cell debris was removed by brief centrifugation. The protein concentration of cell extracts was determined by a micro-BCA kit (Pierce). Twenty µg of protein was applied to each lane of SDS-PAGE (6% gel) and then blotted onto polyvinylidene difluoride membranes, and conventional immunoblotting was performed.
Polysialylated proteins were immunoprecipitated from C2C12 cell lysates or [3H]glucosamine-labeled cell lysates by using 5A5 anti-polysialic acid antibody and goat anti-mouse IgM antibody conjugated to agarose beads (Sigma). The immune complex was washed by radioimmune precipitation assay buffer and PBS and subjected to SDS-polyacrylamide gel electrophoresis followed by immunoblotting using NCAM antibody (nonradioactive) or fluorography (radioactive).
RT-PCRFollowing the manufacturer's protocol, 100-200 µg of total RNA was isolated from C2C12 cells using the TRIZOL RNA extraction reagent (Invitrogen). After treatment with DNase I, 20 µg of total RNA was reverse transcribed by SuperScript II (Invitrogen) using an oligo(dT) primer. The cDNA sample was dissolved in 100 µl of water, and 2.5 µl was used for each PCR. Competitive PCR for mouse ST8Sia II and ST8Sia IV was carried out essentially as described with a slight modification (23).
Since PCR products for NCAM showed several bands, these bands were separately excised, cloned into TA vector (pGEM-5Zf(+), Promega) and sequenced. Primers used to detect NCAM variants in PCR were as follows: MSD-f, GGTGCAGTTTGATGAGCCAGAGG; MSD-r, GATAGTGTCTGATGGGGGAGCC; GPI/TMD-f, CAGGTAGATATTGTTCCCAGCC; GPI-reverse; TMD-r, AGTCCGTTCTTCCTCCGTTC. PCR using MSD-f and MSD-r yields PCR products from transcripts encoding MSD. PCR using GPI/TMD-f and GPI-reverse yields PCR products for GPI-anchored NCAM, whereas PCR with TMD-f and TMD-r yields products for transmembrane domain-containing NCAM.
Oligosaccharide Structure AnalysisC2C12 cells were metabolically labeled with 40 µCi/ml of [3H]glucosamine in 10 ml of glucose-free DME medium for 4 h on day 2, and then 10 ml of DME-high glucose, 2% horse serum was added and incubated for an additional 20 h at 37 °C. Labeled cells were scraped on day 3 and lysed in radioimmune precipitation assay buffer as described above.
The same amount of protein derived from control and ST8Sia IV-transfected C2C12 cells was subjected to immunoprecipitation by anti-NCAM antibody (H.28-123). Ten µl out of 300 µl of immunoprecipitate suspension were subjected to SDS-polyacrylamide gel electrophoresis and fluorography, using Amplify (Amersham Biosciences). The rest of the samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes. After staining polyvinylidene difluoride membrane by Coomassie Brilliant Blue R-250, bands corresponding to each NCAM isoform were excised and subjected to N-glycanase digestion (N-glycosidase F; Calbiochem). Supernatants of the N-glycanase digest were purified and subjected to Mono-Q anion exchange high performance liquid chromatography as described previously (15).
 |
RESULTS
|
|---|
NCAM-MSD and Polysialic Acid Are Sequentially Expressed on the Cell Surface of C2C12 CellsDifferentiation of C2C12 cells can be induced by substitution of culture medium containing 20% fetal calf serum with 2% horse serum (day 0, D0). Fig. 1A shows that NCAM and polysialic acid were sequentially expressed on the cell surface after induction of differentiation. Myosin represents a marker of differentiated cells (day 3 and later). Before induction, neither NCAM nor polysialic acid was clearly detected on the cell surface. At the onset of myoblast fusion at around day 1-3, NCAM first appeared on the cell surface, followed by polysialic acid. Fig. 1B shows confocal images at day 5. On mature myotubes, both polysialic acid and NCAM were expressed. Whereas NCAM was expressed mostly at the outer surface of myotubes (see red color), polysialic acid was almost exclusively expressed on the outside surface of myotube bundles (Fig. 1B, green). The latter finding is consistent with previous observation of chick myoblast development that outer surface of myotube bundle is decorated by polysialic acid (24). Strong staining of polysialic acid can be occasionally observed on fused cells at day 3, but its function is unknown.

View larger version (110K):
[in this window]
[in a new window]
|
FIG. 1. Expression of myosin, NCAM, and polysialic acid in differentiating C2C12 cells. A, C2C12 cells were induced to differentiate in a low concentration of horse serum. At day 0 (D0) and 1, 3, and 7 days (D1, D3, and D7) after initiation of differentiation, C2C12 cells were stained with monoclonal antibodies specific to myosin (a marker of myotubes), NCAM, and polysialic acid (PSA). B, D5 cells were examined by confocal microscopy. Red, NCAM; green, polysialic acid (PSA). Left panel, surface image of myotubes; right panel, crosssection image of myotubes. Size markers, 20 µm for both A and B.
|
|
Four Isoforms of NCAM Are Expressed in C2C12 CellsTo determine how NCAM expression is regulated during C2C12 cell differentiation, we examined the amount of NCAM and its transcription. First we could observe several isoforms of NCAM protein by immunoblotting (Fig. 2B). The top band corresponds to the TM form of NCAM with MSD (155 kDa), and the middle thick band consists of two bands, the TM form without MSD (140 kDa) and GPI form with MSD (125 kDa). The lower band is the GPI form without MSD. These four isoforms were clearly separated after sialidase digestion (Fig. 2B, second row). The blot of sialidase-treated NCAM shows switching in the synthesis of NCAM from the TM form to the GPI + MSD form as differentiation progresses, consistent with the developmental change of NCAM isoforms in chick embryonic muscle (25). Lectin blots using PNA, which is specific for O-linked Gal
1-3GalNAc, showed that the GPI + MSD isoform is O-glycosylated during days 2-8 (Fig. 2B). Interestingly, O-glycosylation of TM+MSD and soluble forms of NCAM were also observed. We then examined the transcription of NCAM mRNAs by RT-PCR. RT-PCR analysis confirmed that NCAM was expressed as both GPI-anchoring and transmembrane (TM) isoforms, and that both isoforms contain various forms of MSD insertion (Fig. 2C). At the onset of myoblast fusion at around day 2, MSD began to be transcribed, and the levels of NCAM isoforms with MSD insertion (abcK, abK, and a) gradually increased. To characterize polysialylated NCAM expressed in C2C12 cells, polysialic acid-containing glycoproteins were immunoprecipitated from [3H]glucosamine-labeled C2C12 cells at day 6. The anti-polysialic acid antibody 5A5 immunoprecipitated NCAM and a smaller molecule with relative molecular mass around 40 kDa (Fig. 2D, lane 1). Polysialic acid is attached to N-glycans, since it was released by N-glycanase digestion (Fig. 2D, lane 2). Polysialic acid is mostly attached to the transmembrane form, NCAM-140 (Fig. 2D, lanes 4 and 5). From these analyses, it can be concluded that the GPI+MSD isoform of NCAM is O-glycosylated during the fusion process, whereas polysialylation is restricted to the transmembrane form of NCAM that does not contain MSD.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 2. Expression of NCAM muscle-specific domain during in vitro differentiation of C2C12 cells. A, schematic structures of mouse NCAM. MSD is flanked by two fibronectin type III domains (FNIII) and encoded by four exons. Ig, immunoglobulin-like domains. B, total cell lysate was separated by SDS-PAGE before and after sialidase treatment and blotted onto polyvinylidene difluoride membrane. The blot was reacted with anti-NCAM antibody. O-glycans of immunoprecipitated NCAM were visualized using PNA. NCAM containing TM, MSD, GPI-anchored NCAM, and soluble NCAM (sol) are shown. C, RT-PCR of MSD and GPI-anchored and TM-containing NCAM during differentiation of C2C12 cells. abcK, abK, acK, a, and no correspond to those in A, D, lanes 1-3, C2C12 cells were metabolically labeled with [3H]glucosamine at days 5-6 and immunoprecipitated with anti-polysialic acid antibody. Aliquots were treated without (lane 1) or with N-glycanase (lane 2) or with endoneuroaminidase-N (lane 3). Fluorography of [3H]-glucosamine-labeled proteins after separation on SDS-polyacrylamide gels is shown. Lanes 4 and 5, total proteins of C2C12 cells immunoprecipitated with anti-polysialic antibody (lane 4) or total cell lysate (lane 5) were separated on SDS-PAGE, blotted, and reacted with anti-NCAM antibody.
|
|
Abolition of MSD and Polysialic Acid on NCAM Differentially Alters Myoblast Fusion RateTo examine the effect of NCAM glycosylation on myoblast fusion, we constructed NCAM mutants lacking N-glycosylation sites that are preferentially polysialylated, or O-glycosylation sites in the MSD (Fig. 3A). In our previous study, we found that the fourth, fifth and sixth N-glycosylation sites of NCAM are preferentially polysialylated (15). On the other hand, from the results shown above (Fig. 2B) and from previous reports (4, 26), it can be concluded that O-glycans are attached to the MSD. Therefore, based on the structure of GPI anchoring isoforms present in nature, we constructed cDNAs encoding chimeric proteins of NCAM with and without N-glycosylation sites for polysialylation and with and without the MSD (Fig. 3A). Stable cell lines expressing each NCAM isoform were established, and the expression of transfected human NCAM was confirmed by immunoblot (Fig. 3B) and fluorescence-activated cell sorting analysis. The results shown in Fig. 3C indicate that C2C12 cells expressing NCAM+MSD (M-) tend to fuse faster, forming elongated mature myotubes at day 5, than cells expressing NCAM without MSD (M-) when they do not contain polysialylated N-glycans (N-). By contrast, C2C12 cells expressing polysialylated NCAM (N+) tend to fuse more slowly, and fused cells form round and short myotubes. Graphical representation of these results (Fig. 3D) indicates that C2C12 cells expressing NCAM containing the MSD (M+) showed enhanced fusion, whereas this MSD activity is not prominent when N-glycan polysialylation sites are intact (N+). These results clearly demonstrate that the MSD on NCAM has a positive effect, whereas have N-glycans containing polysialic acid on NCAM have a negative effect on myoblast fusion.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3. Effect of MSD and N-glycan polysialylation on C2C12 cell differentiation. A, schematic structure of NCAM with MSD (M+) or without MSD (M-) or with (N+) or without (N-) N-glycosylation sites for polysialylation. B, immunoblot analysis of C2C12 cells expressing different forms of NCAM at day 0. The same amount of total protein was applied to each lane. Transfected human NCAM was detected using anti-human NCAM antibody. C, immunofluorescent staining of myosin (green) and nuclei (blue) in C2C12 cells expressing different forms of NCAM at day 5. D, the number of fused cells (fusion index) in C2C12 cells expressing different forms of NCAM. Fusion index = (number of nuclei in fused cells, green)/(total nuclei) x 100%.
|
|
O-Linked Oligosaccharides Are Responsible for MSD ActivityIt has been reported that the XTPXP sequence is the most efficient acceptor for polypeptide O-GalNAc transferase-1 and that XTXXP functions as the second best acceptor (27). When we examined the amino acid sequence of NCAM, we observed that these preferential O-glycosylation sites are clustered in the MSD, as shown in Fig. 4A. Since this region is rich in proline, which prevents the formation of
-helices or
-sheets, the effect of MSD could be due to its unique structure. To examine whether myoblast fusion-promoting activity of the MSD is derived from O-glycosylation or peptide structure, potential O-glycosylated threonines were mutated to alanines by site-directed mutagenesis (Fig. 4A), and those mutated NCAMs were stably transfected into C2C12 cells (Fig. 4B). The mutation of one (TA1), two (TA2), and three (TA3) threonine residues, shown in Fig. 4A, resulted in decreased O-glycosylation as assessed by PNA staining (Fig. 4C). Moreover, NCAM lacking MSD (M-) did not show PNA staining, consistent with our conclusion that MSD contains O-glycans (Fig. 4C). As shown in Fig. 4, D and E, mutating just one threonine to alanine in the MSD region (TA1) dramatically reduced fusion competency. When two or three of the threonine residues were mutated (TA2, TA3), the MSD fusion-promoting activity was reduced to a level equivalent to NCAM without the MSD (M-N-). These results indicate that specific O-glycans in MSD are critical for MSD activity promoting myoblast fusion.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4. Mutation of NCAM O-glycosylation sites reduces C2C12 myoblast fusion. A, amino acid sequences of the MSD in wild-type (WT) and mutated (TA1-3) human NCAM. Threonines were mutated to alanines. B, immunoblot analysis of NCAM containing only MSD (M+N-), no MSD (M-N-), or TA1, TA2, and TA3 mutant NCAM (N-). C, Western blot analysis of NCAM containing MSD (M+), no MSD (M-), or mutants TA1, TA2, and TA3 NCAM. The same NCAM proteins shown in B were produced in Lec 1 cells, and extent of O-glycosylation was assessed using PNA. The density of PNA and O-glycosylated NCAM (indicated by bars on the right) were scanned and relative density of PNA/NCAM was shown at the bottom panel. One representative result of two separate experiments is shown here. D, immunofluorescent staining of myosin (green) and nuclei (blue) expressed in C2C12 cells at day 5, which were transfected with different forms of NCAM. E, the number of fused cells (fusion index) at different days of differentiation.
|
|
Overexpression of Polysialic Acid Inhibits Myoblast FusionTwo mammalian polysialyltransferases, ST8Sia II and ST8Sia IV, have been cloned and characterized so far (9-13). C2C12 cells were found to express the transcripts for both ST8Sia II and ST8Sia IV (Fig. 5A, upper panel). Competitive PCR revealed that the amounts of both enzymes gradually increase during C2C12 cell differentiation (Fig. 5A, lower panel). An increase in the expression levels of polysialyltransferases is consistent with the results shown in Fig. 1, showing that polysialic acid is expressed on the outer surface of mature myotubes. As shown above, the presence of N-glycosylation/polysialylation sites inhibits myoblast fusion (Fig. 3). These results suggest that polysialic acid probably inhibits the formation of large myotubes. To delineate the effect of polysialic acid on myoblast fusion, a vector encoding ST8Sia IV-CFP fusion protein was constructed, and stable C2C12 cell lines expressing ST8Sia IV-CFP were established. The fusion of these C2C12 cell lines overexpressing polysialic acid was almost completely inhibited as shown in Fig. 5, B and C. When ST8Sia IV expression was induced in the middle of fusion stages using ecdysone-inducible vector, the fusion rate was decreased (Fig. 5D). Similar fusion-inhibitory effect was obtained when ST8Sia II-CFP was transiently transfected into C2C12 (see below). These results combined indicate that the expression of polysialic acid in early stages of differentiation inhibits myoblast fusion.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 5. Polysialylation impairs C2C12 myoblast fusion. A, RT-PCR of ST8Sia IV, ST8Sia II, and -actin (upper panel) during C2C12 differentiation. The lower panel represents the estimation of amounts of ST8Sia IV and ST8Sia II transcripts by competitive PCR. B, immunofluorescent staining of myosin (green) and nuclei (blue) in parental C2C12 cells (Ctrl) and C2C12 cells transfected with ST8Sia IV cDNA. C, fusion index at different days from the initiation of differentiation. D, fusion index of a cell line with ecdyson, inducible promoter-ST8Sia IV. The expression of ST8Sia IV was induced at day 2 (bar) by the addition of inducer (closed circle). Open circle, without the inducer.
|
|
NCAM Transmembrane Isoform Is Polysialylated by Exogenous PolysialyltransferaseTo confirm that NCAM is polysialylated in C2C12 cells overexpressing ST8Sia IV, NCAM was isolated from the stable cell line C2C12-ST8Sia IV, and the length of polysialic acid of NCAM was analyzed. After metabolic labeling with [3H]glucosamine from day 2 to day 3, NCAM was immunoprecipitated from the cell extract. Fig. 6A shows that control C2C12 cells express four NCAM isoforms, whereas C2C12-ST8Sia IV cells express only two isoforms. This finding was confirmed by RT-PCR of NCAM transcripts, and the amount of NCAM transcripts encoding abcK, abK, and a forms of MSD were significantly reduced in C2C12 cells transfected with ST8Sia IV (Fig. 6B). These results indicate that expression of polysialic acid delays or inhibits the expression of NCAM containing MSD in C2C12 cells.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6. NCAM and NCAM glycans expressed in parental C2C12 cells and ST8Sia IV-transfected C2C12 cells. A, analysis of NCAM proteins on parental C2C12 (Ctrl) and ST8Sia IV-transfected (ST8Sia IV) C2C12 cells. Total cell lysates were subjected to SDS-polyacrylamide gel electrophoresis followed by immunoblot of NCAM. Note that C2C12-ST8Sia IV cells do not contain NCAM containing MSD. B, RT-PCR of transcripts encoding different forms of NCAM was carried out for different differentiation days of C2C12 as shown in Fig. 2C. Note that MSD-containing transcripts were significantly decreased in ST8Sia IV-transfected C2C12 cells. C, parental (Ctrl) and ST8Sia IV-transfected (ST8Sia IV) C2C12 cells are metabolically labeled with [3H]glucosamine at days 2-3, and NCAM was immunoprecipitated. N-glycans were released by N-glycanase treatment of four different NCAM isoforms shown in A and subjected to Mono-Q anionic exchange chromatography. Endoneuraminidase-treated samples are also shown (EN). Numbers denote the number of sialic acid residues in a glycan, calibrated by oligosialic acid and polysialic acid obtained by partial acid hydrolysis of colominic acid.
|
|
We then estimated the amount of polysialic acid attached to each NCAM isoform. C2C12 cells were metabolically labeled with [3H]glucosamine, and NCAM isoforms corresponding TM+MSD, TM, GPI+MSD and GPI were isolated. Fig. 6C clearly demonstrates that TM isoforms of either control C2C12 or C2C12-ST8Sia IV are oligosialylated, and the number of polysialic acids was as high as 7 on NCAM from C2C12-ST8Sia IV, in contrast to that of NCAM from control C2C12 cells containing 1-4 sialic acids. After endoneuraminidase digestion of N-glycans, oligosialic acid containing 1-4 sialic acids was produced (see EN in Fig. 7C), as expected from the specificity of endoneuraminidase that cannot break down oligosialic acids containing fewer than four sialic acids (28). The same results also indcate that these acidic oligosaccharides are
2,8-linked oligosialic acids. Taken together, these results indicate that the NCAM transmembrane isoform of C2C12 cells overexpressing ST8Sia IV is polysialylated. By contrast, GPI-anchored NCAM contains a negligible amount of polysialic acid. It is noteworthy that attachment of multiple but short polysialic acids to NCAM exerted significant inhibitory effect on myoblast fusion.

View larger version (90K):
[in this window]
[in a new window]
|
FIG. 7. Polysialyltransferase-mediated inhibition of myoblast fusion can be reversed by antisense DNA of polysialyltransferases. A, C2C12 cells transiently transfected with ST8Sia II (top) or ST8Sia IV (bottom), shown in green, are devoid of myosin (red). B, effect of antisense DNA (+AS) encoding ST8Sia IV, ST8Sia II on C2C12 and RD cells. For RD cells, antisense DNAs for both STS8Sia II and ST8Sia IV were introduced. Red, myosin; green, polysialic acid. C, RT-PCR of ST8Sia II, ST8Sia IV and -actin transcripts of parental C2C12 cells and rhabdomyosarcoma RD and TE671 cells.
|
|
Antisense DNA of Polysialyltransferases Restores Fusion CompetencyTo confirm that C2C12 cells overexpressing ST8Sia II or ST8Sia IV do not differentiate into myotubes, ST8Sia II or ST8Sia IV was transiently expressed in C2C12 cells. Fig. 7A shows that ST8Sia II- or ST8Sia IV-positive cells (green) were negative for differentiation marker myosin (red), supporting the above conclusion that myoblast fusion is inhibited by polysialylation.
To verify that polysialylation inhibits myoblast fusion, the expression of ST8Sia II or ST8Sia IV was inhibited by antisense DNA. As shown in Fig. 7B, the antisense DNA of each polysialyltransferase suppressed the expression of polysialic acid (green) in C2C12 cells that were stably transfected with ST8Sia II or ST8Sia IV, and the differentiation marker myosin (red) appeared as differentiation was induced (+AS panel). By contrast, myosin synthesis was not induced in control ST8Sia II- or ST8Sia IV-transfected C2C12 cells (upper panel of Fig. 7B).
As an extension of the experiment above, antisense DNA of ST8Sia IV and ST8Sia II were transiently introduced into tumor cell lines. We screened several rhabdomyosarcoma cell lines and found that RD and TE671 are strongly positive for polysialic acid expression. These cells apparently express higher amounts of ST8Sia II and ST8Sia IV transcripts than do C2C12 cells at day 0 (Fig. 7C). After introduction of antisense DNA for both ST8Sia II and ST8Sia IV, the expression of polysialic acid on RD was diminished, and induction of myosin could be observed (Fig. 7B), By contrast, the parent RD cells did not synthesize myosin even after culturing in differentiation-induction medium (Fig. 7B, upper panel). Given these results, it is tempting to hypothesize that up-regulation of polysialic acid synthesis in rhabdomyosarcoma prevents myoblast fusion, and as a result, these muscle tumor cell lines cannot differentiate into mature multinucleated myocytes.
 |
DISCUSSION
|
|---|
Using in vitro cell culture system C2C12, we determined that two types of glycosylation of NCAM regulate myoblast fusion. O-Glycans attached to the MSD promote myoblast fusion, whereas polysialylation of N-glycans attached to NCAM prevents myoblast fusion. Since mutation of O-glycan attachment sites at MSD abolishes the effect on myoblast fusion, O-glycosylation at MSD is critical for facilitating myoblast fusion. Polysialic acid, on the other hand, could be a termination signal to block further cell fusion, preventing the formation of overly thick myotubes. It was reported that polysialic acid is attached to mucin type O-glycans in breast carcinoma and leukemic cells, although the glycoproteins containing polysialic acid have not been identified (29). Similarly, polysialic acid was shown to be attached to O-linked oligosaccharides present in rainbow trout egg glycoproteins (30). By contrast, in C2C12 cells, polysialic acid is concluded to be attached to N-glycans of NCAM.
Mucin type O-glycans are found in several glycoproteins such as intestinal mucins, selectin ligands on leukocytes, lysosomal glycoproteins LAMP-1 and 2, antifreeze glycoproteins, cytokines, and others (for a review, see Ref. 31). In most of these cases, mucin type O-glycans are clustered so that they could function as armor against protease attack or could present multiple ligands on O-glycans for a receptor. Indeed, we demonstrate in the present study that O-glycosylation takes place only on an MSD that contains multiple O-glycosylation sites. The structure of those O-glycans contains Gal
1-3GalNAc
1-Ser/Thr, and some of them are sialylated (4, 26).
There is no evidence that O-glycans in NCAM function as ligands. On the other hand, it is possible that O-glycans contribute to maintain the three-dimensional structure of NCAM that efficiently facilitates myoblast fusion. Recently, it was reported that N-acetylgalactosamine residues of mucin type O-glycans stabilize peptide backbone structure (32). NMR analysis of GalNAc
1
Ser/Thr-containing synthetic glycopeptides revealed that the N-acetylamide proton of GalNAc and oxygen of threonine (or serine) residues form hydrogen-bonding interactions so that the structure of a backbone peptide is stabilized, and free rotation of the peptide is prevented. As a result, the peptide portion forms a rigid, rodlike structure, and the carbohydrate moiety is presented outward from a polypeptide as seen in CD43 (leukosialin) (33). This model most likely can be applied to the MSD. It is conceivable that the structure of NCAM without MSD is relatively flexible, whereas insertion of MSD and O-glycosylation provides an NCAM conformation favorable for membrane fusion. This hypothesis is consistent with our finding that the effect on membrane fusion was more dramatic than the decrease in O-glycans after threonine residues were mutated, suggesting that the mutation of specific O-glycosylation site(s) causes conformational change in NCAM. Further investigation of NCAM conformation is required to test this hypothesis.
RT-PCR of endogenous MSD variants in C2C12 indicated that various forms of MSD exist due to alternative mRNA splicing of four exons encoding MSD. On the other hand, decreased levels of O-glycans through mutation of O-glycosylation sites in the MSD of transfected NCAM reduced MSD fusion-promoting activity in a dose-response manner. It is thus tempting to speculate that variation of O-glycan content by alternative mRNA splicing of the MSD regulates the function of NCAM-MSD during myoblast fusion.
In the present study, we also found that polysialylation of NCAM in an early stage of differentiation prevents C2C12 myoblast fusion. Surprisingly, this inhibition is associated with the loss of NCAM containing MSD. The molecular mechanism of how overly expressed polysialic acid prevents myoblast fusion and thus prevents the synthesis of NCAM containing MSD is not clear, although we can propose several hypotheses. First, the surface of cells is negatively charged with phospholipids and other components. When a polymer of cations (i.e. a polyelectrolyte such as polylysine) is applied to liposomes, it promotes membrane fusion of the lipid bilayer, as seen in the liposome transfection method (34). If a polyanion such as polysialic acid is applied, on the other hand, it should prevent membrane fusion.
A second possibility is that polysialic acid may function to concentrate growth factors such as fibroblast growth factor (FGF) and transfer these factors to the receptor. Basic FGF is known to inhibit myoblast fusion of MM14 cells (35). By contrast, if heparan sulfate is present in the extracellular matrix, it captures basic FGF, and basic FGF is not transferred to its receptor, promoting myoblast differentiation (36). In other reports, NCAM is thought to couple with FGF receptors, thereby facilitating neurite outgrowth (37, 38) or pancreatic tumor cell metastasis (39). Similarly, it has been reported that NCAM can associate with a receptor for members of signaling glial cell line-derived neutrophic factor (40). Synthetic sulfated polysialic acid binds to abasic FGF and basic FGF as strongly as heparin (41). It is thus possible that polysialic acid of NCAM on myotubes concentrates FGF and presents it to FGF receptors, thus providing a signal to stop further myoblast fusion.
In this report, we also found that the RD and TE671 rhabdomyosarcoma cell lines, which express significant amounts of polysialic acid, can be induced to differentiate by inhibiting the expression of ST8Sia II and ST8sia IV. The expression of polysialic acid was shown to be positively correlated with the progression of rhabdomyosarcomas (42). In another study, RD cells were cloned into those synthesizing myosin and those synthesizing no myosin. When they were inoculated into nude mice, myosin-positive, differentiated RD cells did not metastasize to the lung, whereas myosin-negative RD cells did (43). Similarly, polysialic acid-specific endoneuraminidase treatment of TE671 cells decreased the number of lung or liver metastases in nude mice (44). It has been demonstrated that approximately half of alveolar rhabdomyosarcoma is caused by a genetic alteration of transcription factor Pax3-FKHR (45). This genetic alteration may cause an up-regulation of ST8Sia II, since ST8Sia II transcription is thought to be controlled by Pax3 (46).
NCAM-deficient mice have been generated and show no gross anatomical defect in muscular development (47, 48). Close examination of the neuromuscular junction, however, shows that the size of end plates was smaller and the formation of junctional fold was delayed (49). In transgenic mice overexpressing the human 125-kDa NCAM isoform, secondary myoblast fusion is apparently enhanced, resulting in larger diameter and fewer numbers of myofibers (7). These results are consistent with our findings that the balance between NCAM-MSD and polysialylated NCAM is critical for the formation of proper myotube bundles.
Recently, glycosyltransferases that synthesize O-mannosyl oligosaccharides of
-dystroglycans such as O-mannosyltransferase POMT-1 were found to be responsible for Walker-Warburg syndrome (50), and
1,2-N-acetylglucosaminyl transferase POMGnT-1 was identified to be a causative gene of muscle-eye-brain disease (51). In addition, fukutin is mutated in Fukuyama type congenital muscular dystrophy (52), LARGE is mutated in muscular dystrophy mice myd (53), both fukutin and LARGE have homology to glycosyltransferases (54-56), and these gene products probably glycosylate
-dystroglycan (57). These results indicate that mutation of several genes involved in glycosylation of muscle cells can cause muscular dystrophy.
In this report, we showed that mucin type O-glycosylation of NCAM promotes myoblast fusion, but polysialylation of NCAM inhibits myoblast fusion. In contrast to species such as Drosophila, which lack polysialylation, vertebrates have developed a finely tuned system of molecular interactions using differentially glycosylated cell adhesion molecules such that cells can control complex events including myoblast fusion. We expect that such an elaborate role of glycosylation is critical in many biological systems.
 |
FOOTNOTES
|
|---|
This article is dedicated to the memory of Dr. Makoto Takeuchi.
* This work was supported by National Institutes of Health Grants CA33895 and CA33000 (to M. F.) and Ministry of Education, Culture, Sports, Science, and Technology of Japan Grant 14082201 (to J. N.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
To whom correspondence should be addressed: The Burnham Institute, 10901 N. Torrey Pines Rd., La Jolla, CA 92037. Tel.: 858-646-3144; Fax: 858-646-3193; E-mail: minoru{at}burnham.org.
1 The abbreviations used are: NCAM, the neural cell adhesion molecule; GPI, glycosylphosphatidylinositol; MSD, muscle-specific domain; PNA, peanut agglutinin; CFP, cyan fluorescence protein; DME, Dulbecco's modified Eagle's medium; FITC, fluorescein isothiocyanate; PBS, phosphate-buffered saline; TM, transmembrane; FGF, fibroblast growth factor; RT, reverse transcriptase. 
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Patrick Doherty and Frank Walsh for the gifts of human NCAM cDNAs; Drs. Assou El-Battari, Nobuyoshi Hiraoka, Yu Yamaguchi, Edgar Ong, and Erkki Rouslahti for critical discussion; Drs. Eva Engvall and Ling Liu for cells; Cheryl Silao for cell sorting; and Dr. Elise Lamar for critical reading of the manuscript.
 |
REFERENCES
|
|---|
- Knudsen, K. A. (1991) in Membrane Fusion (Wilschut, J., and Hoekstral, D., eds) pp. 601-626, Dekker, New York
- Knudsen, K. A., McElwee, S. A., and Smith, L. (1990) Dev. Biol. 138, 159-168[CrossRef][Medline]
[Order article via Infotrieve]
- Schwander, M., Leu, M., Stumm, M., Dorchies, O. M., Ruegg, S. T., Schittny, J., and Muller, U. (2003) Dev. Cell, 4, 673-685[CrossRef][Medline]
[Order article via Infotrieve]
- Walsh, F. S., Parekh, R. B., Moore, S. E., Dickson, G., Barton, C. H., Gower, H. J., Dwek, R. A., and Rademacher, T. W. (1989) Development 105, 803-811[Abstract/Free Full Text]
- Dickson, G., Gower, H. J., Barton, C. H., Prentice, H. M., Elsom, V. L., Moore, S. E., Cox, R. D., Quinn, C., Putt, W., and Walsh, F. S. (1987) Cell 50, 1119-1130[CrossRef][Medline]
[Order article via Infotrieve]
- Dickson, G., Peck, D., Moore, S. E., Barton, C. H., and Walsh, F. S. (1990) Nature 344, 348-351[CrossRef][Medline]
[Order article via Infotrieve]
- Fazeli, S., Wells, D. J., Hobbs, C., and Walsh, F. S. (1996) J. Cell Biol. 135, 241-251[Abstract/Free Full Text]
- Angata, K., and Fukuda, M. (2003) Biochimie (Paris) 85, 195-206
- Livingston, B. D., and Paulson, J. C. (1993) J. Biol. Chem. 268, 11504-11507[Abstract/Free Full Text]
- Eckhardt, M., Muhlenhoff, M., Bethe, A., Koopman, J., Frosch, M., and Gerardy-Schahn, R. (1995) Nature 373, 715-718[CrossRef][Medline]
[Order article via Infotrieve]
- Nakayama, J., Fukuda, M. N., Fredette, B., Ranscht, B., and Fukuda, M. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7031-7035[Abstract/Free Full Text]
- Kojima, N., Yoshida, Y., Kurosawa, N., Lee, Y. C., and Tsuji, S. (1995) FEBS Lett. 360, 1-4[CrossRef][Medline]
[Order article via Infotrieve]
- Scheidegger, E. P., Sternberg, L. R., Roth, J., and Lowe, J. B. (1995) J. Biol. Chem. 270, 22685-22688[Abstract/Free Full Text]
- Nelson, R. W., Bates, P. A., and Rutishauser, U. (1995) J. Biol. Chem. 270, 17171-17179[Abstract/Free Full Text]
- Angata, K., Suzuki, M., and Fukuda, M. (1998) J. Biol. Chem. 273, 28524-28532[Abstract/Free Full Text]
- Close, B. E., Mendiratta, S. S., Geiger, K. M., Broom, L. J., Ho, L. L., and Colley, K. J. (2003) J. Biol. Chem. 278, 30796-30805[Abstract/Free Full Text]
- Eckhardt, M., Bukalo, O., Chazal, G., Wang, L., Goridis, C., Schachner, M., Gerardy-Schahn, R., Cremer, H., and Dityatev, A. (2000) J. Neurosci. 20, 5234-5244[Abstract/Free Full Text]
- Dodd, J., Morton, S. B., Karagogeos, D., Yamamoto, M., and Jessell, T. M. (1988) Neuron 1, 105-116[CrossRef][Medline]
[Order article via Infotrieve]
- Franceschini, I., Angata, K., Ong, E., Hong, A., Doherty, P., and Fukuda, M. (2001) Glycobiology 11, 231-239[Abstract/Free Full Text]
- Angata, K., Nakayama, J., Fredette, B., Chong, K., Ranscht, B., and Fukuda, M. (1997) J. Biol. Chem. 272, 7182-7190[Abstract/Free Full Text]
- Angata, K., Yen, T. Y., El-Battari, A., Macher, B. A., and Fukuda, M. (2001) J. Biol. Chem. 276, 15369-15377[Abstract/Free Full Text]
- Yeh, J. C., Hiraoka, N., Petryniak, B., Nakayama, J., Ellies, L. G., Rabuka, D., Hindsgaul, O., Marth, J. D., Lowe, J. B., and Fukuda, M. (2001) Cell 105, 957-969[CrossRef][Medline]
[Order article via Infotrieve]
- Ong, E., Nakayama, J., Angata, K., Reyes, L., Katsuyama, T., Arai, Y., and Fukuda, M. (1998) Glycobiology 8, 415-424[Abstract/Free Full Text]
- Fredette, B., Rutishauser, U., and Landmesser, L. (1993) J. Cell Biol. 123, 1867-1888[Abstract/Free Full Text]
- Yoshimi, T., Mimura, N., Aimoto, S., and Asano, A. (1993) Cell Struct. Funct. 18, 1-11[Medline]
[Order article via Infotrieve]
- Ong, E., Suzuki, M., Belot, F., Yeh, J. C., Franceschini, I., Angata, K., Hindsgaul, O., and Fukuda, M. (2002) J. Biol. Chem. 277, 18182-18190[Abstract/Free Full Text]
- Yoshida, A., Suzuki, M., Ikenaga, H., and Takeuchi, M. (1997) J. Biol. Chem. 272, 16884-16888[Abstract/Free Full Text]
- Finne, J., and Makela, P. H. (1985) J. Biol. Chem. 260, 1265-1270[Abstract/Free Full Text]
- Martersteck, C. M., Kedersha, N. L., Drapp, D. A., Tsui, T. G., and Colley, K. J. (1996) Glycobiology 6, 289-301[Abstract/Free Full Text]
- Kitazume, S., Kitajima, K., Inoue, S., Inoue, Y., and Troy, F. A., II (1994) J. Biol. Chem. 269, 10330-10340[Abstract/Free Full Text]
- Fukuda, M. (1994) in Molecular Glycobiology (Fukuda, M., and Hindsgaul, O., eds) pp. 1-52, Oxford University Press, Oxford, UK
- Coltart, D. M., Royyuru, A. K., Williams, L. J., Glunz, P. W., Sames, D., Kuduk, S. D., Schwarz, J. B., Chen, X. T., Danishefsky, S. J., and Live, D. H. (2002) J. Am. Chem. Soc. 124, 9833-9844[CrossRef][Medline]
[Order article via Infotrieve]
- Cyster, J. G., Shotton, D. M., and Williams, A. F. (1991) EMBO J. 10, 893-902[Medline]
[Order article via Infotrieve]
- Gad, AE., Elyashiv, G., and Rosenberg, N. (1986) Biochim. Biophys. Acta 860, 314-324
- Clegg, C. H., Linkhart, T. A., Olwin, B. B., and Hauschka, S. D. (1987) J. Cell Biol. 105, 949-956[Abstract/Free Full Text]
- Rapraeger, A. C., Krufka, A., and Olwin, B. B. (1991) Science 252, 1705-1708[Abstract/Free Full Text]
- Williams, E. J., Walsh, F. S., and Doherty, P. (2003) J. Cell Biol. 160, 481-486[Abstract/Free Full Text]
- Kolkova, K., Novitskaya, V., Pedersen, N., Berezin, V., and Bock, E. (2000) J. Neurosci. 20, 2238-2246[Abstract/Free Full Text]
- Cavallaro, U., Niedermeyer, J., Fuxa, M., and Christofori, G. (2001) Nat. Cell Biol. 3, 650-657[CrossRef][Medline]
[Order article via Infotrieve]
- Paratcha, G., Ledda, F., and Ibanez, C. F. (2003) Cell 113, 867-879[CrossRef][Medline]
[Order article via Infotrieve]
- Kunou, M., Koizumi, M., Shimizu, K., Kawase, M., and Hatanaka, K. (2000) Biomacromolecules 1, 451-458[CrossRef][Medline]
[Order article via Infotrieve]
- Gluer, S., Schelp, C., Von Schweinitz, D., and Gerardy-Schahn, R. (1998) Pediatric Res. 43, 145-147[Medline]
[Order article via Infotrieve]
- Lollini, P. L., De Giovanni, C., Landuzzi, L., Nicoletti, G., Scotlandi, K., and Nanni, P. (1991) Invasion & Metastasis 11, 116-124[Medline]
[Order article via Infotrieve]
- Daniel, L., Durbec, P., Gautherot, E., Rouvier, E., Rougon, G., and Figarella-Branger, D. (2001) Oncogene 20, 997-1004[CrossRef][Medline]
[Order article via Infotrieve]
- Biegel, J. A., Nycum, L. M., Valentine, V., Barr, F. G., and Shapiro, D. N. (1995) Genes Chromosomes Cancer 12, 186-192[Medline]
[Order article via Infotrieve]
- Mayanil, C. S., George, D., Freilich, L., Miljan, E. J., Mania-Farnell, B., McLone, D. G., and Bremer, E. G. (2001) J. Biol. Chem. 276, 49299-49309[Abstract/Free Full Text]
- Tomasiewicz, H., Ono, K., Yee, D., Thompson, C., Goridis, C., Rutishauser, U., and Magnuson, T. (1993) Neuron 11, 1163-1174[CrossRef][Medline]
[Order article via Infotrieve]
- Cremer, H., Lange, R., Christoph, A., Plomann, M., Vopper, G., Roes, J., Brown, R., Baldwin, S., Kraemer, P., Scheff, S., Barthels, D., Rajewsky, K., and Wille, W. (1994) Nature 367, 455-459[CrossRef][Medline]
[Order article via Infotrieve]
- Moscoso, L. M., Cremer, H., and Sanes, J. R. (1998) J. Neurosci. 18, 1465-1477[Abstract/Free Full Text]
- Beltran-Valero de Bernabe, D., Currier, S., Steinbrecher, A., Celli, J., van Beusekom, E., van der Zwaag, B., Kayserili, H., Merlini, L., Chitayat, D., Dobyns, W. B., Cormand, B., Lehesjoki, A. E., Cruces, J., Voit, T., Walsh, C. A., van Bokhoven, H., and Brunner, H. G. (2002) Am. J. Hum. Genet. 71, 1033-1043[CrossRef][Medline]
[Order article via Infotrieve]
- Yoshida, A., Kobayashi, K., Manya, H., Tanigushi, K., Kano, H., Mizuno, M., Inazu, T., Mitsuhashi, H., Takahashi, S., Takeuchi, M., Herrmann, R., Straub, V., Talim, B., Voit, T., Topaloglu, H., Toda, T., and Endo, T. (2001) Dev. Cell 1, 717-724[CrossRef][Medline]
[Order article via Infotrieve]
- Kobayashi, K., Nakahori, Y., Miyake, M., Matsumura, K., Kondo-Iida, E., Nomura, Y., Segawa, M., Yoshioka, M., Saito, K., Osawa, M., Hamano, K., Sakakihara, Y., Nonaka, I., Nakagome, Y., Kanazawa, I., nakamura, Y., Tokunaga, K., and Toda, T. (1998) Nature 394, 388-392[CrossRef][Medline]
[Order article via Infotrieve]
- Grewal, P. K., Holzfeind, P. J., Bittner, R. E., and Hewitt, J. E. (2001) Nat. Genet. 28, 151-154[CrossRef][Medline]
[Order article via Infotrieve]
- Aravind, L., and Koonin, E. V. (1999) Curr. Biol. 9, R836-R837[CrossRef][Medline]
[Order article via Infotrieve]
- Jigami, Y., and Odani, T., (1999) Biochim. Biophys. Acta 1426, 335-345[Medline]
[Order article via Infotrieve]
- Sasaki, K., Kurata-Miura, K., Ujita, M., Angata, K., Nakagawa, S., Sekine, S., Nishi T., and Fukuda, M. (1997) Proc. Natl. Acad. Sci. 94, 14294-14299[Abstract/Free Full Text]
- Michele, D. E., Barresi, R., Kanagawa, M., Saito, F., Cohn, R. D., Satz, J. S., Dollar, J., Nishino, I., Kelley, R. I., Somer, H., Straub, V., Mathews, K. D., Moore, S. A., and Campbell, K. P. (2002) Nature 418, 417-422[CrossRef][Medline]
[Order article via Infotrieve]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H.-K. Guttormsen, L. C. Paoletti, K. G. Mansfield, W. Jachymek, H. J. Jennings, and D. L. Kasper
Rational chemical design of the carbohydrate in a glycoconjugate vaccine enhances IgM-to-IgG switching
PNAS,
April 15, 2008;
105(15):
5903 - 5908.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Nakata and F. A. Troy II
Degree of Polymerization (DP) of Polysialic Acid (PolySia) on Neural Cell Adhesion Molecules (N-CAMs): DEVELOPMENT AND APPLICATION OF A NEW STRATEGY TO ACCURATELY DETERMINE |