Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M307953200 on September 15, 2003

J. Biol. Chem., Vol. 278, Issue 49, 49469-49477, December 5, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/49/49469    most recent
M307953200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Réglier-Poupet, H.
Right arrow Articles by Raynaud, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Réglier-Poupet, H.
Right arrow Articles by Raynaud, C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Maturation of Lipoproteins by Type II Signal Peptidase Is Required for Phagosomal Escape of Listeria monocytogenes*

Hélène Réglier-Poupet, Claude Frehel, Iharilalao Dubail, Jean-Luc Beretti, Patrick Berche, Alain Charbit{ddagger}, and Catherine Raynaud, Supported by a fellowship from the "Fondation pour la Recherche Médicale."§

From the INSERM U570, Faculté de Médecine Necker-Enfants Malades, 156 rue de Vaugirard, 75730 Paris cedex 15, France

Received for publication, July 22, 2003 , and in revised form, September 5, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Lipoproteins of Gram-positive bacteria are involed in a broad range of functions such as substrate binding and transport, antibiotic resistance, cell signaling, or protein export and folding. Lipoproteins are also known to initiate both innate and adaptative immune responses. However, their role in the pathogenicity of intracellular microorganisms is yet poorly understood. In Listeria monocytogenes, a Gram-positive facultative intracellular human pathogen, surface proteins have important roles in the interactions of the microorganism with the host cells. Among the putative surface proteins of L. monocytogenes, lipoproteins constitute the largest family. Here, we addressed the role of the signal peptidase (SPase II), responsible for the maturation of lipoproteins in listerial pathogenesis. We identified a gene, lsp, encoding a SPase II in the genome of L. monocytogenes and constructed a {Delta}lsp chromosomal deletion mutant. The mutant strain fails to process several lipoproteins demonstrating that lsp encodes a genuine SPase II. This defect is accompanied by a reduced efficiency of phagosomal escape during infection of eucaryotic cells, and leads to an attenuated virulence. We show that lsp gene expression is strongly induced when bacteria are still entrapped inside phagosomes of infected macrophages. The data presented establish, thus, that maturation of lipoproteins is critical for efficient phagosomal escape of L. monocytogenes, a process temporally controlled by the regulation of Lsp production in infected cells.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Listeria monocytogenes is a ubiquitous food-borne Gram-positive bacterium, responsible for life threatening infections in humans and animals (1). It is a facultative intracellular pathogen able to enter and multiply in both professional (2) and non-professional phagocytes such as epithelial cells (3) or hepatocytes (4). After entry, bacteria rapidly lyse the phagosomal membranes and gain access to the cytosol where they spread to adjacent cells by an actin-based motility process (5). Most of the virulence factors of L. monocytogenes, identified to date, are either secreted or surface-associated proteins (6). Several distinct mechanisms of cell wall attachment and display of surface proteins have been described in Gram-positive bacteria (7). Among them, bacterial lipoproteins form a subclass of exported proteins that are involved in a broad range of functions such as: (i) substrate-binding proteins, in ABC transporter systems; (ii) antibiotic resistance; (iii) cell signaling; (iv) protein export and folding; and (v) sporulation, germination, and conjugation (8). In addition, lipoproteins are known to initiate both innate and adaptative immune responses in activating nuclear factor-{kappa}B, cytokine production, and B-cell expansion through the interaction with human Toll-like receptor-2 (9). However, the role of lipoproteins in the pathogenicity of intracellular bacteria is yet poorly understood.

Two main genetic approaches can be undertaken to address the role of lipoproteins in pathogenesis. The first one consists of inactivating individually each of the genes encoding putative lipoproteins and study the properties of the mutant strains. This approach requires extensive work because the number of genes to inactivate is important (20 to >100) and may prove inefficient in the case of proteins with overlapping functions. The second approach consists of inactivating the gene encoding the signal peptidase responsible for their maturation. Indeed, the NH2-terminal signal sequences of lipoproteins are specifically processed by a unique signal peptidase, named type II signal peptidase (or SPase II).1 Maturation of lipoproteins by SPase II, initially described in Gram-negative bacteria (10), has been recently studied in Gram-positive bacteria, and especially in Bacillus subtilis (11, 12). SPases II remove signal peptides from the lipoproteins first modified by a diacylglyceryltransferase (Lgt). This step could be inhibited by globomycin, a reversible and non-competitive peptide inhibitor (13, 14). After cleavage, the step of N-acylation of the cysteine observed in Escherichia coli was not described in B. subtilis, probably because of the absence of the lnt gene responsible of the lipoprotein aminoacyltransferase.

Among the 133 putative surface proteins of the L. monocytogenes genome (15), lipoproteins constitute the largest family (i.e. 2.5% of all genes), with 68 members. The lipoprotein signal peptide is characterized by a well conserved lipobox preceding a cysteine residue. The signal sequences of the putative lipoproteins encoded by the genome of L. monocytogenes are listed in Table I.


View this table:
[in this window]
[in a new window]
 
TABLE I
Putative lipoproteins of L. monocytogenes

The lipoprotein signal peptide is characterized by a well conserved lipobox of 4 residues. Invariably, the carboxyl-terminal residue of the lipobox is cysteine, which is modified by the addition of fatty acids that anchor the protein in the membrane (41). The sequence of the amino acids around this cysteine residue in lipoprotein precursors is relatively well conserved, and their signal peptides have several features that distinguish them from precursors of other bacterial-exported proteins. The charged NH2-terminal amino acid residues preceding the hydrophobic core region of the signal peptide are indicated in bold. The conserved residues of the lipobox, preceding the putative lipidated cysteine (in bold), are underlined. Lmo2637, identified by microsequencing, Lmo1847 (corresponding to LpeA), and Lmo2196 (corresponding to OppA) are shaded in gray.

 
Preliminary experimental data on the role of two of them have been recently obtained in our laboratory: (i) OppA that belongs to an oligopeptide ABC-like transporter, required for bacterial growth at low temperature (16); and (ii) LpeA an adhesin-like protein favoring entry of L. monocytogenes into non-professional phagocytes (17). Individual inactivation of these genes had no effect on bacterial virulence.

Here, we focused on a gene, designated lsp, encoding a potential SPase II in the genome of L. monocytogenes. We constructed a {Delta}lsp chromosomal deletion mutant and studied its characteristics. Our analyses demonstrate that the lsp gene product is a genuine SPase II involved in the processing of lipoproteins, and that this process is critical for efficient phagosomal escape and intracellular survival of L. monocytogenes. We also monitored the expression of lsp during the infectious process. The data suggest that maturation of lipoproteins might be temporally controlled by the regulation of Lsp production inside infected cells.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial Strains, Plasmids, and Growth Conditions—We used the reference strain of L. monocytogenes EGD-e belonging to serovar 1/2a recently sequenced (15). Brain heart infusion (BHI; Difco Laboratories, Detroit, MI) and Luria-Bertani (LB, Difco) broth and agar were used to grow L. monocytogenes and E. coli strains, respectively. Strains harboring plasmids were grown in the presence of the following antibiotics: pCRTM derivatives, kanamycin (Km) 50 µg/ml; pAUL-A derivatives, erythromycin (Em) 150 (E. coli) and 5 µg/ml (L. monocytogenes). To analyze mutant bacteria, we studied 50 metabolic characters on API-50 strips (Biomerieux, Marcy l'Etoile, France).

Genetic Manipulations—Chromosomal DNA, plasmid extraction, electrophoresis, restriction enzyme analysis, and amplification by PCR were performed according to standard protocols (18). Restriction enzymes and ligase were purchased from New England Biolabs and used as recommended by the manufacturer. DNA was amplified with the AmpliTaq DNA polymerase of Thermus aquaticus from PerkinElmer, in a Gene Amp System 9600 thermal cycler (PerkinElmer Life Sciences). Nucleotide sequencing was carried out with Taq dideoxy terminators and the DyePrimer Cycling Sequence protocol developed by Applied Biosystems with fluorescently labeled dideoxynucleotides and primers, respectively (Invitrogen). Labeled extension products were analyzed on an ABI Prism 310 apparatus (Applied Biosystems).

Construction of a {Delta}lsp Mutant of L. monocytogenes—A lsp mutant was constructed by deletion of a 200-bp internal fragment of lsp. We inserted a 1,022-bp EcoRI-BamHI EGD-e DNA fragment (-800 to +200) and a 922-bp BamHI-HindIII EGD-e DNA fragment (+400 to +1,300), between the EcoRI and HindIII sites of the thermosensitive shuttle vector pAUL-A, as previously described (19), to give pAUL-{Delta}lsp. These two DNA fragments were amplified by PCR from the EGD-e genomic DNA using the following primers pairs: Ecolsp5' (5'-GGAATTCCTTATTCGGAAAATTCCAGGCGCTTTCTTATGG-3') and Bamlsp3' (5'-CGCGGATCCGCGACAACAACAGTAATAAGATAGAAAAACC-3'); Bamlsp5' (5'-CGCGGATCCGCGTTGGTGTCGTACTAATGCTCGTGTATG-3') and HIIIlsp3' (5'-CCCAAGCTTGGGTCATTCGTTGTCGGATGATCAAATCCTA-3'). Oligonucleotides were synthesized by Genset (Paris, France). The 2 amplified double-stranded DNA fragments were first cloned into the pCRTM cloning vector using the Invitrogen TA CloningTM kit (Invitrogen). Plasmid pAUL-{Delta}lsp was electroporated into EGD-e and transformants were selected for Em resistance at 30 °C. Allelic exchange was obtained by homologous recombination using a two-step procedure: at 40 °C, a single crossing-over event integrated the entire plasmid into the chromosome; the plasmid was then excised by subculture at 30 °C. The deletion was confirmed by PCR sequence analysis of chromosomal DNA from the mutant.

RNA Isolation and Real-time Quantitative PCR Assays—To extract RNA of L. monocytogenes grown in Caco-2 cell or bone marrow (BM) macrophages from BALB/c mice, cells were infected at a multiplicity of infection of 10, for 30 min, 30 min, and 1 h, respectively. Cells were lysed with 4 ml of 0.1% Triton X-100, the supernatant containing the bacteria was centrifuged for 10 min at 4,000 x g and the pellet was washed twice with saline buffer.

Bacteria were broken in a solution of Trizol (1 ml) (Invitrogen) with miniglass beads using a Bead Beater apparatus (Polylabo) set at maximum speed. RNA was extracted with 300 µl of chloroform:isoamyl alcohol. After 10 min of centrifugation at 13,000 x g, the aqueous phase was transferred to a tube containing 270 µl of isopropyl alcohol. Total RNA was then precipitated overnight at 4 °C and washed with 1 µl of a 75% ethanol solution before suspension in diethyl pyrocarbonate-treated water. Contaminating DNA was removed by digestion with DNase I, according to the manufacturer's instructions (Roche Diagnostics). As a negative control, the same experiment was performed on non-infected cells.

Real-time quantitative PCR was carried out on the ABI Prism 7700 sequence detection system using Taqman Universal PCR master mixture (PE Applied Biosystems). The primers were designed using the Primer Express software and obtained from PE Applied Biosystems. Sequences were as follows: lsp primers, forward, TATGCCAAAGGAAAGCGACTATT; and reverse, ACCCGGTCGATAAAATTACCAA; gyrA primers, forward, AAATGCGGACATCATTCCTAGACT, and reverse, TTTAACCCGTCACGAACATCAG. Reverse transcription-PCR experiments were carried out with 1 µg of RNA and 2.5 pmol of specific primers for lsp, gyrA, in a volume of 8 µl. After denaturation at 65 °C for 10 min, 12 µl of the mixture containing 2 µl of dNTP (25 mM), 4 µlof4x buffer, 2 µl of dithiothreitol, 1 µl of RNasin (Promega), and 1.5 µl of Superscript II (Invitrogen) was added. Samples were incubated for 60 min at 42 °C, heated at 75 °C for 15 min, and then chilled on ice. Samples were diluted with 40 µl of H2O and stored at -20 °C. PCR conditions were identical for all reactions. The 25-µl reactions consisted of 12.5 µl of PCR master mixture (PE Applied Biosystems) containing Sybr Green, 4 µl of template, 5 pmol of each primer. The reactions were carried out in sealed tubes. Results were normalized to the amount of gyrA mRNA (31). The gene gyrA was chosen because its expression remained constant under the different experimental conditions used here. Each assay was performed in triplicate.

SDS-PAGE and Western Blot Analyses—Protein extracts were prepared from cultures of bacteria grown in BHI broth at 37 °C (at A600 of 0.6 for exponential phase; and after overnight incubation, at A600 of 1.2 for stationary phase). The bacterial pellets were suspended in Tris (10 mM)/EDTA (1 mM) and bacteria were disrupted using a Fastprep FP120 apparatus (BIO 101 Inc., Ozyme) by 2 pulses of 30 s at a speed of 6.5. Lysates were centrifuged and the pellet suspended in 1x SDS-PAGE sample buffer. Electrophoresis and Western blotting were carried out as described previously in SDS-10% polyacrylamide minigels (Mini Protean II; Bio-Rad). Nitrocellulose sheets were probed with anti-ScaA antibody, kindly provided by Dr. Kolenbrander (Bethesda) and anti-rabbit horseradish peroxidase-conjugated secondary antibody. Antibodies were used at a final dilution of 1:1,000. Antibody binding was revealed by adding 0.05% diaminobenzidine tetrahydrochloride (Sigma) and 0.03% hydrogen peroxide (Sigma).

Protein Sequencing—Wild-type EGD-e and EGD{Delta}lsp were grown in BHI overnight with agitation at 37 °C. The bacterial pellets were suspended in Tris (10 mM)/EDTA (1 mM) and bacteria were disrupted using a Fastprep FP120 apparatus (BIO 101 Inc., Ozyme) by 2 pulses of 30 s at a speed of 6.5. Denatured proteins were separated by SDS-PAGE and then transferred electrophoretically onto polyvinylidene difluoride membranes (Millipore). Protein bands were visualized by staining the membrane with Coomassie Blue. For NH2-terminal sequencing, the two major unknown protein bands observed in the EGD{Delta}lsp were cut from the polyvinylidene difluoride membranes and sequenced on an Applied Biosystems Procise sequencer (J. d'Alayer, Laboratoire de Séquencage des Protéines, Institut Pasteur, Paris).

Intracellular Growth in Macrophages—Bone marrow-derived macrophages from BALB/c mice (IFFA-CREDO, Grenoble, France) were cultured and infected for growth curves at a cell/bacterium ratio of 10:1. Macrophages were exposed for 15 min at 37 °C and non-ingested bacteria were removed by several washings. Infected cells were re-fed with fresh medium (time 0).

Confocal Microscopy—Infected cells were examined at 0, 1, 2, and 4 h post-infection. Double fluorescence labeling of F-actin and bacteria was performed as described (20), using phalloidin coupled to Oregon Green 488 (Molecular Probes, Eugene, OR) and a rabbit anti-Listeria serum (J. Rocourt, Institut Pasteur, Paris), revealed with an anti-IgG antibody coupled to Alexa 546 (Molecular Probes). Images were scanned on a Zeiss LSM 510 confocal microscope.

The percentage of phagosomal escape was calculated as described previously (20). The number of bacteria per infected cell and the number of infected cells containing bacteria surrounded by polymerized actin were quantified on a mean of 50-100 infected cells, at 1, 2, and 4 h of the infection.

Electron Microscopy—At selected intervals following infection (0, 1, 2, and 4 h), BM macrophages were fixed and processed as described previously (20). Thin sections were stained with 2% uranyl acetate and lead citrate. We quantified the percentage of bacteria surrounded by: (i) an intact phagosomal membrane; (ii) a partially damaged membrane; or (iii) polymerized actin. For this purpose, BM macrophages were infected at a ratio of 100:1, to have a sufficient number of bacteria per thin section. Fifty to 100 phagosomes were studied, corresponding to about 50 infected cells.

Infection of Caco-2 Cells—We also used the human colon carcinoma cell line Caco-2 (ATCC HTB37) from the American Type Culture Collection (Manassas, VA). The invasion assays were carried out as described previously (17). Viable bacteria released from the cells were plated onto BHI plates. Each experiment was carried out in triplicate, repeated three times and expressed as mean ± S.D.

Mouse Virulence Assays—Six- to eight-week-old female Swiss mice (Janvier, Le Geneset St-Isle, France) were inoculated intravenously (iv) with various doses of bacteria. Mortality was followed over a 14-day period on groups of 5 mice. The lethal doses 50 (LD50) were determined by the Probit method. Bacterial growth was followed in organs (spleen and liver) of mice infected intravenously with 105 bacteria, as previously described (21). For the oral infections, 5-6-week-old-female BALB/c mice were starved for 24 h (water allowed) and were inoculated orally with 4 x 1010 bacteria (in 0.2 ml). This dose was chosen based on previous studies (22). After 3 days, the small intestines were recovered and rinsed in Dulbecco's modified Eagle's medium (Invitrogen) to remove the intestinal content. Intestines were then incubated at 20 °C for 2 h in Dulbecco's modified Eagle's medium containing 100 mg/liter gentamicin to kill extracellular bacteria from the intestinal lumen and rinsed three times in Dulbecco's modified Eagle's medium. Intestinal tissues were finally homogenized in 0.15 M NaCl and plated on BHI agar.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The lsp Gene of L. monocytogenes Encodes a Lipoprotein-specific Signal Peptidase—We identified an orf, designated lsp, in the genome of L. monocytogenes EGD-e (15), encoding a putative SPase II. The protein has 57.5% amino acid identity with Lsp of B. subtilis and is of identical size (154 amino acids in length). Lsp is highly conserved in L. monocytogenes serovar 4b, as well as in the non-pathogenic species Listeria innocua, with 99 and 98.1% amino acid identity, respectively (preliminary sequence data on the 4b strain was obtained from The Institute for Genomic Research website).2 Lsp of EGD-e contains the five conserved domains present in all other known SPases II. In particular, the Asn, Asp, and Ala residues, in domains III and V, which are critical for the activity of B. subtilis SPase II (Ref. 23 and references therein) are conserved (not shown). An lsp transcript was detected by reverse transcriptase-PCR in bacteria grown in broth ("Experimental Procedures"), suggesting that lsp encodes a functional protein.

Construction of a Chromosomal {Delta}lsp Deletion—We constructed an lsp knockout mutant of L. monocytogenes (EGD{Delta}lsp) by deletion of a 200-bp internal fragment of lsp, and chromosomal integration by allelic replacement (see "Experimental Procedures" for details). The deletion had no effect on bacterial viability in BHI, at all the temperatures tested (i.e. 4, 30, 37, and 42 °C). No difference between the mutant and wild-type strain was observed with respect to microscopic morphology, motility, colony aspect, hemolysis on blood agar plates, metabolic profiles on API strips, or antibiotic resistance profiles (not shown). These data indicate that the lsp gene product of L. monocytogenes is not essential for viability and not required for normal growth in broth.

Processing of the Lipoprotein LpeA—We first tested the expression of LpeA, a recently identified lipoprotein of L. monocytogenes (17), in wild-type EGD-e and in the {Delta}lsp mutant. For Western blot analyses, we used an antibody directed against ScaA of Streptococcus gordonii (a protein sharing 57% amino acid identity with LpeA of L. monocytogenes) shown to cross-react with LpeA (17). Two bands were detected in the {Delta}lsp mutant: a minor band with the same apparent molecular weight as that of the single band detected in the wild-type strain; and a major band with a slightly higher apparent Mr (Fig. 1A). This upper band, which likely to corresponds to the precursor form of LpeA, was detected both in the exponential and stationary phases of growth. This assumption was confirmed by testing the expression of LpeA in the wild-type strain, grown in rich medium containing globomycin, an inhibitor of SPases II (see "Experimental Procedures"). Two forms of LpeA were detected after globomycin treatment: a lower band corresponding to mature LpeA; and an upper band corresponding to the unprocessed form of LpeA, with the same apparent Mr as the upper band of the {Delta}lsp mutant. In agreement with these observations, previous studies have shown that B. subtilis cells lacking SPase II accumulate not only the precursor form, but also alternatively processed mature-like forms of lipoproteins PrsA (12).



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 1.
Western blots. Protein extracts were prepared from cultures of bacteria grown in BHI broth at 37 °C, in exponential phase (E) or stationary phase (S). Cells were grown either in the presence (+) or absence (-) of 100 µg/ml globomycin for 2 h. A, LpeA was detected with anti-ScaA antibody (raised against ScaA from S. gordonii), used at a final dilution of 1:1,000. B, the lipoprotein PrsA was detected with anti-PrsA antibody (raised against PrsA from B. subtilis), used at a final dilution of 1:1,000. In each case, two forms of the protein were detected, likely to correspond to the precursor and mature forms. They are indicated by a black arrowhead. Molecular mass markers were indicated in kilodaltons (kDa) to the left of the panel. WT, wild-type.

 
L. monocytogenes Expresses a PrsA-like Protein Processed by Lsp—In B. subtilis, the folding catalyst PrsA is a major lipoprotein that is essential for life (24). The chromosome of L. monocytogenes encodes a putative PrsA-like protein (Lmo2219) sharing 45% identity with PrsA of B. subtilis. We tested whether an anti-B. subtilis PrsA antibody (kindly provided by Vesa Kontinen), could cross-react with PrsA of L. monocytogenes in Western blot. A single band was detected in wild-type EGD-e. One band with a slightly higher apparent Mr, likely to correspond to the unprocessed precursor form of PrsA, was detected in the {Delta}lsp mutant (Fig. 1B). As with LpeA, two forms of PrsA were detected after globomycin treatment of the wild-type strain. As expected, the detection of PrsA from B. subtilis extracts (used as a control) was significantly stronger. These results show, thus that: (i) L. monocytogenes expresses a PrsA-like protein antigenically related to PrsA of B. subtilis; and (ii) Lsp is responsible for the maturation of this PrsA homolog. Together, the Western blot analyses demonstrate that the protein encoded by lsp is a genuine SPase II involved in the maturation of lipoproteins, including LpeA and PrsA.

Variations in Envelope Protein Composition—The total protein composition was monitored in envelope fractions and culture supernatants, by Bradford protein assay. It was similar in EGD-e and in the {Delta}lsp mutant, in both fractions. To visualize specific effects of lsp inactivation on protein expression, we compared the envelope fractions of the two strains by SDS-PAGE. The two protein patterns were globally similar (Fig. 2), except in the 30-kDa range where several differences were clearly visible. In particular, two major protein bands were detected in the {Delta}lsp mutant extract, and missing in the wild-type extract. NH2-terminal protein sequence analyses ("Experimental Procedures") revealed that the upper band corresponded to the precursor form of a conserved lipoprotein of as yet unknown function (encoded by lmo2637). Notably, this 299-amino acid long lipoprotein shows significant similarity to a 15-kDa lipoprotein precursor of Treponema pallidum (25), a major membrane immunogen in syphilis infection. Peptidic alignment of the two sequences suggests that Lmo2637 is a duplicated form of the 15-kDa antigen (with 44% identity between residues 50 to 168 of Lmo2637 and 22 to 138 of T. pallidum lipoprotein; and 50% identity between residues 184-290 of Lmo2637 and 31-138 of T. pallidum lipoprotein). Lmo2637 also has 50% identity to the cAD1 Sex pheromone precursor in Enterococcus faecalis (26). The identification of the precursor form of Lmo2637 in the {Delta}lsp mutant further indicates that the lsp-encoded SPase II is responsible for the maturation of this lipoprotein.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 2.
SDS-PAGE. A, total bacterial extracts were electrophoretically separated on an SDS-10% polyacrylamide gel and visualized by staining with Coomassie Brilliant Blue. Arrows indicate the main differences observed between the two strains. The two major protein bands induced in the extract of the mutant are indicated by arrowheads. A magnification of the corresponding region is shown to the right. B, the NH2-terminal sequence of these two protein bands was determined by microsequencing after transfer onto polyvinylidene difluoride membranes, as described previously (40). Sequences were determined on an Applied Biosystems Procise Sequencer (J. d'Alayer, Institut Pasteur, Paris).

 
NH2-terminal sequencing of the second protein (Fig. 2A, lower band) detected in the {Delta}lsp mutant revealed a putative pyruvate dehydrogenase (encoded by lmo1053). This non-lipoprotein of 325 amino acids does not bear a predicted NH2-terminal signal sequence. It shares 80% identity with the E-1{beta} chain subunit of the B. subtilis pyruvate dehydrogenase complex, encoded by pdhB (27). Notably, PdhB was also identified in the extracellular proteome of B. subtilis (28).

Lsp Inactivation Impairs Virulence—We evaluated the impact of lsp inactivation on bacterial pathogenicity in eucaryotic cells, in cultures as well as in vivo.

Intracellular Survival in BM Macrophages—We studied infection and intracellular multiplication of the {Delta}lsp mutant in BM macrophages from BALB/c mice by confocal microscopy, after double staining with an anti-Listeria antibody and with {beta}-phalloidin to visualize the F-actin (29). EGD-e was used as a positive control. Macrophages were exposed to a bacterium/cell ratio of 10:1 and bacterial multiplication was followed over a 4-h period. We monitored quantitatively the capacity of the mutant strain to promote the disruption of the phagosomal membrane and to multiply intracellularly, by immunofluorescence microscopy analysis (Fig. 3, A and B). After 4 h of incubation, wild-type bacteria formed actin comets and massively invaded the BM macrophages, as previously reported (20). In contrast, with the {Delta}lsp mutant, a reduced bacterial growth was observed after 2 h of infection as well as a delay in actin polymerization. After 4 h, intramacrophagic multiplication reached only about one-fourth that of the wild-type strain and only 60% of the bacteria were surrounded by polymerized actin (Fig. 3, C and D), suggesting that lipoprotein maturation plays an important role in the intracellular survival of L. monocytogenes.



View larger version (89K):
[in this window]
[in a new window]
 
FIG. 3.
Invasivity assay into BM macrophages. BM macrophages from BALB/c mice were infected (20 bacteria per cell) with EGD-e (A) or {Delta}lsp (B). The kinetics of infection of BM-derived macrophages was followed by confocal microscopy over a 4-h period. F-actin was stained with phalloidin (green) and bacteria were labeled with anti-Listeria antibodies (red). C, intramacrophagic bacterial multiplication was evaluated by determining the number of bacteria per infected BM-derived macrophage. Each point is the mean of 50-100 infected cells. Values presented correspond to a typical experiment. D, the percentage of bacteria coated with actin filaments, was determined by phalloidin staining as described previously (29).

 
To determine whether the {Delta}lsp mutant had a defect in phagosomal escape or in its capacity to polymerize actin, we then followed the kinetics of bacterial infection by electron microscopy. This assay, for which a higher ratio of bacteria per cell was used (i.e. 100 bacteria per cell, see "Experimental Procedures" for details), confirmed the growth defect observed by confocal microscopy. We examined the structure of the phagosomal membrane after entry of the bacteria. After 1 h of infection, 65% of wild-type bacteria were surrounded by a meshwork of polymerized actin, and only 14% of the phagosomes still presented an intact membrane. In contrast, with the {Delta}lsp mutant, only 14.2% of the bacteria were surrounded by polymerized actin and 55% of the phagosomes had an intact membrane (Fig. 4). These analyses demonstrated that the delay in actin polymerization of the {Delta}lsp strain was because of a reduced efficiency of phagosomal escape.



View larger version (78K):
[in this window]
[in a new window]
 
FIG. 4.
Thin sections of infected BM macrophages. BM macrophages were infected with either EGD-e (A) or {Delta}lsp mutant (B), for 1 h. Cells infected with EGD-e contained several bacteria, surrounded by a meshwork of actin filaments (the white arrowhead points to the polymerized actin around bacteria, panel A). In contrast, most of thin sections of cells infected with the {Delta}lsp mutant only displayed one or two bacteria, still entrapped into an intact phagosome (the black arrowhead points to the phagosomal membrane, in inset of panel B). C, quantitative analysis of phagosomal escape. Percentage of bacteria surrounded by intact phagosomal membrane ({blacksquare}), partially lysed membrane (), or surrounded by actin filaments ({square}).

 
We compared by Western blot the production of the cell surface-anchored protein ActA and two secreted proteins, listeriolysine O and the phosphatidylcholine-phospholipase C, in the wild-type strain and the {Delta}lsp mutant. Each of these three proteins was produced in comparable amounts in the two strains. This result confirmed that the defect of intracellular growth of the {Delta}lsp mutant was not because of a reduced production of these virulence factors. Moreover, the three proteins, which bear classical SPase I-dependent NH2-terminal signal sequences, were detected in the {Delta}lsp mutant at the same apparent Mr as that in the wild-type strain (not shown), indicating that Lsp is not involved in their processing.

Invasion and Intracellular Survival in Enterocytes—Natural infection by L. monocytogenes generally occurs by the digestive port of entry, after ingestion of contaminated food. Therefore, we monitored intracellular survival of the {Delta}lsp mutant in the human enterocyte-like cell line Caco-2. Bacteria were counted at time 0 and after 2 and 4 h of incubation. No difference was observed between EGD-e and the {Delta}lsp mutant strain by time 0, indicating that inactivation of lsp did not influence adherence to these epithelial cells. At later times (after 2 and 4 h of infection), the {Delta}lsp mutant showed a moderate growth defect; with 3-fold fewer bacteria than the wild-type strain (0.5 log, Fig. 5A).



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 5.
In vitro and in vivo survival of the {Delta}lsp mutant. A, Caco-2 cells were exposed to EGD-e or {Delta}lsp mutant at a ratio of 100 bacteria per cell. Invasion and intracellular multiplication was followed over a 4-h period. At T 0, the number of bacteria counted was identical with both strains, whereas after 2 and 4 h the counts recorded with the mutant strain was about 3-fold lower (0.5 log) than with wild-type EGD-e. Experiments were repeated three times. B, bacteria were orally inoculated into five BALB/c mice at a dose of 4 x 1010 bacteria per mouse. Three days after infection, the small intestine were collected and prepared as described under "Experimental Procedures." Bacterial counts were determined by plating homogenates onto BHI solid medium. Symbols indicate log10 bacteria of EGD-e (closed squares) and the {Delta}lsp mutant (white circles).

 
We also followed survival of the {Delta}lsp mutant in vivo, in the small intestinal tissue of BALB/c mice, after intragastric inoculation with 4 x 1010 bacteria (see "Experimental Procedures"). Viable bacterial counts were determined 3 days after the inoculation (Fig. 5B). The counts recorded were comparable with those recorded earlier by this route of administration (22). No difference was observed between the {Delta}lsp mutant and the wild-type strain (5.5 ± 0.33 versus 5.01 ± 0.36). These data suggest that lipoprotein maturation by Lsp does not play a major role in the crossing of the digestive barrier by L. monocytogenes.

Virulence—We also evaluated the effect of lsp inactivation on bacterial virulence after intravenous inoculation. The LD50 of the {Delta}lsp mutant was of 105.5 in Swiss mice, about 10-fold lower than that of EGD-e (104.5), indicating that the {Delta}lsp mutation moderately attenuated the virulence of L. monocytogenes. However, the kinetics of infection in livers and spleens of infected mice (not shown) did not reveal any significant growth defect of the {Delta}lsp mutant, suggesting that the non-processed forms of lipoproteins still promote in vivo survival of the bacterium.

Lsp Expression Is Temporally Controlled during Infection—Earlier studies have shown that the expression of several virulence genes was temporally controlled during the infectious process. For example, hly and plcA genes, encoding listeriolysine O and phosphoinositol-phospholipase C, two proteins required for phagosomal escape, are predominantly expressed in the phagosomal compartment. In contrast, expression of ActA, which is required for intracytoplasmic actin polymerization and bacterial motility, is strongly induced in the cytoplasm of the infected host cell (30). These observations prompted us to monitor the levels of L. monocytogenes lsp gene expression in broth and inside infected cells. Transcription of the lsp gene was quantitatively determined by real-time quantitative PCR, in BM macrophages and Caco-2 cells. The levels of transcription of lsp were compared with those obtained from bacteria growth in broth (BHI medium). Cell lines were infected during 30 min to 1 h with a bacteria/cell ratio of 10:1 and total bacteria RNA was extracted. For real-time quantitative PCR, we used gyrA as a reference gene. We previously showed that the level of expression of gyrA was constant in a variety of different growth conditions in broth (31). We checked here that it also did not vary when L. monocytogenes grew intracellularly (not shown).

Lsp expression appeared to be tightly temporally controlled during the infectious process. After 30 min of infection in BM macrophages as well as in Caco-2 cells, expression of the lsp gene was strongly induced, with an induction ratio of 10.8 ± 2.6 and 9.6 ± 2.2, respectively (Fig. 6). After 1 h of infection, the induction ratio then decreased significantly (about 5-fold) but was still higher than in broth (with a 2.2 ± 0.8 induction ratio). Localization of the bacteria inside infected BM macrophages was simultaneously followed by confocal microscopy. In agreement with earlier observations, after 30 min, bacteria had not yet multiplied and no actin polymerization was detected. After 1 h, bacteria had multiplied and ~10% of them were already surrounded by polymerized actin (not shown). These observations show that lsp gene expression is highly up-regulated when the bacteria reside inside phagosomes and then decreases when bacteria gain access to the cell cytoplasm. These observations favor the idea that lipoprotein maturation is optimal in the phagosomal compartment.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 6.
Induction of lsp gene expression in BM macrophages. Real-time quantitative PCR. We monitored quantitatively the transcription of the lsp gene in BM macrophages by real-time PCR, after 30 min and 1 h of infection (A), as well as in Caco-2 cells after 30 min infection (B). The induction ratio was the amount of transcripts detected in bacteria in BM macrophages divided by the number of transcripts detected in bacteria grown in BHI medium. In both conditions, the values were expressed relative to the amounts of gyrA transcripts. Reverse transcriptase-PCR was performed at least three times at each sample. Error bars show standard deviations.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We show that the lsp gene of L. monocytogenes encodes a lipoprotein-specific signal peptidase (SPase II). A {Delta}lsp chromosomal mutant has a reduced capacity to multiply in macrophages because of a severe delay in phagosomal escape. Expression of the lsp gene appears to be up-regulated when bacteria are present in the phagosomal compartment of infected eucaryotic cells, strongly suggesting a participation of processed forms of lipoproteins in the early steps of the intracellular life cycle of this pathogen.

Lipoproteins, a Novel Family of Virulence Determinants in L. monocytogenes—There is only limited experimental data on the importance of the maturation of preliproteins by SPase II in bacterial pathogenesis. In vivo screenings for attenuated mutants by signature-tagged mutagenesis, in Staphylococcus aureus, identified transposon insertions into the lsp gene (32, 33). However, the effect of lsp inactivation on virulence was very modest. More recently, a lsp knockout mutant of Streptococcus suis has been also shown to have no effect on virulence (34). These preliminary studies suggested that maturation of lipoproteins might not play a significant role in virulence of extracellular bacterial pathogens.

We show here that lipoprotein maturation is critical for the intracellular survival of L. monocytogenes. A severe growth defect of the {Delta}lsp mutant was observed in BM macrophages. We demonstrate that the defect is mainly because of a reduced capacity to escape from the phagosomal compartment. The fact that subsequent intracytosolic multiplication and cell-to-cell spread are apparently not affected in the {Delta}lsp mutant, suggests that the non-processed forms of lipoproteins have lost at least some of their activities required for intraphagosomal survival of the bacterium. The {Delta}lsp mutant was not impaired in adhesion to Caco-2 enterocytes and showed only a moderate defect of intracellular multiplication. Thus, either lipoproteins do not participate to adhesion to, and invasion of, epithelial cells, or precursor forms of lipoproteins remain active in this process.

Notably, expression of the lsp gene was strongly induced (10-fold) when bacteria were inside eucaryotic cells. In macrophages, the peak of induction of lsp expression was recorded when most bacteria were still entrapped into phagosomes. After bacterial release into the cytosol, lsp induction decreased rapidly. These data are compatible with the idea that lsp expression is induced to enable optimal maturation of lipoproteins, some of which may participate to phagosomal escape. The {Delta}lsp mutation had a moderate effect on the virulence of L. monocytogenes in mice. Kinetic analyses further indicated that the non-processed precursor forms of lipoproteins retained sufficient biological activities to promote in vivo survival. At this stage, it cannot be excluded that in humans, or in other animal species, lipoproteins might play a more important role in the pathogenesis of L. monocytogenes. The fact that the mutant bacteria could multiply in the cytosol of infected cells suggests that the role of lipoproteins in intracellular survival might be mainly restricted to the early step of phagosomal escape.

Role of Lipoproteins in the Metabolism of L. monocytogenes—The importance of the lipoprotein processing by SPases II for cellular homeostasis differs between the Gram-negative and Gram-positive bacteria and among Gram-positive bacteria. For example, unlike the SPase II of E. coli (35), the SPase II of B. subtilis and Lactococcus lactis are not essential for growth and viability (36, 37). However, in these non-pathogenic species, the absence of SPase II resulted in cold and heat sensitivity. In B. subtilis, SPase II is not required for the development of genetic competence, sporulation, and spore germination although at least eight known lipoproteins are important for these processes (24). Cells lacking SPase II accumulated lipid-modified precursor and mature-like forms of PrsA. This precursor form seems to be active. In L. lactis, SPase II is required for pre-PrtM, an ortholog of the B. subtilis PrsA protein and for pre-OppA (an oligopeptide-binding protein) processing. No alternative processing of these precursors occurs in the absence of this SPase II. Unprocessed lactoccocal lipoprotein precursors kept their biological activity (37). In L. monocytogenes, the lack of Lsp did not impair growth in broth, including at 4 °C. Because a strain lacking only the lipoprotein OppA is unable to grow at 4 °C (16), it is possible that some non-processed forms of lipoproteins remain active. Alternatively, it cannot be excluded that some lipoproteins are processed by alternative enzymatic activities.

The {Delta}lsp deletion did not alter the general level of protein expressed by L. monocytogenes. However, at least two proteins were overexpressed in the mutant. One of them corresponds to the precursor form of a conserved lipoprotein of unknown function, Lmo2637. It is possible that, after processing by Lsp, Lmo2637 normally localizes into the extracellular medium. In contrast, the unprocessed precursor form of the protein would remain stuck in the membrane via its NH2-terminal hydrophobic signal sequence. In B. subtilis, important variations in the amounts of several extracellular proteins have been observed in mutants lacking Lsp, but no information is yet available on the effects on the envelope protein content. The second protein overproduced in the {Delta}lsp mutant of L. monocytogenes is homologous to PdhB of the pyruvate dehydrogenase complex of B. subtilis (27). The pyruvate dehydrogenase complex of Gram-positive bacteria, which displays three different enzymatic activities (E1, pyruvate decarboxylase; E2, dihydrolioamide dehydrogenase; and E3, lipoamide dehydrogenase), consists of a core of 60 E2 subunits and 30 E1 and 6 E3 subunits associated. E1 is a heterotetramer, composed of E1{alpha}2 E1{beta}2. The different proteins of the complex are encoded by the linked genes pdhA (E1{alpha}), pdhB (E1{beta}), pdhC (E2), and pdhD (E3). This protein complex is capable of binding to promoter regions in DNA and was shown to regulate certain steps of the sporulation process in the Bacillus species (27, 38). The reason for the up-regulation of PdhB in a {Delta}lsp mutant and its physiological role in L. monocytogenes remain to be elucidated.

Possible Interactions between Lipoproteins and the Phagosomal Membrane—In Gram-negative bacteria such as E. coli, lipoproteins are anchored to the periplasmic side of either the inner or outer membrane through NH2-terminal lipids, depending on the lipoprotein sorting signal present at position 2 (39). In Gram-positive organisms, after their cleavage by SPase II, mature lipoproteins are generally tethered to the cytoplasmic membrane, via their long chain fatty acids, and face outside the cell. Computer-assisted analyses suggest that a major fraction of the membrane-bound forms of lipoproteins belong to ABC-type transporters. The secreted forms of lipoproteins (8, 28) are believed to have diverse binding and/or enzymatic activities. In L. monocytogenes, 37% of the lipoproteins (Table I) are predicted to belong to an ABC-type transporter; and 10% have a predicted enzymatic activity. We have shown that maturation of pre-lipoproteins was important for phagosomal escape of L. monocytogenes, suggesting that mature lipoproteins could interact with components of the phagosomal membrane to facilitate its disruption (mainly mediated by listeriolysine O and phosphoinositol-phospholipase C). In principle, two possible modes of interaction between lipoproteins and the phagosomal membrane can be envisaged (Fig. 7): (i) direct interactions, mediated either by the soluble or membrane-bound forms (pathways A, B); or (ii) indirect interactions (pathways C and D), via another extracytoplasmic protein, or through a more complex signaling cascade mediated by cytoplasmic components. On a structural point of view, the peptidoglycan of Gram-positive cells comprises about 20 to 40 layers. This rigid layer of about 20-80 nm thick covers the cytoplasmic membrane (about 3 nm thick), and should thus, hinder direct contacts between proteins directly bound to the cytoplasmic membrane. Unless some membrane-bound lipoproteins adopt extended structures allowing them to cross most of the peptidoglycan, the interactions with the phagosomal membrane are more likely to occur via soluble forms of lipoproteins or to involve indirect pathways. At this stage it cannot be excluded that bacterial lipoproteins may recognize non-proteinaceous components of the phagosomal membrane, like lipid raft or other cholesterol-rich regions.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 7.
Possible interactions between lipoproteins and the phagosomal membrane. Schematic representation of the envelope of L. monocytogenes. On top, the phagosomal membrane. To the right, an electron microscopic picture of wild-type EGD-e trapped into a phagosome of BM macrophage. Three types of lipoproteins are presented: 1, membrane-bound lipoproteins alone; 2, membrane-bound lipoproteins associated with an ABC-type transporter; or 3, soluble lipoproteins 3. Two possible modes of interaction between bacterial lipoproteins and hypothetical proteins of the phagosomal membrane are proposed. Direct interactions (red arrows); A, with soluble lipoproteins; B, with membrane-bound lipoproteins. Indirect interactions (blue arrows); C, via an interaction with another cell surface-associated protein (designated by an X); D, via a cytoplasmic regulatory circuit (designated an Y).

 
We show here the importance of the processing of the lipoproteins by Lsp in the pathogenesis of L. monocytogenes. The molecular mechanisms of interaction between lipoproteins and the host cell, during intracellular survival, remain to be elucidated.


    FOOTNOTES
 
* This work was supported in part by CNRS, INSERM, and the Université Paris V. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence may be addressed. Tel.: 33-1-40-61-53-79; Fax: 33-1-40-61-55-92; E-mail: charbit{at}necker.fr. § To whom correspondence may be addressed. E-mail: cathraynaud{at}yahoo.fr.

1 The abbreviations used are: SPase II, signal peptidase type II; BHI, brain heart infusion; BM, bone marrow. Back

2 www.tigr.org. Back



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Farber, J. M., and Peterkin, P. I. (1991) Microbiol. Rev. 55, 476-511[Abstract/Free Full Text]
  2. Mackaness, G. B. (1962) J. Exp. Med. 116, 381-406[Abstract]
  3. Gaillard, J. L., Berche, P., Mounier, J., Richard, S., and Sansonetti, P. (1987) Infect. Immun. 55, 2822-2829[Abstract/Free Full Text]
  4. Wood, S., Maroushek, N., and Czuprynski, C. J. (1993) Infect. Immun. 61, 3068-3072[Abstract/Free Full Text]
  5. Vazquez-Boland, J. A., Kuhn, M., Berche, P., Chakraborty, T., Dominguez-Bernal, G., Goebel, W., and Gonzalez-Zorn, B. (2001) Clin. Microbiol. Rev. 14, 584-640[Abstract/Free Full Text]
  6. Cossart, P., and Bierne, H. (2001) Curr. Opin. Immunol. 13, 96-103[CrossRef][Medline] [Order article via Infotrieve]
  7. Cabanes, D., Dehoux, P., Dussurget, O., Frangeul, L., and Cossart, P. (2002) Trends Microbiol. 10, 238-245[CrossRef][Medline] [Order article via Infotrieve]
  8. Sutcliffe, I. C., and Russell, R. R. (1995) J. Bacteriol. 177, 1123-1128[Free Full Text]
  9. Aliprantis, A. O., Yang, R. B., Mark, M. R., Suggett, S., Devaux, B., Radolf, J. D., Klimpel, G. R., Godowski, P., and Zychlinsky, A. (1999) Science 285, 736-739[Abstract/Free Full Text]
  10. Tokunaga, M., Loranger, J. M., Chang, S. Y., Regue, M., Chang, S., and Wu, H. C. (1985) J. Biol. Chem. 260, 5610-5615[Abstract/Free Full Text]
  11. Leskela, S., Wahlstrom, E., Kontinen, V. P., and Sarvas, M. (1999) Mol. Microbiol. 31, 1075-1085[CrossRef][Medline] [Order article via Infotrieve]
  12. Tjalsma, H., Kontinen, V. P., Pragai, Z., Wu, H., Meima, R., Venema, G., Bron, S., Sarvas, M., and van Dijl, J. M. (1999) J. Biol. Chem. 274, 1698-1707[Abstract/Free Full Text]
  13. Giam, C. Z., Hayashi, S., and Wu, H. C. (1984) J. Biol. Chem. 259, 5601-5605[Abstract/Free Full Text]
  14. von Heijne, G. (1989) Protein Eng. 2, 531-534[Abstract/Free Full Text]
  15. Glaser, P., Frangeul, L., Buchrieser, C., Rusniok, C., Amend, A., Baquero, F., Berche, P., Bloecker, H., Brandt, P., Chakraborty, T., Charbit, A., Chetouani, F., Couve, E., de Daruvar, A., Dehoux, P., Domann, E., Dominguez-Bernal, G., Duchaud, E., Durant, L., Dussurget, O., Entian, K. D., Fsihi, H., Portillo, F. G., Garrido, P., Gautier, L., Goebel, W., Gomez-Lopez, N., Hain, T., Hauf, J., Jackson, D., Jones, L. M., Kaerst, U., Kreft, J., Kuhn, M., Kunst, F., Kurapkat, G., Madueno, E., Maitournam, A., Vicente, J. M., Ng, E., Nedjari, H., Nordsiek, G., Novella, S., de Pablos, B., Perez-Diaz, J. C., Purcell, R., Remmel, B., Rose, M., Schlueter, T., Simoes, N., Tierrez, A., Vazquez-Boland, J. A., Voss, H., Wehland, J., and Cossart, P. (2001) Science 294, 849-852[Abstract/Free Full Text]
  16. Borezee, E., Pellegrini, E., and Berche, P. (2000) Infect. Immun. 68, 7069-7077[Abstract/Free Full Text]
  17. Reglier-Poupet, H., Pellegrini, E., Charbit, A., and Berche, P. (2003) Infect. Immun. 71, 474-482[Abstract/Free Full Text]
  18. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) in Molecular Cloning: A Laboratory Manual (Nolan, C., ed) Vol. 3, pp. 17.37-17.41, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  19. Lingnau, A., Domann, E., Hudel, M., Bock, M., Nichterlein, T., Wehland, J., and Chakraborty, T. (1995) Infect. Immun. 63, 3896-3903[Abstract]
  20. Lety, M. A., Frehel, C., Dubail, I., Beretti, J. L., Kayal, S., Berche, P., and Charbit, A. (2001) Mol. Microbiol. 39, 1124-1140[CrossRef][Medline] [Order article via Infotrieve]
  21. Autret, N., Dubail, I., Trieu-Cuot, P., Berche, P., and Charbit, A. (2001) Infect. Immun. 69, 2054-2065[Abstract/Free Full Text]
  22. Barbour, A. H., Rampling, A., and Hormaeche, C. E. (1996) Microbiol. Pathog. 20, 247-253
  23. Tjalsma, H., Zanen, G., Venema, G., Bron, S., and van Dijl, J. M. (1999) J. Biol. Chem. 274, 28191-28197[Abstract/Free Full Text]
  24. Kontinen, V. P., and Sarvas, M. (1993) Mol. Microbiol. 8, 727-737[Medline] [Order article via Infotrieve]
  25. Centurion-Lara, A., Arroll, T., Castillo, R., Shaffer, J. M., Castro, C., Van Voorhis, W. C., and Lukehart, S. A. (1997) Infect. Immun. 65, 1440-1444[Abstract]
  26. An, F. Y., and Clewell, D. B. (2002) J. Bacteriol. 184, 1880-1887[Abstract/Free Full Text]
  27. Gao, H., Jiang, X., Pogliano, K., and Aronson, A. I. (2002) J. Bacteriol. 184, 2780-2788[Abstract/Free Full Text]
  28. Antelmann, H., Tjalsma, H., Voigt, B., Ohlmeier, S., Bron, S., van Dijl, J. M., and Hecker, M. (2001) Genome Res. 11, 1484-1502[Abstract/Free Full Text]
  29. Lety, M. A., Frehel, C., Berche, P., and Charbit, A. (2002) Mol. Microbiol. 46, 367-379[CrossRef][Medline] [Order article via Infotrieve]
  30. Bubert, A., Sokolovic, Z., Chun, S. K., Papatheodorou, L., Simm, A., and Goebel, W. (1999) Mol. Gen. Genet. 261, 323-336[Medline] [Order article via Infotrieve]
  31. Autret, N., Raynaud, C., Dubail, I., Trieu-Cuot, P., Berche, P., and Charbit, A. (2003) Infect. Immun. 71, 4463-4471[Abstract/Free Full Text]
  32. Mei, J. M., Nourbakhsh, F., Ford, C. W., and Holden, D. W. (1997) Mol. Microbiol. 26, 399-407[CrossRef][Medline] [Order article via Infotrieve]
  33. Coulter, S. N., Schwan, W. R., Ng, E. Y., Langhorne, M. H., Ritchie, H. D., Westbrock-Wadman, S., Hufnagle, W. O., Folger, K. R., Bayer, A. S., and Stover, C. K. (1998) Mol. Microbiol. 30, 393-404[CrossRef][Medline] [Order article via Infotrieve]
  34. De Greeff, A., Hamilton, A., Sutcliffe, I. C., Buys, H., Van Alphen, L., and Smith, H. E. (2003) Microbiology 149, 1399-1407[Abstract/Free Full Text]
  35. Yamagata, H., Ippolito, C., Inukai, M., and Inouye, M. (1982) J. Bacteriol. 152, 1163-1168[Abstract/Free Full Text]
  36. Bolhuis, A., Tjalsma, H., Smith, H. E., de Jong, A., Meima, R., Venema, G., Bron, S., and van Dijl, J. M. (1999) Appl. Environ. Microbiol. 65, 2934-2941[Abstract/Free Full Text]
  37. Venema, R., Tjalsma, H., Van Dijl, J. M., De Jong, A., Leenhouts, K., Buist, G., and Venema, G. (2003) J. Biol. Chem. 278, 14739-14746[Abstract/Free Full Text]
  38. Walter, T., and Aronson, A. (1999) J. Biol. Chem. 274, 7901-7906[Abstract/Free Full Text]
  39. Masuda, K., Matsuyama, S., and Tokuda, H. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 7390-7395[Abstract/Free Full Text]
  40. Lety, M. A., Frehel, C., Beretti, J. L., Berche, P., and Charbit, A. (2003) Microbiology 149, 1249-1255[Abstract/Free Full Text]
  41. Sankaran, K., and Wu, H. C. (1994) J. Biol. Chem. 269, 19701-19706[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
S. Machata, S. Tchatalbachev, W. Mohamed, L. Jansch, T. Hain, and T. Chakraborty
Lipoproteins of Listeria monocytogenes Are Critical for Virulence and TLR2-Mediated Immune Activation
J. Immunol., August 1, 2008; 181(3): 2028 - 2035.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
E. L. Denham, P. N. Ward, and J. A. Leigh
Lipoprotein Signal Peptides Are Processed by Lsp and Eep of Streptococcus uberis
J. Bacteriol., July 1, 2008; 190(13): 4641 - 4647.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Henneke, S. Dramsi, G. Mancuso, K. Chraibi, E. Pellegrini, C. Theilacker, J. Hubner, S. Santos-Sierra, G. Teti, D. T. Golenbock, et al.
Lipoproteins Are Critical TLR2 Activating Toxins in Group B Streptococcal Sepsis
J. Immunol., May 1, 2008; 180(9): 6149 - 6158.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Bas, L. Neff, M. Vuillet, U. Spenato, T. Seya, M. Matsumoto, and C. Gabay
The Proinflammatory Cytokine Response to Chlamydia trachomatis Elementary Bodies in Human Macrophages Is Partly Mediated by a Lipoprotein, the Macrophage Infectivity Potentiator, through TLR2/TLR1/TLR6 and CD14
J. Immunol., January 15, 2008; 180(2): 1158 - 1168.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
H. Bierne and P. Cossart
Listeria monocytogenes Surface Proteins: from Genome Predictions to Function
Microbiol. Mol. Biol. Rev., June 1, 2007; 71(2): 377 - 397.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. Baumgartner, U. Karst, B. Gerstel, M. Loessner, J. Wehland, and L. Jansch
Inactivation of Lgt Allows Systematic Characterization of Lipoproteins from Listeria monocytogenes
J. Bacteriol., January 15, 2007; 189(2): 313 - 324.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
F. Garcia-del Portillo and P. Cossart
An Important Step in Listeria Lipoprotein Research
J. Bacteriol., January 15, 2007; 189(2): 294 - 297.
[Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. S. Rahman, S. M. Ceraul, S. M. Dreher-Lesnick, M. S. Beier, and A. F. Azad
The lspA Gene, Encoding the Type II Signal Peptidase of Rickettsia typhi: Transcriptional and Functional Analysis
J. Bacteriol., January 15, 2007; 189(2): 336 - 341.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Hamilton, C. Robinson, I. C. Sutcliffe, J. Slater, D. J. Maskell, N. Davis-Poynter, K. Smith, A. Waller, and D. J. Harrington
Mutation of the Maturase Lipoprotein Attenuates the Virulence of Streptococcus equi to a Greater Extent than Does Loss of General Lipoprotein Lipidation
Infect. Immun., December 1, 2006; 74(12): 6907 - 6919.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
A. Bigot, E. Botton, I. Dubail, and A. Charbit
A Homolog of Bacillus subtilis Trigger Factor in Listeria monocytogenes Is Involved in Stress Tolerance and Bacterial Virulence.
Appl. Envir. Microbiol., October 1, 2006; 72(10): 6623 - 6631.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
I. Dubail, A. Bigot, V. Lazarevic, B. Soldo, D. Euphrasie, M. Dupuis, and A. Charbit
Identification of an Essential Gene of Listeria monocytogenes Involved in Teichoic Acid Biogenesis.
J. Bacteriol., September 1, 2006; 188(18): 6580 - 6591.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. M. Babu, M. L. Priya, A. T. Selvan, M. Madera, J. Gough, L. Aravind, and K. Sankaran
A Database of Bacterial Lipoproteins (DOLOP) with Functional Assignments to Predicted Lipoproteins.
J. Bacteriol., April 1, 2006; 188(8): 2761 - 2773.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
C. Raynaud and A. Charbit
Regulation of expression of type I signal peptidases in Listeria monocytogenes
Microbiology, November 1, 2005; 151(11): 3769 - 3776.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Bigot, H. Pagniez, E. Botton, C. Frehel, I. Dubail, C. Jacquet, A. Charbit, and C. Raynaud
Role of FliF and FliI of Listeria monocytogenes in Flagellar Assembly and Pathogenicity
Infect. Immun., September 1, 2005; 73(9): 5530 - 5539.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. Stoll, J. Dengjel, C. Nerz, and F. Gotz
Staphylococcus aureus Deficient in Lipidation of Prelipoproteins Is Attenuated in Growth and Immune Activation
Infect. Immun., April 1, 2005; 73(4): 2411 - 2423.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/49/49469    most recent
M307953200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Réglier-Poupet, H.
Right arrow Articles by Raynaud, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Réglier-Poupet, H.
Right arrow Articles by Raynaud, C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement