 |
INTRODUCTION |
Seven transmembrane domain, G protein-coupled receptors
(GPCR)1 are expressed in many
different cell types and have various functions ranging from chemotaxis
to light detection. Approximately 1-2% of the human genome encodes
for GPCRs (1-3) and as such, these proteins are commonly targeted for
pharmaceutical intervention. Purification and study of GPCRs are
complicated by both low expression levels (4) and hydrophobicity.
CXCR4 is a member of the GPCR family of proteins and is the natural
receptor for stromal cell-derived growth factor 1
(SDF-1
) (5, 6).
CXCR4 is essential in mouse development, as demonstrated by the
observation that disruption of the cxcr4 gene leads to hematopoietic, cardiovascular, and cerebellar defects and embryonic lethality (7, 8). Almost identical phenotypes were associated with
deletion of the sdf1
gene in mice (9), suggesting that CXCR4 may be the sole receptor for SDF-1
. CXCR4 has also been implicated in breast cancer metastasis (10). These studies demonstrate the biological importance of CXCR4.
CXCR4 has also been shown to be a principal coreceptor for human
immunodeficiency virus type 1 (HIV-1) infection (11). The HIV-1
envelope glycoprotein, gp120, binds to the primary receptor, CD4 (12),
expressed on the cell surface. This interaction results in
conformational changes in gp120 that allow binding to either CXCR4 (11)
or CCR5 (13-17), depending on the viral strain. Interaction with these
coreceptors is believed to induce further conformational changes in the
envelope glycoprotein, gp41 (18), culminating in viral fusion with the
host cell membrane. The diverse roles of CXCR4 in physiology and
disease underscore the importance of furthering our understanding of
the biochemistry of this chemokine receptor.
In recent years, it has been speculated that GPCRs may form both
homomultimers and heteromultimers in the cell membrane. Coexpression studies with the GABAb-R2 receptor demonstrated that
efficient surface expression and function was dependent upon
association of this protein with the GABAb-R1 protein
(19-21). The interpretation of these data was that
hetero-oligomerization was necessary for the functionality of this
receptor. Most studies of GPCR oligomerization have involved
co-immunoprecipitation and cross-linking (22). Specifically, multiple
groups have demonstrated either constitutive (23) or ligand-induced
multimerization of CCR5 in cell lysates (22). Using these techniques,
it was also shown that the
2-adrenergic receptor can
form multimers in detergent-containing cell lysates (24-26).
The above studies used detergent-solubilized cell lysates to
investigate GPCR multimerization. Multimerization can also be approached using intact cells with proximity-based assays such as
fluorescence resonance energy transfer (FRET) or bioluminescence resonance energy transfer (BRET). BRET, which utilizes the transfer of
energy from Renilla luciferase to a yellow fluorescent
protein (YFP) in close proximity (<50 Å), has been employed to
demonstrate multimerization of both
2-adrenergic
receptor (26) and CCR5 (27). Recently the BRET technology has been
improved and is now called BRET2. This assay uses a newly
formulated Renilla luciferase substrate (Deep Blue CTM) that
results in emission at a shorter wavelength (395 nm) as compared with
that of conventional coelenterazine (480 nm). In addition, a modified
GFP protein, GFP2, was synthesized that absorbs at 395 nm
and emits at 510 nm. The original BRET assay used yellow fluorescent
protein (YFP: emission of 525 nm), which could not efficiently absorb
at 395 nm. These two modifications allow for greater spectral
resolution (115 nm) than the traditional BRET assay (45 nm). The
greater resolution results in less contamination of the
GFP2 signal with background emission from the luciferase
and thus more interpretable results.
Our laboratory has recently developed a method to solubilize CXCR4 in a
native conformation using the detergent CHAPSO (28). CXCR4 contained
within CHAPSO-solubilized cell lysates could bind conformation-dependent antibodies, the chemokine SDF-1
and CXCR4-using HIV-1 gp120 envelope glycoproteins (28). This method is
also effective at solubilizing conformationally intact
CCR5.2 CCR5 contained in
CHAPSO-solubilized cell lysates can bind both conformation-dependent antibodies and CCR5-using gp120;
however, for as yet undetermined reasons, solubilized CCR5 cannot bind its natural ligands, MIP-1
, MIP-1
, or RANTES (29).
Here we investigate the oligomerization state of CXCR4 in
CHAPSO-solubilized cell lysates and intact cells. Coimmunoprecipitation studies using cell lysates determined that CXCR4 exists as a multimer under these conditions. This multimerization does not appear to be
dependent upon overexpression or artifacts inherent in membrane protein
solubilization. BRET2 analysis of intact cells demonstrated
that CXCR4 is expressed as a constitutive multimer in the cell.
Incubation with SDF-1
and HIV-1 gp120 (ligands for CXCR4) did not
appreciably increase the observed energy transfer. Finally, sucrose
density gradient centrifugation suggested that CXCR4 is dimeric.
 |
EXPERIMENTAL PROCEDURES |
Cells, Cell Culture, and Transfections--
293T cells were
maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented
with 10% fetal calf serum and 100 IU/ml penicillin/streptomycin
(complete DMEM) at 37°C with 5% CO2. For
transfection, 1 × 107 293T cells were seeded in
150-mm tissue culture dishes and transfected with 10 µg of plasmid
DNA using Geneporter 2 reagent (Gene Therapy Systems), as described by
the manufacturer. Medium was replaced 24 h following transfection,
and cells were harvested with phosphate-buffered saline supplemented
with 5 mM EDTA 48 h post-transfection for use in
specific experiments.
Stable cell lines used for the production of CXCR4, CCR5, and CD4 were
Cf2Th-synCXCR4-C9, Cf2Th-synCCR5-C9, and 293T-CD4-C9, respectively.
For metabolic labeling, transfected cells were grown to confluency in
150-mm tissue culture dishes and the medium replaced with Dulbecco's
modified Eagle's medium lacking cysteine and methionine. Then 40 µCi/ml of EXPRE35S35S- Protein labeling mix
(PerkinElmer Life Sciences), which contains 35S-labeled
cysteine and methionine, was added, and cells were incubated for
12 h.
Plasmids--
Codon-optimized CXCR4 (synCXCR4) and CCR5
(synCCR5) were synthesized as previously described. A plasmid
expressing the C5a receptor-C9 construct was a generous gift of Hyeryun
Choe (Children's Hospital, Boston, MA). CXCR4 was subcloned into the
pcDNA 3.1 vector (Invitrogen), and a sequence encoding the C9
peptide (TETSQVAPA) was introduced immediately 5' to the natural stop
codon of CXCR4 (CXCR4-C9). For the creation of CXCR4 containing a
His6 tag, the CXCR4-C9 plasmid was digested with
KpnI and XbaI. This digestion specifically
removed the C9 tag and stop codon of the CXCR4-C9 gene.
Oligonucleotides encoding the His6 sequence (HisFor,
CGGCGGCGGCCACCACCACCACCACCACTAAT; HisRev,
CTAGATTAGTGGTGGTGGTGGTGGTGGCCGCCGCCGGTA) followed by a stop codon and
flanked by KpnI and XbaI overhangs, were
synthesized. These oligonucleotides were mixed at equimolar ratios,
boiled and cooled at room temperature for 1 h to allow annealing
to occur. This pair was then ligated into the digested
pcDNA3.1-CXCR4 backbone to create the expressor plasmid for
CXCR4-His. The plasmid encoding CCR5-His was created in an identical manner.
For the creation of expressor plasmids for the CXCR4 protein fused to
GFP2 or Renilla luciferase
(CXCR4-GFP2 and CXCR4-Rluc, respectively), the plasmid
encoding CXCR4-C9 was digested with HindIII and
KpnI. This digestion excised the CXCR4 open reading frame,
excluding the 3'-end encoding the C9 tag and stop codon, from the
pcDNA3.1 backbone. The pGFP2-N2 vector and pRluc-N2
vectors (both codon-humanized from Biosignal Packard) were also
digested with HindIII and KpnI and the backbone purified. The CXCR4-coding sequence was then ligated into each of the
above backbones. The CXCR4-GFP2 and CXCR4-Rluc constructs,
when expressed, produced CXCR4 with the fusion partner at the
intracellular, C terminus of the protein. Plasmids expressing
CCR5-GFP2, CCR5-Rluc, C5a receptor-GFP2, and
C5a receptor-Rluc were all synthesized in the same manner.
FACS Analysis--
Cells were harvested and resuspended in 100 µl of phosphate-buffered saline supplemented with 2% fetal calf
serum. Fusion protein expression was monitored by staining with the
phycoerythrin (PE)-conjugated antibodies 12G5-PE (anti-CXCR4;
PharMingen) or 2D7-PE (anti-CCR5, PharMingen). To assess the ability of
the CCR5 and CXCR4 fusion proteins to bind ligands, we used constructs consisting of SDF-1
(the natural ligand of CXCR4) and RANTES (a
natural ligand of CCR5) coupled to human Fc proteins. Fusion protein-expressing cells were incubated with increasing concentrations of SDF1
-Ig (for CXCR4) and RANTES-Ig (for CCR5) for 1 h at
37°C. Cells were subsequently stained with an anti-human
Ig-PE antibody (Jackson ImmunoResearch). To study binding of the HIV-1
gp120 envelope glycoprotein to CCR5 and CXCR4, purified gp120
glycoproteins from the ADA and HXBc2 HIV-1 strains, respectively, were
incubated with soluble CD4 (sCD4) for 1 h at room temperature to
create sCD4/gp120 complexes. These complexes were then incubated with transfected cells for 1 h at 37°C. The C11
anti-gp120 antibody, which does not disrupt CD4 or chemokine receptor
binding, was added, and incubation at 37 °C continued for 45 min.
Cells were washed once and anti-human Ig-PE added, followed by a 30-min
incubation at 4°C. All samples were analyzed with a
Becton Dickinson FacStar Plus instrument with CellQuest software.
Solubilization and Coimmunoprecipitation--
Transfected cells
were detached using phosphate-buffered saline, 5 mM EDTA.
Approximately 5 × 106 transfected cells were
resuspended in 1 ml of solubilization buffer containing 1% CHAPSO
(Anatrace), 100 mM
(NH4)2SO4, 20 mM Tris,
pH 8.5, 10% glycerol, 1× Complete Protease Inhibitor Mixture (Roche
Molecular Biochemicals) and incubated at 4 °C with rocking for 30 min. The lysate was then cleared by centrifugation at 14,000 × g for 30 min at 4°C. Cell lysates were
transferred to a clean microcentrifuge tube and precipitated with
either the C9 epitope tag-specific 1D4 antibody (National Cell Culture
Center) or the anti-His5 antibody (Qiagen) and protein
G-Sepharose for 2 h at 4°C. Precipitates were washed
three times with solubilization buffer and protein eluted in 1× SDS
sample buffer for 45 min at 37°C. Eluted protein was
resolved by SDS-PAGE using 12% Tris-glycine polyacrylamide mini-gels
(Invitrogen) for 1.5 h at 200 V. Gels were transferred to
Immobilon-P (Millipore) as described by the manufacturer, and Western
blot analysis was performed. Epitope-tagged proteins were detected with
either the 1D4 or anti-His5 antibodies (1 µg/ml),
followed by an anti-mouse IgG-horseradish peroxidase conjugate (1:5000;
Sigma). Membranes were incubated for 1 min with ECL reagent and exposed
to XOMAT-AR film for varying periods of time.
Sucrose Density Gradient Centrifugation--
Buffers containing
either 5 or 20% sucrose, 100 mM
(NH4)2SO4, 20 mM Tris,
pH 8.5, 5% glycerol, and 1% CHAPSO were combined to make 5-20%
continuous sucrose gradients. Sucrose gradients (11 ml in total) in
polyallomer centrifuge tubes (Beckman) were made using a Labconco
gradient maker. For molecular weight standards, 0.5 mg of bovine serum
albumin (Sigma), aldolase (Amersham Biosciences), catalase (Amersham
Biosciences), apoferritin (Sigma), or thyroglobulin (Amersham
Biosciences) was layered onto the sucrose gradient. Approximately
1 × 108 Cf2Th-synCXCR4-C9,
Cf2Th-synCCR5-C9, or 293T-CD4-C9 cells were solubilized in 1 ml
of solubilization buffer, as described above. Then 100 µl of the
whole cell lysate were loaded onto the sucrose gradient. Gradients were
centrifuged at 40,000 rpm for 18 h in a Beckman Optima L90-K
ultracentrifuge using an SW-41 rotor. Gradient fractions (15 drops
each) were collected from the bottom of the tube, resulting in a total
of 27 fractions. For gradients containing molecular weight markers,
fractions were analyzed by spectrophotometry at a wavelength of 280 nm
to assess protein content. To determine the migration of proteins
contained in whole cell lysates, 10 µl of each fraction was resolved
using SDS-PAGE. Gels were transferred to Immobilon-P, and membranes
were probed with the C9 tag-specific 1D4 antibody as described above.
Films were analyzed using a densitometer to determine the amount of
specific protein in each fraction.
Calculation of Detergent Binding to Membrane
Proteins--
Solubilized membrane proteins are known to bind large
amounts of detergent. Detergent binding exerts far greater effects on molecular weight than on the frictional coefficient of the protein when
native protein structure is maintained. Thus, detergent solubilization would be expected to result in an increase in the apparent molecular weight of the protein on sucrose density gradients. We employed the
following calculations, previously used to analyze detergent binding to
several membrane proteins including bacteriorhodopsin (30), to estimate
the expected molecular weights of CXCR4, CCR5, and CD4 in
detergent-protein complexes. LeMaire, Champeil, and Moller (30, 31)
have modeled the detergent shell surrounding the membrane-spanning
region of integral membrane proteins as a prolate spheroid. The
hydrophobic volume (VHprol) of this detergent shell can be expressed in Equation 1 as,
|
(Eq. 1)
|
where H represents the height of the
membrane-spanning helix or helices, p represents the
perimeter of the hydrophobic membrane-spanning domain of the protein,
and hd represents the height of the hydrophobic domain of the detergent. The height of the membrane-spanning regions of
several membrane proteins crystallized in the presence of detergents is
~30 Å (32, 33). The values of hd have been
calculated for several nonionic detergents bound to bacteriorhodopsin,
with an average hd equal to 8.1 ± 2.2 Å (30, 31). Using these values, Equation 1 reduces to Equation 2.
|
(Eq. 2)
|
For CXCR4 and CCR5, we assume that the values of p
are similar to each other as well as to that of other GPCRs. The
perimeter of bacteriorhodopsin has been previously calculated to be 120 Å (30). This value corresponds to the value of p estimated
from x-ray crystal structures of bacteriorhodopsin and rhodopsin (32, 33), and was used herein for both CCR5 and CXCR4. For membrane proteins
such as CD4, which have a single helix spanning the membrane, we
estimated a perimeter of 44 Å. Thus, for monomeric CCR5 and CXCR4, we
would expect a hydrophobic volume of ~50,000 Å3. For
monomeric CD4, the estimated hydrophobic volume is 21,000 Å3.
If any of these proteins were dimeric, a substantial portion of the
hydrophobic domains would be shielded from detergent by interaction
with the dimer partner. We estimate that the hydrophobic volume of the
detergent shell required to bind a dimer would be ~1.6 times that of
the monomer. If the membrane protein were a tetramer, we would expect a
detergent shell 2.2 times that required for a monomer.
The partial specific volumes of the hydrophobic portions of several
non-ionic detergents bound to bacteriorhodopsin have been calculated,
with a mean value of 337 ± 17 Å3 (reviewed in Ref.
31). This value is close to that estimated from the chemical structure
of non-ionic detergents. Using this value, we estimate that 62 and 148 molecules of detergent can bind to monomers of CD4 and CXCR4/CCR5,
respectively. Approximately 237 and 326 molecules of detergent would be
expected to bind CXCR4/CCR5 dimers and tetramers, respectively.
BRET2 Assay--
Cells transfected with
combinations of plasmids expressing Rluc and GFP2 fusion
proteins were harvested and resuspended in BRET2 buffer
containing 1× phosphate-buffered saline, 1 mM
CaCl2, 1 mM MgCl2, and 1g/liter
D-glucose. A total of 1 × 105 cells in 45 µl of the above buffer was transferred to a 96-well Optiplate
(Biosignal Packard). Deep Blue C, a coelenterazine derivative, was
allowed to warm to room temperature and resuspended in 125 µl of
absolute ethanol (1 mM final concentration). Reconstituted Deep Blue C was diluted 1:20 in BRET2 buffer and 5 µl of
the diluted solution added to each well of the microtiter plate to give
a final concentration of 5 µM. The samples were
immediately read with a Victor2 multilabel counter
(PerkinElmer Life Sciences) using dual sequential luminescence mode.
Each well was analyzed for 1 s with a 370-450 nm filter (for
Rluc), immediately followed by measurements with a 500-530 nm filter
(GFP2). BRET2 ratios were calculated by
dividing the luminescence measurement obtained with the
GFP2 filter by the measurement obtained with the Rluc
filter. For example, a reading of 10,000 counts with the Rluc filter
followed by a measurement of 5,400 counts with the GFP2
filter would yield a BRET2 ratio of 0.54.
For experiments in which ligands were preincubated with cells prior to
BRET2, 1 × 105 cells in 40 µl of
BRET2 buffer were transferred to the microtiter plate. Then
5 µl of ligand (RANTES-Ig, SDF1
-Ig, SDF-1
(R&D Systems), or
sCD4/gp120 complexes) were added to the cells to yield a final
concentration of 100 nM. The plate was incubated at
37°C for 1 h, and Deep Blue C was added. The plates
were immediately analyzed with the Victor2 as described above.
 |
RESULTS |
CXCR4 Contained in Cell Lysates Exists as a Multimer--
We have
previously reported the efficient solubilization of CXCR4 from an
overexpressing cell line employing the detergent CHAPSO (28). CXCR4
contained in CHAPSO-solubilized cell lysates was able to bind
conformation-dependent antibodies, the natural ligand
SDF-1
, and the HIV-1 envelope glycoprotein, gp120. These data
demonstrate that solubilized CXCR4 retained native conformation.
To examine whether CXCR4 can associate to form homomultimers, plasmids
were created that express CXCR4 with either a C-terminal C9 or
His6 epitope tag (CXCR4-C9 and CXCR4-His, respectively). These plasmids were cotransfected into 293T cells, and the resulting transfectants were solubilized with CHAPSO-containing buffer to create
a cell lysate. The cell lysates were incubated with the 1D4 antibody
(C9 epitope tag-directed), anti-His5 antibody
(His6 tag-specific), the conformation-dependent
anti-CXCR4 antibody 12G5, or the conformation-dependent
anti-CCR5 antibody 2D7. SDS-PAGE was performed on the precipitated
material, and the size-fractionated proteins were transferred to
Immobilon-P. A Western blot was performed using the 1D4 antibody, and
the results are shown in Fig. 1
(far left panel). In this experimental format, only the
CXCR4-C9 protein can be detected. The 1D4 antibody recognized CXCR4
precipitated with both the 12G5 and 1D4 antibodies but did not detect
any CXCR4 protein in the precipitates obtained with the negative
control 2D7 antibody. 12G5 only recognizes conformationally intact
CXCR4, whereas the 1D4 can bind all CXCR4-C9, regardless of
conformation. Notably, CXCR4-C9 was also detected in the sample
precipitated with the anti-His5 antibody. The precipitation
of the CXCR4-C9 protein by the anti-His5 antibody was
dependent upon the presence of the CXCR4-His protein in the transfected
cells (Fig. 1, left-center panel). This suggests that
precipitation with the anti-His5 antibody effectively
precipitated the complex of CXCR4-C9/CXCR4-His and that CXCR4-C9
associates with CXCR4-His to form CXCR4 homomultimers in the cellular
lysate.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1.
CXCR4 exists as a multimer in cell
lysates. 293T cells were cotransfected with plasmids expressing
either CXCR4-His and CXCR4-C9 (far left panel), CXCR4-C9 and
CCR5-His (left-center panel), CCR5-C9 and CXCR4-His
(right-center panel), or CCR5-C9 and CCR5-His (far
right panel). Cell lysates were immunoprecipitated with 12G5
(CXCR4-specific), 2D7 (CCR5-specific), 1D4 (C9 tag-specific), or the
anti-His5 (His6 tag-specific) antibodies.
Precipitates were subjected to SDS-PAGE and transferred to Immobilon-P.
Blots were probed with the 1D4 antibody to detect any protein that
contains a C9 tag. The positions of the CXCR4 precursor and mature
CXCR4, as well as that of the proteolytically processed form of CXCR4,
are indicated.
|
|
CXCR4 Multimerization Is Specific--
To examine the specificity
of the CXCR4 multimerization, we coexpressed the CXCR4-C9 and CCR5-His
proteins in 293T cells; the CCR5-C9 and CXCR4-His proteins were
coexpressed in independently transfected cells. The cell lysates were
precipitated with the 12G5, 2D7, 1D4, and anti-His5
antibodies, and the precipitated proteins were separated by SDS-PAGE
and Western blotted with the 1D4 antibody (Fig. 1, middle two
panels). When CCR5-His was precipitated with the anti-His
antibody, no CXCR4-C9 protein could be detected (Fig. 1,
left-center panel). Likewise, when CXCR4-His was
precipitated with the anti-His antibody, no CCR5-C9 could be detected
(Fig. 1, right-center panel). Apparently, CXCR4 does not
associate with CCR5 in the cell lysate, suggesting that the
self-association of CXCR4 is specific. In similarly designed
experiments in which CCR5-His and CCR5-C9 were coexpressed, the
anti-His5 antibody did not precipitate CCR5-C9 (Fig. 1,
far right panel). This suggests either that CCR5 does not
multimerize in the transfected cells or that the CCR5 multimers
associate less strongly than the CXCR4 multimers under the
solubilization conditions used.
CXCR4 Multimerization Is Evident at Low Expression Levels--
To
address whether overexpression might contribute to CXCR4
self-association, a coprecipitation experiment was performed in which
the total DNA transfected into the 293T cells was titered to very low
levels. Only at the lowest level (0.2 µg) of cotransfected plasmids
expressing CXCR4-C9 and CXCR4-His was coprecipitation of CXCR4-C9 by
the anti-His5 antibody not observed (Fig.
2). As can be seen, the level of CXCR4-C9
present (1D4 lane) at this level of transfected DNA was very
low. The affinity of the anti-His5 antibody is ~10-fold
lower than that of the 1D4 antibody. Taking the affinity of the
antibodies into account, the results indicate that a significant
fraction of the CXCR4-His precipitated by the anti-His5
antibody is associated with CXCR4-C9 molecules, even at lower
expression levels.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 2.
CXCR4 multimerization is not the result of
overexpression. 293T cells were cotransfected with decreasing
amounts of plasmids encoding CXCR4-C9 and CXCR4-His. Each construct was
transfected in equivalent amounts; i.e. when 8 µg of total
DNA was transfected, this represents 4 µg each of the plasmids
expressing CXCR4-His and CXCR4-C9. Cells were lysed and the lysates
precipitated with either the 1D4 or the anti-His5
antibodies. Following SDS-PAGE, gels were transferred to a solid
support and immunoblotted with the C9-specific 1D4 antibody.
|
|
Conformation Dependence of CXCR4 Multimerization--
To examine
whether CXCR4 multimerization depends upon the native conformation of
CXCR4, 293T cells coexpressing CXCR4-C9 and CXCR4-His proteins were
solubilized in either CHAPSO or
n-nonyl-
-D-glucoside (NDG). CHAPSO has been
demonstrated to maintain native CXCR4 conformation whereas NDG
denatures CXCR4 (28). Samples were precipitated with the 1D4 antibody
and analyzed by SDS-PAGE and Western blot, using either the 1D4 or the
anti-His5 antibody for detection (Fig. 3A). The CXCR4-His protein was
detected in CXCR4-C9 precipitates only when CHAPSO was used to
solubilize the cells. This result is consistent with a model in which
CXCR4 multimerization is dependent on native conformation.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 3.
CXCR4 multimerization is dependent upon
native conformation and coexpression within the cell.
A, 293T cells were cotransfected with plasmids
expressing CXCR4-C9 and CXCR4-His. Cell lysates were prepared with
either CHAPSO or NDG detergents and precipitated with the 1D4 antibody.
Precipitates were analyzed by SDS-PAGE and Western blotting. Western
blots were probed with either 1D4 (left panel) or the
anti-His5 (right panel) antibodies.
B, 293T cells were cotransfected with plasmids
expressing CXCR4-His and CXCR4-C9 and lysed (left four
lanes). In parallel, one flask of 293T cells was transfected with
a plasmid expressing CXCR4-His and another with a plasmid expressing
CXCR4-C9. The latter cells were harvested, combined and subsequently
lysed as a mixture (right four lanes). Samples were
precipitated with the indicated antibodies and subjected to SDS-PAGE
and Western blotting, using the 1D4 antibody for detection.
|
|
CXCR4 Exists as a Multimer in the Intact Cell
Membrane--
Because artifactual chemokine receptor aggregation can
arise in denaturing detergents, we examined whether the observed CXCR4 multimerization might be detergent-induced. 293T cells were transfected with plasmids expressing CXCR4-C9 and CXCR4-His either together or
individually. The 293T cells transfected with the individual expressor
plasmids were subsequently combined. The 293T cells expressing both
CXCR4-C9 and CXCR4-His, and the mixture of cells expressing the
individual proteins were subsequently solubilized. The cell lysates
were used for precipitation by the 12G5, 2D7, 1D4, or
anti-His5 antibodies and a Western blot performed as
previously described. As shown in Fig. 3B, the
anti-His5 antibody only precipitated CXCR4-C9 when
CXCR4-His and CXCR4-C9 were expressed in the same cell. The
anti-His5 antibody did not precipitate CXCR4-C9 from the
mixture of 293T cells individually expressing CXCR4-His and CXCR4-C9.
These results suggest that the multimeric association of the CXCR4
proteins occurs between molecules expressed in the same cell.
To confirm that CXCR4 multimerization occurs in an intact cell,
we used bioluminescence resonance energy transfer (BRET2)
analysis. BRET2 is a modified version of the standard BRET
analysis. BRET has been previously used for another GPCR, the
2-adrenergic receptor, to demonstrate multimerization
(26).
Briefly, BRET2 can detect molecules in close proximity to
one another by using energy transfer from one tag to another. This is
achieved by using proteins tagged with a modified green fluorescent protein (GFP2) and Renilla luciferase (Rluc).
Plasmids encoding these two proteins are cotransfected into cells, and
the proteins are expressed. Deep Blue CTM (a coelenterazine
derivative), a cell-permeable substrate for Rluc, is then added to the
cells and bioluminescence is measured immediately. This bioluminescence
can provide energy to the GFP2 protein, resulting in
fluorescence, only if the protein-GFP2 and protein-Rluc
molecules are in close proximity (~50 Å). The emitted energy from
the Rluc (395 nm) can be easily distinguished from the energy emitted
by the GFP2 (510 nm) using sequential dual luminescence.
The BRET2 signal is easily determined by measuring the
ratio of GFP2 emission to Rluc emission.
Constructs encoding CXCR4 and CCR5 fusion proteins
(CXCR4-GFP2, CXCR4-Rluc, CCR5-GFP2, and
CCR5-Rluc) were synthesized. The fusion partners were expressed at the
C terminus of the GPCR and thus are expected to be localized inside the
cell. 293T cells were transfected with various combinations of these
constructs and luminescence measurements (emission of 370-450 nm for
luciferase and 500-530 nm for GFP2) were obtained using a
Victor2 multilabel counter. The BRET2 ratio was
calculated by dividing the GFP2 signal by the Rluc signal.
All samples were tested in duplicate, and a negative control consisting
of CXCR4-Rluc only was included. Multiple experiments were performed,
and the results of a representative experiment are shown in Fig.
4. The negative control (CXCR4-Rluc only)
consistently gave a BRET2 ratio of about 0.08. This was
considered to be the lowest possible level that could be obtained due
to "bleed" of the Rluc emission through the GFP2
filter. When CXCR4-Rluc and CXCR4-GFP2 were coexpressed, a
BRET2 ratio of ~0.45 was consistently obtained. By
contrast, when the combinations CXCR4-Rluc/CCR5-GFP2,
CCR5-Rluc/CXCR4-GFP2, or CCR5-Rluc/CCR5-GFP2
were tested, a BRET2 ratio of between 0.12 and 0.19 was
observed. These data strongly suggest that CXCR4 exists as a multimer
in the intact cell membrane.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4.
BRET2 measurements of GPCRs in
intact cells. Specific GFP2 and Rluc constructs,
denoted by a (+) beneath the graph, were
expressed in 293T cells. Transfectants were harvested, transferred to
an Optiplate in duplicate, and Deep Blue C was added at a concentration
of 5 µM. The microtiter plate was immediately read using
dual sequential luminescence on a Victor2 multilabel reader
(filters were 410 ± 40 nm (Rluc) followed by 515 ± 15 nm
(GFP2)). The luminescence reading for GFP2 was
divided by that obtained for Rluc to yield the BRET2
ratio.
|
|
The BRET2 ratios obtained for the CCR5 pair as well as the
control mixed pairs were higher than that observed for the negative control (CXCR4-Rluc only). It is possible that weak CCR5/CCR5 homomultimers as well as CXCR4/CCR5 heteromultimers were present in the
cell membrane, resulting in a BRET2 signal greater than
that seen in the CXCR4-Rluc control. To test this hypothesis, we
created GFP2 and Rluc fusion proteins of the C5a receptor.
This is a G protein-coupled receptor that is only distantly related to
the CXCR4 and CCR5 proteins and would not be expected to
heteromultimerize with either HIV-1 coreceptor. The BRET2
results obtained with the C5a receptor are shown in Fig. 4. The BRET2 ratios observed for the C5a receptor-expressing cells
were less than 0.20, in the same range as the BRET2 ratios
for cells expressing CCR5-Rluc/CCR5-GFP2 or the CCR5/CXCR4
combinations. The BRET2 ratios for cells expressing the C5a
receptor in combination with CXCR4 or CCR5 were also in the same range.
For this group of GPCRs, CXCR4 is unique in its ability to give a
strong BRET2 signal. These results suggest that CXCR4
exists as a homomultimer in the cell membrane.
It is possible that the expression levels of the various fusion
proteins affected the strength of the associations. To monitor expression levels, transfected cells were metabolically labeled with
cysteine and methionine and immunoprecipitated with either the 2D7 (for
CCR5 constructs) or 12G5 (for CXCR4 constructs) antibodies. The
expression levels of all CXCR4 constructs were equivalent, as were the
levels of all CCR5 constructs (data not shown). To ensure that these
proteins were expressed on the cell surface, FACS analysis was
performed using CXCR4- and CCR5-specific antibodies. Fusion proteins
were shown to be expressed on the cell surface at levels similar to
those of the codon-optimized wild-type CXCR4 and CCR5 proteins (data
not shown).
The ratio of protein-GFP2 DNA to protein-Rluc DNA that was
transfected into 293T cells was varied. 293T cells were transfected with different ratios of plasmids expressing CXCR4-GFP2 or
CCR5-GFP2 and CXCR4-Rluc; the BRET2 results are
shown in Fig. 5A. For amounts
of plasmid DNA that gave BRET2 ratios above background, the
BRET2 signal of the CXCR4 pair remained 2.5 times
greater than that of the CXCR4/CCR5 mixed pair. These data demonstrate
that the higher BRET2 signal associated with the CXCR4
homomultimers occurs over a wide range of relative expression of the
GFP2 and Rluc fusion proteins.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 5.
BRET2 measurements are not
dependent upon transfection conditions. A, 293T
cells were transfected with plasmids expressing CXCR4-Rluc and either
CXCR4-GFP2 (dark bars) or CCR5-GFP2
(light bars). A total of 10 µg of DNA was transfected, and
the relative percentage of each construct is indicated at the
bottom of the graph. BRET2 was
performed in duplicate and the results plotted. B, 293T
cells were transfected with various total amounts of plasmid DNA
indicated below the graph. When two different
constructs were expressed, the ratio of each expressor plasmid in the
transfection was 1:1. BRET2 was performed and the results
plotted.
|
|
Overexpression could hypothetically lead to artifactually high
BRET2 signals. We titrated the amount of total DNA
transfected into the 293T cells to determine the effect of expression
levels on the BRET2 ratio. As shown in Fig. 5B,
the BRET2 ratio was essentially unaffected by up to 30-fold
differences in the total amount of DNA transfected. FACS analysis
confirmed that CXCR4 surface expression was directly related to the
amount of plasmid DNA transfected (data not shown). These experiments suggest that, over a wide range of expression levels, CXCR4 exists as a
multimer in the cell membrane.
CXCR4 Multimerization Is Not Greatly Enhanced by Ligands--
The
above studies indicate that CXCR4 multimerization occurs in the absence
of ligands. However, because the proportion of total protein that is
multimeric is unknown, it is possible that ligand binding could
influence the degree of CXCR4 multimerization. To examine this, we
incubated 293T cells coexpressing CXCR4-GFP2 and CXCR4-Rluc
or CCR5-GFP2 and CXCR4-Rluc with 100 nM of
SDF-1
, SDF1
-Ig, RANTES-Ig (CCR5 ligand), or HIV-1 gp120/CD4
complexes prior to BRET2 analysis. As shown in Fig.
6, only SDF1
-Ig and SDF-1
induced minor but reproducible increases in the BRET2 signal. For
SDF1
-Ig, this may be due to the dimeric nature of this ligand. We
conclude that CXCR4 is constitutively multimeric, with ligand binding
exerting minimal effects on multimerization.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 6.
CXCR4 multimerization is not greatly enhanced
by ligand binding. 293T cells were transfected with plasmids
expressing the indicated proteins. Cells were transferred to a
microtiter plate and incubated with 100 nM SDF-1 ,
SDF1 -Ig, RANTES-Ig, or HXBc2 gp120/CD4 complexes for 1 h
at 37°C. Luciferase substrate was then added and
luminescence immediately measured with a Victor2 multilabel
counter.
|
|
CXCR4 Forms Stable Dimers--
The above experiments indicate that
CXCR4 assembles into multimers in cells. To examine the oligomeric
state of CXCR4, we employed sucrose density gradient centrifugation of
CXCR4 solubilized in cell lysates. First, the effects of the detergents
used to solubilize CXCR4 on the sedimentation of the water soluble
proteins used as markers in this study were investigated. Continuous
sucrose gradients (5-20%) containing buffers identical to those used
for CXCR4 solubilization were layered with 0.5 mg bovine serum albumin (66 kDa), aldolase (158 kDa), catalase (232 kDa), apoferritin (440 kDa), or thyroglobulin (669 kDa) and centrifuged at 40,000 rpm for
18 h. Gradients were fractionated and spectrophotometry performed
to determine protein content for each fraction. Fractions 21, 17, 13, 8, and 6 contained the highest concentration of bovine serum albumin,
aldolase, catalase, apoferritin, and thyroglobulin, respectively.
Although the sedimentation of proteins is influenced by the frictional
coefficient as well as the molecular weight, the results indicate that
sedimentation in sucrose density gradients in the presence of CHAPSO
and Cymal-7 detergents can allow an approximation of molecular weights.
All of the above marker proteins are water-soluble and are therefore
expected to bind little detergent. By contrast, integral membrane
proteins bind significant amounts of detergent, and therefore sediment
as protein-detergent complexes. In addition to CXCR4, two other
integral membrane proteins, CCR5 and CD4, were studied. Cf2Th-synCXCR4-C9, Cf2Th-synCCR5-C9, and 293T-CD4-C9
cells expressing C9-tagged CXCR4, CCR5 and CD4, respectively, were
lysed in buffers containing either CHAPSO or Cymal-7, and the cell
lysates were layered onto 5-20% continuous sucrose density gradients.
The gradient fractions were analyzed by SDS-PAGE followed by Western
blotting using the C9-specific 1D4 antibody (Fig.
7). The CXCR4 protein sedimented as a
symmetric peak centered at fraction 14 in the gradient. CCR5 and CD4
sedimented as asymmetric peaks with fractions 19 and 18, respectively,
containing the most protein. The results obtained with both CHAPSO and
Cymal-7 detergents were similar (data not shown).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 7.
CXCR4 sediments as a dimer on sucrose density
gradients. Cell lysates containing CXCR4-C9, CCR5-C9, or CD4-C9
were applied to 5-20% sucrose gradients, centrifuged, and
fractionated. Fractions were resolved on SDS-PAGE and Western blotted,
using the 1D4 antibody for detection. The top panel shows
the results for CXCR4-C9, the middle panel, CCR5-C9, and the
bottom panel, CD4-C9. Fraction number is indicated
above the figure (fraction 1 is the bottom of the gradient
and fraction 27 is the top). Densitometry was performed, and the
filled arrows above the figure denote the peak of protein
migration for all three proteins. The fractions in which the protein
markers sedimented are also indicated (open arrows).
|
|
Interpolating from the observed sedimentation of the soluble protein
standards, the estimated molecular masses of the protein-detergent complexes for CXCR4, CCR5, and CD4 were 215, 115, and 135 kDa, respectively. The molecular masses of the monomeric CXCR4, CCR5 and CD4 proteins are 43, 39 and 52 kDa, respectively. It has been shown
that the apparent molecular weight of bovine rhodopsin increased by a
factor of 2.2 when bound to detergent (Triton X-100) (30). A similar
increase for the proteins studied herein would explain the apparent
molecular weights of detergent complexes with CCR5 and CD4, provided
these proteins were mostly monomeric. As CD4 is known to be primarily a
monomer, the relatively close sedimentation of CD4 and CCR5 in the
presence of detergent suggests that CCR5 is also monomeric under these conditions.
The observed sedimentation of the CCR5 and CD4 proteins is consistent
with expectations of the number of detergent molecules bound to the
membrane-spanning portions of the monomeric proteins. Such estimates
are based on the known structures of integral membrane proteins and
generally correspond well to empirical data (30, 31). Assuming that
CCR5 resembles rhodopsin in the membrane-spanning region and that CD4
has a single, helical membrane-spanning anchor, we estimated the number
of detergent molecules bound to these proteins, as described under
"Experimental Procedures." These calculations suggest that 62 and
148 molecules of detergent would be expected to bind monomers of CD4
and CCR5, respectively. Using 630 Da as the molecular mass of CHAPSO,
we would expect detergent-protein complexes of monomeric CD4 and CCR5
to exhibit molecular masses of ~90 and 130 kDa, respectively. Given
the unknown contribution of the bound detergent to the frictional
coefficient, which influences sedimentation velocity, the observed
sedimentation of CD4 and CCR5 is consistent with that of monomeric proteins.
The solubilized CXCR4 protein sedimented significantly faster than
either CD4 or CCR5, suggesting that it is a multimer under these
conditions. As CXCR4 and CCR5 are similar in molecular weight and
presumably in structure, we would expect that detergent would contribute comparably to the molecular weight and frictional
coefficient of the two proteins. Thus, the observed sedimentation of
CXCR4, which suggests a molecular weight that is approximately twice that of CCR5, implies that CXCR4 is a dimer under these conditions. This interpretation is supported by predictions of the number of
detergent molecules, 237, that could bind a GPCR dimer (see "Experimental Procedures"). A CXCR4 dimer-CHAPSO complex would be
predicted to have a molecular mass of 230 kDa, in agreement with the
molecular mass approximated from the sucrose gradients. Were CXCR4
assembled into oligomers larger than dimers, the predicted molecular
weight of such protein-detergent complexes would be too great to fit
the observed sedimentation. We conclude that, under the solubilization
conditions employed, CXCR4 is a dimer. Most of the CCR5 and CD4
proteins are apparently monomers under these conditions.
 |
DISCUSSION |
Herein we provide several pieces of evidence that suggest that
human CXCR4 forms stable dimers in cells. Coimmunoprecipitation studies
indicated that CXCR4 associated with itself in detergent lysates, but
not with a related GPCR, CCR5. BRET2 analysis confirmed
that, in intact cells, the self-association of CXCR4 is significantly
more efficient than the homomultimerization of CCR5 or C5a receptor, a
GPCR unrelated to the CXCR4 or CCR5 chemokine receptors. The
BRET2 studies also confirmed that CXCR4 associates with
itself far more efficiently than it associates with either CCR5 or C5a
receptor. The binding of ligands to CXCR4 did not appear to
substantially alter the degree of multimerization. The multimerization
of CXCR4 occurs over a wide range of expression levels and depends upon preservation of the native conformation of CXCR4. The sedimentation of
CXCR4-detergent complexes from cell lysates suggests that the majority
of CXCR4 is a dimer under these conditions. These results indicate that
CXCR4 forms specific, constitutive dimers in expressing cells.
Dimerization between homologous and heterologous GPCRs has been
described (19-23). In most cases, dimerization of GPCRs occurs independently of bound ligands, although stabilization of GPCR oligomers by agonist treatment has been reported (26, 34). Our
observation that precursor forms of CXCR4 were apparently self-associated in the coprecipitation studies suggests that
dimerization occurs soon after CXCR4 synthesis and folding. The results
of the sucrose density gradient analysis indicate that most or all of
the CXCR4 in the cell lysate is dimeric. Ligand binding exerted little
effect on multimerization. Together, these observations indicate that
the native state of human CXCR4 may be a dimer.
We observed little or no evidence of CXCR4 association with CCR5, the
other major HIV-1 coreceptor (13-17),. The BRET2 signal
associated with coexpression of CXCR4 and CCR5 did not exceed that
associated with coexpression of CXCR4 or CCR5 with an unrelated GPCR,
C5a receptor. We suspect that these BRET2 signals, which
are consistently lower than that seen in the case of CXCR4
self-association, may result from the membrane expression of any tagged
GPCRs. Thus, such BRET2 signals may not reflect specific
associations between these proteins, but rather random associations
promoted by the limited degrees of freedom available to the fusion
proteins in the cell membrane.
The specificity of CXCR4 association with itself suggests that regions
of the protein that are unique among GPCRs mediate the dimerization.
Based on the strong propensity of CXCR4 to form dimers and not higher
order oligomers, it is likely that these represent head-to-head dimers.
For some dimeric GPCRs, transmembrane helices 5 and 6 have been
suggested to play an important role in protein-protein contacts (35,
36). The fifth transmembrane helix of CXCR4 contains an additional
cysteine not found in the other chemokine receptors. Although there are
no disulfide bonds linking CXCR4 dimers,2 it is possible
that this residue contributes in other ways to CXCR4 dimerization. The
robust nature of CXCR4 self-association should facilitate attempts to
understand the molecular contacts responsible.
It will be of interest to define the role of CXCR4 dimerization in the
diverse roles of this GPCR in physiology and pathology. Some chemokines
have been shown to form dimers, and significant avidity effects would
accompany the interaction of dimeric ligands and receptors. There are
conflicting data regarding the propensity of SDF-1
to dimerize.
Sedimentation equilibrium and NMR studies of SDF-1
suggested that
this chemokine is a monomer (37), even at high concentrations. On the
other hand, the N33A variant of SDF-1
crystallized as a dimer (38),
the structure of which resembled the dimer of another chemokine, IL-8.
Using analytical ultracentrifugation and dynamic light scattering,
Holmes et al. (39) obtained evidence that SDF-1
exists in
a monomer-dimer equilibrium. The dimerization constant was only 150 µM, suggesting that the weak self-association of SDF-1
could be significantly influenced by context-dependent
variables. It is possible that receptor binding promotes SDF-1
dimerization through these otherwise weak bonds.
CXCR4 dimerization could also influence its activity as an HIV-1
receptor. Most HIV-1 that are transmitted and predominate early in the
course of infection utilize CCR5 as a coreceptor (40-43). Later in
infection, a high percentage of infected individuals harbor HIV-1
isolates that utilize, in addition, the CXCR4 receptor (40, 44-47).
The efficiency with which these late isolates replicate in cells
expressing CD4 and CXCR4 equals or exceeds that of early isolates in
cells expressing CD4 and CCR5 (48-50). This high replication efficiency is achieved despite a significantly lower affinity of the
gp120 glycoprotein of late isolates for CXCR4 compared with that of
early isolates for CCR5 (28, 51, 52). The HIV-1 envelope glycoproteins
are trimers and thus contain three receptor-binding sites. The
interactions of envelope glycoprotein trimers with head-to-head dimers
of CXCR4 could form hexameric arrays at the virus-cell interface. The
avidity gained by the formation of such arrays could compensate for low
gp120-CXCR4 affinity. Moreover, the assembly of such hexameric
structures might also facilitate the membrane fusion process, which has
been proposed to require the cooperation of several envelope
glycoprotein trimers and 4-6 chemokine receptors (50).
Other laboratories have recently reported that CCR5 exists as a
multimer in cell lysates (22, 23) and intact cells (27). Our data
suggest that, if CCR5 dimerizes, such dimers are much more weakly
associated than CXCR4 dimers. The asymmetric peak of CCR5 in the
sucrose density gradients raises the possibility that a minor fraction
of CCR5 exists as a dimer under these conditions. CD4 also exhibited an
asymmetric peak in the gradients, and weakly associated dimers of
soluble CD4 have been observed at high protein concentrations (53). We
did not detect evidence of CCR5 self-association in the coprecipitation
experiments. Moreover, the BRET2 ratio observed for
coexpression of CCR5-GFP2 and CCR5-Rluc was no greater than
that observed for all of the mixed GPCR pairs tested. As discussed
above, this BRET2 ratio may simply represent the background
fluorescence due to the coexpression of two membrane-associated
receptors with GFP2 and Rluc domains fused to their
cytoplasmic tails. Future work will be required to determine whether
CCR5 forms dimers and if such dimerization is relevant to its natural
state and function. Recognition of the strong propensity of CXCR4 to
dimerize should lead to an understanding of the importance of
dimerization to CXCR4 signaling and utilization as an HIV-1 receptor.