JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M210140200 on November 13, 2002

J. Biol. Chem., Vol. 278, Issue 5, 3378-3385, January 31, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/5/3378    most recent
M210140200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Babcock, G. J.
Right arrow Articles by Sodroski, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Babcock, G. J.
Right arrow Articles by Sodroski, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Ligand-independent Dimerization of CXCR4, a Principal HIV-1 Coreceptor*

Gregory J. BabcockDagger §, Michael FarzanDagger §, and Joseph SodroskiDagger §||**

From the Dagger  Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, the § Department of Pathology, Division of AIDS, Harvard Medical School, and the || Department of Immunology and Infectious Disease, Harvard School of Public Health, Boston, Massachusetts 02115

Received for publication, October 3, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

CXCR4, a member of the G protein-coupled receptor family of proteins, is the receptor for stromal cell-derived factor (SDF-1alpha ) and is a principal coreceptor for human immunodeficiency virus type 1 (HIV-1). CXCR4 has also been implicated in breast cancer metastasis. We examined the ability of CXCR4 to homomultimerize in detergent-solubilized cell lysates and in the membranes of intact cells. CXCR4 was found to multimerize in cell lysates containing the detergents CHAPSO or Cymal-7 but not other detergents that have been shown to disrupt the native conformation of CXCR4. CXCR4 expression levels did not affect the observed multimerization and differentially tagged CXCR4 molecules associated only when coexpressed in the same cell. CXCR4 did not interact with CCR5, the other principal HIV-1 coreceptor, when the two proteins were coexpressed. Using bioluminescence resonance energy transfer (BRET2), we demonstrated that CXCR4 multimers are found naturally in the intact cell membrane, in both the presence and absence of multiple CXCR4 ligands. Ligand binding did not significantly alter the observed BRET2 signal, suggesting that CXCR4 exists as a constitutive oligomer. In cell lysates prepared with non-denaturing detergents, CXCR4 sedimented in a manner consistent with a dimer, whereas CCR5 sedimented as a monomer under these conditions. The stable, constitutive dimerization of CXCR4 may contribute to its biological functions in chemokine binding, signaling, and HIV-1 entry.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Seven transmembrane domain, G protein-coupled receptors (GPCR)1 are expressed in many different cell types and have various functions ranging from chemotaxis to light detection. Approximately 1-2% of the human genome encodes for GPCRs (1-3) and as such, these proteins are commonly targeted for pharmaceutical intervention. Purification and study of GPCRs are complicated by both low expression levels (4) and hydrophobicity.

CXCR4 is a member of the GPCR family of proteins and is the natural receptor for stromal cell-derived growth factor 1alpha (SDF-1alpha ) (5, 6). CXCR4 is essential in mouse development, as demonstrated by the observation that disruption of the cxcr4 gene leads to hematopoietic, cardiovascular, and cerebellar defects and embryonic lethality (7, 8). Almost identical phenotypes were associated with deletion of the sdf1alpha gene in mice (9), suggesting that CXCR4 may be the sole receptor for SDF-1alpha . CXCR4 has also been implicated in breast cancer metastasis (10). These studies demonstrate the biological importance of CXCR4.

CXCR4 has also been shown to be a principal coreceptor for human immunodeficiency virus type 1 (HIV-1) infection (11). The HIV-1 envelope glycoprotein, gp120, binds to the primary receptor, CD4 (12), expressed on the cell surface. This interaction results in conformational changes in gp120 that allow binding to either CXCR4 (11) or CCR5 (13-17), depending on the viral strain. Interaction with these coreceptors is believed to induce further conformational changes in the envelope glycoprotein, gp41 (18), culminating in viral fusion with the host cell membrane. The diverse roles of CXCR4 in physiology and disease underscore the importance of furthering our understanding of the biochemistry of this chemokine receptor.

In recent years, it has been speculated that GPCRs may form both homomultimers and heteromultimers in the cell membrane. Coexpression studies with the GABAb-R2 receptor demonstrated that efficient surface expression and function was dependent upon association of this protein with the GABAb-R1 protein (19-21). The interpretation of these data was that hetero-oligomerization was necessary for the functionality of this receptor. Most studies of GPCR oligomerization have involved co-immunoprecipitation and cross-linking (22). Specifically, multiple groups have demonstrated either constitutive (23) or ligand-induced multimerization of CCR5 in cell lysates (22). Using these techniques, it was also shown that the beta 2-adrenergic receptor can form multimers in detergent-containing cell lysates (24-26).

The above studies used detergent-solubilized cell lysates to investigate GPCR multimerization. Multimerization can also be approached using intact cells with proximity-based assays such as fluorescence resonance energy transfer (FRET) or bioluminescence resonance energy transfer (BRET). BRET, which utilizes the transfer of energy from Renilla luciferase to a yellow fluorescent protein (YFP) in close proximity (<50 Å), has been employed to demonstrate multimerization of both beta 2-adrenergic receptor (26) and CCR5 (27). Recently the BRET technology has been improved and is now called BRET2. This assay uses a newly formulated Renilla luciferase substrate (Deep Blue CTM) that results in emission at a shorter wavelength (395 nm) as compared with that of conventional coelenterazine (480 nm). In addition, a modified GFP protein, GFP2, was synthesized that absorbs at 395 nm and emits at 510 nm. The original BRET assay used yellow fluorescent protein (YFP: emission of 525 nm), which could not efficiently absorb at 395 nm. These two modifications allow for greater spectral resolution (115 nm) than the traditional BRET assay (45 nm). The greater resolution results in less contamination of the GFP2 signal with background emission from the luciferase and thus more interpretable results.

Our laboratory has recently developed a method to solubilize CXCR4 in a native conformation using the detergent CHAPSO (28). CXCR4 contained within CHAPSO-solubilized cell lysates could bind conformation-dependent antibodies, the chemokine SDF-1alpha and CXCR4-using HIV-1 gp120 envelope glycoproteins (28). This method is also effective at solubilizing conformationally intact CCR5.2 CCR5 contained in CHAPSO-solubilized cell lysates can bind both conformation-dependent antibodies and CCR5-using gp120; however, for as yet undetermined reasons, solubilized CCR5 cannot bind its natural ligands, MIP-1alpha , MIP-1beta , or RANTES (29).

Here we investigate the oligomerization state of CXCR4 in CHAPSO-solubilized cell lysates and intact cells. Coimmunoprecipitation studies using cell lysates determined that CXCR4 exists as a multimer under these conditions. This multimerization does not appear to be dependent upon overexpression or artifacts inherent in membrane protein solubilization. BRET2 analysis of intact cells demonstrated that CXCR4 is expressed as a constitutive multimer in the cell. Incubation with SDF-1alpha and HIV-1 gp120 (ligands for CXCR4) did not appreciably increase the observed energy transfer. Finally, sucrose density gradient centrifugation suggested that CXCR4 is dimeric.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cells, Cell Culture, and Transfections-- 293T cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum and 100 IU/ml penicillin/streptomycin (complete DMEM) at 37°C with 5% CO2. For transfection, 1 × 107 293T cells were seeded in 150-mm tissue culture dishes and transfected with 10 µg of plasmid DNA using Geneporter 2 reagent (Gene Therapy Systems), as described by the manufacturer. Medium was replaced 24 h following transfection, and cells were harvested with phosphate-buffered saline supplemented with 5 mM EDTA 48 h post-transfection for use in specific experiments.

Stable cell lines used for the production of CXCR4, CCR5, and CD4 were Cf2Th-synCXCR4-C9, Cf2Th-synCCR5-C9, and 293T-CD4-C9, respectively.

For metabolic labeling, transfected cells were grown to confluency in 150-mm tissue culture dishes and the medium replaced with Dulbecco's modified Eagle's medium lacking cysteine and methionine. Then 40 µCi/ml of EXPRE35S35S- Protein labeling mix (PerkinElmer Life Sciences), which contains 35S-labeled cysteine and methionine, was added, and cells were incubated for 12 h.

Plasmids-- Codon-optimized CXCR4 (synCXCR4) and CCR5 (synCCR5) were synthesized as previously described. A plasmid expressing the C5a receptor-C9 construct was a generous gift of Hyeryun Choe (Children's Hospital, Boston, MA). CXCR4 was subcloned into the pcDNA 3.1 vector (Invitrogen), and a sequence encoding the C9 peptide (TETSQVAPA) was introduced immediately 5' to the natural stop codon of CXCR4 (CXCR4-C9). For the creation of CXCR4 containing a His6 tag, the CXCR4-C9 plasmid was digested with KpnI and XbaI. This digestion specifically removed the C9 tag and stop codon of the CXCR4-C9 gene. Oligonucleotides encoding the His6 sequence (HisFor, CGGCGGCGGCCACCACCACCACCACCACTAAT; HisRev, CTAGATTAGTGGTGGTGGTGGTGGTGGCCGCCGCCGGTA) followed by a stop codon and flanked by KpnI and XbaI overhangs, were synthesized. These oligonucleotides were mixed at equimolar ratios, boiled and cooled at room temperature for 1 h to allow annealing to occur. This pair was then ligated into the digested pcDNA3.1-CXCR4 backbone to create the expressor plasmid for CXCR4-His. The plasmid encoding CCR5-His was created in an identical manner.

For the creation of expressor plasmids for the CXCR4 protein fused to GFP2 or Renilla luciferase (CXCR4-GFP2 and CXCR4-Rluc, respectively), the plasmid encoding CXCR4-C9 was digested with HindIII and KpnI. This digestion excised the CXCR4 open reading frame, excluding the 3'-end encoding the C9 tag and stop codon, from the pcDNA3.1 backbone. The pGFP2-N2 vector and pRluc-N2 vectors (both codon-humanized from Biosignal Packard) were also digested with HindIII and KpnI and the backbone purified. The CXCR4-coding sequence was then ligated into each of the above backbones. The CXCR4-GFP2 and CXCR4-Rluc constructs, when expressed, produced CXCR4 with the fusion partner at the intracellular, C terminus of the protein. Plasmids expressing CCR5-GFP2, CCR5-Rluc, C5a receptor-GFP2, and C5a receptor-Rluc were all synthesized in the same manner.

FACS Analysis-- Cells were harvested and resuspended in 100 µl of phosphate-buffered saline supplemented with 2% fetal calf serum. Fusion protein expression was monitored by staining with the phycoerythrin (PE)-conjugated antibodies 12G5-PE (anti-CXCR4; PharMingen) or 2D7-PE (anti-CCR5, PharMingen). To assess the ability of the CCR5 and CXCR4 fusion proteins to bind ligands, we used constructs consisting of SDF-1alpha (the natural ligand of CXCR4) and RANTES (a natural ligand of CCR5) coupled to human Fc proteins. Fusion protein-expressing cells were incubated with increasing concentrations of SDF1alpha -Ig (for CXCR4) and RANTES-Ig (for CCR5) for 1 h at 37°C. Cells were subsequently stained with an anti-human Ig-PE antibody (Jackson ImmunoResearch). To study binding of the HIV-1 gp120 envelope glycoprotein to CCR5 and CXCR4, purified gp120 glycoproteins from the ADA and HXBc2 HIV-1 strains, respectively, were incubated with soluble CD4 (sCD4) for 1 h at room temperature to create sCD4/gp120 complexes. These complexes were then incubated with transfected cells for 1 h at 37°C. The C11 anti-gp120 antibody, which does not disrupt CD4 or chemokine receptor binding, was added, and incubation at 37 °C continued for 45 min. Cells were washed once and anti-human Ig-PE added, followed by a 30-min incubation at 4°C. All samples were analyzed with a Becton Dickinson FacStar Plus instrument with CellQuest software.

Solubilization and Coimmunoprecipitation-- Transfected cells were detached using phosphate-buffered saline, 5 mM EDTA. Approximately 5 × 106 transfected cells were resuspended in 1 ml of solubilization buffer containing 1% CHAPSO (Anatrace), 100 mM (NH4)2SO4, 20 mM Tris, pH 8.5, 10% glycerol, 1× Complete Protease Inhibitor Mixture (Roche Molecular Biochemicals) and incubated at 4 °C with rocking for 30 min. The lysate was then cleared by centrifugation at 14,000 × g for 30 min at 4°C. Cell lysates were transferred to a clean microcentrifuge tube and precipitated with either the C9 epitope tag-specific 1D4 antibody (National Cell Culture Center) or the anti-His5 antibody (Qiagen) and protein G-Sepharose for 2 h at 4°C. Precipitates were washed three times with solubilization buffer and protein eluted in 1× SDS sample buffer for 45 min at 37°C. Eluted protein was resolved by SDS-PAGE using 12% Tris-glycine polyacrylamide mini-gels (Invitrogen) for 1.5 h at 200 V. Gels were transferred to Immobilon-P (Millipore) as described by the manufacturer, and Western blot analysis was performed. Epitope-tagged proteins were detected with either the 1D4 or anti-His5 antibodies (1 µg/ml), followed by an anti-mouse IgG-horseradish peroxidase conjugate (1:5000; Sigma). Membranes were incubated for 1 min with ECL reagent and exposed to XOMAT-AR film for varying periods of time.

Sucrose Density Gradient Centrifugation-- Buffers containing either 5 or 20% sucrose, 100 mM (NH4)2SO4, 20 mM Tris, pH 8.5, 5% glycerol, and 1% CHAPSO were combined to make 5-20% continuous sucrose gradients. Sucrose gradients (11 ml in total) in polyallomer centrifuge tubes (Beckman) were made using a Labconco gradient maker. For molecular weight standards, 0.5 mg of bovine serum albumin (Sigma), aldolase (Amersham Biosciences), catalase (Amersham Biosciences), apoferritin (Sigma), or thyroglobulin (Amersham Biosciences) was layered onto the sucrose gradient. Approximately 1 × 108 Cf2Th-synCXCR4-C9, Cf2Th-synCCR5-C9, or 293T-CD4-C9 cells were solubilized in 1 ml of solubilization buffer, as described above. Then 100 µl of the whole cell lysate were loaded onto the sucrose gradient. Gradients were centrifuged at 40,000 rpm for 18 h in a Beckman Optima L90-K ultracentrifuge using an SW-41 rotor. Gradient fractions (15 drops each) were collected from the bottom of the tube, resulting in a total of 27 fractions. For gradients containing molecular weight markers, fractions were analyzed by spectrophotometry at a wavelength of 280 nm to assess protein content. To determine the migration of proteins contained in whole cell lysates, 10 µl of each fraction was resolved using SDS-PAGE. Gels were transferred to Immobilon-P, and membranes were probed with the C9 tag-specific 1D4 antibody as described above. Films were analyzed using a densitometer to determine the amount of specific protein in each fraction.

Calculation of Detergent Binding to Membrane Proteins-- Solubilized membrane proteins are known to bind large amounts of detergent. Detergent binding exerts far greater effects on molecular weight than on the frictional coefficient of the protein when native protein structure is maintained. Thus, detergent solubilization would be expected to result in an increase in the apparent molecular weight of the protein on sucrose density gradients. We employed the following calculations, previously used to analyze detergent binding to several membrane proteins including bacteriorhodopsin (30), to estimate the expected molecular weights of CXCR4, CCR5, and CD4 in detergent-protein complexes. LeMaire, Champeil, and Moller (30, 31) have modeled the detergent shell surrounding the membrane-spanning region of integral membrane proteins as a prolate spheroid. The hydrophobic volume (VHprol) of this detergent shell can be expressed in Equation 1 as,


V<SUB>Hprol</SUB>=<FR><NU>&pgr;</NU><DE>2</DE></FR>Hh<SUB>d</SUB>p+<FR><NU>2&pgr;</NU><DE>3</DE></FR>Hh<SUB>d</SUB><SUP>2</SUP> (Eq. 1)
where H represents the height of the membrane-spanning helix or helices, p represents the perimeter of the hydrophobic membrane-spanning domain of the protein, and hd represents the height of the hydrophobic domain of the detergent. The height of the membrane-spanning regions of several membrane proteins crystallized in the presence of detergents is ~30 Å (32, 33). The values of hd have been calculated for several nonionic detergents bound to bacteriorhodopsin, with an average hd equal to 8.1 ± 2.2 Å (30, 31). Using these values, Equation 1 reduces to Equation 2.
V<SUB>Hprol</SUB>=438 Å<SUP>2</SUP> p+5434 Å<SUP>3</SUP> (Eq. 2)
For CXCR4 and CCR5, we assume that the values of p are similar to each other as well as to that of other GPCRs. The perimeter of bacteriorhodopsin has been previously calculated to be 120 Å (30). This value corresponds to the value of p estimated from x-ray crystal structures of bacteriorhodopsin and rhodopsin (32, 33), and was used herein for both CCR5 and CXCR4. For membrane proteins such as CD4, which have a single helix spanning the membrane, we estimated a perimeter of 44 Å. Thus, for monomeric CCR5 and CXCR4, we would expect a hydrophobic volume of ~50,000 Å3. For monomeric CD4, the estimated hydrophobic volume is 21,000 Å3.

If any of these proteins were dimeric, a substantial portion of the hydrophobic domains would be shielded from detergent by interaction with the dimer partner. We estimate that the hydrophobic volume of the detergent shell required to bind a dimer would be ~1.6 times that of the monomer. If the membrane protein were a tetramer, we would expect a detergent shell 2.2 times that required for a monomer.

The partial specific volumes of the hydrophobic portions of several non-ionic detergents bound to bacteriorhodopsin have been calculated, with a mean value of 337 ± 17 Å3 (reviewed in Ref. 31). This value is close to that estimated from the chemical structure of non-ionic detergents. Using this value, we estimate that 62 and 148 molecules of detergent can bind to monomers of CD4 and CXCR4/CCR5, respectively. Approximately 237 and 326 molecules of detergent would be expected to bind CXCR4/CCR5 dimers and tetramers, respectively.

BRET2 Assay-- Cells transfected with combinations of plasmids expressing Rluc and GFP2 fusion proteins were harvested and resuspended in BRET2 buffer containing 1× phosphate-buffered saline, 1 mM CaCl2, 1 mM MgCl2, and 1g/liter D-glucose. A total of 1 × 105 cells in 45 µl of the above buffer was transferred to a 96-well Optiplate (Biosignal Packard). Deep Blue C, a coelenterazine derivative, was allowed to warm to room temperature and resuspended in 125 µl of absolute ethanol (1 mM final concentration). Reconstituted Deep Blue C was diluted 1:20 in BRET2 buffer and 5 µl of the diluted solution added to each well of the microtiter plate to give a final concentration of 5 µM. The samples were immediately read with a Victor2 multilabel counter (PerkinElmer Life Sciences) using dual sequential luminescence mode. Each well was analyzed for 1 s with a 370-450 nm filter (for Rluc), immediately followed by measurements with a 500-530 nm filter (GFP2). BRET2 ratios were calculated by dividing the luminescence measurement obtained with the GFP2 filter by the measurement obtained with the Rluc filter. For example, a reading of 10,000 counts with the Rluc filter followed by a measurement of 5,400 counts with the GFP2 filter would yield a BRET2 ratio of 0.54.

For experiments in which ligands were preincubated with cells prior to BRET2, 1 × 105 cells in 40 µl of BRET2 buffer were transferred to the microtiter plate. Then 5 µl of ligand (RANTES-Ig, SDF1alpha -Ig, SDF-1alpha (R&D Systems), or sCD4/gp120 complexes) were added to the cells to yield a final concentration of 100 nM. The plate was incubated at 37°C for 1 h, and Deep Blue C was added. The plates were immediately analyzed with the Victor2 as described above.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

CXCR4 Contained in Cell Lysates Exists as a Multimer-- We have previously reported the efficient solubilization of CXCR4 from an overexpressing cell line employing the detergent CHAPSO (28). CXCR4 contained in CHAPSO-solubilized cell lysates was able to bind conformation-dependent antibodies, the natural ligand SDF-1alpha , and the HIV-1 envelope glycoprotein, gp120. These data demonstrate that solubilized CXCR4 retained native conformation.

To examine whether CXCR4 can associate to form homomultimers, plasmids were created that express CXCR4 with either a C-terminal C9 or His6 epitope tag (CXCR4-C9 and CXCR4-His, respectively). These plasmids were cotransfected into 293T cells, and the resulting transfectants were solubilized with CHAPSO-containing buffer to create a cell lysate. The cell lysates were incubated with the 1D4 antibody (C9 epitope tag-directed), anti-His5 antibody (His6 tag-specific), the conformation-dependent anti-CXCR4 antibody 12G5, or the conformation-dependent anti-CCR5 antibody 2D7. SDS-PAGE was performed on the precipitated material, and the size-fractionated proteins were transferred to Immobilon-P. A Western blot was performed using the 1D4 antibody, and the results are shown in Fig. 1 (far left panel). In this experimental format, only the CXCR4-C9 protein can be detected. The 1D4 antibody recognized CXCR4 precipitated with both the 12G5 and 1D4 antibodies but did not detect any CXCR4 protein in the precipitates obtained with the negative control 2D7 antibody. 12G5 only recognizes conformationally intact CXCR4, whereas the 1D4 can bind all CXCR4-C9, regardless of conformation. Notably, CXCR4-C9 was also detected in the sample precipitated with the anti-His5 antibody. The precipitation of the CXCR4-C9 protein by the anti-His5 antibody was dependent upon the presence of the CXCR4-His protein in the transfected cells (Fig. 1, left-center panel). This suggests that precipitation with the anti-His5 antibody effectively precipitated the complex of CXCR4-C9/CXCR4-His and that CXCR4-C9 associates with CXCR4-His to form CXCR4 homomultimers in the cellular lysate.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   CXCR4 exists as a multimer in cell lysates. 293T cells were cotransfected with plasmids expressing either CXCR4-His and CXCR4-C9 (far left panel), CXCR4-C9 and CCR5-His (left-center panel), CCR5-C9 and CXCR4-His (right-center panel), or CCR5-C9 and CCR5-His (far right panel). Cell lysates were immunoprecipitated with 12G5 (CXCR4-specific), 2D7 (CCR5-specific), 1D4 (C9 tag-specific), or the anti-His5 (His6 tag-specific) antibodies. Precipitates were subjected to SDS-PAGE and transferred to Immobilon-P. Blots were probed with the 1D4 antibody to detect any protein that contains a C9 tag. The positions of the CXCR4 precursor and mature CXCR4, as well as that of the proteolytically processed form of CXCR4, are indicated.

CXCR4 Multimerization Is Specific-- To examine the specificity of the CXCR4 multimerization, we coexpressed the CXCR4-C9 and CCR5-His proteins in 293T cells; the CCR5-C9 and CXCR4-His proteins were coexpressed in independently transfected cells. The cell lysates were precipitated with the 12G5, 2D7, 1D4, and anti-His5 antibodies, and the precipitated proteins were separated by SDS-PAGE and Western blotted with the 1D4 antibody (Fig. 1, middle two panels). When CCR5-His was precipitated with the anti-His antibody, no CXCR4-C9 protein could be detected (Fig. 1, left-center panel). Likewise, when CXCR4-His was precipitated with the anti-His antibody, no CCR5-C9 could be detected (Fig. 1, right-center panel). Apparently, CXCR4 does not associate with CCR5 in the cell lysate, suggesting that the self-association of CXCR4 is specific. In similarly designed experiments in which CCR5-His and CCR5-C9 were coexpressed, the anti-His5 antibody did not precipitate CCR5-C9 (Fig. 1, far right panel). This suggests either that CCR5 does not multimerize in the transfected cells or that the CCR5 multimers associate less strongly than the CXCR4 multimers under the solubilization conditions used.

CXCR4 Multimerization Is Evident at Low Expression Levels-- To address whether overexpression might contribute to CXCR4 self-association, a coprecipitation experiment was performed in which the total DNA transfected into the 293T cells was titered to very low levels. Only at the lowest level (0.2 µg) of cotransfected plasmids expressing CXCR4-C9 and CXCR4-His was coprecipitation of CXCR4-C9 by the anti-His5 antibody not observed (Fig. 2). As can be seen, the level of CXCR4-C9 present (1D4 lane) at this level of transfected DNA was very low. The affinity of the anti-His5 antibody is ~10-fold lower than that of the 1D4 antibody. Taking the affinity of the antibodies into account, the results indicate that a significant fraction of the CXCR4-His precipitated by the anti-His5 antibody is associated with CXCR4-C9 molecules, even at lower expression levels.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.   CXCR4 multimerization is not the result of overexpression. 293T cells were cotransfected with decreasing amounts of plasmids encoding CXCR4-C9 and CXCR4-His. Each construct was transfected in equivalent amounts; i.e. when 8 µg of total DNA was transfected, this represents 4 µg each of the plasmids expressing CXCR4-His and CXCR4-C9. Cells were lysed and the lysates precipitated with either the 1D4 or the anti-His5 antibodies. Following SDS-PAGE, gels were transferred to a solid support and immunoblotted with the C9-specific 1D4 antibody.

Conformation Dependence of CXCR4 Multimerization-- To examine whether CXCR4 multimerization depends upon the native conformation of CXCR4, 293T cells coexpressing CXCR4-C9 and CXCR4-His proteins were solubilized in either CHAPSO or n-nonyl-beta -D-glucoside (NDG). CHAPSO has been demonstrated to maintain native CXCR4 conformation whereas NDG denatures CXCR4 (28). Samples were precipitated with the 1D4 antibody and analyzed by SDS-PAGE and Western blot, using either the 1D4 or the anti-His5 antibody for detection (Fig. 3A). The CXCR4-His protein was detected in CXCR4-C9 precipitates only when CHAPSO was used to solubilize the cells. This result is consistent with a model in which CXCR4 multimerization is dependent on native conformation.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3.   CXCR4 multimerization is dependent upon native conformation and coexpression within the cell. A, 293T cells were cotransfected with plasmids expressing CXCR4-C9 and CXCR4-His. Cell lysates were prepared with either CHAPSO or NDG detergents and precipitated with the 1D4 antibody. Precipitates were analyzed by SDS-PAGE and Western blotting. Western blots were probed with either 1D4 (left panel) or the anti-His5 (right panel) antibodies. B, 293T cells were cotransfected with plasmids expressing CXCR4-His and CXCR4-C9 and lysed (left four lanes). In parallel, one flask of 293T cells was transfected with a plasmid expressing CXCR4-His and another with a plasmid expressing CXCR4-C9. The latter cells were harvested, combined and subsequently lysed as a mixture (right four lanes). Samples were precipitated with the indicated antibodies and subjected to SDS-PAGE and Western blotting, using the 1D4 antibody for detection.

CXCR4 Exists as a Multimer in the Intact Cell Membrane-- Because artifactual chemokine receptor aggregation can arise in denaturing detergents, we examined whether the observed CXCR4 multimerization might be detergent-induced. 293T cells were transfected with plasmids expressing CXCR4-C9 and CXCR4-His either together or individually. The 293T cells transfected with the individual expressor plasmids were subsequently combined. The 293T cells expressing both CXCR4-C9 and CXCR4-His, and the mixture of cells expressing the individual proteins were subsequently solubilized. The cell lysates were used for precipitation by the 12G5, 2D7, 1D4, or anti-His5 antibodies and a Western blot performed as previously described. As shown in Fig. 3B, the anti-His5 antibody only precipitated CXCR4-C9 when CXCR4-His and CXCR4-C9 were expressed in the same cell. The anti-His5 antibody did not precipitate CXCR4-C9 from the mixture of 293T cells individually expressing CXCR4-His and CXCR4-C9. These results suggest that the multimeric association of the CXCR4 proteins occurs between molecules expressed in the same cell.

To confirm that CXCR4 multimerization occurs in an intact cell, we used bioluminescence resonance energy transfer (BRET2) analysis. BRET2 is a modified version of the standard BRET analysis. BRET has been previously used for another GPCR, the beta 2-adrenergic receptor, to demonstrate multimerization (26).

Briefly, BRET2 can detect molecules in close proximity to one another by using energy transfer from one tag to another. This is achieved by using proteins tagged with a modified green fluorescent protein (GFP2) and Renilla luciferase (Rluc). Plasmids encoding these two proteins are cotransfected into cells, and the proteins are expressed. Deep Blue CTM (a coelenterazine derivative), a cell-permeable substrate for Rluc, is then added to the cells and bioluminescence is measured immediately. This bioluminescence can provide energy to the GFP2 protein, resulting in fluorescence, only if the protein-GFP2 and protein-Rluc molecules are in close proximity (~50 Å). The emitted energy from the Rluc (395 nm) can be easily distinguished from the energy emitted by the GFP2 (510 nm) using sequential dual luminescence. The BRET2 signal is easily determined by measuring the ratio of GFP2 emission to Rluc emission.

Constructs encoding CXCR4 and CCR5 fusion proteins (CXCR4-GFP2, CXCR4-Rluc, CCR5-GFP2, and CCR5-Rluc) were synthesized. The fusion partners were expressed at the C terminus of the GPCR and thus are expected to be localized inside the cell. 293T cells were transfected with various combinations of these constructs and luminescence measurements (emission of 370-450 nm for luciferase and 500-530 nm for GFP2) were obtained using a Victor2 multilabel counter. The BRET2 ratio was calculated by dividing the GFP2 signal by the Rluc signal. All samples were tested in duplicate, and a negative control consisting of CXCR4-Rluc only was included. Multiple experiments were performed, and the results of a representative experiment are shown in Fig. 4. The negative control (CXCR4-Rluc only) consistently gave a BRET2 ratio of about 0.08. This was considered to be the lowest possible level that could be obtained due to "bleed" of the Rluc emission through the GFP2 filter. When CXCR4-Rluc and CXCR4-GFP2 were coexpressed, a BRET2 ratio of ~0.45 was consistently obtained. By contrast, when the combinations CXCR4-Rluc/CCR5-GFP2, CCR5-Rluc/CXCR4-GFP2, or CCR5-Rluc/CCR5-GFP2 were tested, a BRET2 ratio of between 0.12 and 0.19 was observed. These data strongly suggest that CXCR4 exists as a multimer in the intact cell membrane.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4.   BRET2 measurements of GPCRs in intact cells. Specific GFP2 and Rluc constructs, denoted by a (+) beneath the graph, were expressed in 293T cells. Transfectants were harvested, transferred to an Optiplate in duplicate, and Deep Blue C was added at a concentration of 5 µM. The microtiter plate was immediately read using dual sequential luminescence on a Victor2 multilabel reader (filters were 410 ± 40 nm (Rluc) followed by 515 ± 15 nm (GFP2)). The luminescence reading for GFP2 was divided by that obtained for Rluc to yield the BRET2 ratio.

The BRET2 ratios obtained for the CCR5 pair as well as the control mixed pairs were higher than that observed for the negative control (CXCR4-Rluc only). It is possible that weak CCR5/CCR5 homomultimers as well as CXCR4/CCR5 heteromultimers were present in the cell membrane, resulting in a BRET2 signal greater than that seen in the CXCR4-Rluc control. To test this hypothesis, we created GFP2 and Rluc fusion proteins of the C5a receptor. This is a G protein-coupled receptor that is only distantly related to the CXCR4 and CCR5 proteins and would not be expected to heteromultimerize with either HIV-1 coreceptor. The BRET2 results obtained with the C5a receptor are shown in Fig. 4. The BRET2 ratios observed for the C5a receptor-expressing cells were less than 0.20, in the same range as the BRET2 ratios for cells expressing CCR5-Rluc/CCR5-GFP2 or the CCR5/CXCR4 combinations. The BRET2 ratios for cells expressing the C5a receptor in combination with CXCR4 or CCR5 were also in the same range. For this group of GPCRs, CXCR4 is unique in its ability to give a strong BRET2 signal. These results suggest that CXCR4 exists as a homomultimer in the cell membrane.

It is possible that the expression levels of the various fusion proteins affected the strength of the associations. To monitor expression levels, transfected cells were metabolically labeled with cysteine and methionine and immunoprecipitated with either the 2D7 (for CCR5 constructs) or 12G5 (for CXCR4 constructs) antibodies. The expression levels of all CXCR4 constructs were equivalent, as were the levels of all CCR5 constructs (data not shown). To ensure that these proteins were expressed on the cell surface, FACS analysis was performed using CXCR4- and CCR5-specific antibodies. Fusion proteins were shown to be expressed on the cell surface at levels similar to those of the codon-optimized wild-type CXCR4 and CCR5 proteins (data not shown).

The ratio of protein-GFP2 DNA to protein-Rluc DNA that was transfected into 293T cells was varied. 293T cells were transfected with different ratios of plasmids expressing CXCR4-GFP2 or CCR5-GFP2 and CXCR4-Rluc; the BRET2 results are shown in Fig. 5A. For amounts of plasmid DNA that gave BRET2 ratios above background, the BRET2 signal of the CXCR4 pair remained 2.5 times greater than that of the CXCR4/CCR5 mixed pair. These data demonstrate that the higher BRET2 signal associated with the CXCR4 homomultimers occurs over a wide range of relative expression of the GFP2 and Rluc fusion proteins.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5.   BRET2 measurements are not dependent upon transfection conditions. A, 293T cells were transfected with plasmids expressing CXCR4-Rluc and either CXCR4-GFP2 (dark bars) or CCR5-GFP2 (light bars). A total of 10 µg of DNA was transfected, and the relative percentage of each construct is indicated at the bottom of the graph. BRET2 was performed in duplicate and the results plotted. B, 293T cells were transfected with various total amounts of plasmid DNA indicated below the graph. When two different constructs were expressed, the ratio of each expressor plasmid in the transfection was 1:1. BRET2 was performed and the results plotted.

Overexpression could hypothetically lead to artifactually high BRET2 signals. We titrated the amount of total DNA transfected into the 293T cells to determine the effect of expression levels on the BRET2 ratio. As shown in Fig. 5B, the BRET2 ratio was essentially unaffected by up to 30-fold differences in the total amount of DNA transfected. FACS analysis confirmed that CXCR4 surface expression was directly related to the amount of plasmid DNA transfected (data not shown). These experiments suggest that, over a wide range of expression levels, CXCR4 exists as a multimer in the cell membrane.

CXCR4 Multimerization Is Not Greatly Enhanced by Ligands-- The above studies indicate that CXCR4 multimerization occurs in the absence of ligands. However, because the proportion of total protein that is multimeric is unknown, it is possible that ligand binding could influence the degree of CXCR4 multimerization. To examine this, we incubated 293T cells coexpressing CXCR4-GFP2 and CXCR4-Rluc or CCR5-GFP2 and CXCR4-Rluc with 100 nM of SDF-1alpha , SDF1alpha -Ig, RANTES-Ig (CCR5 ligand), or HIV-1 gp120/CD4 complexes prior to BRET2 analysis. As shown in Fig. 6, only SDF1alpha -Ig and SDF-1alpha induced minor but reproducible increases in the BRET2 signal. For SDF1alpha -Ig, this may be due to the dimeric nature of this ligand. We conclude that CXCR4 is constitutively multimeric, with ligand binding exerting minimal effects on multimerization.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6.   CXCR4 multimerization is not greatly enhanced by ligand binding. 293T cells were transfected with plasmids expressing the indicated proteins. Cells were transferred to a microtiter plate and incubated with 100 nM SDF-1alpha , SDF1alpha -Ig, RANTES-Ig, or HXBc2 gp120/CD4 complexes for 1 h at 37°C. Luciferase substrate was then added and luminescence immediately measured with a Victor2 multilabel counter.

CXCR4 Forms Stable Dimers-- The above experiments indicate that CXCR4 assembles into multimers in cells. To examine the oligomeric state of CXCR4, we employed sucrose density gradient centrifugation of CXCR4 solubilized in cell lysates. First, the effects of the detergents used to solubilize CXCR4 on the sedimentation of the water soluble proteins used as markers in this study were investigated. Continuous sucrose gradients (5-20%) containing buffers identical to those used for CXCR4 solubilization were layered with 0.5 mg bovine serum albumin (66 kDa), aldolase (158 kDa), catalase (232 kDa), apoferritin (440 kDa), or thyroglobulin (669 kDa) and centrifuged at 40,000 rpm for 18 h. Gradients were fractionated and spectrophotometry performed to determine protein content for each fraction. Fractions 21, 17, 13, 8, and 6 contained the highest concentration of bovine serum albumin, aldolase, catalase, apoferritin, and thyroglobulin, respectively. Although the sedimentation of proteins is influenced by the frictional coefficient as well as the molecular weight, the results indicate that sedimentation in sucrose density gradients in the presence of CHAPSO and Cymal-7 detergents can allow an approximation of molecular weights.

All of the above marker proteins are water-soluble and are therefore expected to bind little detergent. By contrast, integral membrane proteins bind significant amounts of detergent, and therefore sediment as protein-detergent complexes. In addition to CXCR4, two other integral membrane proteins, CCR5 and CD4, were studied. Cf2Th-synCXCR4-C9, Cf2Th-synCCR5-C9, and 293T-CD4-C9 cells expressing C9-tagged CXCR4, CCR5 and CD4, respectively, were lysed in buffers containing either CHAPSO or Cymal-7, and the cell lysates were layered onto 5-20% continuous sucrose density gradients. The gradient fractions were analyzed by SDS-PAGE followed by Western blotting using the C9-specific 1D4 antibody (Fig. 7). The CXCR4 protein sedimented as a symmetric peak centered at fraction 14 in the gradient. CCR5 and CD4 sedimented as asymmetric peaks with fractions 19 and 18, respectively, containing the most protein. The results obtained with both CHAPSO and Cymal-7 detergents were similar (data not shown).


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 7.   CXCR4 sediments as a dimer on sucrose density gradients. Cell lysates containing CXCR4-C9, CCR5-C9, or CD4-C9 were applied to 5-20% sucrose gradients, centrifuged, and fractionated. Fractions were resolved on SDS-PAGE and Western blotted, using the 1D4 antibody for detection. The top panel shows the results for CXCR4-C9, the middle panel, CCR5-C9, and the bottom panel, CD4-C9. Fraction number is indicated above the figure (fraction 1 is the bottom of the gradient and fraction 27 is the top). Densitometry was performed, and the filled arrows above the figure denote the peak of protein migration for all three proteins. The fractions in which the protein markers sedimented are also indicated (open arrows).

Interpolating from the observed sedimentation of the soluble protein standards, the estimated molecular masses of the protein-detergent complexes for CXCR4, CCR5, and CD4 were 215, 115, and 135 kDa, respectively. The molecular masses of the monomeric CXCR4, CCR5 and CD4 proteins are 43, 39 and 52 kDa, respectively. It has been shown that the apparent molecular weight of bovine rhodopsin increased by a factor of 2.2 when bound to detergent (Triton X-100) (30). A similar increase for the proteins studied herein would explain the apparent molecular weights of detergent complexes with CCR5 and CD4, provided these proteins were mostly monomeric. As CD4 is known to be primarily a monomer, the relatively close sedimentation of CD4 and CCR5 in the presence of detergent suggests that CCR5 is also monomeric under these conditions.

The observed sedimentation of the CCR5 and CD4 proteins is consistent with expectations of the number of detergent molecules bound to the membrane-spanning portions of the monomeric proteins. Such estimates are based on the known structures of integral membrane proteins and generally correspond well to empirical data (30, 31). Assuming that CCR5 resembles rhodopsin in the membrane-spanning region and that CD4 has a single, helical membrane-spanning anchor, we estimated the number of detergent molecules bound to these proteins, as described under "Experimental Procedures." These calculations suggest that 62 and 148 molecules of detergent would be expected to bind monomers of CD4 and CCR5, respectively. Using 630 Da as the molecular mass of CHAPSO, we would expect detergent-protein complexes of monomeric CD4 and CCR5 to exhibit molecular masses of ~90 and 130 kDa, respectively. Given the unknown contribution of the bound detergent to the frictional coefficient, which influences sedimentation velocity, the observed sedimentation of CD4 and CCR5 is consistent with that of monomeric proteins.

The solubilized CXCR4 protein sedimented significantly faster than either CD4 or CCR5, suggesting that it is a multimer under these conditions. As CXCR4 and CCR5 are similar in molecular weight and presumably in structure, we would expect that detergent would contribute comparably to the molecular weight and frictional coefficient of the two proteins. Thus, the observed sedimentation of CXCR4, which suggests a molecular weight that is approximately twice that of CCR5, implies that CXCR4 is a dimer under these conditions. This interpretation is supported by predictions of the number of detergent molecules, 237, that could bind a GPCR dimer (see "Experimental Procedures"). A CXCR4 dimer-CHAPSO complex would be predicted to have a molecular mass of 230 kDa, in agreement with the molecular mass approximated from the sucrose gradients. Were CXCR4 assembled into oligomers larger than dimers, the predicted molecular weight of such protein-detergent complexes would be too great to fit the observed sedimentation. We conclude that, under the solubilization conditions employed, CXCR4 is a dimer. Most of the CCR5 and CD4 proteins are apparently monomers under these conditions.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Herein we provide several pieces of evidence that suggest that human CXCR4 forms stable dimers in cells. Coimmunoprecipitation studies indicated that CXCR4 associated with itself in detergent lysates, but not with a related GPCR, CCR5. BRET2 analysis confirmed that, in intact cells, the self-association of CXCR4 is significantly more efficient than the homomultimerization of CCR5 or C5a receptor, a GPCR unrelated to the CXCR4 or CCR5 chemokine receptors. The BRET2 studies also confirmed that CXCR4 associates with itself far more efficiently than it associates with either CCR5 or C5a receptor. The binding of ligands to CXCR4 did not appear to substantially alter the degree of multimerization. The multimerization of CXCR4 occurs over a wide range of expression levels and depends upon preservation of the native conformation of CXCR4. The sedimentation of CXCR4-detergent complexes from cell lysates suggests that the majority of CXCR4 is a dimer under these conditions. These results indicate that CXCR4 forms specific, constitutive dimers in expressing cells.

Dimerization between homologous and heterologous GPCRs has been described (19-23). In most cases, dimerization of GPCRs occurs independently of bound ligands, although stabilization of GPCR oligomers by agonist treatment has been reported (26, 34). Our observation that precursor forms of CXCR4 were apparently self-associated in the coprecipitation studies suggests that dimerization occurs soon after CXCR4 synthesis and folding. The results of the sucrose density gradient analysis indicate that most or all of the CXCR4 in the cell lysate is dimeric. Ligand binding exerted little effect on multimerization. Together, these observations indicate that the native state of human CXCR4 may be a dimer.

We observed little or no evidence of CXCR4 association with CCR5, the other major HIV-1 coreceptor (13-17),. The BRET2 signal associated with coexpression of CXCR4 and CCR5 did not exceed that associated with coexpression of CXCR4 or CCR5 with an unrelated GPCR, C5a receptor. We suspect that these BRET2 signals, which are consistently lower than that seen in the case of CXCR4 self-association, may result from the membrane expression of any tagged GPCRs. Thus, such BRET2 signals may not reflect specific associations between these proteins, but rather random associations promoted by the limited degrees of freedom available to the fusion proteins in the cell membrane.

The specificity of CXCR4 association with itself suggests that regions of the protein that are unique among GPCRs mediate the dimerization. Based on the strong propensity of CXCR4 to form dimers and not higher order oligomers, it is likely that these represent head-to-head dimers. For some dimeric GPCRs, transmembrane helices 5 and 6 have been suggested to play an important role in protein-protein contacts (35, 36). The fifth transmembrane helix of CXCR4 contains an additional cysteine not found in the other chemokine receptors. Although there are no disulfide bonds linking CXCR4 dimers,2 it is possible that this residue contributes in other ways to CXCR4 dimerization. The robust nature of CXCR4 self-association should facilitate attempts to understand the molecular contacts responsible.

It will be of interest to define the role of CXCR4 dimerization in the diverse roles of this GPCR in physiology and pathology. Some chemokines have been shown to form dimers, and significant avidity effects would accompany the interaction of dimeric ligands and receptors. There are conflicting data regarding the propensity of SDF-1alpha to dimerize. Sedimentation equilibrium and NMR studies of SDF-1alpha suggested that this chemokine is a monomer (37), even at high concentrations. On the other hand, the N33A variant of SDF-1alpha crystallized as a dimer (38), the structure of which resembled the dimer of another chemokine, IL-8. Using analytical ultracentrifugation and dynamic light scattering, Holmes et al. (39) obtained evidence that SDF-1alpha exists in a monomer-dimer equilibrium. The dimerization constant was only 150 µM, suggesting that the weak self-association of SDF-1alpha could be significantly influenced by context-dependent variables. It is possible that receptor binding promotes SDF-1alpha dimerization through these otherwise weak bonds.

CXCR4 dimerization could also influence its activity as an HIV-1 receptor. Most HIV-1 that are transmitted and predominate early in the course of infection utilize CCR5 as a coreceptor (40-43). Later in infection, a high percentage of infected individuals harbor HIV-1 isolates that utilize, in addition, the CXCR4 receptor (40, 44-47). The efficiency with which these late isolates replicate in cells expressing CD4 and CXCR4 equals or exceeds that of early isolates in cells expressing CD4 and CCR5 (48-50). This high replication efficiency is achieved despite a significantly lower affinity of the gp120 glycoprotein of late isolates for CXCR4 compared with that of early isolates for CCR5 (28, 51, 52). The HIV-1 envelope glycoproteins are trimers and thus contain three receptor-binding sites. The interactions of envelope glycoprotein trimers with head-to-head dimers of CXCR4 could form hexameric arrays at the virus-cell interface. The avidity gained by the formation of such arrays could compensate for low gp120-CXCR4 affinity. Moreover, the assembly of such hexameric structures might also facilitate the membrane fusion process, which has been proposed to require the cooperation of several envelope glycoprotein trimers and 4-6 chemokine receptors (50).

Other laboratories have recently reported that CCR5 exists as a multimer in cell lysates (22, 23) and intact cells (27). Our data suggest that, if CCR5 dimerizes, such dimers are much more weakly associated than CXCR4 dimers. The asymmetric peak of CCR5 in the sucrose density gradients raises the possibility that a minor fraction of CCR5 exists as a dimer under these conditions. CD4 also exhibited an asymmetric peak in the gradients, and weakly associated dimers of soluble CD4 have been observed at high protein concentrations (53). We did not detect evidence of CCR5 self-association in the coprecipitation experiments. Moreover, the BRET2 ratio observed for coexpression of CCR5-GFP2 and CCR5-Rluc was no greater than that observed for all of the mixed GPCR pairs tested. As discussed above, this BRET2 ratio may simply represent the background fluorescence due to the coexpression of two membrane-associated receptors with GFP2 and Rluc domains fused to their cytoplasmic tails. Future work will be required to determine whether CCR5 forms dimers and if such dimerization is relevant to its natural state and function. Recognition of the strong propensity of CXCR4 to dimerize should lead to an understanding of the importance of dimerization to CXCR4 signaling and utilization as an HIV-1 receptor.

    ACKNOWLEDGEMENTS

We thank Yvette McLaughlin and Sheri Farnum for manuscript preparation. We acknowledge the National Cell Culture Center for the 1D4 antibody.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant AI41851 and Center for AIDS Research Grant AI28691 and the Bristol-Myers Squibb Foundation and the late William F. McCarty-Cooper.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Supported by National Institutes of Health Grant AI46725.

** To whom correspondence should be addressed: Dana-Farber Cancer Inst., 44 Binney St., JFB824, Boston, MA 02115. Tel.: 617-632-3371; Fax: 617-632-3113; E-mail: joseph_sodroski@dfci.harvard.edu.

Published, JBC Papers in Press, November 13, 2002, DOI 10.1074/jbc.M210140200

2 G. J. Babcock and J. Sodroski, unpublished results.

    ABBREVIATIONS

The abbreviations used are: GPCR, G protein-coupled receptor; HIV-1, human immunodeficiency virus, type 1; CHAPSO, 3-[(3-cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonic acid; BRET2, improved bioluminescence resonance energy transfer; SDF, stromal cell-derived factor; FACS, fluorescence-activated cell sorting; GFP, green fluorescent protein; GFP2, modified GFP; Rluc, Renilla luciferase; GABAb, gamma -aminobutyric acid, type b.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Drews, J. (1996) Nat. Biotechnol. 14, 1516-1518[CrossRef][Medline] [Order article via Infotrieve]
2. Horn, F., Weare, J., Beukers, M. W., Horsch, S., Bairoch, A., Chen, W., Edvardsen, O., Campagne, F., and Vriend, G. (1998) Nucleic Acids Res. 26, 275-279[Abstract/Free Full Text]
3. Stadel, J. M., Wilson, S., and Bergsma, D. J. (1997) Trends Pharmacol. Sci. 18, 430-437[Medline] [Order article via Infotrieve]
4. Tate, C. G., and Grisshammer, R. (1996) Trends Biotechnol. 14, 426-430[CrossRef][Medline] [Order article via Infotrieve]
5. Bleul, C. C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodroski, J., and Springer, T. A. (1996) Nature 382, 829-833[CrossRef][Medline] [Order article via Infotrieve]
6. Oberlin, E., Amara, A., Bachelerie, F., Bessia, C., Virelizier, J. L., Arenzana-Seisdedos, F., Schwartz, O., Heard, J. M., Clark-Lewis, I., Legler, D. F., Loetscher, M., Baggiolini, M., and Moser, B. (1996) Nature 382, 833-835[CrossRef][Medline] [Order article via Infotrieve]
7. Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I., and Littman, D. R. (1998) Nature 393, 595-599[CrossRef][Medline] [Order article via Infotrieve]
8. Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., Kitamura, Y., Matsushima, K., Yoshida, N., Nishikawa, S., Kishimoto, T., and Nagasawa, T. (1998) Nature 393, 591-594[CrossRef][Medline] [Order article via Infotrieve]
9. Nagasawa, T., Hirota, S., Tachibana, K., Takakura, N., Nishikawa, S., Kitamura, Y., Yoshida, N., Kikutani, H., and Kishimoto, T. (1996) Nature 382, 635-638[CrossRef][Medline] [Order article via Infotrieve]
10. Muller, A., Homey, B., Soto, H., Ge, N., Catron, D., Buchanan, M. E., McClanahan, T., Murphy, E., Yuan, W., Wagner, S. N., Barrera, J. L., Mohar, A., Verastegui, E., and Zlotnik, A. (2001) Nature 410, 50-56[CrossRef][Medline] [Order article via Infotrieve]
11. Feng, Y., Broder, C. C., Kennedy, P. E., and Berger, E. A. (1996) Science 272, 872-877[Abstract]
12. Dalgleish, A. G., Beverley, P. C., Clapham, P. R., Crawford, D. H., Greaves, M. F., and Weiss, R. A. (1984) Nature 312, 763-767[CrossRef][Medline] [Order article via Infotrieve]
13. Alkhatib, G., Combadiere, C., Broder, C. C., Feng, Y., Kennedy, P. E., Murphy, P. M., and Berger, E. A. (1996) Science 272, 1955-1958[Abstract]
14. Choe, H., Farzan, M., Sun, Y., Sullivan, N., Rollins, B., Ponath, P. D., Wu, L., Mackay, C. R., LaRosa, G., Newman, W., Gerard, N., Gerard, C., and Sodroski, J. (1996) Cell 85, 1135-1148[CrossRef][Medline] [Order article via Infotrieve]
15. Deng, H., Liu, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., Di, Marzio, P., Marmon, S., Sutton, R. E., Hill, C. M., Davis, C. B., Peiper, S. C., Schall, T. J., Littman, D. R., and Landau, N. R. (1996) Nature 381, 661-666[CrossRef][Medline] [Order article via Infotrieve]
16. Doranz, B. J., Rucker, J., Yi, Y., Smyth, R. J., Samson, M., Peiper, S. C., Parmentier, M., Collman, R. G., and Doms, R. W. (1996) Cell 85, 1149-1158[CrossRef][Medline] [Order article via Infotrieve]
17. Dragic, T., Litwin, V., Allaway, G. P., Martin, S. R., Huang, Y., Nagashima, K. A., Cayanan, C., Maddon, P. J., Koup, R. A., Moore, J. P., and Paxton, W. A. (1996) Nature 381, 667-673[CrossRef][Medline] [Order article via Infotrieve]
18. Jones, P. L., Korte, T., and Blumenthal, R. (1998) J. Biol. Chem. 273, 404-409[Abstract/Free Full Text]
19. Jones, K. A., Borowsky, B., Tamm, J. A., Craig, D. A., Durkin, M. M., Dai, M., Yao, W. J., Johnson, M., Gunwaldsen, C., Huang, L. Y., Tang, C., Shen, Q., Salon, J. A., Morse, K., Laz, T., Smith, K. E., Nagarathnam, D., Noble, S. A., Branchek, T. A., and Gerald, C. (1998) Nature 396, 674-679[CrossRef][Medline] [Order article via Infotrieve]
20. Kaupmann, K., Malitschek, B., Schuler, V., Heid, J., Froestl, W., Beck, P., Mosbacher, J., Bischoff, S., Kulik, A., Shigemoto, R., Karschin, A., and Bettler, B. (1998) Nature 396, 683-687[CrossRef][Medline] [Order article via Infotrieve]
21. White, J. H., Wise, A., Main, M. J., Green, A., Fraser, N. J., Disney, G. H., Barnes, A. A., Emson, P., Foord, S. M., and Marshall, F. H. (1998) Nature 396, 679-682[CrossRef][Medline] [Order article via Infotrieve]
22. Vila-Coro, A. J., Mellado, M., Martin de Ana, A., Lucas, P., del Real, G., Martinez, A. C., and Rodriguez-Frade, J. M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 3388-3393[Abstract/Free Full Text]
23. Benkirane, M., Jin, D. Y., Chun, R. F., Koup, R. A., and Jeang, K. T. (1997) J. Biol. Chem. 272, 30603-30606[Abstract/Free Full Text]
24. Hebert, T. E., Loisel, T. P., Adam, L., Ethier, N., Onge, S. S., and Bouvier, M. (1998) Biochem. J. 330, 287-293[Medline] [Order article via Infotrieve]
25. Hebert, T. E., Moffett, S., Morello, J. P., Loisel, T. P., Bichet, D. G., Barret, C., and Bouvier, M. (1996) J. Biol. Chem. 271, 16384-16392[Abstract/Free Full Text]
26. Angers, S., Salahpour, A., Joly, E., Hilairet, S., Chelsky, D., Dennis, M., and Bouvier, M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 3684-3689[Abstract/Free Full Text]
27. Issafras, H., Angers, S., Bulenger, S., Blanpain, C., Parmentier, M., Labbe-Jullie, C., Bouvier, M., and Marullo, S. (2002) J. Biol. Chem. 277, 34666-34673[Abstract/Free Full Text]
28. Babcock, G. J., Mirzabekov, T., Wojtowicz, W., and Sodroski, J. (2001) J. Biol. Chem. 276, 38433-38440[Abstract/Free Full Text]
29. Mirzabekov, T., Kontos, H., Farzan, M., Marasco, W., and Sodroski, J. (2000) Nat. Biotechnol. 18, 649-654[CrossRef][Medline] [Order article via Infotrieve]
30. Moller, J. V., and le Maire, M. (1993) J. Biol. Chem. 268, 18659-18672[Abstract/Free Full Text]
31. le Maire, M., Champeil, P., and Moller, J. V. (2000) Biochim. Biophys. Acta 1508, 86-111[Medline] [Order article via Infotrieve]
32. Pebay-Peyroula, E., Rummel, G., Rosenbusch, J. P., and Landau, E. M. (1997) Science 277, 1676-1681[Abstract/Free Full Text]
33. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A., Le, Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and Miyano, M. (2000) Science 289, 739-745[Abstract/Free Full Text]
34. Lee, S. P., Xie, Z., Varghese, G., Nguyen, T., O'Dowd, B. F., and George, S. R. (2000) Neuropsychopharmacology 23, S32-40[CrossRef][Medline] [Order article via Infotrieve]
35. Dean, M. K., Higgs, C., Smith, R. E., Bywater, R. P., Snell, C. R., Scott, P. D., Upton, G. J., Howe, T. J., and Reynolds, C. A. (2001) J. Med. Chem. 44, 4595-4614[CrossRef][Medline] [Order article via Infotrieve]
36. Gouldson, P. R., Higgs, C., Smith, R. E., Dean, M. K., Gkoutos, G. V., and Reynolds, C. A. (2000) Neuropsychopharmacology 23, S60-77[CrossRef][Medline] [Order article via Infotrieve]
37. Crump, M. P., Gong, J. H., Loetscher, P., Rajarathnam, K., Amara, A., Arenzana-Seisdedos, F., Virelizier, J. L., Baggiolini, M., Sykes, B. D., and Clark-Lewis, I. (1997) EMBO J. 16, 6996-7007[CrossRef][Medline] [Order article via Infotrieve]
38. Dealwis, C., Fernandez, E. J., Thompson, D. A., Simon, R. J., Siani, M. A., and Lolis, E. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 6941-6946[Abstract/Free Full Text]
39. Holmes, W. D., Consler, T. G., Dallas, W. S., Rocque, W. J., and Willard, D. H. (2001) Protein Expr. Purif. 21, 367-377[CrossRef][Medline] [Order article via Infotrieve]
40. Valentin, A., Albert, J., Fenyo, E. M., and Asjo, B. (1994) J. Virol. 68, 6684-6689[Abstract/Free Full Text]
41. Wolinsky, S. M., Wike, C. M., Korber, B. T., Hutto, C., Parks, W. P., Rosenblum, L. L., Kunstman, K. J., Furtado, M. R., and Munoz, J. L. (1992) Science 255, 1134-1137[Abstract/Free Full Text]
42. Zhang, L. Q., MacKenzie, P., Cleland, A., Holmes, E. C., Brown, A. J., and Simmonds, P. (1993) J. Virol. 67, 3345-3356[Abstract/Free Full Text]
43. Zhu, T., Mo, H., Wang, N., Nam, D. S., Cao, Y., Koup, R. A., and Ho, D. D. (1993) Science 261, 1179-1181[Abstract/Free Full Text]
44. Asjo, B., Morfeldt-Manson, L., Albert, J., Biberfeld, G., Karlsson, A., Lidman, K., and Fenyo, E. M. (1986) Lancet 2, 660-662[Medline] [Order article via Infotrieve]
45. Schuitemaker, H., Koot, M., Kootstra, N. A., D