HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 278, Issue 51, 51085-51090, December 19, 2003

This Article Abstract Full Text (PDF) All Versions of this Article: 278/51/51085    most recent M308321200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Huang, L. Articles by Cui, J. Search for Related Content PubMed PubMed Citation Articles by Huang, L. Articles by Cui, J. Social Bookmarking                      What's this?

Farnesoid X Receptor Activates Transcription of the Phospholipid Pump MDR3^*

Li Huang, Annie Zhao, Jane-L. Lew, Theresa Zhang, Yaroslav Hrywna¶, John R. Thompson¶, Nuria de Pedro||, Inmaculada Royo||, Richard A. Blevins, Fernando Peláez||, Samuel D. Wright, and Jisong Cui**

From the Departments of Atherosclerosis and Endocrinology, Bioinformatics, and ^¶Molecular Profiling, Merck Research Laboratories, Rahway, New Jersey 07065 and ^||Merck Sharp and Dohme de España, S. A. Josefa Valcarcel 38, 28027 Madrid, Spain

Received for publication, July 30, 2003 , and in revised form, October 1, 2003.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The human multidrug resistance gene MDR3 encodes a P-glycoprotein that belongs to the ATP-binding cassette transporter family (ABCB4). MDR3 is a critical trans-locator for phospholipids across canalicular membranes of hepatocytes, evidenced by the fact that human MDR3 deficiencies result in progressive familial intrahepatic cholestasis type III. It has been reported previously that MDR3 expression is modulated by hormones, cellular stress, and xenobiotics. Here we show that the MDR3 gene is trans-activated by the farnesoid X receptor (FXR) via a direct binding of FXR/retinoid X receptor heterodimers to a highly conserved inverted repeat element (a FXR response element) at the distal promoter (-1970 to -1958). In FXR trans-activation assays, both the endogenous FXR agonist chenodeoxycholate and the synthetic agonist GW4064 activated the MDR3 promoter. Deletion or mutation of this inverted repeat element abolished FXR-mediated MDR3 promoter activation. Consistent with these data, MDR3 mRNA was significantly induced by both chenodeoxycholate and GW4064 in primary human hepatocytes in time- and dose-dependent fashions. In conclusion, we demonstrate that MDR3 expression is directly up-regulated by FXR. These results, together with the previous report that the bile salt export pump is a direct FXR target, suggest that FXR coordinately controls secretion of bile salts and phospholipids. Results of this study further support the notion that FXR is a master regulator of lipid metabolism.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
ATP-binding cassette (ABC)¹ transporters constitute a large family of proteins, and many have been shown to be involved in lipid transport. MDR3 (ABCB4), a P-glycoprotein, is predominantly expressed in the liver (1) and is the critical trans-locator for phospholipids across canalicular membranes of hepatocytes (2). The MDR3 function is essential for the liver as evidenced by the fact that MDR3 deficiencies in humans result in progressive familial intrahepatic cholestasis type III (3, 4). A number of factors, such as hormones, cellular stress, and xenobiotics have been shown to modulate MDR3 expression (5-7). However, the underlying molecular mechanisms for MDR3 gene regulation are unclear. In this study, we demonstrate that the bile acid receptor FXR directly regulates expression of MDR3.

FXR is a nuclear receptor for bile acids and regulates expression of a number of genes in which products are critically important for bile acid and cholesterol homeostasis (8-11). FXR functions as a heterodimer with the 9-cis-retinoic acid receptor (RXR) (12, 13), and the FXR/RXR heterodimer activates gene transcription via binding to a specific DNA sequence comprised of two inverted hexamer repeats separated by one nucleotide (IR-1) in the target promoter. To date, there is only one reported case in which FXR down-regulates apolipoprotein A-I expression via a FXR monomer or homodimer binding to an IR-1 (14).

Previous studies (15, 16) have shown that agonist-bound FXR directly regulates expression of the bile salt export pump (BSEP), an ABC transporter (ABCB11) in which deficiencies also cause progressive familial intrahepatic cholestasis (type II) (3). We hypothesized that FXR might also regulate expression of MDR3 to coordinately control secretion of bile acids and phospholipids.

To determine whether the MDR3 gene is a target of FXR, we first treated primary human hepatocytes with FXR agonists and analyzed endogenous MDR3 expression by real time PCR and by Northern blot analysis. Indeed, in primary human hepatocytes, the MDR3 mRNA was strongly induced by both the endogenous FXR agonist CDCA and the synthetic ligand GW4064. We further identified an IR-1 element in the MDR3 promoter and demonstrated that the FXR/RXR heterodimer specifically bound to the IR-1 and that the integrity of this IR-1 is essential for FXR-mediated promoter activation. These results indicate that the human MDR3 gene is directly trans-activated by FXR via the IR-1 element in the MDR3 promoter and suggest that FXR regulates expression of MDR3 and BSEP coordinately by a feed-forward mechanism to facilitate hepatic export of bile acids and phospholipids. These results support the critical role of FXR in cholesterol and bile acid metabolism.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Reagents—The following reagents were obtained from Invitrogen: DMEM and Opti-MEM I medium, regular fetal bovine serum (FBS) and charcoal-stripped FBS (CS-FBS), TRIzol reagents, T4 polynucleotide kinase, PCR Supermix, and oligonucleotide primers for gene cloning. [-³²P]ATP (3000 mCi/mmol) was obtained from Amersham Biosciences. The TNT T7 quick-coupled transcription/translation kit and reagents for -galactosidase and luciferase assays were purchased from Promega (Madison, WI). The QuikChange mutagenesis kit was obtained from Stratagene. FuGENE 6 transfection reagent was obtained from Roche Diagnostics. CDCA was obtained from Steraloids, Inc. (Newport, RI). TaqMan reagents for cDNA synthesis and real time PCR and TaqMan oligonucleotide primers and probes for human MDR3 were purchased from Applied Biosystems (Foster City, CA).

Sequence Analysis of MDR3 Genomic Region—Previous study has identified multiple transcription start sites for human MDR3 (17). To better define the transcription start site of MDR3, we blasted the predominant form of the gene, NM_000443 [GenBank] , against human mRNA and EST data bases. Multiple transcripts of human MDR3 were identified and retrieved. Each of them was mapped onto the Celera human genome (R26) using BLAT (18). The map indicated two transcription start sites >5 kb apart. Based on information from the full-length transcripts, we refer to the upstream site as the transcription start site of human MDR3. The genomic region spanning MDR3 and its 10-kb upstream flanking region was then extracted. Putative binding sites for transcription factors were identified by scanning this genomic sequence against the TRANSFAC data base (19) and the position-weighted matrices constructed internally.

MDR3 Promoter and Reporter Plasmid Constructs—Comparison of human MDR3 cDNA sequence by the BLAST search identified the genomic region spanning MDR3 and its 10-kb upstream-flanking region. The fragment of -2201/+37 was amplified by PCR, and the MDR3₂₂₀₁-Luc construct was generated by subcloning of the PCR-amplified fragment (-2201/+37) into the pGL3-enhancer plasmid vector (Promega) at NheI/HindIII sites. Similarly, the MDR3₂₀₀₀-Luc and MDR3₁₉₅₅-Luc constructs were also generated by subcloning of the PCR-amplified fragment (-2000/+37) and (-1955/+37) into the pGL3-enhancer plasmid, respectively. The sequence integrity for all constructs was confirmed by DNA sequencing. The expression vector pcDNA3.1-hFXR, pcDNA3.1-hRXR, and pCMV-lacZ were described previously (20).

MDR3 Promoter Mutants—FXRE in the MDR3 promoter was mutated using the QuikChange mutagenesis kit (Stratagene). PCR reactions were carried out according to the manufacturer's directions with the MDR3₂₀₀₀-Luc construct as a template. The sense primer was 5'-AG AGT TAG TAA A AATCA A TAATTT TAAGCC TAG TG-3', and the antisense primer was 5'-CA CTA GGC TTA AAATTA T TGA TTT TT A CTA ACT CT-3' (altered bases are in bold and underlined).

Electrophoretic Mobility Shift Assay (EMSA)—cDNA encoding human FXR or RXR was transcribed and translated using the TNT quick-coupled transcription/translation system (Promega) according to the instructions of the manufacturer. Double-stranded oligonucleotide probes for the EMSA were end-labeled with [-³²P]ATP (3000 mCi/mmol) by T4 polynucleotide kinase. The EMSA was performed as described previously (21) with minor modifications. Briefly, 2 µl of in vitro translated FXR or RXR protein alone or together were added to 20 µl of reaction containing 10 mM Tris (pH 8.0), 40 mM KCl, 0.05% Nonidet P-40, 6% glycerol, 1 mM dithiothreitol, 1 µg of poly(dI-dC). Cold competitor oligonucleotides including the wild type MDR3 FXRE (5'-AGT TAG TAA ATGTCAATAACCT TAAGC-3'), mutated MDR3 FXRE (5'-AG AGT TAG TAA A aaTCA A TAAttT TAAGCC TAG TG-3') and ideal IR-1 containing an IR-1 consensus (5'-GATGGGCCA AGGTCA A TGACCT CGGGG-3') were included in 20-, 50-, and 200-fold excess. After a 20-min incubation on ice, 10 fmol of the 5'-end-labeled MDR3 FXRE probes were added, and the mixture was continuously incubated for an additional 20 min on ice. DNA-protein complexes were resolved on a 4% native polyacrylamide gel electrophoresis containing 0.5x Tris borate-EDTA (0.89 M Tris, 0.89 M boric acid, 0.02 M disodium EDTA for 10x Tris borate-EDTA). The gel was dried and exposed to x-ray film at -70 °C.

FXR Trans-activation—HepG2 cells were transfected in 96-well plates using the FuGENE 6 transfection reagent as described previously (22). Transfection mixtures for each well contained 0.405 µl of FuGENE 6, 10.4 ng of pcDNA3.1-hFXR, 10.4 ng of pcDNA3.1-hRXR, 10.4 ng of pGL3-enhancer-MDR3-promoter-Luc, and 103.8 ng of pCMV-lacZ. The treatment of transfected cells with various FXR ligands, assays for luciferase, and -galactosidase activities were performed following the same protocols as described previously (22). This assay was performed at Merck Sharp and Dohme de España in Spain.

Treatment of Primary Human Hepatocytes for Gene Expression— Primary human hepatocytes were purchased from In Vitro Technologies. Cells were maintained in DMEM containing 10% FBS, 1% penicillin/streptomycin, 1 mM sodium pyruvate, and 5 mM HEPES. For determination of gene specific expression by TaqMan analysis, cells were seeded in 6-well plates at a density of 2 million cells/well in DMEM containing 10% FBS, 1% penicillin/streptomycin and 5 mM HEPES. Twenty-four hours after seeding, cells were treated with various concentrations of compounds in DMEM containing 0.5% CS-FBS, 1% penicillin/streptomycin, and 5 mM HEPES. Unless specified, cells were treated for 24 h.

RNA Isolation and Real Time Quantitative PCR—Total RNA was extracted from the treated human primary hepatocytes using the TRIzol reagent according to the manufacturer's instructions. Reverse transcription reactions and TaqMan PCRs were performed according to the manufacturer's instructions (Applied Biosystems). Sequence-specific amplification was detected with an increased fluorescent signal of carboxyfluorescein (reporter dye) during the amplification cycles. Amplification of human 18 S RNA was used in the same reaction of all samples as an internal control. Gene-specific mRNA was subsequently normalized to 18 S RNA. Levels of human MDR3 mRNA were expressed as the -fold difference of compound-treated cells against Me₂SO-treated cells.

Northern Blot Analysis—Isolation of total RNA was similar to that used in real time quantitative PCR. Total RNA (10 µg) was separated by electrophoresis on a 1% denaturing agarose gel with 1x formaldehyde/MOPS (Ambion, TX) and then transferred to a nylon membrane (Nytran SuPerCharge, Schleicher and Schuell). Blots were hybridized with ³²P-labeled cDNA probe of the human MDR3 gene (GenBank^TM accession number M23234 [GenBank] , bases 536-1129) and then re-probed with a radiolabeled cDNA probe of the -actin gene (Ambion, TX).

TaqMan Primers and Probes—Oligonucleotide primers and probe for human MDR3 were designed using the Primer Express program and were synthesized by Applied Biosystems. These sequences (5'-3') are as follows: forward primer (GTACTGGTGCACTTTCTACAAGACTTG), probe (6FAM-CACAGATGCTGCCCAAGTCCAAGGA-TAMRA), and reverse primer (TGCAATTAAAGCCAACCTGGTT) (where 6FAM is 6-carboxyfluorescein and TAMRA is carboxytetramethylrhodamine). The primers and probe for human 18 S RNA were also purchased from Applied Biosystems.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Endogenous Expression of MDR3 Is Increased by FXR Agonists in Primary Human Hepatocytes—To determine whether MDR3 expression is regulated by FXR, primary human hepatocytes were treated with the endogenous FXR agonist CDCA (60 µM) and the synthetic FXR agonist GW4064 (5 µM) for 3, 6, 12, 24, and 48 h, and the endogenous expression of MDR3 was determined by real time PCR (TaqMan). Up-regulation was readily detectable within 3 h with a maximum induction of 1.5-2-fold, which increased to around 3-fold at 6 h and about 4-fold at 12 h (Fig. 1A). Twenty-four-hour treatment yielded a peak induction of 5-6-fold, which decreased slightly at 48 h (Fig. 1A). The fact that MDR3 up-regulation by FXR agonists was readily detectable as early as 3 h suggests MDR3 is a direct target of FXR. Upon 24-h treatment, MDR3 mRNA was increased by CDCA in a dose-dependent manner with a maximum induction of 15-fold (Fig. 1B). Compared with the result in Fig. 1A, the more robust induction on MDR3 mRNA by CDCA in Fig. 1B may be because of the variation of individual donors.

View larger version (27K): [in this window] [in a new window]   FIG. 1. Induction of human MDR3 mRNA by FXR agonists in primary human hepatocytes. A and B, primary human hepatocytes at a density of 2 million cells/well in 6-well plates were treated with 60 µM CDCA (hatched bars) or 5 µM GW4064 (solid bars) at various time points (A) or with various concentrations of CDCA (B) for 24 h in DMEM containing 0.5% CS-FBS. Total RNA was prepared, and MDR3 mRNA was analyzed by TaqMan PCR as described under "Materials and Methods." Results are normalized as the -fold of control (treated cells versus vehicle). Each value represents the mean ± S.D. of duplicate three determinations. C, Northern blot analysis for induction of human MDR3 mRNA by FXR agonists. Total RNA was isolated from primary human hepatocytes as described under "Materials and Methods," and 10 µg were separated on a 1% agarose/formaldehyde gel, transferred to a nylon membrane, and hybridized to the MDR3 or -actin radiolabeled cDNA probe as described under "Materials and Methods." DMSO, Me2SO.

The MDR3 Promoter Contains an IR-1 That Binds Specifically to the FXR/RXR Heterodimer—The FXR/RXR heterodimer binds to specific DNA sequences in promoters of target genes to regulate gene transcription. The DNA sequences recognized by the heterodimer comprise an inverted repeat separated by a single nucleotide (IR-1). A data base search using the IR-1 consensus sequence identified a highly conserved IR-1 element in the distal promoter of MDR3 (-1970 to -1958). To examine whether the FXR/RXR heterodimer binds to this IR-1 element, an electrophoretic mobility shift assay was performed using ³²P-labeled IR-1 from the human MDR3 promoter in the presence of in vitro translated human FXR and/or human RXR proteins. The results of EMSAs are shown in Fig. 2A. Neither FXR nor RXR alone bound to the probe (lanes 1 and 2). However, when both FXR and RXR proteins were present, a complex was formed indicating that it is the FXR/RXR heterodimer that is bound by the IR-1 element (lane 3). Competition analysis showed that an unlabeled IR-1 oligonucleotide from MDR3 promoter (Fig. 2B, WT) at a 20-, 50-, or 200-fold molar excess was able to compete for binding in a dose-dependent manner (lanes 4-6), whereas the same molar excess of a mutated oligonucleotide (Fig. 2B, Mut) failed to compete for binding (lanes 7-9). Moreover, an ideal IR-1 sequence (Fig. 2B, IR-1) efficiently competed for binding at a 20-, 50-, or 200-fold molar excess (lanes 10-12). These results indicate that the IR-1 element in the MDR3 promoter is an authentic FXR/RXR-binding cis element.

View larger version (40K): [in this window] [in a new window]   FIG. 2. FXR/RXR heterodimers bind specifically to the IR-1 element in the human MDR3 promoter. A, EMSAs were performed as described under "Materials and Methods" with in vitro translated FXR (lane 1), RXR (lane 2), or FXR/RXR (lanes 3-12) with the wild type (WT) IR-1 in the human MDR3 promoter as probe. Competition analysis was performed with a 20-, 50-, or 200-fold excess of wild type MDR3 IR-1 (lanes 4-6), mutated IR-1 (Mut, lanes 7-9), or idealized IR-1 (lanes 10-12). Sp, specific DNA-protein complex. B, the sequences of oligonucleotides used in this study.

View larger version (35K): [in this window] [in a new window]   FIG. 3. Deletion-mutation analysis of the human MDR3 promoter. A, schematic presentation of different MDR3 promoter constructs. The constructs of MDR32201-Luc and MDR32000-Luc contain the IR-1 sequence localized between -1970 and -1958. MDR31955-Luc lacks the IR-1 element, and MDR3mut-Luc contains a mutated IR-1 (mutation in lowercase), which is otherwise the same as MDR32000-Luc. B and C, HepG2 cells (3.2 x 104 cells/well of 96-well plates) were co-transfected with pCMV-lacZ, FXR/RXR expression vectors, and each of the MDR3 promoter constructs as indicated in A. Cells were then treated with 50 µM CDCA (B, hatched bars) or 0.5 µM GW4064 (C, solid bars) for 40-48 h, and the cell lysate was used for determination of luciferase and -galactosidase activities as described under "Materials and Methods." Luciferase activities were normalized to -galactosidase activities individually for each well. Each value represents the mean ± S.D. of six determinations. DMSO (open bars), Me2SO.

Mutation of MDR3 IR-1 Abolishes Promoter Trans-activation by FXR/RXR—To demonstrate further that the IR-1 element at -1970 to -1958 is responsible for the trans-activation of MDR3 promoter, mutations in both halves of the IR-1 element (ATGTCA A TAACCT to AaaTCA A TAAttT; mutated bases in lowercase type) were created in the MDR3₂₀₀₀-Luc construct using site-directed mutagenesis, and the mutant construct (MDR3_mut-Luc) was transfected in HepG2 cells together with FXR and RXR expression vectors. Compared with MDR3₂₀₀₀-Luc, MDR3_mut-Luc showed only a modest residual induction by 50 µM CDCA (Fig. 3B) and 0.5 µM GW4064 (Fig. 3C). This induction was indistinguishable from that of the construct lacking the IR-1 element (MDR3₁₉₅₅-Luc) and the pGL3 vector control (Fig. 3, B and C). This result indicates that the integrity of the IR-1 element in the MDR3 promoter is essential for the promoter trans-activation by FXR/RXR.

GW4064 Activates the MDR3 Promoter in a Dose-dependent Fashion—To determine the dose dependence of MDR3 promoter activation by FXR, the MDR3₂₀₀₀-Luc construct (a minimal promoter containing the IR-1 element) was transiently transfected into HepG2 cells together with the FXR and RXR expression vectors, and cells were treated by the synthetic FXR ligand GW4064. Fig. 4 indicates that GW4064 increased the luciferase activity in a dose-dependent manner with an EC₅₀ value of 25 nM and a maximum induction of 8-10-fold. The EC₅₀ value in this assay correlates well with the binding affinity of this ligand on FXR (23). In the absence of exogenous FXR/RXR (without co-transfection with the FXR and RXR expression vectors), GW4064 did not significantly increase the luciferase activity (Fig. 4B). This is presumably because of a low basal level of FXR expression in HepG2 cells that was not enough for activating the MDR3 promoter construct that was transiently transfected into the cells.

View larger version (31K): [in this window] [in a new window]   FIG. 4. GW4064 induces expression of the MDR3 promoter in a dose-dependent fashion. A, HepG2 cells (3.2 x 104 cells/well of 96-well plates) were co-transfected with pCMV-lacZ, FXR/RXR expression vectors, and the MDR32000-Luc construct (see Fig. 3A). B, HepG2 cells (3.2 x 104 cells/well of 96-well plates) were co-transfected with MDR32000-Luc construct and pCMV-lacZ. Cells were then treated with various concentrations of GW4064 for 40-48 h, and the cell lysate was used for determination of luciferase and -galactosidase activities as described under "Materials and Methods." Luciferase activities were normalized to -galactosidase activities individually for each well. Each value represents the mean ± S.D. of six determinations.

View larger version (20K): [in this window] [in a new window]   FIG. 5. GW4064 and 9-cis-RA additively increase expression of the MDR3 promoter. HepG2 cells (3.2 x 104 cells/well of 96-well plates) were co-transfected with pCMV-lacZ, FXR/RXR expression vectors, and the MDR32000-Luc construct (see Fig 3A). Cells were then treated with various concentrations of 9-cis-RA in the presence (solid bars) or absence (hatched bars) of 50 nM GW4064 for 40-48 h, and the cell lysate was used for determination of luciferase and -galactosidase activities as described under "Materials and Methods." Luciferase activities were normalized to -galactosidase activities individually for each well. Each value represents the mean ± S.D. of six determinations.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Treatment of primary human hepatocytes with the endogenous FXR agonist CDCA and the synthetic agonist GW4064 greatly induced MDR3 mRNA (Fig. 1). Consistent with this observation, an IR-1 was identified in the distal promoter of MDR3. Furthermore, deletion or mutation of this IR-1 abolished the binding by the FXR/RXR heterodimer and also abolished MDR3 promoter activation (Figs. 2 and 3) indicating that it is this IR-1 that mediates the up-regulation of MDR3 by FXR. These observations support the idea that bile acids may increase phospholipid secretion via FXR up-regulation of MDR3.

Although many of the IR-1 elements of known FXR target genes are located in the proximal promoter, it is not uncommon that the FXRE of human MDR3 promoter is about 2 kb upstream of the transcription start site. It has been shown that the apolipoprotein C-II promoter contains a functional FXRE that is located 7.5 kb upstream of the transcription start site and that this FXRE is essential for FXR-mediated up-regulation of apolipoprotein C-II (28).

The discovery of up-regulation of MDR3 by FXR makes good physiological sense. When bile acid concentrations in the liver are elevated, activated FXR on one hand increases expression of BSEP for promoting bile salt secretion and on the other hand up-regulates MDR3 expression resulting in an increased phospholipid secretion. The coordinated regulation of MDR3 and BSEP by FXR represents a feed-forward mechanism for hepatic export of bile acids and phospholipids. The increased expression of BSEP and MDR3 would lead to the efflux of bile acids and phospholipids into bile canaliculi, although both transporters may also influence the secretion of cholesterol into bile resulting in an appropriate ratio of bile acids/phospholipid/cholesterol. This study provides further evidence for the critical role of FXR in bile acid and cholesterol metabolism.

	FOOTNOTES

 
The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EBI Data Bank with accession number(s) M23234 [GenBank] .

^* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^** To whom correspondence should be addressed: Dept. of Atherosclerosis and Endocrinology, Merck Research Laboratories, 126 E. Lincoln Ave., P. O. Box 2000, RY80W-107, Rahway, NJ 07065. Tel.: 732-594-6369; Fax: 732-594-7926; E-mail: jisong_cui{at}merck.com.

¹ The abbreviations used are: ABC, ATP-binding cassette; FXR, the farnesoid X receptor; FXRE, FXR response element; MDR, multidrug resistance; CDCA, chenodeoxycholate; RXR, retinoid X receptor ; BSEP, the bile salt export pump; IR-1, inverted repeat separated by a single nucleotide; EMSA(s), electrophoretic mobility shift assay; FBS, fetal bovine serum; CS-FBS, charcoal-stripped FBS; DMEM, Dulbecco's modified Eagle's medium; MOPS, 4-morpholinepropanesulfonic acid; RA, retinoic acid.

	ACKNOWLEDGMENTS

 
We thank Dr. Jilly Evans for critically reading the manuscript.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Gottesman, M. M., Hrycyna, C. A., Schoenlein, P. V., Germann, U. A., and Pastan, I. (1995) Annu. Rev. Genet. 29, 607-649[CrossRef][Medline] [Order article via Infotrieve]
2. van Helvoort, A., Smith, A. J., Sprong, H., Fritzsche, I., Schinkel, A. H., Borst, P., and van Meer, G. (1996) Cell 87, 507-517[CrossRef][Medline] [Order article via Infotrieve]
3. Strautnieks, S. S., Bull, L. N., Knisely, A. S., Kocoshis, S. A., Dahl, N., Arnell, H., Sokal, E., Dahan, K., Childs, S., Ling, V., Tanner, M. S., Kagalwalla, A. F., Nemeth, A., Pawlowska, J., Baker, A., Mieli-Vergani, G., Freimer, N. B., Gardiner, R. M., and Thompson, R. J. (1998) Nat. Genet. 20, 233-238[CrossRef][Medline] [Order article via Infotrieve]
4. de Vree, J. M., Jacquemin, E., Sturm, E., Cresteil, D., Bosma, P. J., Aten, J., Deleuze, J. F., Desrochers, M., Burdelski, M., Bernard, O., Oude Elferink, R. P., and Hadchouel, M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 282-287[Abstract/Free Full Text]
5. Piekarz, R. L., Cohen, D., and Horwitz, S. B. (1993) J. Biol. Chem. 268, 7613-7616[Abstract/Free Full Text]
6. Gant, T. W., Silverman, J. A., and Thorgeirsson, S. S. (1992) Nucleic Acids Res. 20, 2841-2846[Abstract/Free Full Text]
7. Gant, T. W., Silverman, J. A., Bisgaard, H. C., Burt, R. K., Marino, P. A., and Thorgeirsson, S. S. (1991) Mol. Carcinog. 4, 499-509[Medline] [Order article via Infotrieve]
8. Makishima, M., Okamoto, A. Y., Repa, J. J., Tu, H., Learned, R. M., Luk, A., Hull, M. V., Lustig, K. D., Mangelsdorf, D. J., and Shan, B. (1999) Science 284, 1362-1365[Abstract/Free Full Text]
9. Parks, D. J., Blanchard, S. G., Bledsoe, R. K., Chandra, G., Consler, T. G., Kliewer, S. A., Stimmel, J. B., Willson, T. M., Zavacki, A. M., Moore, D. D., and Lehmann, J. M. (1999) Science 284, 1365-1368[Abstract/Free Full Text]
10. Wang, H., Chen, J., Hollister, K., Sowers, L. C., and Forman, B. M. (1999) Mol. Cell 3, 543-553[Medline] [Order article via Infotrieve]
11. Tu, H., Okamoto, A. Y., and Shan, B. (2000) Trends Cardiovasc. Med. 10, 30-35[CrossRef][Medline] [Order article via Infotrieve]
12. Forman, B. M., Goode, E., Chen, J., Oro, A. E., Bradley, D. J., Perlmann, T., Noonan, D. J., Burka, L. T., McMorris, T., and Lamph, W. W. (1995) Cell 81, 687-693[CrossRef][Medline] [Order article via Infotrieve]
13. Zavacki, A. M., Lehmann, J. M., Seol, W., Willson, T. M., Kliewer, S. A., and Moore, D. D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7909-7914[Abstract/Free Full Text]
14. Claudel, T., Sturm, E., Duez, H., Torra, I. P., Sirvent, A., Kosykh, V., Fruchart, J. C., Dallongeville, J., Hum, D. W., Kuipers, F., and Staels, B. (2002) J. Clin. Investig. 109, 961-971[CrossRef][Medline] [Order article via Infotrieve]
15. Yu, J., Lo, J. L., Huang, L., Zhao, A., Metzger, E., Adams, A., Meinke, P. T., Wright, S. D., and Cui, J. (2002) J. Biol. Chem. 277, 31441-31447[Abstract/Free Full Text]
16. Ananthanarayanan, M., Balasubramanian, N., Makishima, M., Mangelsdorf, D. J., and Suchy, F. J. (2001) J. Biol. Chem. 276, 28857-28865[Abstract/Free Full Text]
17. Smit, J. J., Mol, C. A., van Deemter, L., Wagenaar, E., Schinkel, A. H., and Borst, P. (1995) Biochim. Biophys. Acta 1261, 44-56[Medline] [Order article via Infotrieve]
18. Kent, W. J. (2002) Genome Res. 12, 656-664[Abstract/Free Full Text]
19. Wingender, E., Chen, X., Fricke, E., Geffers, R., Hehl, R., Liebich, I., Krull, M., Matys, V., Michael, H., Ohnhauser, R., Pruss, M., Schacherer, F., Thiele, S., and Urbach, S. (2001) Nucleic Acids Res. 29, 281-283[Abstract/Free Full Text]
20. Cui, J., Huang, L., Zhao, A., Lew, J. L., Yu, J., Sahoo, S., Meinke, P. T., Royo, I., Pelaez, F., and Wright, S. D. (2003) J. Biol. Chem. 278, 10214-10220[Abstract/Free Full Text]
21. Grober, J., Zaghini, I., Fujii, H., Jones, S. A., Kliewer, S. A., Willson, T. M., Ono, T., and Besnard, P. (1999) J. Biol. Chem. 274, 29749-29754[Abstract/Free Full Text]
22. Cui, J., Heard, T. S., Yu, J., Lo, J. L., Huang, L., Li, Y., Schaeffer, J. M., and Wright, S. D. (2002) J. Biol. Chem. 277, 25963-25969[Abstract/Free Full Text]
23. Willson, T. M., Jones, S. A., Moore, J. T., and Kliewer, S. A. (2001) Med. Res. Rev. 21, 513-522[CrossRef][Medline] [Order article via Infotrieve]
24. Denson, L. A., Sturm, E., Echevarria, W., Zimmerman, T. L., Makishima, M., Mangelsdorf, D. J., and Karpen, S. J. (2001) Gastroenterology 121, 140-147[CrossRef][Medline] [Order article via Infotrieve]
25. Kast, H. R., Goodwin, B., Tarr, P. T., Jones, S. A., Anisfeld, A. M., Stoltz, C. M., Tontonoz, P., Kliewer, S., Willson, T. M., and Edwards, P. A. (2002) J. Biol. Chem. 277, 2908-2915[Abstract/Free Full Text]
26. Gerloff, T., Stieger, B., Hagenbuch, B., Madon, J., Landmann, L., Roth, J., Hofmann, A. F., and Meier, P. J. (1998) J. Biol. Chem. 273, 10046-10050[Abstract/Free Full Text]
27. Green, R. M., Hoda, F., and Ward, K. L. (2000) Gene (Amst.) 241, 117-123[CrossRef][Medline] [Order article via Infotrieve]
28. Kast, H. R., Nguyen, C. M., Sinal, C. J., Jones, S. A., Laffitte, B. A., Reue, K., Gonzalez, F. J., Willson, T. M., and Edwards, P. A. (2001) Mol. Endocrinol. 15, 1720-1728[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				I. Kim, K. Morimura, Y. Shah, Q. Yang, J. M. Ward, and F. J. Gonzalez Spontaneous hepatocarcinogenesis in farnesoid X receptor-null mice Carcinogenesis, May 1, 2007; 28(5): 940 - 946. [Abstract] [Full Text] [PDF]

				T. Gautier, U. J. F. Tietge, R. Boverhof, F. G. Perton, N. Le Guern, D. Masson, P. C. N. Rensen, L. M. Havekes, L. Lagrost, and F. Kuipers Hepatic lipid accumulation in apolipoprotein C-I-deficient mice is potentiated by cholesteryl ester transfer protein J. Lipid Res., January 1, 2007; 48(1): 30 - 40. [Abstract] [Full Text] [PDF]

				T. Hu, M. Chouinard, A. L. Cox, P. Sipes, M. Marcelo, J. Ficorilli, S. Li, H. Gao, T. P. Ryan, M. D. Michael, et al. Farnesoid X Receptor Agonist Reduces Serum Asymmetric Dimethylarginine Levels through Hepatic Dimethylarginine Dimethylaminohydrolase-1 Gene Regulation J. Biol. Chem., December 29, 2006; 281(52): 39831 - 39838. [Abstract] [Full Text] [PDF]

				K. E. Swales, M. Korbonits, R. Carpenter, D. T. Walsh, T. D. Warner, and D. Bishop-Bailey The farnesoid x receptor is expressed in breast cancer and regulates apoptosis and aromatase expression. Cancer Res., October 15, 2006; 66(20): 10120 - 10126. [Abstract] [Full Text] [PDF]

				C. Stedman, C. Liddle, S. Coulter, J. Sonoda, J. G. Alvarez, R. M. Evans, and M. Downes Benefit of farnesoid X receptor inhibition in obstructive cholestasis PNAS, July 25, 2006; 103(30): 11323 - 11328. [Abstract] [Full Text] [PDF]

				F. Y. Lee, H. R. Kast-Woelbern, J. Chang, G. Luo, S. A. Jones, M. C. Fishbein, and P. A. Edwards {alpha}-Crystallin Is a Target Gene of the Farnesoid X-activated Receptor in Human Livers J. Biol. Chem., September 9, 2005; 280(36): 31792 - 31800. [Abstract] [Full Text] [PDF]

				A. M. Anisfeld, H. R. Kast-Woelbern, H. Lee, Y. Zhang, F. Y. Lee, and P. A. Edwards Activation of the nuclear receptor FXR induces fibrinogen expression: a new role for bile acid signaling J. Lipid Res., March 1, 2005; 46(3): 458 - 468. [Abstract] [Full Text] [PDF]

				L. Alvarez, P. Jara, E. Sanchez-Sabate, L. Hierro, J. Larrauri, M. C. Diaz, C. Camarena, A. De la Vega, E. Frauca, E. Lopez-Collazo, et al. Reduced hepatic expression of farnesoid X receptor in hereditary cholestasis associated to mutation in ATP8B1 Hum. Mol. Genet., October 1, 2004; 13(20): 2451 - 2460. [Abstract] [Full Text] [PDF]

				I. Pineda Torra, L. P. Freedman, and M. J. Garabedian Identification of DRIP205 as a Coactivator for the Farnesoid X Receptor J. Biol. Chem., August 27, 2004; 279(35): 36184 - 36191. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 278/51/51085    most recent M308321200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Huang, L. Articles by Cui, J. Search for Related Content PubMed PubMed Citation Articles by Huang, L. Articles by Cui, J. Social Bookmarking                      What's this?