Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M307332200 on October 7, 2003

J. Biol. Chem., Vol. 278, Issue 51, 51223-51231, December 19, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/51/51223    most recent
M307332200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kang, H. T.
Right arrow Articles by Hwang, E. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, H. T.
Right arrow Articles by Hwang, E. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Down-regulation of Sp1 Activity through Modulation of O-Glycosylation by Treatment with a Low Glucose Mimetic, 2-Deoxyglucose*

Hyun Tae Kang{ddagger}, Jung Won Ju§, Jin Won Cho§, and Eun Seong Hwang{ddagger}||

From the {ddagger}Department of Life Science, University of Seoul, Seoul 130-743, Korea and the §Department of Biology and Protein Network Research Center, Yonsei University, Seoul 120-749, Korea

Received for publication, July 9, 2003 , and in revised form, September 22, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
2-Deoxyglucose (2-DG), a nonmetabolizable glucose analogue, blocks glycolysis at the phosphohexose isomerase step and has been frequently used as a glucose starvation mimetic in studies of a wide variety of physiological dysfuctions. However, the effect of 2-DG on protein glycosylation and related signal pathways has not been investigated in depth. In HeLa, an HPV18-positive cervical carcinoma line, 2-DG treatment down-regulates human papillomavirus early gene transcription. This down-regulation was also achieved by low glucose supply or hypoxia, suggesting that this is a response commonly modulated by cellular glucose or energy level. We investigated how 2-DG and low glucose affect transcriptional activity. Human papillomavirus gene transcription was only marginally affected by the inhibition of ATP synthesis or the supplementation of pyruvate to 2-DG-treated cells, suggesting that poor ATP generation is involved only to a limited extent. 2-DG treatment also inhibited activation of p21 WAF1 promoter, which is controlled by p53 and/or Sp1. In a reporter assay using p21 WAF1 promoter constructs, 2-DG exerted a strong inhibitory effect on Sp1 activity. DNA binding activity of Sp1 in 2-DG-treated HeLa cells was intact, whereas it was severely impaired in cells incubated in a low glucose medium or in hypoxic condition. Unexpectedly, Sp1 was heavily modified with GlcNAc in 2-DG-treated cells, which is at least partially attributed to the inhibitory effect of 2-DG on N-acetyl-{beta}-D-glucosaminidase activity. Our results suggest that 2-DG, like low glucose or hypoxic condition, down-regulates Sp1 activity, but through hyper-GlcNAcylation instead of hypo-GlcNAcylation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
For most tumor cells and some rapidly proliferating cells, poor blood supply would impose an environmental stress such as nutritional starvation and hypoxia, which evidently leads to apoptotic or necrotic death of cells (1). Glucose deprivation-induced ATP depletion stimulates the mitochondrial death pathway cascade, which involves the loss of mitochondrial membrane potential and cytochrome c release (2-4) or causes necrotic cell death (5). Also, in glucose-deprived cells, the level of prooxidants, such as superoxide and hydrogen peroxide, increases probably as a result of the metabolic shift to oxidative phosphorylation, and this triggers signal transduction pathways involving the activation of c-Jun N-terminal kinase/mitogen-activated protein kinase that leads to apoptotic cell death (6, 7). Both hypoxia and hypoglycemia induce HIF-1{alpha} in most cells in an effort to restore oxygen homeostatsis by stimulating glycolysis, erythropoiesis, and angiogenesis but also induce G1 arrest (8) and apoptosis (9) in a manner dependent on HIF-1{alpha} and p53 in most cell types. In addition, because glucose is a key source for sugar moieties in glycoproteins, glucose deprivation also blocks the completion of protein modification and thereby affects various aspects of cell physiology and biochemical activities mediated by glycoproteins. Furthermore, accumulation in the endoplasmic reticulum of proteins misfolded because of poor glycosylation (unfolded protein response or glucose-regulated stress) is known to induce apoptotic cell death and so-called glucose-regulated proteins such as Grp78 and Grp94, probably as a cellular defense response to endoplasmic reticulum stress (reviewed in Ref. 10).

A variety of glycoprotein linkages have been discovered to form between 13 different sugar molecules and 8 amino acids on proteins (reviewed in Ref. 11). Among them, three types of protein glycosylations are most widely distributed and well characterized. N-Linked glycosylation is transfer of oligosaccharides to asparagine residues en bloc in endoplasmic reticulum, and O-linked glycosylation is transfer of a small number of glucose, galactose, or N-acetylgalactosamine to serine or threonine residues in succession during transport through Golgi network. Another form of O-linked protein glycosylation occurs in a variety of proteins including nuclear pore complex proteins, cytoskeletal proteins, and transcription factors (reviewed in Refs. 12 and 13). These proteins are modified by a single monosaccharide, GlcNAc, at serine or threonine residues. This O-GlcNAc modification (O-GlcNAcylation) is catalyzed by UDP-N-acetylglucosamine:peptide N-acetylglucosaminyl transferase (O-GlcNAc transferase; OGT)1 (14). UDP-GlcNAc, the substrate of this enzyme, is synthesized from glucose via the hexosamine biosynthetic pathway (15). The availability of UDP-GlcNAc correlates with the glycosylation levels of many intracellular proteins and the transcriptional levels of some genes (16). Because many transcription factors are modified by O-GlcNAc (17), it is likely that O-GlcNAcylation of certain transcription factors could regulate gene expression in response to glucose flux.

In numerous studies, interference with glycolysis or conditions for nutritional deprivation or energy depletion have been simulated in in vitro culture by utilizing 2-deoxyglucose (2-DG) (Refs. 18-22, for example). 2-DG, a nonmetabolizable glucose analogue, is known to block glycolysis by inhibiting phosphohexose isomerase (23, 24). 2-DG also induces glucose-regulated proteins, as does low glucose stress (25, 26). 2-DG has been shown to effectively block the growth of tumor cells in animal models (27, 28) and of a variety of human tumors cells alone or in combination with hypoxia or other tumor therapy tools (29-31). 2-DG has also been utilized as a mimetic of calorie restriction in an animal study (32). Despite such an extensive utilization as an effective low glucose mimetic in a wide variety of physiological situations, however, the effect of 2-DG on protein glycosylation and the related signal pathway has not been closely investigated nor significantly considered in previous studies.

In a previous study (33), human papillomavirus (HPV) early gene transcription was shown to be suppressed in HeLa cervical carcinoma cells and its derivative cells by the treatment of 2-DG, and it was postulated that high glucose availability is indispensable for both high glycolysis rate of cervical cancer cells and the maintenance of the carcinogenic state by continued expression of HPV oncoproteins. However, the molecular mechanism by which 2-DG treatment caused down-regulation of HPV gene expression was not investigated. There might be several different routes through which 2-DG causes repression of HPV gene expression: inhibition of glycolysis and ATP production, interference in protein glycosylation and the resulting endoplasmic reticulum stress, and attenuation of activities of certain transcription factors through alterations in its O-GlcNAcylation level. Transcription of HPV early genes is controlled by a region of HPV DNA called the upstream regulatory region (URR), which contains numerous sequence elements that interact with cellular and viral transcription factors (see Ref. 34 for a recent review).

Using HPV URR as a model, we investigated how 2-DG and hypoxia affect gene transcription. In our study, not only HPV URR but also p21 WAF1 promoter activities were severely suppressed by 2-DG treatment. Through investigation on the possible regulatory events associated with the glucose-linked modulation of HPV URR and p21 WAF1 transcription, we found that Sp1 activity is inhibited and that its glycosylation status is severely altered by the treatment of 2-DG. Our results suggest that Sp1, through O-GlcNAcylation, functions as a molecular switch that modulates both host and viral gene transcription in response to cellular nutritional status. Our study also suggests that hypoxia and low glucose also affect Sp1 activity but through mechanisms different from that of 2-DG.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—Cervical carcinoma cell lines positive for HPV DNA, HeLa (HPV 18), and CaSki (HPV 16); a non-small cell lung carcinoma cell line, H460; and a rat cell line, PC12, were all incubated in normal Dulbecco's modified Eagle's medium (DMEM; Invitrogen) containing 25 mM glucose. All of the media were supplemented with 10% fetal bovine serum. Hypoxic incubation condition was established with an ambient oxygen concentration of 0.01% (using a controlled incubator with CO2/O2 monitoring and CO2/N2 gas sources). For 2-DG treatment, the cells were incubated in DMEM supplemented with 45 mM 2-DG (Sigma). For low glucose treatment, the cells were incubated in DMEM (without glucose; Invitrogen) supplemented with 1 mM glucose. To measure cellular ATP levels, 2 x 105 HeLa cells were collected, washed in phosphate-buffered saline, lysed, and applied to an ATP Somatic cell assay kit (Sigma) following the manufacturer's instructions. The luminescence emitted from the ATP-dependent luciferase reaction was monitored in a luminometer and used as the relative ATP level in test cells.

Western Analyses—The cells were washed twice in phosphate-buffered saline containing 1 mM phenylmethylsulfonyl fluoride (PMSF), pelleted, and lysed with RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS) containing 1 mM PMSF and 10 µg/ml leupeptin. After 20 min on ice, the lysate was centrifuged at 14,000 rpm for 15 min, and supernatant was saved. The protein concentration was determined by using a Bio-Rad protein assay reagent. 30 or 50 µg of proteins were separated by SDS-PAGE. The protein bands were transferred to nitrocellulose membrane (Hybond ECL; Amersham Biosciences) in 12.5 mM Tris, 100 mM glycine transfer buffer containing 20% methanol and 0.1% SDS. The membranes were blocked in 5% milk-TBST buffer (10 mM Tris-Cl, pH 8.0, 150 mM NaCl, 0.05% Tween 20) incubated in 5% milk-TBST buffer containing antibody to either p53 (DO-1; Calbiochem, Cambridge, MA), p21 WAF1 (C-19, HRP; Santa Cruz, Santa Cruz, CA), E2F1 (KH95; Santa Cruz), c-Myc (9E10; Santa Cruz), MDM2 (Ab-1; Oncogene, Cambridge, MA), Bax1 (N-20; Santa Cruz), Sp1 (Upstate USA, Charlottesville, VA), O-GlcNAc (RL2; Affinity Bioreagents, Bolden, CO), phosphothreonine (Sigma), or HPV16 E7 or HPV18 E7 protein (both kindly provided by Dr. In Gyu Kim) (35). The filters were washed with TBST buffer and incubated with either anti-mouse or anti-rabbit IgG conjugated to horseradish peroxidase. The protein bands were visualized by chemiluminescence using Lumi-LightPLUS (Roche Applied Science).

RT-PCR—After washing in phosphate-buffered saline, total RNA was isolated using TRIzol reagent (Invitrogen) following the manufacturer's protocol. A total of 5 µg of RNA was converted to cDNA by using Moloney murine leukemia virus reverse transcriptase and oligo(dT) primer (Promega, Madison, WI), and 1/40 volume of synthesized cDNA was applied to PCR. The cDNAs for all tested genes were amplified using the following sets of primers: 5'-GCGCAGATCTATGGCGCGCTTTGAGG-3' and 5'-ATATAGATCTCTTAGGTCCATGCATA-3' for HPV18 E6; 5'-ATGTTTCAGGACCCACAGGAGCGA-3' and 5'-TTACAGCTGGGTTTCTCTACGTG-3' for HPV16 E6; 5'-ATGGAGACAGCATGCGAACGT-3' and 5'-TTGCTTAACTCCTGCA-3' for BPV E2; 5'-CGGGCTATCGAACTACAACCA-3' and 5'-CCCATATTAGAGTAGGCATCAGCAAAG-3' for OGT; 5'-AAGGCTCCAGAAATGGGAAT-3' and 5'-GATGGAGACTTGGGCATGAG-3' for O-GlcNAcase; and 5'-GTCGCCCTGGACTTCGAGCAAGAG-3' and 5'-CTAGAAGCATTTGCGGTGGACG-3' for {beta}-actin.

Transient Transfection and Reporter Assay—HeLa cells in 6-well plates were transfected with 2 µg/well of pGL2-0.3 plasmids (kindly provided by Dr. J. Y. Lee, Hallym University, Chuncheon, Korea) by using GeneCarry Transfection reagent (GoodGene, Seoul, Korea). 24 h after transfection, the cells were treated with 45 mM 2-DG for 24 h and lysed. The extracts were applied to luciferase activity by using a luciferase assay kit (Promega). The luciferase activities were normalized based on protein concentrations.

Electrophoretic Mobility Shift Assay—The cells were resuspended in buffer A (10 mM Hepes, pH 7.8, 1.5 mM MgCl2, 10 mM KCl, 1 mM dithiothreitol, 1 mM PMSF, 10 µg/ml leupeptin) for 25 min. After centrifugation, the cells were incubated in 0.1% Triton X-100 for 5 min. The cell pellets were incubated in nuclear protein isolation buffer B (20 mM Hepes, pH 7.8, 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM dithiothreitol, 1 mM PMSF, 10 µg/ml leupeptin) on ice for 30 min. In binding reactions, radiolabeled probe for Sp1 binding from HPV18 URR (AGGGAGTAACCGAAAACGGT) and 10 µg of nuclear extracts were incubated in binding buffer (4 mM Tris-Cl, pH 7.8, 12 mM Hepes, pH 7.9, 60 mM KCl, 30 mM NaCl, 0.1 mM EDTA, 1 mM ZnCl2, 1 µg of poly(dI-dC), 10% glycerol) for 20 min at 22 °C. In supershift experiments, nuclear extract was incubated with 2 µg of anti-Sp1 antibody for 30 min at 22 °C prior to the addition of the probe. In competition experiments, a 300-fold higher amount of unlabeled probe was incubated with binding mixture containing radiolabeled probe. The reaction products were resolved in 5% nondenaturing polyacrylamide gel in 0.25x TBE buffer at 4 °C. The gel was dried and applied to autoradiography. A known Sp1-binding sequence in HPV18 URR (5'-AGGGAGTAACCGAAAACGGT-3') was used for the DNA probe. The single-stranded oligomers were annealed by incubation in 80 °C for 5 min followed by cooling down slowly to room temperature and labeled by using a Klenow fragment of DNA polymerase and [32P]dGTP (Amersham Biosciences).

Immunoprecipitation—Nuclear extracts were prepared as described under "Electrophoretic Mobility Shift Assay." Equal amounts of protein were incubated overnight at 4 °C with anti-Sp1 antibody, followed by overnight incubation with protein A-Sepharose (Amersham Biosciences). The beads were washed three times in nuclear protein isolation buffer B (20 mM Hepes, pH 7.8, 25% glycerol, 420 mM NaCl, 1 mM PMSF), boiled, and spun down. The supernatants were applied to SDS-PAGE followed by Western blotting. Quantitation of the band signals on film (from three independent experiments) was carried out by Gel-Pro analyzer version 3.1 (Media Cybernetics).

In Vitro O-GlcNAcase Assay—PC12 cells were collected in 50 mM Tris-HCl, pH 7.5, containing 150 mM NaCl, 10% glycerol, 2 mM EDTA, 1 mM Na3VO4, and protease inhibitors. After homogenization by using 26-gauge needle, the samples were centrifuged at 20,000 x g for 30 min at 4 °C. The supernatant was collected as O-GlcNAcase-rich cytosols. The cell lysate was incubated first with each chemical (STZ, 2-DG, and glucose) for 30 min at room temperature, and then assay buffer (50 mM sodium cacodylate, pH 6.5, 50 mM N-acetyl galactosamine, 2 mM p- nitrophenyl-N-acetyl-D-glucosaminide) was added and incubated for 1 h at 37 °C. At the end of the incubation, the reaction was stopped by the addition of 0.5 M sodium carbonate. Color development was measured spectophotometrically at 400 nm. To compare O-GlcNAcase activity levels in 2-DG or mock-treated HeLa cells, the cells were lysed in 1/10 volume of the buffer, and 40-µg protein samples were applied to the assay as described above.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Repression of HPV Early Gene Expression by 2-DG Treatment, Hypoxia, or Low Glucose Stress in Cervical Carcinoma Cells—Previously, 2-DG treatment was reported to down-regulate HPV early gene expression in HPV18-positive HeLa cells (33). The results of RT-PCR and Western blotting showed that 45 mM 2-DG caused a marked reduction in the levels of HPV16 E6/E7 transcripts and proteins in HPV16-positive CaSki cells as well (Fig. 1, A and B). This suggests that 2-DG acts through modulation on a common factor that plays a critical role in activation of URR of a variety of HPV types. Fig. 1 also shows that HPV gene expression in HeLa cells is down-regulated by hypoxia or low glucose supply (1 mM) as well (Fig. 1, C and D), suggesting that HPV transcription may be modulated by the cellular energy or glucose level. During a 24-h incubation period, approximately one-fourth of cells in the culture treated with 2-DG or low glucose underwent either apoptotic or necrotic death, and the remaining cells were viable but growth-arrested. Meanwhile, hypoxic cells remained growth-arrested during first 24 h but underwent extensive apoptosis afterward (data not shown).



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 1.
Effect of 2-DG treatment on the level of HPV early gene transcription in cervical cancer cells. A, CaSki and HeLa cells were incubated in normal DMEM (lanes 1 and 3) or in the medium containing 45 mM 2-DG (lanes 2 and 4) for 20 h. RNA was isolated and applied to RT-PCR for HPV18 (HeLa) or HPV16 (CaSki) E6. B, HeLa and CaSki cells were incubated as in A. The cells were lysed in RIPA buffer, and equal amounts of protein were applied to Western blotting for E7 proteins. C and D, HeLa cells were incubated in the presence of 45 mM 2-DG (lane 2, C and D) or in hypoxic conditions (lane 3, C), or in medium containing 1 mM glucose (lane 3, D) for 20 h. RNA was isolated and applied to RT-PCR for HPV18 E6. RT-PCR using {beta}-actin primers was applied in parallel as control. lowGlc, low glucose.

 
Effect of Inhibition in ATP Generation on HPV Early Gene Expression—In 2-DG-treated cells, the ATP level is severely reduced (33). Whether the reduced ATP level exerts an inhibitory effect on HPV URR was determined by testing whether a direct inhibition of ATP generation down-regulates HPV UPP. HeLa cells were treated with a complex II inhibitor, thenoyltrifluoroacetone (TTFA; 100 µM) (5), or a cytochrome c oxidase inhibitor, sodium azide (NaN3; 1 mM) (36). TTFA treatment caused a 30% reduction of cellular ATP level (Fig. 2B). 2-DG treatment also caused a 33% reduction. Despite this similar degree of repression in ATP levels, there was no significant reduction in HPV E7 protein level in TTFA-treated cells, whereas it was almost extinct in 2-DG-treated cells (Fig. 2A, lane 4 versus lane 2), and in NaN3-treated cells, where cellular ATP synthesis was almost abolished (7.3% of untreated cells), the HPV E7 level was reduced but still maintained by nearly 40% of that in untreated cells (lane 3). (This is a significantly high level considering a global decrease in cellular protein levels upon NaN3 treatment.) These results suggest that a decrease in ATP synthesis may cause some reduction in HPV gene transcription, but its effect is only marginal. This was confirmed by an RT-PCR experiment, in which the HPV E6 mRNA level in TTFA-treated cells was only moderately reduced (data not shown). Therefore, the effect of 2-DG on HPV gene expression may in a small part be attributed to a low ATP level but for the most part originates from mechanisms not related to ATP status.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 2.
Effect of reduced ATP synthesis on the level of HPV gene expression. A, HeLa cells were incubated in medium containing 0 (lane 1), 45 mM 2-DG (lane 2), 1 mM NaN3 (lane 3), and 0.1 mM TTFA (lane 4) for 20 h. The cells were collected and applied to Western blotting for HPV18 E7. Erk-1/2 protein bands served as a loading control. B, 2 x 105 HeLa cells were treated as in A and lysed to measure cellular ATP content. The values of luminescence measured from three independently treated samples were averaged and listed in the second row. In the third row, relative luminescence compared with that of cells treated with vehicle only was expressed as a relative ATP level. a denotes that these values are not statistically different from each other through one-way analysis of variance test.

 
Effect of 2-DG on p21 WAF1 Promoter Activity—2-DG-induced inhibition of E6/E7 expression caused up-regulation of p53 (Ref. 32 and Fig. 3, A and B). This is most likely through increased stability of p53 resulting from depletion of E6 protein, which induces ubiquitin-mediated proteolysis of p53 (37). Meanwhile, the level of E2F1 protein and its activity as determined by c-Myc expression level were reduced upon 2-DG treatment (Fig. 3A), most likely because of the depletion of E7, which has been shown to activate E2F1 either directly (38) or through inactivation of Rb (39). Therefore, the status of these factors is as expected in HeLa cells where E6/E7 proteins were depleted. Similar changes have been induced in HeLa cells where E6/E7 genes were repressed by the expression of BPV E2, which blocks transcription of HPV early promoter (Refs. 40 and 41 and Fig. 3C). Depletion of E6 and E7 in HeLa cells transduced with BPV E2 lead to an increase in the steady state level of p53 followed by an induction of p21 WAF1, a p53 response gene (Fig. 3C, lane 2). In contrast, the p21 WAF1 was not induced in 2-DG-treated cells (Fig. 3, A and B). This is not because p53 is transcriptionally inactive because MDM2 and Bax1, other p53 response genes, were up-regulated in parallel to the increase of p53 level (Fig. 3B). These results suggest that certain element(s) present in the upstream of p21 WAF1 gene is not properly responding to p53. This assumption was further supported by the results in Fig. 3 (D and E). Treatment of sodium butyrate, an inhibitor of histone deacetylase (42), induces p21 WAF1 independently of p53 (43). This indeed is the case in HeLa cells as shown in Fig. 3D (lane 3), but treatment of cells with 2-DG reduced this effect of butyrate (lane 4). Therefore, 2-DG represses a p21 WAF1 promoter activity that is independent of p53. In a separate experiment, doxorubicin treatment of H460 cells, a lung carcinoma line with a wild-type p53, induced p53 and accordingly p21 WAF1 (Fig. 3E, lane 3). However, 2-DG treatment abolished the effect of p53 on p21 WAF1 expression without affecting the level of p53 (lane 4). Therefore, 2-DG represses p53-dependent p21 WAF1 promoter activity as well. Overall, these results suggest that a transcription factor that functions either by itself or in cooperation with p53 in activation of p21 WAF1 promoter is affected by 2-DG treatment.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 3.
Effect of 2-DG treatment on the p21 WAF1 induction by p53. A and B, HeLa cells were incubated in the presence of 45 mM 2-DG for indicated period of time and lysed in RIPA buffer. Equal amounts of protein were applied to Western analysis for p53, p21, c-Myc, and E2F1 (A) and MDM2 and Bax1 (B) proteins. C, HeLa cells were infected with a recombinant virus that expresses BPV E2 (72). Two days after virus infection, BPV E2 expression was detected by RT-PCR, and the status of HPV18 E7, p53, and p21 WAF1 was detected by Western blotting. D, HeLa cells were incubated in plain DMEM (lane 1), in medium containing 45 mM 2-DG (lane 2), 5 mM butyrate (lane 3), or 45 mM 2-DG with 5 mM butyrate (lane 4) for 24 h. The cell extracts were applied to Western blot analysis for p53 and p21 WAF1. E, H460 cells were incubated in plain DMEM (lane 1), in medium containing 45 mM 2-DG (lane 2), 2 µM doxorubicin (lane 3), or 45 mM 2-DG with 2 µM doxorubicin (lane 4) for 12 h. The cells were collected, and equal amounts of protein were applied to Western analysis for p53 and p21 WAF1.

 
Sp1 Activity Is Repressed by 2-DG Treatment—In addition to p53, Sp1 plays a critical role in activation of p21 WAF1 promoter (44). In fact, the effect of sodium butyrate on p21 WAF1 transcription is through modulation of the availability of Sp1 to its binding sites within the proximal region of the promoter (43). Furthermore, there are sequence elements in the promoter proximal region of HPV URR that bind with Sp1 and regulate HPV early gene transcription in Sp1-dependent manner (45, 46). We tested whether Sp1 and the Sp1 sites in p21 WAF1 upstream respond to 2-DG by transfecting HeLa cells with a reporter construct derived from the upstream region of the p21 WAF1 promoter. The plasmid lacks a distal region of p21 WAF1 upstream that contains p53-binding sites but has the proximal region that contains six putative Sp1 sites (Fig. 4A). As predicted, butyrate caused a strong activation of this promoter (Fig. 4B). However, treatment of 2-DG almost abolished the butyrate-mediated increase in the reporter activity (Fig. 4B). This confirms the previous Western blotting results demonstrating that Sp1 activity on p21 WAF1 transcription is affected by 2-DG treatment.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 4.
Inhibition by 2-DG of butyrate-mediated activation of p21 WAF1 promoter. A, schematic representation of p21 WAF1 promoter reporter construct, pGL2-0.3. pGL2-0.3 has only a proximal 300-bp p21 WAF1 upstream that contains six putative Sp1-binding sites. B, HeLa cells were transfected with pGL2-0.3. 24 h post-transfection, the cells were treated with 45 mM 2-DG, 5 mM butyrate, or 45 mM 2-DG with 5 mM butyrate for another 24 h. The cells were lysed, and the extracts were applied to luciferase (Luc) assay.

 
Effect of 2-DG, Low Glucose, and Hypoxia on DNA Binding Activity of Sp1—To determine whether Sp1 activity is indeed attenuated in the cells treated with 2-DG and to find the underlying reasons, the specific DNA binding activity of Sp1 was tested by electrophoretic mobility shift assay using 20-mer double-stranded oligonucleotides that contain Sp1-binding sequences in HPV 18 URR. As shown in Fig. 5, nuclear extract from untreated HeLa cells had an activity that specifically interacted with the probe DNA (lanes 1-3). Incubation of cells in hypoxic conditions nearly abolished the DNA binding activity of Sp1 (lanes 8), suggesting that hypoxia-induced down-regulation of HPV gene expression as shown in Fig. 1C is through the loss of DNA binding activity of Sp1. Incubation of cells in low glucose conditions (1 mM) caused a moderate reduction in DNA binding activity (lane 7). In contrast, 2-DG had no apparent effect on the DNA binding of Sp1 (lanes 4 and 6). Therefore, different from low glucose and hypoxia, 2-DG does not affect the DNA binding activity of Sp1.



View larger version (65K):
[in this window]
[in a new window]
  		FIG. 5.
Effects of glucose regulated stresses on DNA binding activity of Sp1. HeLa cells were either treated with 45 mM 2-DG (lanes 4 and 6) or incubated in the presence of 1 mM glucose (hypoG, lane 7) or in hypoxic conditions (hypox, lane 8) for 24 h. The nuclear extracts were applied to electrophoretic mobility shift assay. The 32P-radiolabeled probe contains nucleotides composing the Sp1-binding element on HPV18 URR. To confirm specific binding, 300-fold higher amount of unlabeled probe was added (lane 2). Sp1-specific shift (top band) was demonstrated through a supershift of DNA band by anti-Sp1 antibody (lane 3).

 
Effect of 2-DG, Low Glucose, and Hypoxia on O-linked Glycosylation of Sp1—Sp1 is one of the nuclear proteins that are glycosylated at serine/threonine residues with N-acetylglucosamine (O-GlcNAcylation) (47). It has been suggested that Sp1 activity is regulated by a fine balance between O-GlcNAcylation and phosphorylation at overlapping residues especially at the N terminus (48). Therefore, we assumed that 2-DG might attenuate Sp1 activity by inducing hypo-GlcNAcylation through inhibition of UDP-GlcNAc synthesis and supply. To determine whether this is the case, the O-GlcNAcylation status of Sp1 was examined by using RL2, an antibody that recognizes O-GlcNAc moiety linked to serine residues (49). After treatment of 2-DG, nuclear Sp1 proteins were immunoprecipitated and subjected to Western blotting for RL2 or Sp1 (Fig. 6A). The Sp1 protein level itself was not significantly affected by 2-DG treatment. However, to our surprise, Sp1 O-GlcNAcylation was dramatically increased in 2 h after 2-DG treatment (4.2-fold), peaked at 4 h post-treatment (5.7-fold), and was maintained over 24 h (Fig. 6D). In this time course study, a decrease in E7 protein level was detected immediately following the increase of Sp1 O-GlcNAcylation (from 2 to 4 h). Meanwhile, O-GlcNAcylation status of Sp1 in cells incubated in hypoxic condition remained rather constant (Fig. 6B). Interestingly, levels of E7 decreased at later time points, being prominent only after 16 h in incubation at hypoxic conditions, clearly demonstrating a difference in kinetics between the effects exerted by 2-DG and hypoxic treatments. In cells incubated in low glucose medium, both O-GlcNAcylation status and the steady state level of Sp1 protein slowly decreased, possibly because of a slow decrease in the cellular glucose level (Fig. 6, C and D). These decreases in both the O-GlcNAcylation level and the steady state level of Sp1 reflect the previous finding that reduced O-GlcNAcylation causes proteosome-mediated degradation of Sp1 protein in glucose-starved cells (50).



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 6.
Effects of glucose regulated stresses on O-GlcNAcylation of Sp1. HeLa cells were treated with 2-DG (A), hypoxic conditions (B), or 1 mM glucose (C) for indicated period of time. Nuclear extracts were made and immunoprecipitated (IP) with {alpha}-Sp1 antibody. The immunoprecipitates were applied to Western blotting (WB) analysis for O-GlcNAc level (RL2) or Sp1 level ({alpha}-Sp1). Whole cell extracts were directly applied to Western blotting using anti-Sp1 or anti-HPV18 E7 antibody. Sp1 in 2-DG-treated HeLa cells were highly O-GlcNAcylated from 2 h after 2-DG treatment, although the total SP1 level did not change. D, Sp1 O-GlcNAcylation bands and Sp1 immunoprecipitated bands in A-C were densitometrically quantitated. The values of the O-GlcNAcylation bands were normalized by those of the Sp1 bands at each time point, and the relative numbers to the ones from untreated cells are expressed as black bars. The gray bars represent non-normalized O-GlcNAcylation intensities. In the case of low glucose treatment, both O-GlcNAcylation and the steady state level of SP1 protein decreased during the time course period.

 
Inhibitory Effect of 2-DG on O-GlcNAcase—The finding that 2-DG causes an increase in O-GlcNAcylation level in Sp1 protein is rather unexpected. Furthermore, as shown in Fig. 7A, the O-GlcNAcylation level of proteins in whole extracts of the 2-DG-treated PC12 cells was significantly increased although not quite high as that in cells treated with STZ, a potent inhibitor for O-GlcNAcase (51). O-GlcNAcase is responsible for removal of GlcNAc from O-GlcNAcylated proteins (52, 53). Either stimulation of O-GlcNAcylation or attenuation of de-GlcNAcylation would result in an increased steady state level of O-GlcNAcylated Sp1. The similar outcomes of the 2-DG and STZ treatments prompted us to determine whether 2-DG, too, has an inhibitor activity on O-GlcNAcase. This was determined in an in vitro O-GlcNAcase assay (Fig. 7B). The cell lysates were preincubated with either STZ or 2-DG for 30 min before an artificial substrate p-nitrophenyl N-acetyl-{beta}-D-glucosamine was added. The effect on the O-GlcNAcase was determined by measuring the degree of GlcNAc removal through a colorimetric method. 50 mM 2-DG caused a reduction in the enzyme activity by ~40%, and 100 mM 2-DG caused a 60% decrease in activity. This demonstrates that 2-DG indeed has an inhibitory effect on O-GlcNAcase, albeit one less potent than STZ. In addition, the relative effectiveness of 2-DG as an O-GlcNAcase inhibitor and the relative effectiveness of 2-DG as a protein O-GlcNAcylation stimulator shown in Fig. 7A are quite similar to each other, indicating that the increase in protein O-GlcNAcylation by 2-DG treatment is in large part due to its inhibition on O-GlcNAcase activity. Importantly, this suggests that the hyper-GlcNAcylated state of Sp1 in the 2-DG-treated cells can be at least in part explained by the inhibition of deGlcNAcylation by 2-DG.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 7.
A, effects of streptozotocin and 2-DG on O-GlcNAcylation level of total cellular proteins. PC12 cells were treated with either streptozotocin at 5 (lane 2) or 10 mM (lane 3) or 2-DG at 10 (lane 4), 20 (lane 5), or 50 mM (lane 6) for 6 h and lysed. 30 µg of total cellular proteins were applied to Western blotting using RL2. A film exposed for a longer time showed more protein bands whose intensities also increased along with higher dose of the chemicals (not shown). B, inhibition of O-GlcNAcase activity by STZ or 2-DG in vitro. 40 µg of PC12 cell cytosol extract was incubated with 5 (bar 2) or 10 (bar 3) streptozotocin; 20 (bar 4), 50 (bar 5), or 100 mM (bar 6) 2-DG; or glucose (bars 7-9) for 30 min at room temperature and applied to O-GlcNAcase reaction using 2 mM p-nitrophenyl-N-acetyl-D-glucosaminide as a substrate for 1 h. The results are expressed as the means ± S.E. from two independent experiments, each performed in duplicate. The relative O-GlcNAcase activities were as follows: 53% in 5 mM STZ; 31% in 10 mM STZ; 82% in 20 mM 2-DG; 61% in 50 mM 2-DG; 43% in 100 mM 2-DG; 91% in 20 mM glucose; 81% in 50 mM glucose; 71% in 100 mM glucose. con, control.

 
Effect of STZ on the Status of Sp1 O-GlcNAcylation and Activity—Another important question raised is whether this O-GlcNAcylation of Sp1 is indeed responsible for the decrease of Sp1 activity and transcription of HPV early gene and p21 WAF1. It has been reported that O-GlcNAcylation of the Sp1 activation domain down-regulates its transcriptional activity (54). Along with our previous results, this suggests that the down-regulation of HPV URR and p21 WAF1 promoter in 2-DG-treated cells might be attributed to Sp1 hyperglycosylation. Based on the finding that STZ treatment, like 2-DG, causes protein hyper-GlcNAcylation (Fig. 7A), we attempted to check whether Sp1 is hyper-GlcNAcyated in the presence of STZ and whether its transcriptional activity is affected by STZ treatment. Therefore, HeLa cells were incubated in the presence of 10 mM STZ, and its effects on Sp1 O-GlcNAcylation, p21 WAF1 promoter activity, and HPV E7 expression were determined. As expected, STZ treatment caused an increase in the level of Sp1 O-GlcNAcylation without affecting the steady state level of the protein (Fig. 8A), and the extent of O-GlcNAcylation is quite similar to that caused by 2-DG (lane 2 versus lanes 3 and 4). Furthermore, E7 expression and p53-mediated expression of p21 WAF1 were both down-regulated by STZ treatment as well (Fig. 8A). Treatment of H460 cells with STZ caused an increase in p53 protein level and a slight increase of p21 WAF1 (Fig. 8B, lane 3), whereas 2-DG treatment did not (lane 2). However, STZ suppressed the p53-mediated activation of p21 WAF1 promoter in the cells treated with doxorubicin (lane 6), as did 2-DG (lane 5). Overall, these results suggest that STZ causes Sp1 hyper-GlcNAcylation and thereby represses its activity. The quite similar outcomes of the 2-DG and STZ treatments, i.e. hyper-GlcNAcylation of Sp1 and down-regulation of the promoters that is dependent on Sp1, strongly indicate that 2-DG and STZ both inhibit Sp1 activity by causing its hyper-GlcNAcylation.



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 8.
A, effect of streptozotocin on Sp1 O-GlcNAcylation and HPV gene expression and p53 and p21 WAF1 status. HeLa cells were incubated in medium containing either 45 mM 2-DG (lane 2), or streptozotocin at 5 mM (lane 3) or 10 mM (lane 4) for 24 h. The nuclear extracts were made, immunoprecipitated (IP) with {alpha}-Sp1 antibody, and then applied to Western blotting (WB) analysis for O-GlcNAc level (RL2) or Sp1 level ({alpha}-Sp1). Whole cell extracts were directly applied to Western blotting using anti-HPV18 E7, anti-p53, or anti-p21 WAF1 antibody. B, H460 cells were treated with either 45 mM 2-DG (lanes 2 and 5) or 10 mM STZ (lanes 3 and 6) in the presence (lanes 4-6) or absence (lanes 1-3) of 2 µM doxorubicin for 12 h. The cells were lysed, and equal amount of proteins were applied to Western blotting analysis for p53 and p21 WAF1. STZ by itself increased the p53 level and also caused a slight increase in p21 WAF1 (lane 3).

 
Effect of 2-DG on Sp1 Phosphorylation Status in Vivo—It has been suggested that O-GlcNAcylation and phosphorylation occur on identical serine/threonine residues in certain proteins known to be O-GlcNAcylated (55, 56), and in Sp1, O-GlcNAcylation and phosphorylation have opposite effects on its activity (48). Whether Sp1 hyper-GlcNAcylation in the cells treated with 2-DG is accompanied by its hypophosphorylation was determined using an antibody that recognizes phosphorylated threonine residues. (Phosphorylation status at serine residues could not be determined because no antibody specific for phosphorylated serine worked in Western blotting.) As shown in Fig. 9, the level of Sp1 phosphorylation at threonine residues decreased as its O-GlcNAcylation level increased, and these two changes appeared quite reciprocal. This and the previous results suggest that, first, Sp1 proteins in the 2-DG-treated cells are in hyper-GlcNAcylated state, and second, this high O-GlcNAc level functionally blocks phosphorylation of Sp1. Furthermore, our results strongly support the notion that Sp1 is in inactive state because of hyper-GlcNAcylation in cells treated with 2-DG.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 9.
Effect of 2-DG on Sp1 phosphorylation. HeLa cells were treated with 45 mM 2-DG for indicated period of time. Nuclear extracts were made, and an equal amount of proteins was immunoprecipitated with anti-Sp1 antibody. The immunoprecipitates were applied to Western blotting analysis for phosphothreonine (p-Thr), O-GlcNAc level (O-GlcNAc), or Sp1 protein using an antibody against phosphothreonine, RL2, and anti-Sp1 antibody, respectively.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Our results indicate that 2-DG causes repression of certain promoters by inducing hyper-O-GlcNAcylation of Sp1. Because Sp1 is a ubiquitous transcription factor regulating TATA-less housekeeping genes, a variety of cellular genes are expected to be affected by 2-DG. The 2-DG-induced blocks to glycolysis and energy depletion appear to be minimally involved in this transcriptional dysfunction. Incubation of cells in low glucose or hypoxic condition also affects the activity of Sp1 (this study and Ref. 57). Thus, when 2-DG or low glucose treatment to cells or animals is applied as a mimetic of cellular energy deprivation, glycolysis block, or an unfolded protein response, the effect on Sp1 activity should be considered. Our results also demonstrate that the p21 WAF1 promoter activity is modulated by Sp1 O-GlcNAcylation. Previous DNA transfection experiments using the Sp1-less Drosophila cell line SL2, reported a severe reduction in constitutive and p53-inducible p21 promoter activity by the mutations in the Sp1 binding site (58), a result suggesting that Sp1 must play crucial roles in the activity of p53 on the p21 WAF1 promoter. Our results show, in a more appropriate cellular context, that attenuation of Sp1 activity causes a severe reduction in p53-inducible p21 WAF1 promoter activity.

Although both 2-DG and low glucose cause down-regulation of Sp1 activity, they modulate Sp1 through different mechanisms. 2-DG treatment down-regulates Sp1 activity without alleviating its DNA binding activity, whereas low glucose causes attenuation of DNA binding activity of Sp1 (this study and Ref. 56). This difference may originate from the fact that 2-DG treatment causes hyper-GlcNAcylation of Sp1, whereas low glucose treatment causes its hypo-GlcNAcylation. Both hyper- and hypo-GlcNAcylation impair the activity of Sp1, but by different mechanisms. Using peptides for Sp1 activation domain, Kudlow and co-workers (54, 59) proposed that O-GlcNAcylation of Sp1 activation domain blocks its homomultimerization or interactions with TAFII130 and thereby interferes with Sp1-driven transcription. Sp1 contains at least 9 serine and threonine sites that are O-GlcNAcylated (47), and the activation domain spans two serine/threonine-rich domains (60). Although the location of the O-GlcNAcylation in Sp1 molecules in cells treated with 2-DG was not determined, O-GlcNAcylation is likely to occur at the sites in the activation domain, resulting in Sp1 inactivation. Meanwhile, under low glucose conditions, Sp1 is affected in two different ways. First, Sp1 was reported to be in hyperphosphorylated state in cells under glucose starvation (61), and hyperphosphorylated Sp1 was shown to have a defect in DNA binding (62). Second, hypo-GlcNAcylated Sp1 was shown to undergo rapid proteolysis mediated by a 20 S proteosome system (50).

Why is Sp1 hyper-GlcNAcylated in the presence of 2-DG? One plausible model is that Sp1 deGlcNAcylation (removal of GlcNAc residues from protein) is inhibited by 2-DG. This possibility is strongly supported by our finding that 2-DG inhibits O-GlcNAcase in vitro (Fig. 7B). Actually, not only Sp1, but also overall protein O-GlcNAcylation increased in cells treated with 2-DG as well as those treated with STZ (Fig. 7A). This inhibitory effect of 2-DG would shift the equilibrium in favor of O-GlcNAcylation of cellular target proteins and therefore contribute to an increase of Sp1 O-GlcNAcylation.

However, the O-GlcNAcase inhibitory effect of 2-DG appeared not very high, although in vitro activity may not be reflected in vivo, and the quite dramatic increase in O-GlcNAcylations in cells suggests that some additional mechanisms may also be working. Sp1 hyperglycosylation could be caused by the activation of the hexosamine synthesis pathway through an increased cellular pool of glucose caused by a block in glycolysis. The large quantity of unused glucose may be converted through the hexosamine synthesis pathway to GlcNAc and further to UDP-GlcNAc (63). As a consequence of high substrate supply, hyperglycosylation might have occurred. However, the possibility of hexosamine synthesis pathway activation is not strongly supported theoretically or experimentally. First, 2-DG inhibits phosphohexose isomerase (23, 24), which generates fructose 6-phosphate, the precursor of glucosamine 6-phosphate, and therefore GlcNAc production would be inhibited as well in 2-DG-treated cells. Second, supplementation of 20 mM glucosamine did not increase O-GlcNAcylation level of Sp1 in HeLa cells,2 and treatment of 6-diazo-5-oxo-L-norleucine, which blocks the hexosamine pathway by inhibiting glutamine:fructose-6-phosphate aminotransferase (50), had no apparent effect on Sp1 O-GlcNAcylation level in HeLa cells (data not shown), which is in accordance to the previous finding that glucose availability is not a limiting factor for O-GlcNAcylation in HeLa cells (50). Sp1 hyperglycosylation may also be induced through up-regulation of OGT or down-regulation of O-GlcNAcase at the level of gene expression and/or enzyme activity. The results of our RT-PCR experiments, in which the levels of mRNA of both genes did not appear to be altered during the 2-24-h period after 2-DG treatment,2 rule out the possibilities of 2-DG-induced up-regulation of OGT gene or down-regulation of O-GlcNAcase gene expression. Also, the O-GlcNAcase activity in HeLa cell extracts measured in vitro did not decrease upon 2-DG treatment, suggesting that 2-DG does not cause alteration of O-GlcNAcase enzyme status.3 Meanwhile, other possibilities such as direct stimulation of enzyme activities of OGT or other enzymes involved in the production of UDP-GlcNAc by 2-DG have not been examined in this study. Therefore, OGT activity and the UDP-GlcNAc level could be determined and compared to help sort out these possibilities.

So far, PUGNAc (64) and streptozotocin (STZ) (50) are two known inhibitors of O-GlcNAcase enzyme. Based on our study, 2-DG is also an inhibitor of O-GlcNAcase. In addition, in this study, STZ treatment resulted in an increase in the level of Sp1 O-GlcNAcylation to a level comparable with that caused by 2-DG. Down-regulation of HPV early gene transcription occurred as well. Furthermore, both 2-DG and STZ abolished p53-mediated activation of p21 WAF1 promoter. The similar effects of 2-DG and STZ on Sp1 O-GlcNAcylation and transcriptional activity strongly support our hypothesis that the inhibitory effect of 2-DG is through hyper-GlcNAcylation. Our study also showed for the first time that STZ causes inhibition of Sp1 activity again through hyper-GlcNAcylation. Although 2-DG and STZ caused identical changes on Sp1 O-GlcNAcylation and its activity, there may be some differences in their target molecules and action mechanisms. STZ treatment increased p53 protein level in H460 cells, whereas 2-DG did not (Fig. 8B). Currently, we do not know how STZ up-regulates p53. STZ may alter p53 stability either by directly modulating O-GlcNAcylation and phosphorylation or through activating the p53-stimulatory pathway(s). Meanwhile, 2-DG not only inhibits O-GlcNAcase but also is expected to increase the cellular pool of glucose through the block in glycolysis, whereas STZ does not.

Down-regulation of HPV early gene transcription by 2-DG treatment was first observed by Maehama et al. (33). In this study, c-Myc transcription increased upon 2-DG treatment. c-Myc induction was reportedly detected as early as in 2 h after 2-DG treatment. Meanwhile, in our study, the c-Myc protein level decreased gradually in the course of 24 h. Although it is a possibility that c-Myc expression may be induced by an immediate effect of 2-DG or 2-DG-induced [Ca2+] fluctuation (33), our results certainly reflect the cellular event that follows depletion of E7: a decrease of c-Myc transcription that is modulated by E2F1 (65), which is in turn modulated by E7. E7 activates E2F1 gene expression either directly (50) or through inactivation of Rb (51).

Sp1 plays a critical role in the transcription of a number of glycolytic enzymes (55, 66, 67). Thus, it is conceivable that Sp1 and O-GlcNAc function as glucose sensors that link the metabolic activities of a cell to its nutritional condition. Other than HPV, regulatory elements of many viral genome such as SV40 early promoter (68), herpes simplex virus immediate early promoter (69), and human immunodeficiency virus long terminal repeat (70) contain Sp1-binding sequences and are also regulated by Sp1, possibly reflecting that Sp1 is a ubiquitous transcription factor. Why is Sp1 involved in expression of genes essential for virus production? Viruses are obligatory intracellular parasites, and therefore their reproduction is totally dependent on the state of host metabolism. The result of this study provides one example of the possibility that viral replication is governed by the metabolic state of the host, and this is through the transcription factors of the host that senses its nutritional state. HPV E6 and E7 and SV40 T antigen proteins play essential roles in uncontrolled cell proliferation through recruitment of the machinery of the host for S phase entry and inactivation of checkpoint control functions. For the viruses, which depend on the machinery of the host for their own replication, it may be more advantageous if the virus stays dormant when the host cell is in an environment that is not only less supportive for ATP production but also in danger of being induced to apoptosis. Therefore, Sp1 functions as a molecular sensor not only for the host cell but also for the virus in that it enables the virus to adjust its replication potential to the status of the nutrition supply and energy metabolism of the host.

In this study, although not extensively studied, hypoxia also was shown to down-regulate Sp1 activity. Hypoxia has previously been shown to regulate Sp1-dependent promoters by modulation of the DNA binding activity of Sp1 (56). Indeed, a loss of DNA binding activity of Sp1 proteins was observed in cells incubated in hypoxic conditions in our study. In addition, unlike the situation of 2-DG treatment, in cells under hypoxia, Sp1 glycosylation status was not affected, and HPV repression occurred in later time points. Clearly, hypoxia and 2-DG treatment cause down-regulation of Sp1 activity in different mechanisms. A detailed study on hypoxia-mediated Sp1 regulation would greatly help understanding of the mechanism involved in the DNA binding of Sp1.

Overall, the results of our study suggest that, unlike low glucose supply, 2-DG and STZ treatment causes down-regulation of Sp1 activity through hyperglycosylation. In addition, it is also suggested that 2-DG and STZ can be used as an efficient way to enhance protein O-GlcNAcylation. Further clarification of how 2-DG induces hyper-GlcNAcylation of Sp1 will not only help elucidation of how Sp1 activity is regulated but will also enhance the usefulness of this approach and provide another valuable tool in the field of glycobiology and the study of diabetes mellitus.


   FOOTNOTES
 
* This work was supported by Grant R11-2002-001-04001-0 from the Korea Science and Engineering Foundation through the Center for Aging and Apoptosis Research at Seoul National University (to H. T. K. and E. S. H.) and by a grant from Protein Network Research Center (Korea Science and Engineering Foundation) (to J. W. J. and J. W. C.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence may be addressed: Dept. of Biology and Protein Network Research Center, Yonsei University, 134 Sinchondong, Seodaemungu, Seoul 120-749, Korea. E-mail: chojw311{at}yonsei.ac.kr.

|| To whom correspondence may be addressed: Eun Seong Hwang, 90 Jeonnongdong, Dongdaemungu, Seoul 130-743, Korea. E-mail: eshwang{at}uos.ac.kr.

1 The abbreviations used are: OGT, UDP-N-acetylglucosamine:peptide N-acetylglucosaminyl transferase (O-GlcNAc transferase); 2-DG, 2-deoxyglucose; HPV, human papillomavirus; URR, upstream regulatory region; O-GlcNAcase, N-acetyl-{beta}-D-glucosaminidase; STZ, streptozotocin; DMEM, Dulbecco's modified Eagle's medium; PMSF, phenylmethylsulfonyl fluoride; RT, reverse transcription; TTFA, thenoyltrifluoroacetone. Back

2 H. T. Kang, unpublished results. Back

3 J. W. Ju, unpublished results. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Daniel Dimaio (Yale University) and Dr. Innoc Han (Seoul National University, Seoul, Korea) for helpful comments. We also thank Dr. Jae Yong Lee (Hallym University, Chuncheon, Korea) for the p21 WAF1 promoter-reporter constructs, and Dr. In Gyu Kim (Seoul National University, Seoul, Korea) for the HPV E7 antibodies.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sutherland, R. M. (1988) Science 240, 177-184[Abstract/Free Full Text]
  2. Malhotra, R., and Brosius, F. C., III (1999) J. Biol. Chem. 274, 12567-12575[Abstract/Free Full Text]
  3. Li, W., Liu, X., He, Z., Yanoff, M., Jian, B., and Ye, X. (1998) Invest. Ophthalmol. Vis. Sci. 39, 1535-1543[Abstract/Free Full Text]
  4. Bialik, S., Cryns, V. L., Drincic, A., Miyata, S., Wollowick, A. L., Srinivasan, A., and Kitsis, R. N. (1999) Circ. Res. 85, 403-414[Abstract/Free Full Text]
  5. Schulze-Osthoff, K., Beyaert, R., Vandevoorde, V., Haegeman, G., and Fiers, W. (1993) EMBO J. 12, 3095-3104[Medline] [Order article via Infotrieve]
  6. Blackburn, R. V., Spitz, D. R., Liu, X., Galoforo, S. S., Sim, J. E., Ridnour, L. A., Chen, J. C., Davis, B. H., Corry, P. M., and Lee Y. J. (1999) Free. Radic. Biol. Med. 26, 419-430[CrossRef][Medline] [Order article via Infotrieve]
  7. Lee, Y. J., Galoforo, S. S., Berns, C. M., Tong, W. P., Kim, H. R., and Corry, P. M. (1997) J. Cell Sci. 110, 681-686[Abstract]
  8. Goda, N., Ryan, H. E., Khadivi, B., McNulty, W., Rickert, R. C., and Johnson, R. S. (2003) Mol. Cell. Biol. 23, 359-369[Abstract/Free Full Text]
  9. Carmeliet, P., Dor, Y., Herbert, J. M., Fukumura, D., Brusselmans, K., Dewerchin, M., Neeman, M., Bono, F., Abramovitch, R., Maxwell, P., Koch, C. J., Ratcliffe, P., Moons, L., Jain, R. K., Collen, D., Keshert, E., and Keshet, E. (1998) Nature 394, 485-490[CrossRef][Medline] [Order article via Infotrieve]
  10. Lee, Amy. (2001) Trends Biochem. Sci. 26, 504-510[CrossRef][Medline] [Order article via Infotrieve]
  11. Spiro, R. G. (2002) Glycobiology 12, 43-56
  12. Hart, G. W. (1997) Annu. Rev. Biochem. 66, 315-335[CrossRef][Medline] [Order article via Infotrieve]
  13. Van den Steen, P., Rudd, P. M., Dwek, R. A., and Opdenakker, G. (1998) Crit. Rev. Biochem. Mol. Biol., 33, 151-208[Medline] [Order article via Infotrieve]
  14. Haltiwanger, R. S., Blomberg, M. A., and Hart, G. W. (1992) J. Biol. Chem. 267, 9005-9013[Abstract/Free Full Text]
  15. McClain, D. A. (2002) J. Diabet. Complications 16, 72-80
  16. Boehmelt, G., Wakeham, A., Elia, A., Sasaki, T., Plyte, S., Potter, J., Yang, Y., Tsang, E., Ruland, J., Iscove, N. N., Dennis, J. W., and Mak, T. W. (2000) EMBO J. 19, 5092-5104[CrossRef][Medline] [Order article via Infotrieve]
  17. Wells, L., Vosseller, K., and Hart, G. W. (2001) Science 291, 2376-2378[Abstract/Free Full Text]
  18. Munoz-Pinedo, C., Ruiz-Ruiz, C., Ruiz De Almodovar, C., Palacios, C., and Lopez-Rivas, A. (2003) J. Biol. Chem. 278, 12759-12768[Abstract/Free Full Text]
  19. Miller, C. C., Martin, R. J., Whitney, M. L., and Edwards, G. L. (2002) Nutr. Neurosci. 5, 359-362[CrossRef][Medline] [Order article via Infotrieve]
  20. Healy, D. A., Watson, R. W., and Newsholme, P. (2002) Clin. Sci. (Lond.) 103, 179-189[Medline] [Order article via Infotrieve]
  21. Schwoebel, E. D., Ho, T. H., and Moore, M. S. (2002) J. Cell Biol. 157, 963-974[Abstract/Free Full Text]
  22. Merker, M. P., Bongard, R. D., Kettenhofen, N. J., Okamoto, Y., and Dawson, C. A. (2002) Am. J. Physiol. Lung. 282, L36-L43
  23. Sols, A., and Crane, R. K. (1954) J. Biol. Chem. 210, 581-595[Free Full Text]
  24. Tower, D. B. (1958) J. Neurochem. 3, 185-205[Medline] [Order article via Infotrieve]
  25. Little, E., Ramakrishnan, M., Roy, B., Gazit, G., and Lee, A. S. (1994) Crit. Rev. Eukaryotic Gene Expression 4, 1-18[Medline] [Order article via Infotrieve]
  26. Welch, W. J. (1990) Stress Proteins in Biology and Medicine, pp. 223-278, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  27. Kern, K. A., and Norton, J. A. (1987) Surgery 102, 380-385[Medline] [Order article via Infotrieve]
  28. Cay, O., Radnell, M., Jeppsson, B., Ahren, B., and Bengmark, S. (1992) Cancer Res. 52, 5794-5796[Abstract/Free Full Text]
  29. Mese, H., Sasaki, A., Nakayama, S., Yokoyama, S., Sawada, S., Ishikawa, T., and Matsumura, T. (2001) Anticancer Res. 21, 1029-1033[Medline] [Order article via Infotrieve]
  30. Dwarkanath, B. S., Zolzer, F., Chandana, S., Bauch, T., Adhikari, J. S., Muller, W. U., Streffer, C., and Jain, V. (2001) Int. J. Radiat. Oncol. Biol. Phys. 50, 1051-1061[CrossRef][Medline] [Order article via Infotrieve]
  31. Liu, H., Savaraj, N., Priebe, W., and Lampidis, T. J. (2002) Biochem. Pharmacol. 64, 1745-1751[CrossRef][Medline] [Order article via Infotrieve]
  32. Lane, M. A., Ingram, D. K., and Roth, G. S. (1998) J. Anti-aging Med. 1, 327-337
  33. Maehama, T., Patzelt, A., Lengert, M., Hutter, K. J., Kanazawa, K., Hausen, H., and Rosl, F. (1998) Int. J. Cancer. 76, 639-646[CrossRef][Medline] [Order article via Infotrieve]
  34. Ishiji, T. (2000) J. Dermatol. 27, 73-86[Medline] [Order article via Infotrieve]
  35. Jeon, J. H., Cho, S. Y., Kim, C. W., Shin, D. M., Kwon, J. C., Choi, K. H., and Kim, I. G. (2002) Exp. Mol. Med. 34, 496-499[Medline] [Order article via Infotrieve]
  36. Dawson, T. L., Gores, G. J., Nieminen, A.-L., Herman, B., and Lemasters, J. J. (1993) Am. J. Physiol. 264, C961-C967[Medline] [Order article via Infotrieve]
  37. Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J., and Howley, P. M. (1990) Cell 63, 1129-1136[CrossRef][Medline] [Order article via Infotrieve]
  38. Hwang, S. G., Lee, D., Kim, J., Seo, T., and Choe, J. (2002) J. Biol. Chem. 277, 2923-2930[Abstract/Free Full Text]
  39. Boyer, S. N., Wazer, D. E., and Band, V. (1996) Cancer Res. 56, 4620-4624[Abstract/Free Full Text]
  40. Hwang, E. S., Riese, D., Settleman, J., Nilson, L. A., Honig, J., Flynn, S., and DiMaio, D. (1993) J. Virol. 67, 3720-3729[Abstract/Free Full Text]
  41. Hwang, E. S., Naeger, L. K., and DiMaio, D. (1996) Oncogene 12, 795-803[Medline] [Order article via Infotrieve]
  42. Schlake, T., Klehr-Wirth, D., Yoshida, M., Beppu, T., and Bode, J. (1994) Biochemistry 33, 4197-4206[CrossRef][Medline] [Order article via Infotrieve]
  43. Nakano, K., Mizuno, T., Sowa, Y., Orita, T., Yoshino, T., Okuyama, Y., Fujita, T., Ohtani-Fujita, N., Matsukawa, Y., Tokino, T., Yamagishi, H., Oka, T., Nomura, H., and Sakai, T. (1997) J. Biol. Chem. 272, 22199-22206[Abstract/Free Full Text]
  44. Biggs, J. R., Kudlow, J. E., and Kraft, A. S. (1996) J. Biol. Chem. 271, 901-906[Abstract/Free Full Text]
  45. Gloss, B., and Bernard, H. U. (1990) J. Virol. 64, 5577-5584[Abstract/Free Full Text]
  46. Hoppe-Seyler, F., and Butz, K. (1993) J. Gen. Virol. 74, 281-286[Abstract/Free Full Text]
  47. Jackson, S. P., and Tjian, R. (1988) Cell 55, 125-133[Medline] [Order article via Infotrieve]
  48. Bouwman, P., and Philipsen, S. (2002) Mol. Cell. Endocrinol. 195, 27-38[CrossRef][Medline] [Order article via Infotrieve]
  49. Snow, C. M., Senior, A., and Gerace, L. (1987) J. Cell Biol. 104, 1143-1156[Abstract/Free Full Text]
  50. Han, I., and Kudlow, J. E. (1997) Mol. Cell. Biol. 17, 2550-2558[Abstract]
  51. Hanover, J. A., Lai, Z., Lee, G., Lubas, W., and Sato, S. M. (1999) Arch. Biochem. Bophys. 362, 38-45
  52. Dong, D. L., and Hart, G. W. (1994) J. Biol. Chem. 269, 19321-19330[Abstract/Free Full Text]
  53. Gao, Y., Wells, L., Comer, F. I., Parker, G. J., and Hart, G. W. (2001) J. Biol. Chem. 276, 9838-9845[Abstract/Free Full Text]
  54. Yang, X., Su, K., Roos, M. D., Chang, Q., Paterson, A. J., and Kudlow, J. E. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 6611-6616[Abstract/Free Full Text]
  55. Griffith, L. S., and Schmitz, B. (1999) Eur. J. Biochem. 262, 824-831[Medline] [Order article via Infotrieve]
  56. Comer, F. I., and Hart, G. W. (2000) J. Biol. Chem. 275, 29179-29182[Free Full Text]
  57. Discher, D. J., Bishopric, N. H., Wu, X., Peterson, C. A., and Webster, K. A. (1998) J. Biol. Chem. 273, 26087-26093[Abstract/Free Full Text]
  58. Koutsodontis, G., Tentes, I., Papakosta, P., Moustakas, A., and Kardassis, D. (2001) J. Biol. Chem. 276, 29116-29125[Abstract/Free Full Text]
  59. Roos, M. D., Xie, W., Su, K., Clark, J. A., Yang, X., Chin, E., Paterson, A. J., and Kudlow, J. E. (1998) Proc. Assoc. Am. Physicians 110, 422-432[Medline] [Order article via Infotrieve]
  60. Kadonaga, J. T., Courey, A. J., Ladika, J., and Tjian, R. (1988) Science 242, 1566-1570[Abstract/Free Full Text]
  61. Schafer, D., Hamm-Kunzelmann, B., and Brand, K. (1997) FEBS Lett. 417, 325-328[CrossRef][Medline] [Order article via Infotrieve]
  62. Jackson, S. P., MacDonald, J. J., Lees-Miller, S., and Tjian, R. (1990) Cell 63, 155-165[CrossRef][Medline] [Order article via Infotrieve]
  63. Hawkins, M., Barzilai, N., Liu, R., Hu, M., Chen, W., and Rossetti, L. (1997) J. Clin. Invest. 99, 2173-2182[Medline] [Order article via Infotrieve]
  64. Haltiwanger, R. S., Grove, K., and Philipsberg, G. A. (1998) J. Biol. Chem. 273, 3611-3617[Abstract/Free Full Text]
  65. Moberg, K. H., Logan, T. J., Tyndall, W. A., and Hall, D. J. (1992) Oncogene 7, 411-421[Medline] [Order article via Infotrieve]
  66. Hermfisse, U., Schafer, D., Netzker, R., and Brand, K. (1996) Biochem. Biophys. Res. Commun. 225, 997-1005[CrossRef][Medline] [Order article via Infotrieve]
  67. Netzker, R., Weigert, C., and Brand, K. (1997) Eur. J. Biochem. 245, 174-181[Medline] [Order article via Infotrieve]
  68. Dynan, W. S., Saffer, J. D., Lee, W. S., and Tjian, R. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 4915-4919[Abstract/Free Full Text]
  69. Jones, K. A., and Tjian, R. (1985) Nature 317, 179-182[CrossRef][Medline] [Order article via Infotrieve]
  70. Bargonetti, J., Chicas, A., White, D., and Prives, C. (1997) Cell. Mol. Biol. 43, 935-949[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
H. S. Kim and I. K. Lim
Phosphorylated Extracellular Signal-regulated Protein Kinases 1 and 2 Phosphorylate Sp1 on Serine 59 and Regulate Cellular Senescence via Transcription of p21Sdi1/Cip1/Waf1
J. Biol. Chem., June 5, 2009; 284(23): 15475 - 15486.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
R. Jochmann, M. Thurau, S. Jung, C. Hofmann, E. Naschberger, E. Kremmer, T. Harrer, M. Miller, N. Schaft, and M. Sturzl
O-Linked N-Acetylglucosaminylation of Sp1 Inhibits the Human Immunodeficiency Virus Type 1 Promoter
J. Virol., April 15, 2009; 83(8): 3704 - 3718.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
T. Okuda and K.-i. Nakayama
Identification and characterization of the human Gb3/CD77 synthase gene promoter
Glycobiology, December 1, 2008; 18(12): 1028 - 1035.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
W. H. Yang, S. Y. Park, H. W. Nam, D. H. Kim, J. G. Kang, E. S. Kang, Y. S. Kim, H. C. Lee, K. S. Kim, and J. W. Cho
NF{kappa}B activation is associated with its O-GlcNAcylation state under hyperglycemic conditions
PNAS, November 11, 2008; 105(45): 17345 - 17350.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
V. Egler, S. Korur, M. Failly, J.-L. Boulay, R. Imber, M. M. Lino, and A. Merlo
Histone Deacetylase Inhibition and Blockade of the Glycolytic Pathway Synergistically Induce Glioblastoma Cell Death
Clin. Cancer Res., May 15, 2008; 14(10): 3132 - 3140.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. J. Aiken, J. S. Bickford, M. S. Kilberg, and H. S. Nick
Metabolic Regulation of Manganese Superoxide Dismutase Expression via Essential Amino Acid Deprivation
J. Biol. Chem., April 18, 2008; 283(16): 10252 - 10263.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
D. Y. C. Wu, R. Wu, Y. Chen, N. Tarasova, and M. M. J. Chang
PMA Stimulates MUC5B Gene Expression through an Sp1-Based Mechanism in Airway Epithelial Cells
Am. J. Respir. Cell Mol. Biol., November 1, 2007; 37(5): 589 - 597.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Yao, T. Taguchi, T. Matsumura, R. Pestell, D. Edelstein, I. Giardino, G. Suske, N. Rabbani, P. J. Thornalley, V. P. Sarthy, et al.
High Glucose Increases Angiopoietin-2 Transcription in Microvascular Endothelial Cells through Methylglyoxal Modification of mSin3A
J. Biol. Chem., October 19, 2007; 282(42): 31038 - 31045.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
M J Moreno-Aliaga, M M Swarbrick, S Lorente-Cebrian, K L Stanhope, P J Havel, and J A Martinez
Sp1-mediated transcription is involved in the induction of leptin by insulin-stimulated glucose metabolism
J. Mol. Endocrinol., May 1, 2007; 38(5): 537 - 546.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
N. Vij and P. L. Zeitlin
Regulation of the ClC-2 Lung Epithelial Chloride Channel by Glycosylation of SP1
Am. J. Respir. Cell Mol. Biol., June 1, 2006; 34(6): 754 - 759.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J.-J. Hung, C.-Y. Wu, P.-C. Liao, and W.-C. Chang
Hsp90{alpha} Recruited by Sp1 Is Important for Transcription of 12(S)-Lipoxygenase in A431 Cells
J. Biol. Chem., October 28, 2005; 280(43): 36283 - 36292.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
J. Ye, D. Shedd, and G. Miller
An Sp1 Response Element in the Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50 Promoter Mediates Lytic Cycle Induction by Butyrate
J. Virol., February 1, 2005; 79(3): 1397 - 1408.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Parker, R. Taylor, D. Jones, and D. McClain
Hyperglycemia and Inhibition of Glycogen Synthase in Streptozotocin-treated Mice: ROLE OF O-LINKED N-ACETYLGLUCOSAMINE
J. Biol. Chem., May 14, 2004; 279(20): 20636 - 20642.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Y. Mizukami, J. Li, X. Zhang, M. A. Zimmer, O. Iliopoulos, and D. C. Chung
Hypoxia-Inducible Factor-1-Independent Regulation of Vascular Endothelial Growth Factor by Hypoxia in Colon Cancer
Cancer Res., March 1, 2004; 64(5): 1765 - 1772.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/51/51223    most recent
M307332200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kang, H. T.
Right arrow Articles by Hwang, E. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, H. T.
Right arrow Articles by Hwang, E. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement