|
Originally published In Press as doi:10.1074/jbc.M207163200 on November 14, 2002
J. Biol. Chem., Vol. 278, Issue 6, 4000-4009, February 7, 2003
A 14-Amino Acid Sequence with a -Turn Structure Is Required
for Apical Membrane Sorting of the Rat Ileal Bile Acid Transporter*
An-Qiang
Sun §,
Rachita
Salkar ¶,
Sachchidanand ,
Shuhua
Xu**,
Lei
Zeng ,
Ming-Ming
Zhou , and
Frederick J.
Suchy
From the Department of Pediatrics and Structural
Biology Program, Department of Physiology and Biophysics,
Mount Sinai School of Medicine, New York, New York 10029-6574 and
the ** Department of Pediatrics, Yale University School
of Medicine, New Haven, Connecticut 06520
Received for publication, July 17, 2002, and in revised form, October 16, 2002
 |
ABSTRACT |
The rat ileal sodium-dependent bile
acid transporter (Asbt) is a polytopic membrane glycoprotein, which is
specifically expressed on the apical domain of the ileal brush-border
membrane. In the present study, an essential 14-amino acid (aa
335-348) sorting signal was defined on the cytoplasmic tail of Asbt
with two potential phosphorylation sites motifs for casein kinase II
(335SFQE) and protein kinase C (PKC)
(339TNK). Two-dimension NMR spectra analysis demonstrated
that a tetramer, 340NKGF, which overlaps with the potential
PKC site within the 14-mer signal sequence, adopts a type I -turn
conformation. Replacement of the potential phosphorylation residue
Ser335 and Thr339 with alanine or deletion of
either the 4 (335SFQE) or 10 aa (338-348, containing
339TNKGF) from the C terminus of Asbt resulted in a
significantly decreased initial bile acid transport activity and
increased the basolateral distribution of the mutants by 2-3-fold
compared with that of wild type Asbt. Deletion of the entire last 14 amino acids (335-348) from the C terminus of Asbt abolished the apical
expression of the truncated Asbt. Moreover, replacement of the
cytoplasmic tail of the liver basolateral membrane protein,
Na+/taurocholate cotransporting polypeptide, with the
14-mer peptide tail of Asbt redirected the chimera to the apical
domain. In contrast, a chimera consisting of the 14-mer peptide of Asbt
fused with green fluorescent protein was expressed in an intracellular
transport vesicle-like distribution in transfected Madin-Darby canine
kidney and COS 7 cells. This suggests that the apical localization of the 14-mer peptide requires a membrane anchor to support proper targeting. The results from biological reagent treatment and low temperature shift (20 °C) suggests that Asbt follows a transport vesicle-mediated apical sorting pathway that is brefeldin
A-sensitive and insensitive to protein glycosylation, monensin
treatment, and low temperature shift.
 |
INTRODUCTION |
Bile acids are the major products of cholesterol catabolism and
perform an important role in bile secretion and intestinal absorption
of lipids and lipid-soluble nutrients. During the past decade,
considerable progress has been made in our understanding of mechanisms
by which bile acids enter and exit liver and intestinal cells. By
contrast, the molecular mechanisms that regulate the activity and
membrane localization of these ion transporters remain poorly
understood. Recent cloning of several key genes, whose protein products
are integral to the enterohepatic circulation of bile acids, has
provided an opportunity to investigate the cellular and molecular
control of this important metabolic and physiologic pathway.
The ileal apical sodium bile acid transporter
(Asbt)1 plays a major role in
the recovery of bile acids from the intestinal lumen (1, 2). The
cDNAs encoding this transporter have been cloned from several
species (3, 4). Rat Asbt contains seven potential transmembrane
domains, localizes to apical surface of ileal enterocytes, and
transports conjugated bile acids in a
Na+-dependent fashion. Sequence analyses of
Asbt revealed that there are three conserved domains in the 40-amino
acid cytoplasmic tails across species. In addition, there are two
potential phosphorylation sites, one for casein kinase II (CK II,
335SFQE) and another for protein kinase C (PKC,
339TNK), in the last 14 amino acids of the carboxyl
terminus of rat Asbt. Previous studies from our laboratory demonstrated
that deletion of the 40-amino acid cytoplasmic tail from the carboxyl
terminus of rat Asbt results in a total loss of bile acid transport
function (5). This suggests that the cytoplasmic tail of Asbt is
important for protein localization and/or transport function.
The mechanisms underlying the basolateral sorting of membrane proteins
have been recently defined and have been associated with sorting
signals in the cytoplasm tail of these proteins. A -turn structure
has been found in several proteins as part of the sorting signal for
the basolateral membrane targeting (6, 7). However, the apical
targeting signals are less well defined and are of diverse molecular
nature. Up to now, no conformational data are available for the apical
sorting signals.
In the present study, we have constructed a series of truncated,
mutated, and chimeric rat Asbts to analyze the targeting signals of
this apical membrane transporter. A novel 14-mer apical plasma membrane
sorting signal has been identified on the cytoplasmic carboxyl terminus
of Asbt. The potential secondary structure of this apical sorting
signal has been evaluated by two-dimensional NMR of a synthesized
peptide. The results demonstrate that a tetrapeptide, 340NGKP, which overlaps with a potential PKC
phosphorylation site in this 14-mer sequence, adopts a type I -turn
structure. As far as we know, this is the first structural data for an
apical targeting signal that contains an apparent -turn
conformation. In addition, we have also examined the sensitivity of the
apical sorting of Asbt to drug treatment and low temperature shift.
These experiments provide new information regarding the residues and mechanisms that contribute to the protein localization and the apical
sorting of Asbt.
 |
EXPERIMENTAL PROCEDURES |
Materials
Cell culture media were obtained from Invitrogen.
[3H]Taurocholic acid (2.1-3.47 Ci/mmol) was purchased
from PerkinElmer Life Sciences. Unlabeled taurocholate was purchased
from Sigma. Subcloning reagents, enzymes, and competent cells were
obtained from Stratagene (La Jolla, CA), Invitrogen, and New England
Biolabs (Beverly, MA).
Construction of Mutant and GFP-fused Rat Ileal Bile Acid
Transporter (Asbt) cDNA
Plasmid Construction--
Wild type and mutant rat Asbt
cDNAs were subcloned into the mammalian expression vector pCMV2 or
a green fluorescent protein (GFP) vector, pEGFPN2
(Clontech) as described previously (8). A
combination of restriction enzyme digestion and PCR was used to
generate mutant and chimeric transporters. The PCR was done with
oligonucleotide primers generated from cDNA sequencing information as detailed previously (5). PCR amplifications were carried out using a
PTC-100TM Programmable Thermal Controller (MJ Research,
Inc., Watertown, MA). After subcloning into expression vectors, the
fidelity of all of the constructs was verified by DNA cycle sequencing
using a PerkinElmer Life Sciences, GeneAmp 9600, ABI Prism 377 DNA
Sequencer at the DNA Core Facility, Mount Sinai School of Medicine.
Truncated transporters were generated by using a PCR-based strategy to
modify the coding sequence as described previously (9). All
PCR-amplified products were purified by QIAquick column (Qiagen Corp.)
and digested with restriction enzyme. Fragments were subcloned into the
MluI and NotI sites of pCMV2 vectors. Proper
orientation of constructs was analyzed by restriction enzyme digestion
and DNA sequencing.
Del4--
The Asbt with deletion of the potential CK II motif
(aa 335-338, SFQE) was constructed by PCR using a forward primer
5'-CCACGCGTATGGATAACTCCTCCGTCTGTTCC, which is designed to
anneal to 5'-end coding sequence of rat Asbt cDNA with an
MluI restriction site (boldface), and a reverse primer 5'-CCCGCGGCCGCTATTTCTCATCTGGTTGAAATCCCTTGTTTGTTGGCATGGGGTCCATATCATTG1099-,
containing codons that anneal to sequences 3'-end region of rat Asbt
cDNA, but no SFQE codons, with a NotI restriction site (underlined).
Del10--
The Asbt with deletion of the carboxyl-terminal 10 amino acids (aa 339-348, containing 339TNKGF), was
constructed by PCR using a forward primer
5'-CCACGCGTATGGATAACTCCTCCGTCTGTTCC, which is designed to
anneal to 5'-end coding sequence of rat Asbt cDNA with an
MluI restriction site (boldface), and a reverse primer 5'-CCCGCGGCCGCTATGTCTCCTGGAATGATGGCATGGG, containing codons
that anneal to sequences 3'-end region of rat Asbt cDNA with a
NotI restriction site (underlined).
Del14--
The Asbt with deletion of the carboxyl-terminal 14 amino acids (aa 335-348) was constructed by PCR using a forward primer 5'- CCACGCGTATGGATAACTCCTCCGTCTGTTCC, which is designed to
anneal to 5'-end coding sequence of rat Asbt cDNA with an
MluI restriction site (boldface), and a reverse primer
5'-CCCGCGGCCGCTACATGGGGTCCATATCATTGTCTG, containing codons
that anneal to sequences 3'-end region of rat Asbt cDNA with a
NotI restriction site (underlined).
Del25--
The Asbt with deletion of the carboxyl-terminal 25 amino acids (aa 324-348) was constructed by PCR using a forward primer 5'- CCACGCGTATGGATAACTCCTCCGTCTGTTCC, which is designed to
anneal to 5'-end coding sequence of rat Asbt cDNA with an
MluI restriction site (boldface), and a reverse primer
5'-CCCGCGGCCGTAAAACTCAGCATCATTTTTTCCATG-, containing codons
that anneal to sequences 3'-end region of rat Asbt cDNA with a
NotI restriction site (underlined).
Del40--
The Asbt with deletion of the carboxyl-terminal 40 amino acids (aa 309-348) was constructed by PCR using a forward primer 5'- CCACGCGTATGGATAACTCCTCCGTCTGTTCC, which is designed to
anneal to 5'-end coding sequence of rat Asbt cDNA with an
MluI restriction site (boldface), and a reverse primer
5'-CCCGCGGCCGCTACATTCCTAATATTATTGCTGC containing codons
that anneal to sequences 3'-end region of rat Asbt cDNA with a
NotI restriction site (underlined).
Chimeric Transporters
NtA14--
This chimera (the truncated rat Ntcp fused with C-end
14 amino acid residues of rat Asbt) was constructed by PCR using a
forward primer 5'-CGACGCGTATGGAGGTGCACAACGTATCAGCC-, which
is designed to anneal to 5'-end coding sequence of rat Ntcp cDNA
with an MluI restriction site (boldface), and a reverse
primer
GGAAGCTTCTATTTCTCATCTGGTTGAAATCCCTTGTTTGTCTCCTGGAATGAGCACCGGAAGATAATGATGATGAGAAGTCCTTCTGCcontaining codons that anneal to sequences 3'-end region of rat Asbt cDNA (nucleotides C1159 to A1118, underlined) and 3'-end region of rat Ntcp
(nucleotides G1040 to C1004) with a NotI restriction site (boldface).
GFP-A14--
The 14-amino acid cytoplasmic tail of rat Asbt was
constructed by PCR using a forward primer 5'-GC
AAGCTTTCATTCCAGGAGACAAAC-, which is designed to
anneal to 5'-end coding sequence (Thr1118 to
Cys1135) of 14 amino acids of rat Asbt cDNA with a
HindIII restriction site (boldface), and a reverse primer
5'-CCCGGATCCTTTCTCATCTGGTTGAAATC CCTTGT-TTGT1133-, containing codons that anneal to
sequences 3'-end region of rat Asbt cDNA with a
BemHI restriction site (underlined). These restriction sites were compatible with the polylinker of pEGFP C3
vector. The PCR products were gel-purified, digested at sites incorporated at the ends of PCR products, and ligated directly to pEGFP
C3 vector digested with the same restriction enzymes to produce the
GFP-fused 14-amino acid tail of rat Asbt chimera.
Site-directed Mutagenesis
Potential sorting determinant residues were examined by
site-specific mutagenesis. The QuikChangeTM site-directed
mutagenesis kit (Stratagene, La Jolla, CA) was used to convert codons
for potential sorting determinant residues to alanine residues
according to manufacturer's directions with minor modification as
described previously (8).
S335A--
(mutation at potential CK II phosphorylation residue
Ser335) The rat Asbt was used as template. A S335A
substitution was made using a forward primer
5'-1104TGGACCCCATGCCAGCATTCCAGGAG1129-3',
which annealed to the coding sequence in the Ser335 region,
and a compatible reverse primer, in place of the codon for
Ser335 was converted to alanine residue
(underlined).
T339A (Mutation at Potential PKC Phosphorylation Residue
Thr339)--
The rat Asbt was used as template. A T339A
substitution was made using a forward primer
5'-1119CATTCCAGGAGGCAAACAAGGGATTTCAACC1149-3',
which annealed to the coding sequence in the Thr339 region,
and a compatible reverse primer, in place of the codon for
Thr339 was converted to alanine residue (underlined).
ST/AA--
The Ser335 and Thr339 double
mutant was constructed by using T339A primers and Asbt-S335A mutant
construct as template.
GFP-fused transporters were constructed using similar PCR-based
strategies. The full-length cDNA-coding sequences of wild type or
mutant transporters were used as templates. The PCR-generated mutant
and wild type transporter cDNA products were subcloned into a GFP
vector, pEGFPN2 (Clontech), using standard
techniques. The coding sequences of wild type and mutant transporters
were fused with HindIII site at N-end and BamHI
site at C-end and amplified by PCR using full-length cDNA as
template. These restriction sites were compatible with the pEGFP N2
polylinker. The PCR products were gel-purified, digested at sites
incorporated at the ends of PCR products, and ligated directly to pEGFP
N2 digested with the same restriction enzymes to produce chimeras. All
plasmid constructs were checked for correct orientation by restriction digestion analysis. The positive clones containing the wild type or
mutant cDNA inserts were verified by DNA sequencing.
Cell Culture and Transfection
COS 7 (SV40-transformed monkey kidney fibroblast) cells were
maintaining in complete Dulbecco's modified Eagle's medium
(containing 10% (v/v) fetal bovine serum, 50 units/ml penicillin, 50 µg/ml streptomycin, and 2 mM L-glutamine).
Transient DNA transfection was carried out by
LipofectinTM-mediated transfection (Invitrogen) according
to the manufacturer's directions. MDCK II cells were maintained in
complete MEM-E medium that was supplemented with 10% (v/v) fetal
bovine serum, 50 units/ml penicillin, 50 µg/ml streptomycin, and 2 mM L-glutamine. Stable DNA transfection was
carried out by LipofectinTM-mediated transfection
(Invitrogen) according to the manufacturer's directions. Briefly,
5-10 × 105 cells were plated on a 100-mm tissue
culture dish. The next day, cells were ~50% confluent and were
transfected with 5 µg of DNA per 100-mm tissue culture dish. On the
following day, transfected MDCK cells were split at 1:3 ratios in
complete medium, and the transfected cell lines were selected by growth
in the antibiotic G418 (900 µg/ml) (Invitrogen). 10-15 days after
transfection, large, healthy colonies were picked by cloning cylinders
and transferred to 12-well plates. The expression of the transporters
was assayed initially by taurocholate influx assay and confocal
microscopy (see below). All of the cells were maintained in a
humidified incubator at 37 °C under 5% CO2 atmosphere.
Bile Acid Influx Transport Assay
The Na+-dependent taurocholate (TC)
influx assay was done as described previously (8). The Transwell filter
system (Costar, Cambridge, MA) was used for the study of polarity of
taurocholate influx. Transfected and untransfected cells were grown to
confluence for 5-7 days on 0.45-µm pore size Transwell filter
inserts. Formation of a tight seal between the upper and lower chambers
was measured by transepithelial transport of
[14C]mannitol, which was <10%, as described previously
(5). Taurocholate uptake was performed at 37 °C for 10 min. The
confluent cell monolayers grown on Transwell filters were washed twice
with warm uptake buffer (116 mM NaCl (or choline), 5.3 mM KCl, 1.1 mM KH2PO4,
0.8 mM MgSO4, 1.8 mM
CaCl2, 11 mM D-glucose, 10 mM Hepes, at pH 7.4), and each well was incubated from the
apical (0.2 ml) or basolateral (0.6 ml) side with uptake buffer
containing 10 µM [3H]taurocholate at the
final concentrations. Following 10 min of incubation, the influx assays
were terminated by aspirating the medium, and the filters were
successively dipped into three beakers, each of which contained 100 ml
of ice-cold uptake buffer. The filters were excised from the cups, and
the attached cells were solubilized in 0.2 ml of 1% SDS and
transferred into scintillation vials with 4 ml of Optifluor
(PerkinElmer Life Sciences). The level of protein expression of wild
type and various deleted and mutated transporters in transfected cells
was normalized by total protein concentrations. The protein was
determined with the Bio-Rad protein assay kit.
In the inhibition studies, taurocholate influx in the absence of
competitor was set as 100%, and all values were graphed relative to
this level. The final concentration of each inhibitor was 100 µM or indicated in figure legends.
Fluorescence Confocal Microscopy
Indirect immunofluorescence microscopy for Asbt was carried out
as described previously (10). Confocal microscopy of GFP-fused chimeras
was performed on a confluent monolayer of transfected cells cultured on
glass coverslips. Glass coverslip-grown cells were rinsed 3 times with
phosphate-buffered saline, fixed for 7 min in 100% methanol at
20 °C, and rinsed 4 times with phosphate-buffered saline, and then
mounted with Aquamount (BDH). Fluorescence were examined with a Leica
TCS-SP (UV) 4-channel confocal laser scanning microscope in the Imaging
Core Facility, Mount Sinai School of Medicine. The 488 nm wavelength
line of an argon laser and the 568 nm wavelength line of a krypton
laser were used. The cell monolayer was optically sectioned every 0.5 µm. Image resolution using a Leica ×63 and/or ×100 Neofluor
objective and Leica TCS-SP software was 512 × 512 pixels.
NMR Spectroscopy
All NMR spectra were acquired at 20 and 30 °C on a Bruker
DRX-600 NMR spectrometer. The NMR sample of the 20-mer peptide (2.5 mM) derived from the cytoplasmic tail of rat ileal bile
acid transporter was prepared in a 10 mM phosphate buffer,
pH 7.4, containing 150 mM sodium chloride in 90%
H2O and 10% 2H2O. The
two-dimensional homonuclear TOCSY (36 ms), NOESY (300 ms), and ROESY
(300 ms) spectra were acquired with 256 and 2048 complex points in
1 and 2, respectively (11). All NMR
spectra were processed and analyzed using the NMRPipe (12) and NMRView (13) programs. A 20-mer peptide, dmdpmpsfqetnkgfqpdek, corresponding to
the sequence from Asp329 to Lys348 on the
cytoplasmic tail of rat Asbt was synthesized by Genosys (The Woodlands,
TX). The crude peptide was purified by reverse phase high pressure
liquid chromatography on a YMC C-18 column. The peak fractions
were subjected to matrix-assisted laser desorption ionization mass
spectrometry and analytical high pressure liquid chromatography.
Biological Reagent Treatments
The effects of biological agents on delivery of these
transporters to the cell surface were performed as described previously (14-16). Brefeldin A was added to a final concentration of 1-2 µM, as described previously for MDCK II cells (15, 16).
Monensin was evaluated at a final concentration of 1.4 µM, as described previously for MDCK II cells (14, 15).
Treatment of tunicamycin that abolishes the glycosylation of viral
glycoproteins was performed as described previously (8). Inhibition of
Asbt-GFP glycosylation by tunicamycin treatment was confirmed by
Western blotting.
Statistics Analysis
Most of the results were expressed as mean value ± S.E.
and examined by Student's t test. When two or more tests
were performed in an experiment, the mean is used for the group
statistics. Results of different groups or categories were compared
using the unpaired t test.
 |
RESULTS |
The Cytoplasmic Tail of Asbt Is Important for Both Membrane
Localization and Substrate Binding Specificity--
Previous studies
(5) from our laboratory have demonstrated that a apical sorting motif
is located on the cytoplasmic tail of Asbt and may transferable and
capable of redirecting a protein normally sorted to the basolateral
surface to the apical domain of MDCK cells.
There are three domains (amino acids 309-318, 324-328, and 338-348)
that are conserved in the 40-aa carboxyl-terminal tail of ileal
transporters from the rat, hamster, mouse, and human (Fig.
1A). To identify further the
potential sorting motif in the cytoplasmic carboxyl terminus, a series
of sequentially shorter cytoplasmic tails of Asbt protein was
generated. These truncated transporters were then transfected into COS
7 and MDCK cells. The transport activity of these mutant transporters
was analyzed by a TC influx assay in a Transwell culture system. The
results show that compared with wild type Asbt, deletions of 14 (aa
334-348), 25 (aa 322-348), and 40 (aa 309-348) amino acid residues
in the carboxyl tail of Asbt did not change the Na+
dependence of taurocholate transport function but decreased the initial
rates of TC transport activity by ~50, ~82, and >95%, respectively, in transfected COS 7 and MDCK cells (Fig. 1B
and Fig. 2). Moreover, in stably
transfected MDCK cells, deletion of the 14 and 25 amino acid residues
resulted in the mutant proteins being randomly sorted to both apical
and basolateral domains (Fig. 2). These results suggested that an
apical sorting determinant is present within the last 14 amino acids of
Asbt cytoplasmic tail.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 1.
A, alignment of the carboxyl-terminal
cytoplasmic tail of ileal apical sodium-dependent bile acid
cotransporters from rat, hamster, mouse, and human
(GenBankTM accession numbers: rat, Q62633; mouse, D87059;
hamster, A49876; and human, U10417). Asterisks indicate the
residues shown by two-dimensional NMR to adopt a -turn structure.
The arrowheads indicate potential phosphorylation residues.
B, sodium dependence of taurocholate influx in transfected
COS 7 cells. COS 7 cells were either untransfected or transfected with
Asbt or deletion mutants of Asbt. TC transport was measured with 10 µM [3H]TC in the presence of
Na+- or choline (100 mM)-containing buffers at
37 °C for 10 min. Data are presented as pmol/mg protein/min
and represent the mean values ± S.E. of three independent
experiments performed in triplicate.
|
|

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 2.
Polarity of sodium-dependent
taurocholate influx by stably transfected MDCK cells grown on Transwell
filters. The rat Asbt and truncated mutants-transfected MDCK II
cells were incubated in 10 µM [3H]TC (with
Na+ buffer) at 37 °C for 10 min. Data are presented as
cpm per Transwell insert and represent the mean values ± S.E. of
two to four independent experiments performed in triplicate.
|
|
To examine whether the cytoplasmic tail is involved in substrate
binding specificity, the effects of several bile acid analogs and
organic anions on taurocholate transport activity of truncated mutants
were tested. The cells were incubated in the presence or absence of 100 µM unlabeled bile acids or other organic anion competitors. Taurocholate influx in the absence of a competitor was set
at 100%, and all values were measured relative to this level of
activity. Fig. 3 shows that the
competitive inhibitor, cholate, inhibited to a similar degree the
initial rate of TC influx in COS 7 cells expressing the wild type or
truncated transporters. In contrast, the noncompetitive inhibitor
bromosulfophthalein (BSP) and taurodehyrocholate demonstrated various
effects on the initial rate of TC influx in COS 7 cells transfected
with truncated transporters or with wild type Asbt. Compared with the
wild type Asbt (BSP inhibited the TC influx ~20%), BSP had no effect
or stimulated TC influx by about 20% in Del14 and Del25 transfected cells, respectively. Moreover, taurodehyrocholate had no significant effect on wild type Asbt-transfected cells but stimulated the TC influx
more than 40% in the Del14-transfected cells. These results suggest
that the competitive and non-competitive substrates may interact with
Asbt differently, and the cytoplasmic tail of Asbt may be important for
the substrate binding specificity and plasma membrane delivery in the
nonpolarized COS 7 cells.

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of taurocholate influx by bile acid
analog and organic anions in transfected COS 7 cells. Influx of 10 µM [3H]taurocholate (10 min, 37 °C) was
assessed in the presence of a 116 mM NaCl with and without
the addition of unlabeled inhibitors to the incubation media. The final
concentration of each inhibitor was 100 µM. Taurocholate
uptake in the presence of 116 mM sodium was set at 100%,
and all values are graphed relative to this level. The % of control
value was 135 pmol mg of protein 1. Data represent
mean ± S.E. (bars) of triplicate determinations from
three different cell culture preparations. Asterisks for
each cell transfected with mutant transporters treated with various
inhibitors indicate significant differences (p < 0.05)
from wild type Asbt-transfected cells (Asbt-GFP). TDHC,
taurodehyrocholate.
|
|
Apical Sorting of Asbt Is Dependent on a 14-Amino Acid Sorting
Signal on the Cytoplasmic Tail--
There are two potential motifs for
casein kinase II (CK II, 335SFQE) and protein kinase C
(PKC, 339TNK) phosphorylation sites in the last 14 amino
acids of the cytoplasmic tail of Asbt. Previous studies (17) have shown
that PKC could inhibit taurocholate influx in rat hepatocytes. In
addition, a potential CK II phosphorylation site at the extreme
carboxyl terminus of CMV-glycoprotein B has been reported (18), which
is involved in internalization and basolateral membrane localization.
In order to further identify the apical sorting signal and follow the
sorting of a wild type and mutant Asbt in a cell culture model,
GFP-fused wild type and a series of mutant rat Asbts were created.
To examine whether the potential PKC and CK II sites are involved in
the apical targeting of Asbt, we first mutated the potential phosphorylation residues Ser335 and Thr339.
Three mutants were constructed by site-directed mutagenesis to replace
the Ser335 (S335A-GFP), Thr339 (T339A-GFP), and
both Ser335 and Thr339 (ST/AA-GFP) with
alanines. Then these point mutated, and wild type Asbts were fused with
the amino terminus of GFP in order to follow the intracellular
localization of these proteins in transfected COS 7 and MDCK II cells.
Northern and Western blotting were used to verify the cellular
expression of the GFP-fused proteins (data not shown). The bile acid
transport activity and cell surface expression of these mutant proteins
were examined in transfected COS 7 cells by a TC influx assay and
fluorescence confocal microscopy. The results show that all three of
the GFP-fused point mutants were functionally similar to the GFP-fused
wild type Asbt in Na+ dependence of bile acid transport and
surface membrane localization in transfected non-polarized COS 7 cells
(data not shown). The polarized membrane distribution of the point
mutants of Asbt was then examined in stably transfected MDCK cells. The
stably transfected MDCK cells were grown to confluence on permeable
Transwell filter inserts. The bile acid influx was measured across the
apical and basolateral membrane domains of the Transwell filter
inserts. The results show that replacement of Ser335 and
Thr339 reduced the initial apical transport activity more
than 20% and enhanced the basolateral transport activity by 2-fold
(Fig. 4), but all three of the
point-mutated transporters were predominantly localized to the
apical surface of MDCK cells (Table
I).

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 4.
Expression of potential phosphorylation
residue mutated rat Asbt in stably transfected MDCK cells. MDCK
cells were stably transfected with Asbt-GFP or the potential
phosphorylation residue, Ser335 (S335A-GFP),
Thr339 (T339A-GFP), and double mutated (ST/AA-GFP) mutants.
The polarity of the Na+-dependent taurocholate
influx was performed on a confluent monolayer of stably transfected
MDCK grown on Transwell filters. Asbt and mutant-transfected cells were
incubated in 10 µM [3H]taurocholate (with
Na+ buffer) at 37 °C for 10 min. Asterisks
for each MDCK cell stably transfected with mutant transporters indicate
significant differences (p < 0.05) from wild type
Asbt-transfected cells (Asbt).
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Plasma membrane distribution of wild type and mutant Asbt
The percentage of membrane distribution of GFP-fused wild type and
mutated transporters on apical versus basolateral enrichment
was calculated from the taurocholate uptake data in stably transfected
MDCK cells.
|
|
To identify further the apical sorting determinants of Asbt,
domain-deleted mutants were generated. In these mutated transporters, one of the potential phosphorylation sites, 335SFQE for CK
II (del4) and the last 10 amino acid including the PKC site (del10) or
the last 14 amino acids including both CK II and PKC sites (del14),
were deleted. These constructs were then stably transfected into MDCK
cells. As shown in Fig. 5, the polarized
[3H]taurocholate transport assay demonstrated that
deletion of only one of the two potential phosphorylation sites
significantly decreased the initial taurocholate influx activity and
the fidelity of polarized apical sorting but did not change the
dominant apical localization. In contrast, deletion of the entire last
14 amino acid residues resulted in the GFP-fused mutant proteins being
randomly sorted to both apical and basolateral domains (Fig. 5). To
confirm the surface expression of the GFP-fused wild type and deleted
mutants, transfected MDCK cells were cultured on glass coverslips and
examined by fluorescence confocal microscopy. Similar to the GFP-fused Asbt, the majority of the four amino acids deleted (del4) and the 10 amino acids deleted (del10) mutants were predominantly detected on the
apical plasma membrane of the transfected MDCK cells (Fig. 5). In
contrast, deletion of the entire last 14 amino acids containing both
potential phosphorylation sites resulted in the loss of apical
localization polarity of the GFP-fused mutant proteins (Fig. 5). As a
control, the GFP-transfected MDCK cells showed mostly nuclear
localization of the protein. It is notable that with all of the mutated
constructs (deletion and site directed mutants) expressed in
transfected cells, the initial transport activity of these mutants was
significantly reduced by ~20-30% (Figs. 4 and 5). The fidelity of
apical membrane delivery of these mutant transporters was changed by
increasing the basolateral distribution more than 2-fold (Table I).
With regard to the mutant (del10) containing the potential PKC site,
the initial apical transport activity of del10-transfected cells was
reduced by ~33.2% (Fig. 5), and the basolateral localization was
enhanced more than 4-fold comparing with that of wild type Asbt-GFP
(Fig. 5). These results suggest that the last 14 amino acids contain an
apical sorting determinant. The two potential phosphorylation sites, particularly the PKC region, may be involved in the regulation of
apical membrane delivery.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 5.
Expression of Asbt and truncated mutants in
stably transfected MDCK cells grown on Transwell filters. A,
the polarity of the Na+-dependent taurocholate
influx was performed on a confluent monolayer of stably transfected
MDCK grown on Transwell filters. Asbt and truncated mutant-transfected
cells were incubated in 10 µM
[3H]taurocholate (with Na+ buffer) at
37 °C for 10 min. Asterisks for each cell transfected
with deleted transporters indicate significant differences
(p < 0.05) from wild type Asbt-transfected cells
(Asbt-GFP). B, fluorescence confocal microscopy demonstrated
that similar to wild type Asbt transporters, Del4-GFP and Del10-GFP
mutant proteins were predominantly located to the apical surface of
stably transfected MDCK cells. In contrast, the 14-amino acid truncated
mutant, Del14-GFP, shows a nonspecific cellular distribution in the
stably transfected MDCK cells. Bar, 5 µm.
|
|
The 14-Mer Apical Sorting Determinant Contains a Tetrapeptide
-Turn Structure--
To determine whether the cytoplasmic tail
sequence of Asbt contains any structurally ordered conformation, we
conducted NMR structural analysis of a synthetic peptide containing
NDMDPMPSFQETNKGFQPDEK, derived from the cytoplasmic tail protein
sequence of rat Asbt. To overcome signal overlap problems for resonance
assignment of the peptide, we collected NMR spectra of the peptide at
20 and 30 °C. The two-dimensional NOESY (Fig.
6A) as well as ROESY (data not
shown) spectra show that the NKGF residues of the peptide exhibit a
distinct pattern of backbone HN-HN and
HN-Ha NOE cross-peaks that is consistent with
the reverse type-I -turn conformation (Fig. 6B). The
direct evidence, supporting a type I over type II -turn
conformation, is the observation of similar intensity NOE cross-peaks
of G14HN/K13Ha and
F15HN/G14Ha. The former NOE peak (corresponding
to ~2.2 Å in a well defined -turn) would show significantly
higher intensity than the latter one (~3.2 Å) for a type II
-turn. Small peptides containing related sequences that have been
reported to adopt a stable -turn conformation in solution include
the NPXpY motif, which is known as the canonical sequence
for the phosphotyrosine binding domains (19, 20). Interestingly, it has
been shown that the -turn formation of the NPXY motif
does not depend on phosphorylation of the tyrosine residue (21-23) or
require an amino acid tyrosine (peptides with phenylalanine
substituting the tyrosine could still form a -turn) (24, 25).
Nevertheless, the Asn and a small amino acid such as glycine or alanine
are highly favored at the i and i + 2 positions (26), which is consistent with our observation of the -turn formation of the NKGF segment of the Asbt peptide in this study.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 6.
Two-dimensional NMR spectrum of a
20-mer peptide corresponding to the cytoplasmic tail of rat Asbt.
A, two-dimensional NOESY spectrum of the Asbt peptide
showing the backbone HN-Ha (upper
panel) and HN-HN (lower panel)
NOE connectivity of the TNKGF segment that is characteristic of a type
I -turn conformation. Annotation for the other major peaks of the
peptide residues that were assigned was omitted for clarity.
B, the type I -turn model (40) showing the characteristic
NOEs of the NKGF segment observed in the NMR spectra. Dashed
lines indicate putative hydrogen bonds between amide NH of
Phe15 and carbonyl oxygen of Asn12 and between
the amide NH of Asn12 and carbonyl oxygen of
Phe15.
|
|
A Membrane Anchorage Domain Is Required for the Polarized Apical
Localization of the 14-Mer Peptide--
To examine whether the apical
sorting signals contained in the 14-amino acid tail of rat Asbt is
autonomous and dominant, a chimera (NtA14-GFP) composed of the 14-mer
peptide and truncated liver sodium-taurocholate cotransporting
polypeptide (Ntcp) was constructed. The wild type Ntcp is also a
membrane protein with seven potential transmembrane domains but is
normally sorted to the basolateral domain of the hepatocytes. This
chimera was transiently transfected into COS 7 and stably transfected
into MDCK II cells. The bile acid transport activity and membrane
localization were examined by taurocholate influx assay. The cellular
distribution of this GFP-fused chimera was visualized by fluorescence
and analyzed by confocal microscopy. A previous study (5) from our
laboratory demonstrated that the cytoplasmic tail of rat Ntcp is
essential for the basolateral membrane localization. Deletion of the
cytoplasmic tail of Ntcp resulted in loss of the transport activity
with most of the truncated Ntcp accumulating intracellularly in the
transfected cells (5, 8). The results in this study show that
replacement of the C-end 56-amino acid cytoplasmic tail of rat Ntcp
with the 14-mer peptide of rat Asbt resulted in increased initial
taurocholate influx activity and apical membrane localization of this
chimera transporter in transfected cells (Fig.
7). This suggested that the increased
initial taurocholate influx activity is due to enhanced apical membrane
delivery and localization of this chimeric transporter.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 7.
Expression of cytoplasmic tail truncated
(Nt-GFP) and 14-mer peptide of Asbt-fused chimeric
(NtA14-GFP) rat Ntcp in transfected COS 7 and MDCK
cells. A, the polarity of the
Na+-dependent taurocholate influx was performed
on a confluent monolayer of stably transfected MDCK cells grown on
Transwell filters. The truncated and chimera mutant-transfected cells
were incubated in 10 µM [3H]taurocholate at
37 °C for 10 min. B, fluorescence photomicrographs were
performed on the transient transfected COS 7 and stably transfected
MDCK cells. Confocal enface (X-Y) and X-Z
cross-sectional photomicrographs were of MDCK cells stably transfected
with Nt-GFP cDNA (left) or NtA14-GFP (right).
Bar, 5 µm.
|
|
Previous studies have shown that apical sorting signals require a
supporting membrane anchor. The apical localization of rhodopsin mediated by a cytoplasmic sorting motif also required membrane anchors
provided by the transmembrane domain and/or a palmitoylation signal
(27). This raises the question whether the information present in the
transmembrane domains of Asbt and Ntcp is involved in the apical
targeting of the 14-amino acid sequence. To answer this question, a
chimera (GFP-A14) was constructed, in which GFP was fused with a
triplicate 14-mer peptide of rat Asbt. This chimera (GFP-A14) was
transfected into COS 7 and MDCK II cells. The cellular localization of
GFP-A14 was analyzed by confocal microscopy. The results (Fig.
8) show that in contrast to the nuclear
localization of wild type GFP, fusion of the C-end 14-mer peptide of
rat Asbt with GFP, resulted in the accumulation of the fused protein
(GFP-A14) intracellularly in a transport vesicle-like pattern. These
results suggested that the 14-mer peptide apical sorting signal is
autonomous and dominant but requires a membrane anchor to support its
function.

View larger version (75K):
[in this window]
[in a new window]
|
Fig. 8.
Fluorescence microscopy of
transfected COS 7 and MDCK cells expressing GFP and 14-mer peptide of
Asbt-fused GFP (GFP-A14). Fluorescence photomicrographs were
performed on the confluent monolayers of transient transfected COS 7 and stably transfected MDCK cells. Confocal enface (X-Y) and
X-Z cross-sectional photomicrographs were of MDCK cells
stably transfected with GFP-A14 cDNA (left), GFP
(central), and untransfected (right) cells.
Bar, 5 µm.
|
|
Apical Membrane Sorting of Asbt Is Mediated by a Pathway That Is
BFA-sensitive and -insensitive to the Protein Glycosylation, Monensin
Treatment, and Low Temperature Shift--
Studies involving mutation
of glycosylation sites and inhibition of N-glycosylation by
tunicamycin treatment indicated that the N-linked
carbohydrates were able to mediate apical membrane localization of some
membrane proteins (28). The function of N-linked
carbohydrate on the amino terminus of Asbt-GFP was examined by
tunicamycin inhibition and site-directed mutagenesis of
N-linked glycosylation sites (Asn3 and
Asn10) to alanine in transfected MDCK cells. The results
from taurocholate influx studies and confocal microscopy indicated that
the apical surface expression of Asbt was not effected by tunicamycin
treatment (Fig. 9, A-C).
Moreover, the transporters with N-glycosylation site
(Asn3 and Asn10) mutated to alanine were
also localized to the apical membrane in stably transfected MDCK cells
(data not shown). These results suggest that the polarized apical
surface expression of ASBT proteins is achieved by an apical sorting
pathway that is independent of a carbohydrate-mediated apical sorting
pathway.

View larger version (75K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of biological reagent treatment and
low temperature shift on polarized distribution of rat Asbt-GFP in
stably transfected MDCK cells. A, the polarity of the
Na+-dependent taurocholate uptake was performed
on a confluent monolayer of stably transfected MDCK cells incubated
with Na+ butyrate (10 mM, 15 h, 37 °C).
After 18 h of tunicamycin treatment (2 µg/ml for 16 h + 12 µg/ml for 2 h), the MDCK cells stably expressing Asbt were
incubated in 10 µM [3H]taurocholate at
37 °C for 10 min. B, Western blot of plasma membrane
fractions from stably transfected MDCK cells with (+Tun) and
without ( Tun) tunicamycin treatment. C,
confocal microscopy of rat Asbt expressed in stably transfected MDCK
cells. The stably transfected MDCK cells were treated with tunicamycin
(2 µg/ml for 16 h + 12 µg/ml for 2 h) before cells were
fixed. Bar, 5 µm. D, effects of vesicular
transport inhibitors on polarized taurocholate uptake in stably
transfected MDCK cells. The polarity of the
Na+-dependent taurocholate uptake was performed
on a confluent monolayer of MDCK cells stably expressing GFP-fused rat
Asbt protein cultured on a Transwell culture system. The cells were
incubated with Na+ butyrate (10 mM, 15 h,
37 °C). After 15 h of brefeldin A (2 µM) or
monensin (1.4 µM) treatments, the Asbt-GFP transfected
cells were incubated in 10 µM
[3H]taurocholate (with Na+ buffer) at
37 °C for 10 min. Asterisks for each stably transfected
MDCK cells treated with drugs indicates significant difference
(p < 0.05) from drug-untreated cells. E,
effects of low temperature shift on polarized distribution of rat
Asbt-GFP in stably transfected MDCK cells. Time dependence of polarized
taurocholate uptake of rat Asbt-GFP expressed in stably transfected
MDCK cells at 20 °C. The cells were grown on Transwell filter
inserts until confluent and incubated at 20 °C for 0, 3, and 6 h before the bile acid transport assay. The data are presented as
radioactivity (cpm) of total TC uptake per Transwell filter
insert.
|
|
In MDCK cells and cultured neurons, it has been shown that BFA, a
fungal metabolite that disrupts the Golgi compartment and inhibits
vesicular transport, inhibits apical or axonal sorting of proteins but
does not affect the basolateral or dendritic sorting of proteins (15,
16). Previous studies (27) demonstrated that the apical
localization of rhodopsin was mediated by a brefeldin A and low
temperature shift-sensitive pathway. Our results show that delivery of
Asbt-GFP to the apical surface of MDCK cells was significantly
disrupted by BFA after incubating the transfected MDCK cells in a
medium containing 1 µM BFA for 15 h at 37 °C
(Fig. 9D). The taurocholate transport studies showed that
the basolateral localization of Asbt-GFP proteins was enhanced more
than 2-fold after BFA treatment compared with untreated cells. The
effect of monensin, another transport vesicle-interrupting reagent, on Asbt-GFP sorting to the apical membrane was also examined. Monensin reversibly raises the pH of intracellular vesicles and inhibits recycling of membrane receptors and other glycoproteins (14, 15). In
this study, monensin was evaluated at a final concentration of 1.4 µM, as described previously (14, 15). The results showed that monensin did not significantly affect the polarized membrane targeting of Asbt-GFP (Fig. 9D). To gain further insight
into the possible sorting pathway for rat Asbt, the effect of a low temperature shift (20 °C) on the distribution of Asbt-GFP was examined. Low temperature shift has been shown to block the classical secretory pathway by preventing secreted and membrane proteins from
exiting the Golgi apparatus (27, 29, 30). The results show that after
6 h of incubation at 20 °C, there was no significant change
detected in the initial transport activity and polarity of taurocholate
influx (Fig. 9E). All of these results suggest that the
apical sorting of Asbt-GFP may be mediated by a transport vesicular
sorting pathway that is sensitive, at least partially, to BFA and is
insensitive to the monensin treatment and low temperature shift.
 |
DISCUSSION |
We have systematically examined the cytoplasmic tail sequence
requirements for the rat Asbt apical targeting and its possible secondary structure. A novel 14-amino acid apical plasma membrane sorting signal has been identified on the cytoplasmic carboxyl terminus
of Asbt. Within this 14-mer signal sequence, a tetramer (340NKGF), which overlaps with a potential PKC
phosphorylation site (339TNK), adopts a type I -turn
conformation. Moreover, this 14-mer sorting signal of Asbt requires a
transmembrane anchor domain to support its appropriate apical
localization, and its apical sorting may be mediated by a vesicular
transport pathway that is partially BFA-sensitive and -insensitive to
protein glycosylation, monensin treatment, and low temperature shift.
Our previous studies (5) showed that a tail-less mutant of Asbt lost
its apical sorting polarity. We have found that, in contrast to apical
sorting signals reported previously such as those located in the
lumenal ectodomains or composed of a glycosylphosphatidylinositol anchor or glycans, the apical sorting signal of Asbt is located on its
cytoplasmic tail. Apical sorting signals have been found on the
cytoplasmic tail of several other membrane proteins. For example, the C
terminus of the GABA transporter GAT-3 (31) and cystic fibrosis
transmembrane conductance regulator (CFTR) (32, 33) contain a
PDZ-interacting domain that is required for the apical plasma membrane
localization and interaction with the PDZ domain-containing proteins,
such as EBP50 (NHERF). The PDZ-interacting domain is typically
comprised of a TXL sequence on the carboxyl-terminal cytoplasmic tail of these proteins (33). The CFTR carboxyl-terminal tail alone, or when fused to the GFP, can localize to the apical plasma
membrane, despite the absence of transmembrane domain (32). The short
tail of the 5-HT1B receptor presents an apical targeting signal that
can also act as an axonal targeting signal (34). Rhodopsin, a seven
transmembrane G-protein-coupled receptor, is another example of an
apical sorting signal in the cytoplasmic tail (27). The existence of
multiple autonomous signals for apical targeting in the same protein
have been reported for human cytomegalovirus (CMV) glycoprotein B
(18) and rat 5-HT1B receptor (34), suggesting that proteins can have
redundant signals.
In the current study, our results demonstrated that the last 14 amino
acid residues on the carboxyl terminus of Asbt are important for its
apical membrane localization. However, no similarity could be detected
between the peptide sequence of the cytoplasmic tail of Asbt with that
of PDZ-binding proteins, the 5-HT1B receptor, or rhodopsin.
It is unclear how this 14-mer motif directs Asbt apical targeting.
Previous studies have shown that a secondary structure, e.g.
a turn conformation, is required for the basolateral and/or endocytosis
sorting. In the case of polymeric immunoglobulin receptor and
transferrin receptor, two-dimensional NMR spectroscopy suggested that a
tetrapeptide sequence, R(N/Q)VD, adopts a type I -turn conformation
that is essential for basolateral sorting (6, 7). For polymeric
immunoglobulin receptor, alanine-scanning mutagenesis showed that the
residue Val660 in position i + 2 of this
tetramer is important for both basolateral targeting and stability of
the turn structure (6). When a 36-cytoplasmic residue segment
encompassing the RQVD sequence was deleted, a 20% reduction in the
basolateral distribution of transferrin receptor in MDCK cells was
observed (7). By using NMR of synthetic peptides, Bansal and Gierasch
(21) and Eberle et al. (9) reported that another tetramer
sequence, (N/P)P(V/G)Y, in the low density lipoprotein receptor and
lysosomal acid phosphatase adopts a type I -turn structure that is
essential for a coated pit internalization signal. It has been
suggested that the sequences associated with the internalization and/or
basolateral localization appear to play a critical conformational role
that is required for targeting, probably by enabling binding to adaptor
molecules (35-37).
The Phe802 and a turn structure
(804NPXY) in the cytoplasmic tail of the low
density lipoprotein receptor were shown to be essential for clustering
in clathrin-coated pits (38). Kibbey et al. (38) suggested
that the receptor internalization rates depend on the affinities of the
hexapeptide motif 802FXNPXY for
clathrin and that the affinity depends on a reverse turn
conformation. Tyrosine phosphorylation could also alter the binding specificity of the NPXY motif (38). Aroeti et
al. (6) suggested that the presence and location of specific side
chains might determine the ability of a particular signal to function as a basolateral signal and/or endocytosis signal. In particular, endocytosis signals contain a Tyr (or other aromatic residue) at
position i or i + 3, whereas the -turn in the
basolateral signal of the polymeric immunoglobulin receptor lacks
aromatic residues but contains a bulky hydrophobic Val at position
i + 2 (6). However, in all of the cases above, the results
suggested that the turn structure alone is necessary, but not
sufficient, for a maximal response. Up to now, it is unclear whether a
unique secondary conformation is involved with apical sorting.
Our results showed that the potential CK II and PKC phosphorylation
sites in this 14-mer sequence might act as part of the apical sorting
signal. Replacement of the nearby potential phosphorylation residues
Ser335 and Thr339 reduced the apical transport
activity more than 20% and increased the basolateral distribution
about 2-fold. Moreover, deletion of the last 10 amino acid residues
containing the unique tetramer -turn structure overlapping with the
PKC site region resulted in a significant reduction of the apical
sorting and enhancement of basolateral localization more than 3-fold. A
computer-generated secondary structure prediction analysis
(www.bu.edu/psa/request.htm) of the 40-amino acid sequence of the rat
Asbt tail showed that a potential turn structure, which has been
reported as essential for protein sorting (6, 7, 9, 21), may occur
between amino acids 25 and 35. These residues overlap with the
potential CK II and PKC phosphorylation sites. Further computer
prediction shows that replacement of the Ser335 or the
residues within a tetramer 340NKGF (N, G, and F) with
alanines would result in a significant loss of the turn potential of
tetramer 340NKGF. This suggests that the Ser335
(a potential CK II phosphorylation residue) may be important for
stabilizing the turn conformation. In contrast, computer prediction shows that replacement of the Thr339 with alanine would
have no significant effects on the tetramer -turn potential. This
suggests that the effect on the initial transport activity and apical
sorting by Thr339 mutation may involve a different
mechanism than that of Ser339 mutation. The results from
our two-dimensional NMR analysis confirmed that the tetramer sequence
340NGKF does adopt a type I -turn structure that is
similar to the type I -turn structure in basolateral and endocytosis
signals. This experimental evidence demonstrates, for the first time,
that an apical sorting signal contains a unique secondary structure and
further suggests that turn conformation is a common structural motif
for not only basolateral and endocytosis but also apical sorting
signals. A possible model is that these sorting signal motifs share a
common turn structure backbone but have individual specificity
conferred by side chain variation. The side chains of the amino acid
residues within and/or nearby the turn structure may favor a specific
conformation to interact with cytosolic proteins of the sorting
machinery to regulate different sorting pathways. However, it is not
clear what the relationship is between the phosphorylation and -turn
structure. More studies are necessary to understand the features of
turn structure within the apical, basolateral, and endocytosis signals.
In current study, our results showed that a novel 14-mer sequence with
a unique turn structure acted as an apical sorting determinant, and
this 14-mer peptide can be functionally transferred to a heterologous
protein and act as an autonomous apical targeting signal. This makes it
more plausible that the structural characteristics of the peptide
determined here are biologically relevant. In contrast to the sorting
signals of CFTR and rhodopsin, the apical localization of Asbt requires
a transmembrane anchorage domain to support its appropriate polarized
localization. Asbt is not a glycosylphosphatidylinositol-linked protein, and inhibition of N-linked glycosylation does not
inhibit the polarized apical localization of this protein. Based on
these differences, we surmise that the mechanism for the apical sorting of rat Asbt may be distinct from that used for the recognition of
previously described apical sorting signals.
So far, several regulator and/or adapter proteins have been reported to
regulate the multiple apical sorting pathways by interacting with the
cytoplasmic tail of proteins in MDCK cells. The association of CFTR
with a cytoskeletal complex, e.g. EBP50 and ezrin, could serve as an anchor to determine its specific location within
microdomains of the apical membrane and/or its residence time at the
cell surface (39). MAL is a nonglycosylated integral membrane protein
found in glycolipid-enriched membrane microdomains in several cell
lines including MDCK cells (40, 41). In polarized epithelial MDCK cells, MAL is necessary for normal apical sorting and is thus part of
the integral machinery for glycolipid-enriched membrane-mediated apical
targeting (40, 41). The results from drug treatment studies
demonstrated that MAL-associated apical transport vesicles were
sensitive to drugs such as monensin, chloroquine, and NH4Cl but insensitive to the drug BFA (41). It was also reported that the
Tctex-1, dynein light chain, could directly interact with the
carboxyl-terminal cytoplasmic tail of rhodopsin (42). The apical
localization of rhodopsin can be reversibly blocked at the Golgi
complex by low temperature shift and altered by BFA treatment. Tugizov
et al. (18) reported that CMV glycoprotein B was
transported to apical membrane independently of other envelope glycoproteins and that it colocalized with proteins in transport vesicles of the biosynthetic and endocytic pathways.
In contrast to the apically sorted proteins reported previously, our
results demonstrated that the apical plasma membrane localization of
Asbt was partially interrupted by BFA treatment and was not blocked by
monensin treatment and low temperature shift. In addition, without the
support of a membrane anchor domain, a GFP-fused 14-mer cytoplasmic
tail of rat Asbt was distributed intracellularly in a transport
vesicle-like pattern. The differential sensitivity to drug treatment
and low temperature shift suggests that Asbt apical sorting may be
mediated by a different population of transport vesicles than reported
previously for other apical proteins. It is still unknown how this
14-mer sequence directs Asbt apical transport and whether the apical
localization of Asbt is mediated by an unidentified factor or other
apical targeting regulator/adaptors reported previously, such as
Rab11/Rip11 protein complex (43), Munc 18-2 (44), and Raft-associated
SNAP receptor (45). Further analysis is required to address these
issues and distinguish these possibilities.
 |
ACKNOWLEDGEMENTS |
We thank I'Kyori Swaby for assistance
with this work. Confocal laser scanning microscopy was performed at the
MSSM-CLSM core facility, supported with funding from National
Institutes of Health Shared Instrumentation Grant 1 S10 RR0 9145-01 and
National Science Foundation Major Research Instrumentation Grant
DBI-9724504.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grant HD20632 (to F. J. S.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dept. of Pediatrics,
Box 1664, Mount Sinai Medical School, One Gustave L. Levy Pl., New
York, NY 10029-6574. Tel.: 212-241-2366; Fax: 212-426-1972; E-mail:
An-Qiang.Sun@mssm.edu.
¶
Present address: Dept. of Vaccine Research, University of
Maryland Biotechnology Institute, Baltimore, MD 21201.
Published, JBC Papers in Press, November 14, 2002, DOI 10.1074/jbc.M207163200
 |
ABBREVIATIONS |
The abbreviations used are:
Asbt, rat ileal
sodium-dependent bile acid transporter;
Asbt-GFP, GFP-fused
rat Asbt;
COS 7, SV40-transformed monkey kidney fibroblast cells;
Del4, the C-end 4-amino acid (aa 335-338)-deleted Asbt;
Del10, the C-end
10-amino acid (aa 339-348)-deleted Asbt;
Del14, the C-end 14-amino
acid (aa 335-348)-deleted Asbt;
Del25, the C-end 25-amino acid (aa
324-348)-deleted Asbt;
Del40, the C-end 40-amino acid (aa
309-348)-deleted Asbt;
GFP, green fluorescent protein;
MDCK, Madin-Darby canine kidney;
Ntcp, rat liver Na+/taurocholate
cotransporting polypeptide;
Nt-GFP, 56 amino acids deleted from C-end
of Ntcp and fused with GFP;
NtA14-GFP, the COOH-terminal 56 amino acids
of Ntcp were replaced with the 14-amino acid cytoplasmic tail of Asbt
and fused with GFP;
PKC, protein kinase C;
CK, casein kinase;
TC, taurocholate;
aa, amino acid;
CFTR, cystic fibrosis transmembrane
conductance regulator;
CMV, cytomegalovirus;
BSP, bromosulfophthalein;
NOE, nuclear Overhauser effect.
 |
REFERENCES |
| 1.
|
Inoue, M.,
Kinne, R.,
Tran, T.,
and Arias, I. M.
(1984)
J. Clin. Invest.
73,
659-663[Medline]
[Order article via Infotrieve]
|
| 2.
|
Shneider, B. L.
(1995)
J. Pediatr. Gastroenterol. Nutr.
20,
233-237[Medline]
[Order article via Infotrieve]
|
| 3.
|
Shneider, B. L.,
Dawson, P. A.,
Christie, D.-M.,
Hardikar, W.,
Wong, M. H.,
and Suchy, F. J.
(1995)
J. Clin. Invest.
95,
745-754[Medline]
[Order article via Infotrieve]
|
| 4.
|
Wong, M. H.,
Oelkers, P.,
Craddock, A. L.,
and Dawson, P. A.
(1994)
J. Biol. Chem.
269,
1340-1347[Abstract/Free Full Text]
|
| 5.
|
Sun, A.-Q.,
Ananthanarayanan, M.,
Soroka, C. J.,
Thevananther, S.,
Shneider, B.,
and Suchy, F. J.
(1998)
Am. J. Physiol.
275,
G1045-G1055[Medline]
[Order article via Infotrieve]
|
| 6.
|
Aroeti, B.,
Kosen, P. A.,
Kuntz, I. D.,
Cohen, F. E.,
and Mostov, K. E.
(1993)
J. Cell Biol.
123,
1149-1160[Abstract/Free Full Text]
|
| 7.
|
Dargemont, C., Le,
Bivic, A.,
Rothenberger, S.,
Iacopetta, B.,
and Kuhn, L. C.
(1993)
EMBO J.
12,
1713-1721[Medline]
[Order article via Infotrieve]
|
| 8.
|
Sun, A.-Q.,
Arresa, M. A.,
Zeng, L.,
Swaby, I. K.,
Zhou, M. M.,
and Suchy, F. J.
(2001)
J. Biol. Chem.
276,
6825-6833[Abstract/Free Full Text]
|
| 9.
|
Eberle, W.,
Sander, C.,
Klaus, W.,
Schmidt, B.,
Figura, K. V.,
and Peters, C.
(1991)
Cell
67,
1203-1209[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Sun, A.-Q.,
Swaby, I. K., Xu, S.-H.,
and Suchy, F. J.
(2001)
Am. J. Physiol.
280,
G1305-G1313
|
| 11.
|
Wuthrich, K.
(1986)
NMR of Proteins and Nucleic Acids
, pp. 117-129, John Wiley & Sons, Inc., New York
|
| 12.
|
Delaglio, F.,
Grzesiek, S.,
Vuister, G. W.,
Zhu, G.,
Pfeifer, J.,
and Bax, A.
(1995)
J. Biomol. NMR
6,
277-293[Medline]
[Order article via Infotrieve]
|
| 13.
|
Johnson, B. A.,
and Blevins, R. A.
(1994)
J. Biomol. NMR
4,
603-614[CrossRef]
|
| 14.
|
Alonso, F. V.,
and Compans, R. W.
(1981)
J. Cell Biol.
89,
700-705[Abstract/Free Full Text]
|
| 15.
|
Arreaza, G.,
and Brown, D. A.
(1995)
J. Biol. Chem.
270,
23641-23647[Abstract/Free Full Text]
|
| 16.
|
Low, S. H.,
Wong, S. H.,
Tang, B. L.,
Tan, P.,
Subramaniam, V. N.,
and Hong, W.
(1991)
J. Biol. Chem.
266,
17729-17732[Abstract/Free Full Text]
|
| 17.
|
Grüne, S.,
Engelking, L. R.,
and Anwer, M. S.
(1993)
J. Biol. Chem.
268,
17734-17741[Abstract/Free Full Text]
|
| 18.
|
Tugizov, S.,
Maidji, E.,
Xiao, J.,
Zheng, Z.,
and Pereira, L.
(1998)
J. Virol.
72,
7374-7386[Abstract/Free Full Text]
|
| 19.
|
Fiore, F.,
Zambrano, N.,
Minopoli, G.,
Donini, V.,
Duilio, A.,
and Russo, T.
(1995)
J. Biol. Chem.
270,
30853-30856[Abstract/Free Full Text]
|
| 20.
|
Yan, K. S.,
Kuti, M.,
and Zhou, M.-M.
(2002)
FEBS Lett.
513,
67-70[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Bansal, A.,
and Gierasch, L. M.
(1991)
Cell
67,
1195-1201[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Zhou, M.-M.,
Ravichandran, K. S.,
Olejniczak, E. T.,
Petros, A. P.,
Meadows, R. P.,
Sattler, M.,
Harlan, J. E.,
Wade, W.,
Burakoff, S. J.,
and Fesik, S. W.
(1995)
Nature
378,
584-592[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Zhou, M.-M.,
Huang, B.,
Olejniczak, E. T.,
Meadows, R. P.,
Shuker, S. B.,
Miyazak, M.,
Trüb, T.,
Shoelson, S. E.,
and Fesik, S. W.
(1996)
Nat. Struct. Biol.
3,
388-393[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Zhang, Z.,
Lee, C.-H.,
Mandiyan, V.,
Borg, J.-P.,
Margolis, B.,
Schlessinger, J.,
and Kuriyan, J.
(1997)
EMBO J.
16,
6141-6150[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Zwahlen, C., Li, S.-C.,
Kay, L. E.,
Pawson, T.,
and Forman-Kay, J. D.
(2000)
EMBO J.
19,
1505-1515[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Wilmot, C. M.,
and Thornton, J. M.
(1988)
J. Mol. Biol.
203,
222-232
|
| 27.
|
Chuang, J.-Z.,
and Sung, C.-H.
(1998)
J. Cell Biol.
142,
1245-1256[Abstract/Free Full Text]
|
| 28.
|
Matter, K.
(2000)
Curr. Biol.
10,
R39-R42[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Matlin, K. S.,
and Simons, K.
(1983)
Cell
34,
233-243[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Saraste, J.,
and Svensson, K.
(1991)
J. Cell Sci.
100,
415-430[Abstract/Free Full Text]
|
| 31.
|
Muth, T. R.,
Ahn, J.,
and Caplan, M. J.
(1998)
J. Biol. Chem.
273,
25616-25627[Abstract/Free Full Text]
|
| 32.
|
Milewski, M. I.,
Mickle, J. E.,
Forrest, J. K.,
Stafford, D. M.,
Moyer, B. D.,
Cheng, J.,
Guggino, W. B.,
Stanton, B. A.,
and Cutting, G. R.
(2000)
J. Cell Sci.
114,
719-726
|
| 33.
|
Wang, S.,
Raab, R. W.,
Schatz, P. J.,
Guggino, W. B.,
and Li, M.
(1998)
FEBS Lett.
427,
103-108[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Jolimay, N.,
Franck, L.,
Langlois, X.,
Hamon, M.,
and Darmon, M.
(2000)
J. Neurosci.
20,
9111-9118[Abstract/Free Full Text]
|
| 35.
|
Bonifacino, J. S.,
and Dell'Angelica, E. C.
(1999)
J. Cell Biol.
145,
923-926[Free Full Text]
|
| 36.
|
Vaux, D.
(1992)
Trends Cell Biol.
2,
189-192[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Vleurick, L.,
Pezet, A.,
Kühu, E. R.,
Decuypere, E.,
and Edery, M.
(1999)
Mol. Endocrinol.
13,
1823-1831[Abstract/Free Full Text]
|
| 38.
|
Kibbey, R. G.,
Rizo, J.,
Gierasch, L. M.,
and Anderson, R. G. W.
(1998)
J. Cell Biol.
142,
59-67[Abstract/Free Full Text]
|
| 39.
|
Short, D. B.,
Trotter, K. W.,
Reczek, D.,
Kreda, S. M.,
Bretscher, A.,
Boucher, R. C.,
Stutts, M. J.,
and Milgram, S. L.
(1998)
J. Biol. Chem.
273,
19797-19801[Abstract/Free Full Text]
|
| 40.
|
Puertollano, R.,
and Alonso, M. A.
(1999)
Biochem. Biophys. Res. Commun.
254,
689-692[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Puertollano, R.,
and Alonso, M. A.
(1999)
Mol. Biol. Cell
10,
3435-3447[Abstract/Free Full Text]
|
| 42.
|
Tai, A. W.,
Chuang, K. J.-Z.,
Bode, C.,
Wolfrum, U.,
and Sung, C.-H.
(1999)
Cell
97,
877-887[CrossRef][Medline]
[Order article via Infotrieve]
|
| 43.
|
Prekeris, R.,
Klumperman, J.,
and Scheller, R. H.
(2000)
Mol. Cell
6,
1437-1448[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Riento, K.,
Kauppi, M.,
Keranen, S.,
and Olkkonen, V. M.
(2000)
J. Biol. Chem.
275,
13476-13483[Abstract/Free Full Text]
|
| 45.
|
Lafont, F.,
Verkade, P.,
Galli, T.,
Wimmer, C.,
Louvard, D.,
and Simons, K.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
3734-3738[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
V. S. Subramanian, J. S. Marchant, M. J. Boulware, T. Y. Ma, and H. M. Said
Membrane targeting and intracellular trafficking of the human sodium-dependent multivitamin transporter in polarized epithelial cells
Am J Physiol Cell Physiol,
April 1, 2009;
296(4):
C663 - C671.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Annaba, Z. Sarwar, P. Kumar, S. Saksena, J. R. Turner, P. K. Dudeja, R. K. Gill, and W. A. Alrefai
Modulation of ileal bile acid transporter (ASBT) activity by depletion of plasma membrane cholesterol: association with lipid rafts
Am J Physiol Gastrointest Liver Physiol,
February 1, 2008;
294(2):
G489 - G497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. S. Subramanian, J. S. Marchant, and H. M. Said
Apical membrane targeting and trafficking of the human proton-coupled transporter in polarized epithelia
Am J Physiol Cell Physiol,
January 1, 2008;
294(1):
C233 - C240.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Sharma, S. H. Low, S. Misra, B. Pallavi, and T. Weimbs
Apical targeting of syntaxin 3 is essential for epithelial cell polarity
J. Cell Biol.,
June 19, 2006;
173(6):
937 - 948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-Q. Sun, N. Balasubramaniyan, H. Chen, M. Shahid, and F. J. Suchy
Identification of Functionally Relevant Residues of the Rat Ileal Apical Sodium-dependent Bile Acid Cotransporter
J. Biol. Chem.,
June 16, 2006;
281(24):
16410 - 16418.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Klapper, H. Daniel, and F. Doring
Cytosolic COOH terminus of the peptide transporter PEPT2 is involved in apical membrane localization of the protein
Am J Physiol Cell Physiol,
February 1, 2006;
290(2):
C472 - C483.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. A. Alrefai, Z. Sarwar, S. Tyagi, S. Saksena, P. K. Dudeja, and R. K. Gill
Cholesterol modulates human intestinal sodium-dependent bile acid transporter
Am J Physiol Gastrointest Liver Physiol,
May 1, 2005;
288(5):
G978 - G985.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Xia, M. Roundtree, A. Merikhi, X. Lu, S. Shentu, and G. LeSage
Degradation of the Apical Sodium-dependent Bile Acid Transporter by the Ubiquitin-Proteasome Pathway in Cholangiocytes
J. Biol. Chem.,
October 22, 2004;
279(43):
44931 - 44937.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. S. Subramanian, J. S. Marchant, M. J. Boulware, and H. M. Said
A C-terminal Region Dictates the Apical Plasma Membrane Targeting of the Human Sodium-dependent Vitamin C Transporter-1 in Polarized Epithelia
J. Biol. Chem.,
June 25, 2004;
279(26):
27719 - 27728.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-Q. Sun, N. Balasubramaniyan, C.-J. Liu, M. Shahid, and F. J. Suchy
Association of the 16-kDa Subunit c of Vacuolar Proton Pump with the Ileal Na+-dependent Bile Acid Transporter: PROTEIN-PROTEIN INTERACTION AND INTRACELLULAR TRAFFICKING
J. Biol. Chem.,
April 16, 2004;
279(16):
16295 - 16300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Inukai, A. M. Shewan, W. S. Pascoe, S. Katayama, D. E. James, and Y. Oka
Carboxy Terminus of Glucose Transporter 3 Contains an Apical Membrane Targeting Domain
Mol. Endocrinol.,
February 1, 2004;
18(2):
339 - 349.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|