Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M208898200 on November 20, 2002

J. Biol. Chem., Vol. 278, Issue 6, 4072-4081, February 7, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/6/4072    most recent
M208898200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Milkereit, P.
Right arrow Articles by Tschochner, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Milkereit, P.
Right arrow Articles by Tschochner, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Noc Complex Specifically Involved in the Formation and Nuclear Export of Ribosomal 40 S Subunits*

Philipp MilkereitDagger§, Daniela Strauss§, Jochen Bassler, Olivier Gadal, Holger Kühn, Sylvia Schütz, Nicole Gas, Johannes Lechner, Ed Hurt||, and Herbert Tschochner**

From the Biochemie-Zentrum Heidelberg, Im Neuenheimer Feld 328, 69120 Heidelberg, Germany and  Laboratoire de Biologie Moleculaire Eucaryote, F-32062 Toulouse, France

Received for publication, August 30, 2002, and in revised form, November 18, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Formation and nuclear export of 60 S pre-ribosomes requires many factors including the heterodimeric Noc1-Noc2 and Noc2-Noc3 complexes. Here, we report another Noc complex with a specific role in 40 S subunit biogenesis. This complex consists of Noc4p, which exhibits the conserved Noc domain and is homologous to Noc1p, and Nop14p, a nucleolar protein with a role in 40 S subunit formation. Moreover, noc4 thermosensitive mutants are defective in 40 S biogenesis, and rRNA processing is inhibited at early cleavage sites A0, A1, and A2. Using a fluorescence-based visual assay for 40 S subunit export, we observe a strong nucleolar accumulation of the Rps2p-green fluorescent protein reporter in noc4 ts mutants, but 60 S subunit export was normal. Thus, Noc4p and Nop14p form a novel Noc complex with a specific role in nucleolar 40 S subunit formation and subsequent export to the cytoplasm.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Eukaryotic ribosome biogenesis is spatially organized into different subcellular compartments. Most steps in the pathway leading to mature ribosomes occur in the nucleolus, a specialized nuclear substructure, which includes transcription of the rDNA by RNA polymerase I, modification of the synthesized precursor RNA, and the assembly of both many ribosomal and non-ribosomal proteins with pre-ribosomal RNA (1). In the yeast Saccharomyces cerevisiae the resulting large ribonucleoprotein complex forms the 90 S pre-ribosome, which is split into precursor particles for the mature 40 S and 60 S ribosomal subunit (2). During or after their maturation the pre-ribosomes leave the nucleolus, move toward the nuclear pore, gain export competence, and are finally exported into the cytoplasm. Some maturation steps like processing of the 20 S rRNA intermediate within the 40 S subunit and the association of a few ribosomal proteins to the ribosomes occur rather late, even in the cytoplasm (3).

Many factors known to be involved in biosynthesis and maturation of ribosomes were identified and characterized in S. cerevisiae (4, 5). This organism represents a well suited model organism to study eukaryotic ribosome biogenesis, because homologues of the factors required are found in many eukaryotes. Of the more than 70 non-ribosomal proteins that participate in generation of ribosomes, most have been described to be required for modification of rRNA or removal of the external and internal spacer sequences from the precursor 35S pre-RNA. End products of the rRNA processing pathways are the 18 S rRNA, which is present in the 40 S subunit and the 25 S and 5.8 S rRNA, as well as the RNA polymerase III-encoded 5 S rRNA, which are the rRNA constituents of the 60 S subunit. Among the transacting factors involved to produce mature 40 S and 60 S subunits are nucleases, putative RNA helicases, RNA modifying proteins, and proteins associated with small nucleolar RNAs (4, 5) (see also www.expasy.ch/linder/proteins.html).

Folding, processing, and maturation of the rRNA is coordinated with the association of ribosomal proteins, with the assembly and disassembly of transacting factors, and with the movement of the ribosomal particles toward the nuclear pore (6, 7). Different pre-ribosomal particles are generated, which differ in their sedimentation behavior on sucrose density gradients and in both their incorporated rRNA intermediates and (non-)ribosomal proteins. The 35S pre-rRNA, which is the primary rDNA transcript, is a constituent of the 90 S pre-ribosome. Precursor particles of the 40 S ribosomal subunit co-sediment with a size of ~43 S and contain 20 S pre-rRNA, whereas 60 S precursors co-sediment with ~66 S and contain 27 S or 25 S, 5 S, and 7 S pre-rRNA (2, 8, 9). The components associated with the different pre-ribosomal particles are thought to comprise the machineries required for ribosomal subunits formation and their regulation, as well as for quality control steps and for the movement of pre-ribosomes from the nucleolus to the cytoplasm. These protein complexes are transiently associated with nascent ribosomes. Recently, it became possible to purify large precursor assemblies employing (tandem-)affinity purification strategies under mild ionic strength using tagged non-ribosomal precursor subunits. Several 60 S and 40 S pre-ribosome intermediates could be isolated, which differ in their subunit composition (10-14) and probably reflect a snapshot of nascent ribosomes at a particular stage of development (15).

Biochemical purification of a subnucleolar structure and development of visual screens helped to identify factors that couple 60 S ribosome maturation to the nuclear export of the precursor particles (16-19). Recently, we have identified three novel nucleolar proteins that can be isolated in two heterodimeric complexes; Noc1p-Noc2p is associated with 90 S and 66 S pre-ribosomes in the nucleolus, whereas Noc2p-Noc3p assembles with 66 S particles throughout the whole nucleus (20). The dynamic interaction of the Noc proteins appeared to be crucial for maturation and intranuclear movement of pre-ribosomes leading to the mature 60 S subunit. A common feature of Noc1p and Noc3p is a conserved stretch of 45 amino acids, which is also present in a third yeast protein, which we termed Noc4p (20). Here, we analyze the properties of Noc4p and show that it is required for maturation and transport of the 40 S, but not the 60 S, subunit. Noc4p localizes to the nucleolus and forms a stable heterodimer with Nop14, which was recently described to be involved in 40 S subunit biogenesis (21). Apparently, formation of different pairs of related Noc proteins represents a common theme in ribosome biogenesis; they participate in distinct steps of either pre-40 S or pre-60 S ribosome assembly, which is directly linked to ribosomal precursor transport.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Yeast Strains, DNA Recombinant Work, and Microbiological Techniques-- Yeast strains used in this study are given in Table I. Microbiological techniques, plasmid transformation and recovery, mating, sporulation of diploids, and tetrad analysis were done essentially as described (22). DNA recombinant work was performed according to Ref. 23.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Yeast strains

Plasmid Constructions-- Plasmids pNOPPA1L and pNOPGFP1L were described previously (24). Noc4 with its authentic 5' and 3' untranslated region was amplified by PCR from yeast genomic DNA using 5'144c1F-HindIII and 3'144c1R-KpnI oligonucleotides as primers. The derived fragment was cut with HindIII and KpnI and cloned into YCplac33 using the same sites, generating YCplac33-NOC4.

A protein A-tagged version of NOC4 was generated by cloning the Noc4 gene amplified by PCR with their authentic 3' into pNOPPA1L. NOC4 was amplified using oligonucleotides 5'144c2F-HindIII and 3'144c2R-XhoI and cloned using HindIII and XhoI sites of pNOPPA1L, generating pNOPPA1L-NOC4. pNOPGFP1L-NOC4 was generated utilizing the same restriction sites and oligonucleotides as for pNOPA1L-NOC4.

Strain Construction-- Strain NOC4 shuffle was obtained by transforming plasmid Ycplac33-NOC4 into strain BY4743. After tetrad analysis KAN+ URA+ spores were selected. Strain ProtA-NOC4 and GFP-NOC4 were obtained by transforming NOC4 shuffle with plasmids pNOPPA1L-NOC4 and pNOPGFP1L-NOC4 and shuffling out of the URA3 containing vector using 5-fluoro-orotic acid. Functionality of these tagged version of Noc proteins was tested, and no growth defects were observed. Genomic integration of GFP1 or protein A in-frame with NOC4 and Nop14, respectively, was obtained as described previously (25). Generation of noc4 temperature-sensitive strain was performed by random PCR-mediated mutagenesis using plasmid pNOPPA1L-NOC4 and oligonucleotides o_nocup and o_nocdo as described previously (26). Both noc4 ts mutants stopped growth at 37 °C after one doubling time.

Mass Spectrometry and Protein Identification-- Mass spectrometry was performed as described previously (11).

Affinity Purification of Protein A-tagged Noc Proteins-- Affinity purification of protein A-tagged Noc proteins was performed as described previously (20). Preparation of yeast cell extracts was according to Ref. 27. Briefly, 20 liters of yeast cultures were grown in YPD to A600 of 1-2 (2 × 1011 cells), harvested by centrifugation, washed with ice-cold distilled water, resuspended in ice-cold lysis buffer (0.5 ml/g of cell paste) (0.15 M Hepes, pH 7.8, 60% glycerol, 0.5 M (NH4)2SO4, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 2 mM benzamidine), and frozen in liquid nitrogen. Subsequent manipulations were done at 5 °C. After thawing the cells, the equal volume dilution buffer (0.1 M Hepes, pH 7.8, 20 mM MgCl2, 200 mM (NH4)2SO4, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 2 mM benzamidine) was added, and cells were broken with glass beads as described (28), using four cycles of bead beating for 20 s. Glass beads and cellular debris was removed by centrifugation at 14000 × g for 20 min, and the supernatant was clarified by centrifugation at 100,000 × g for 90 min.

Ribosomes Purification by Sucrose Density Gradient Centrifugation Analysis-- Analysis of polysomes by sucrose density gradient centrifugation was performed as described (20). To disrupt the ribosomal subunits, cells were not incubated with cycloheximide before breakage, and cell breakage and sucrose gradient analysis were performed in 20 mM Hepes, pH 7.8, 100 mM NaCl, 20 mM EDTA, and 1 mM dithiothreitol.

Construction of the Rps2p-eGFP Reporter-- The plasmid pRS316-Rps2p-eGFP was obtained by replacing the RPL25 open reading frame with the RPS2 gene (29) in plasmid pRS316-RPL25-eGFP (17). RPS2, which consists of the entire open reading frame plus 500 nucleotides of its 5' untranslated region including the promoter region, was amplified from genomic DNA by PCR using the primers AAAAAAGAGCTCGCTTATTCACTAAGGATTCTTAAGGTTT and TTTTTTGGATCCGAATCTCTTCTTTTGAGCAGAAGCTTCA. The 1.3-kb PCR product was digested with the restriction enzymes BamHI and SacI and cloned into the 5.9-kb SacI-BamHI cut vector pRS316-RPL25-eGFP. Complementation of the rsp2Delta disruption strain by the Rps2p-eGFP reporter construct was tested in the following way: a diploid yeast strain, which is heterozygous for the rsp2Delta disruption (obtained from Euroscarf), was transformed with pRS316-RPS2-eGFP on synthetic-dextrose complete medium lacking uracil plates, and subsequently transformants were sporulated. After tetrad analysis, spores carrying the rsp2Delta disruption and the pRS316-RPS2-eGFP plasmid were selected and tested for complementation by growth on YPD plates at 30 and 37 °C.

Fluorescence Microscopy to Detect the Rps2p-GFP Reporter in Living Cells-- Plasmids pRS315-RPS2-eGFP or pRS315-RPL25-eGFP were introduced into yeast cells by transformation and selected on synthetic-dextrose complete medium lacking leucine plates. Individual transformants were grown on SDC-leu plates for 4-5 days at 23 °C before transfer in liquid YPD medium and shift to 37 °C for the indicated times. After centrifugation, cells were resuspended in water, mounted on a slide, and viewed in the fluorescent channel of a Zeiss Axioskop fluorescence microscope. Pictures were obtained with a Xillix Microimager CCD camera. Digital pictures were processed by the Improvision software program (Open lab) and Photoshop 4.0.1 (Adobe).

RNA Extraction and Northern Blot Analysis-- RNA was prepared according to Ref. 30. Briefly, 20 ml of yeast culture were harvested and resuspended in 0.4 ml of buffer AE (50 mM sodium acetate, pH 5.3, 10 mM EDTA). 0.04 ml of 10% SDS and 0.440 ml of phenol (equilibrated in buffer AE) was added, and after mixing the suspension was incubated for 4 min at 65 °C. After cooling for 10 s in ethanol/dry ice, phenol and cellular material was spun down for 2 min at 14000 × g. The aqueous phase was extracted once with phenol and once with chloroform; RNA was precipitated by addition of 0.1 volume of 3 M sodium acetate, pH 5.3, and 2.5 volumes ethanol.

20 µg of the resulting pelleted RNA were resolved by denaturating agarose gel electrophoresis and blotted onto a Hybond-N membrane (Amersham Biosciences) according to Ref. 23. Hybridization with radiolabeled oligonucleotides was carried out overnight at 30 °C in 50% formamide, 5× SSC, 50 mM sodium phosphate, pH 6.5, 0.4% SDS, 0.1 mg/ml salmon sperm DNA, 5× Denhardt's solution. To detect 27 S rRNA and 7 S rRNA, 20 S rRNA and actin-mRNA end-labeled oligonucleotides 5'C2-site, 5'A2-site, and actin, respectively, were used. After hybridization the blot was washed twice with 2× SSC and twice with 0.1% SDS in 2× SSC for 30 min at 30 °C and exposed to x-ray films.

Pulse-Chase Labeling of rRNA-- Pulse-chase labeling of rRNA was performed with minor modifications as described by Zanchin et al. (31). Cells of strains ProtA-NOC4 and noc4-1 were grown to early log phase at 25 °C in YPD and then incubated for 3.5 h at 37 °C. The cultures were harvested by centrifugation and resuspended in 1/5 volume of YNB complemented by histidine, lysine, methionine, and 2% glucose. Following a 5-min incubation at 37 °C, 10 µl of 5,6-3H-uracil (45 Ci/mmol, 1mCi/ml; Amersham Biosciences) were added per ml of culture. After 3 min the chase was started by adding unlabeled uracil to a final concentration of 200 µg/ml. Samples of 1 ml were frozen in liquid nitrogen just after starting the chase at the time points indicated. Total RNA was isolated from the cells by the hot-phenol method (32), separated on 1.2% agarose/6% formaldehyde gels, and transferred to Hybond-N+ membranes (Amersham Biosciences). After treatment with En3hance spray (PerkinElmer Life Sciences) the membrane was exposed overnight to an X-OMAT AR film (Amersham Biosciences) at -80 °C.

Miscellaneous-- SDS-PAGE and Western blot analysis were performed according to Ref. 33. Polyclonal antibodies Noc1p and Noc3p were described in Ref. 20. Polyclonal antiserum against S8 and L16 were a kind gift of G. Dieci (Parma). Rabbit peroxidase-anti-peroxidase (Jackson ImmunoResearch) was used in 1:5000 dilution to detect protein A tag in Western blot analysis.

Oligonucleotides used for cloning, PCR, and detection of RNA were as follows: 5'C2-site, GGC CAG CAA TTT CAA GTT A; 5'A2-site, GCT CTC ATG CTC TTG CC; actin, GGA GCG TCG TCA CCG GCA AAA CCG GC (oligonucleotides ON2, ON3, ON4, ON6, ON7, and ON9 were according to Ref. 34); o_nocup, CAA TAA CTC CGA TCA AAT TAA CTC AAA TCA AC; o_nocdo, GCA GTG AGC GCA ACG CAA TTA ATG TGA G; 5'144c1F-HindIII, TTT TTT AAG CTT GCG TCC TTG TCA TTC TTA AGA ATG; 3'144c1R-KpnI, TTT TTT GGT ACC TAA TAA CGC GGG GAT CAG CGG T; 5'144c2F-HindIII, TTT TTT AAG CTT ATG GTA TTG CTT ATA TCA GAA ATT AAA G; 3'144c2R-XhoI, TTT TTT CTC GAG TAA TAA CGC GGG GAT CAG CGG T.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Noc4p Is a Nucleolar Protein with a "Noc Domain"-- The short and conserved Noc domain (~45 amino acids in length) is found in Noc1p and Noc3p, two nuclear proteins with a role in transport and maturation of ribosomal 60 S subunits. Interestingly, an uncharacterized yeast protein named Noc4p also exhibits such a Noc domain (20). To find out whether Noc4p is involved in ribosome biogenesis, we sought to characterize Noc4p, which is an essential protein of 63 kDa. Together with the other Noc proteins, Noc4p is enriched in the previously isolated large nucleolar subcomplex (data not shown) that contains many factors involved in rDNA transcription and ribosome biogenesis (16). Consistent with this biochemical data, chromosomally encoded Noc4p-GFP is located in the nucleolus (Fig. 1A). Because Noc4p not only has the short Noc domain (residue 447-488 in Noc4p) but shows an extended homology throughout a large part of the Noc1 sequence (Fig. 1B), Noc4p and Noc1p could perform a related function. Moreover, Noc4p orthologs exist in other organisms including Schizosaccharomyces pombe and human (Fig. 1B). Taken together these data suggest that Noc4p is a further member of the Noc protein family with a role in ribosome biogenesis.


View larger version (96K):
[in this window]
[in a new window]
 
Fig. 1.   The nucleolar protein Noc4p and its homologues. A, Noc4p is located in the nucleolus. Noc4p-GFP was expressed in the noc4 null strain and visualized by fluorescence microscopy. To show nucleolar location, the DsRed-Nop1 marker was co-expressed in the cells. The Noc4p-GFP and DsRed-Nop1p pictures were merged to observe colocalization. B, Noc4p and Noc1p homologues are structurally related. Sequence comparison of S. cerevisiae Noc4p and Noc1p and their homologues in S. pombe and Homo sapiens. Black or gray rectangles indicate invariant or homologues residues, respectively. The stretch of 45 amino acids of the Noc domain is marked. GenBankTM accession numbers for Noc4p and homologues are as follows: S. cerevisiae (S69032; systematic name Ypr144c), S. pombe (T39508), and H. sapiens (mRNA; MGC3162). GenBankTM accession numbers for Noc1p are as follows: S. cerevisiae (S54044), S. pombe (T38813), and H. sapiens (A36368).

Noc4p Stably Associates with Nop14p-- Previous work showed that Noc1p and Noc2p form a stable heterodimeric complex, which is associated with 60 S pre-ribosomes and required for ribosome maturation and nuclear export. When functional ProtA-tagged Noc4p was affinity-purified under the same stringent conditions that yielded the Noc1p-Noc2p heterodimer, another protein of ~98 kDa was co-enriched (Fig. 2, lane 3). Mass spectrometry analysis identified this protein as Nop14p, which was shown previously to play a role in 40 S subunit biogenesis (21). Subsequently, we generated a chromosomally integrated Nop14p-ProtA and affinity-purified it under the same stringent conditions. This revealed that the major band co-purifying with Nop14p-ProtA is Noc4p (Fig. 2, lane 4). Other bands found in the Nop14p-ProtA eluate were Noc4p or Nop14p breakdown products and heat shock proteins (possible contaminants). Notably, antibodies raised against the N-terminal domain of Noc2p detect Nop14p on Western blots, suggesting a structural relationship between both proteins, despite the fact that Nop14p and Noc2p do not exhibit an apparent sequence homology (data not shown). Taken together, our data show that Noc4p and Nop14p form a heterodimeric complex, reminiscent of the previously characterized Noc1p-Noc2p and Noc3-Noc2p complexes.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2.   Dimeric Noc complexes. Functional fusion proteins ProtA-Noc1p and ProtA-Noc4p expressed in the corresponding null strains and chromosomal encoded Nop14-ProtA were affinity-purified on IgG-Sepharose beads. Co-purifying proteins were separated by SDS-PAGE, visualized by Coomassie staining, and identified by mass spectrometry. The triangle indicates a heat shock protein present in all three purifications.

Noc4p Is Required for 40 S Subunit Biogenesis-- Previous work showed that Nop14p plays a role in 40 S subunit biogenesis (21), yet Noc1p, which is related to Noc4p (see Fig. 1B), is involved in 60 S subunit biogenesis (20, 35). Therefore, we sought to generate temperature-sensitive noc4 mutants to test them for defects in rRNA processing, ribosome formation, and nuclear export. Two noc4 ts mutants, noc4-1 and noc4-2, which grow well at 24 °C, but not at 37 °C, were obtained (Fig. 3A). The mutated noc4-1 protein has amino acid exchanges at position 283 (Ser right-arrow Pro), 344 (Ile right-arrow Val), 463 (Leu right-arrow Gln), and 550 (Val right-arrow Ala). Strikingly, the amount of free 40 S subunits significantly decreased in the noc4-1 mutant upon shift to the restrictive temperature, whereas the amount of 60 S subunits increased. In contrast, the noc1-1 mutant shows opposite effects with a loss of 60 S and an increase of 40 S subunits (Fig. 3, B and C). Similar results were obtained when a noc4 ts mutant was used that exhibits a mutation in the Noc domain (data not shown).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3.   noc4 ts mutants are impaired in 40 S ribosome biogenesis. A, growth defect of noc4 ts mutants at elevated temperature. Dilutions of strain ProtA-Noc4 and yeast strains bearing the noc4-1 and noc4-2 mutation were spotted onto YPD plates and incubated at the temperature indicated. B, UV profiles of polysome gradients. A260 nm of polysome sucrose gradients derived from wild-type (WT) cells, noc1-1 and noc4-1 mutants at permissive (25 °C), and 3.5 h after shift to restrictive (37 °C) temperature. The Western blot depicted below the profile of the noc4 ts mutant (37 °C) documents the sedimentation of the 60 S subunit (antibodies directed against Rpl3). C, UV profiles of ribosomal particles from strain noc4-1 on sucrose gradients in the presence of EDTA. Whole cell extracts were separated on a sucrose gradient in the presence of 20 mM EDTA to disrupt the two ribosomal subunits.

Noc4p Is Required for Processing of 18 S rRNA-- To test whether and at which specific steps Noc4p is involved in the processing pathway leading to 18 S rRNA, the rRNA component of the 40 S subunit, we performed Northern analysis (Fig. 4, B and C) and pulse-chase experiments (Fig. 4D). After a 4-h shift to restrictive temperature (37 °C), the total amount of mature 18 S rRNA was significantly reduced in the noc4-1 mutant, whereas the 25 S rRNA level remained almost unaffected (Fig. 4C). Fig. 4B also depicts that noc4 ts mutants are defective in the pathway leading to mature 18 S rRNA but not to 25 S and 5.8 S rRNA; the 20 S pre-rRNA (the immediate precursor to mature 18 S rRNA) was significantly decreased in the noc4-1 mutant, whereas the 35S pre-rRNA was more pronounced after shift to the restrictive temperature; in contrast, after an initial reduction briefly after the temperature shift, the amounts of 27 S and 7 S pre-rRNA (precursors of the mature 25 S and 5.8 S rRNA, respectively) raised again to wild-type levels (Fig. 4B). To compare the precise processing steps that are affected in noc4 and in noc1 mutants, we used different probes complementary to certain regions of the rRNA transcript. The reduction in the 20 S, 32 S, and 27 S A2 rRNA species in the noc4 mutants clearly indicates blocks at the early cleavage steps at A0, A1, and A2, respectively. Furthermore, an intermediate could be detected that corresponds in size to the 23 S product, a presumably aberrant species when processing at the early sites A0-A2 are blocked. Interestingly, this 23 S species was only slightly accumulated when compared with other yeast strains defective in 18 S processing. This could be because of a reduced stability of this intermediate in noc4 ts mutants. Appearance of the 27SA/27SB rRNA intermediate underlines that later cleavage steps still occur and that the processing of 25 S and 5.8 S rRNA is not affected in the noc4-1 mutant. By contrast, the noc1-1 mutant showed cleavage at sites A1 and A2 (the 20 S species is still detectable) but is impaired in 25 S processing, because all 27 S intermediates are clearly reduced.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4.   noc4 ts mutants are impaired in processing of 18 S rRNA. A, scheme of rRNA processing. The probes for Northern analysis are indicated in the upper two levels. B, Northern analysis of pre-rRNA processing. Left panel, noc4-1 was analyzed following growth at 24 °C (0 and 4-h samples) and 1, 2, and 4 h after transfer to 37 °C. Pre-rRNA species detected are indicated. The probes for hybridization were used simultaneously (oligos 5'A2, 7, and actin). Right panel, quantification of the noc4-1 pre-rRNAs after shift to 37 °C. The signals were normalized using actin mRNA as an internal standard. C, comparison of pre-rRNA cleavages in WT cells and noc1-1 and noc4-1 mutants. rRNA levels were analyzed at time points 0 and 4 h after shift to 37 °C for WT strains and noc1-1 mutants and at 1, 2, and 4 h for noc4-1, respectively. rRNA species used and probes used are indicated. D, pulse-chase labeling of rRNA (intermediates) in WT cells and noc4-1 mutants. Cells were grown at 24 °C, shifted at 37 °C for 3.5 h, and pulse-labeled with 3H-uracil for 3 min. The cells were chased for the time points indicated with an excess of unlabeled uracil. Equal amounts of extracted RNA were loaded on each lane of a denaturing 1.2% agarose gel. Positions of mature and intermediate forms of rRNA are indicated.

Pulse-chase experiments confirmed the results obtained by Northern analysis. After a 3.5-h shift to non-permissive temperature, cells were labeled with 3H-uracil and chased for certain time periods with an excess of cold uracil. As expected, comparison of the time course of rRNA processing between wild-type and noc4-1 mutant cells revealed a delayed cleavage of the 35S rRNA and a strong reduction of the 18 S rRNA in the mutant strain, whereas processing to the mature 25 S rRNA still occurs although it is delayed. Thus, our data demonstrate that Noc4p and Noc1p, although structurally related, participate in two different ribosome biogenesis pathways that lead to 40 S and 60 S subunits, respectively.

The Noc4p-Nop14p Heterodimer Associates with 40 S Pre-ribosomal Particles-- As Noc4p and Nop14p participate in 40 S subunit biogenesis, we wanted to know whether they associate with pre-ribosomal particles to the 40 S subunit. Therefore, we performed sucrose gradient centrifugation of yeast lysates containing ribosomal and pre-ribosomal particles and looked for co-fractionation with Noc4p-ProtA and Nop14p-ProtA. This revealed that Noc3p co-sediments with 66 S pre-ribosomes, and Noc1p co-sediments with 66 S and 90 S pre-ribosomes (see also Ref. 20). Apparently, Noc4p does not co-peak with 66 S particles but is detected in fractions of higher density, which could correspond to 90 S particles (Fig. 5, upper panel). Moreover, a small fraction of ProtA-tagged Noc4p is present in the part of the gradient that contains 43 S pre-ribosomes and 40 S subunits, which becomes evident upon a longer exposure of the Western blot (data not shown). A similar sedimentation behavior on sucrose gradients was also observed for Nop14p-ProtA, although this fusion protein tends to be partly degraded during overnight centrifugation in fractions with rather high protein concentrations (data not shown). We conclude that Noc4p and Nop14p are associated with precursor particles to the 40 S subunit.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 5.   Sedimentation behavior of Noc4p and Nop14p proteins and (pre-)ribosomal particles on sucrose gradients. Analysis of polysomal fractions derived from strain ProtA-NOC4 grown at 30 °C was performed as described under "Experimental Procedures." Aliquots of the fractions were analyzed by Western blot analysis with polyclonal antisera directed against ribosomal protein S8 or affinity-purified antibodies directed against either Noc1p or Noc3p. The fractions containing 40 S, 60 S, and 90 S ribosomal subunits are marked.

Nucleolar Location of Nop14p Depends on Intact Noc4p-- Previous work showed that the Noc proteins Noc1-3 exhibit a dynamic intranuclear distribution (20). To find out whether the Noc4-Nop14p complex also has the capability to migrate between the nucleolus and nucleoplasm, we sought to analyze the intranuclear location of Nop14p-GFP in noc4 ts mutants. In wild-type cells, Nop14p-GFP like Noc4p-GFP is mainly located in the nucleolus (Fig. 6). However, Nop14p-GFP is significantly found in the nucleoplasm in the noc4-1 mutant upon shift to the restrictive temperature (Fig. 6; see merge between the Noc4-eGFP and DNA staining). This suggests that an intact Noc4p is required for steady-state nucleolar location of Nop14p.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 6.   In Vivo localization of Nop14p-GFP in wild-type cells and in the noc4-1 ts mutant after shift to the non-permissive temperature. Shown are fluorescence microscopy photographs of Nop14p-GFP in wild-type (NOC4+) and noc4-1 ts cells shifted for 4 h to 37 °C. Cells were also stained for DNA, and the GFP- and 4',6'-diamidino-2-phenylindole-stained pictures were merged.

A Fluorescence-based in Vivo Assay Reveals That noc4 ts Mutants Are Defective in 40 S Subunit Export-- Previous studies revealed that the Noc1-Noc2 and Noc2-Noc3 complexes are involved in intranuclear transport and nuclear export of 60 S pre-ribosomal subunits (20). We sought to analyze whether the Noc4p-Nop14p complex plays a role in the export of 40 S subunits from the nucleolus into the cytoplasm. To this end, we developed a visual in vivo assay for 40 S small subunit export exploiting a GFP-tagged version of a ribosomal protein of the 40 S subunit. This assay, together with the previously established 60 S subunit export assay (18), allows us to study under comparable conditions which factors are involved in ribosomal export and which affect large and small subunit export differently. Furthermore, it can be determined whether and which (mal)function in 40 S biogenesis is coupled to 40 S transport. Recently, another test system for 40 S subunit export was reported; however, this assay was based on in situ hybridization of rRNA (19).

The essential ribosomal protein Rps2p served as a suitable reporter for the in vivo small subunit assay. Importantly, GFP-tagged Rps2p (Rps2p-eGFP) efficiently complements the non-viable rps2 null mutant (Fig. 7A). Furthermore, Rps2p-eGFP is exclusively located in the cytoplasm, with nuclear and vacuolar exclusion, as revealed by fluorescence microscopy (Fig. 7B). Moreover, Rps2p-eGFP effectively assembles into 40 S subunits and thus is also found in 80 S ribosome and polysome fractions (Fig. 7C). Finally, it was tested whether Rps2p-eGFP accumulates in the nucleus of a bona fide export mutant. Recently, it was shown that Xpo1p, which is the export receptor for nuclear export signal-containing export cargoes (36), is involved in 60 S (17, 37) and 40 S subunit export (19). As expected, the xpo1-1 ts mutant exhibits a strong nuclear accumulation of the Rps2p-eGFP reporter after shift to the restrictive temperature (Fig. 7D).


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 7.   A fluorescence-based in vivo assay for 40 S subunit export. A, growth of the Rps2p-GFP strain. The disruption strain rps2Delta complemented by Rps2p-GFP and an isogenic wild-type strain were grown at 30 and 37 °C for 4 days. Precultures were diluted in growth medium, and equivalent amounts of cells (diluted in 10-1 steps) were spotted onto YPD plates. For description of strains, see "Experimental Procedures" and Table I. B, fluorescence microscopy of the rps2Delta disruption strain complemented by Rps2p-GFP. The corresponding Nomarski picture is also shown. C, Rps2p-GFP associates with 40 S subunits, 80 S ribosomes, and polysomes. The UV profiles (A260 nm) of the sucrose gradient are depicted, and 40 S subunits, 60 S, subunits, 80 S ribosomes, and polysomes are indicated. The fractions from the sucrose gradient were analyzed by SDS-PAGE and Western blotting using an anti-GFP-antibody, which detects the Rps2p-GFP reporter protein. D, Rps2p-GFP accumulates in the nucleus in the temperature-sensitive xpo1-1 mutant. Rps2p-GFP was expressed in xpo1-1 cells, which were shifted for 1 h to the non-permissive temperature (37 °C) before the fluorescence picture was taken.

We next tested whether nuclear export of 40 S and 60 S subunits is impaired in the noc4 ts mutant, using the fluorescence-based in vivo export assays for 40 S (Rps2-eGFP) and 60 S subunits (Rpl25-eGFP) (Fig. 8). Whereas Rps2p-eGFP significantly accumulates in the nucleus of two different noc4 ts mutants upon shift to the non-permissive temperature, nuclear export of the large subunit reporter Rpl25p-eGFP is not impaired (Fig. 8A). To test whether Noc1p, Noc2p, and Noc3p are required for 40 S subunit export, the ts mutants noc1-1, noc2-1, and noc3-1 were transformed with the Rps2p-eGFP reporter. However, no nuclear accumulation of the small subunit reporter was seen in these noc mutants after shift to the non-permissive temperature (Fig. 8B). Previous work showed nuclear accumulation of Rpl25p-eGFP in noc1, noc2, and noc3 ts mutants (20). To find out whether the Rps2-GFP reporter remains associated with pre-ribosomal particles at the restrictive condition, we performed sucrose gradient centrifugation of whole cell lysates derived from the noc4-1 (Fig. 8C) and noc4-2 (not shown) ts mutants grown at the permissive temperature or shifted for 4 h to the restrictive temperature. Western blot analysis of these sucrose gradient fractions revealed no free Rps2-eGFP reporter in the upper part of the gradient, and Rps2-eGFP was exclusively found in the lower part of the gradient, which contains ribosomes and pre-ribosomal particles (Fig. 8C). These data show that the small subunit reporter Rps2-GFP remains associated with 40 S pre-ribosomes upon shift of the noc4 ts mutants to the non-permissive temperature. Moreover, the amount of 40 S subunits is decreased whereas that of 60 S subunits is increased in both noc4 ts mutants upon shift to the restrictive temperature (see also Fig. 3). All ts mutants yet analyzed that are impaired in 40 S biogenesis also exhibited a defect in the small subunit export assay (data not shown). Apparently, 40 S subunit maturation is closely linked to its transport, and it is not yet distinguishable whether accumulation of the Rps2-GFP reporter construct in the nucleolus is because of the blockage of 40 S biogenesis, the missing relief of a retention signal, or the direct inhibition of transport. We conclude that maturation and nuclear export of 40 S pre-ribosomes requires the Noc4-Nop14p complex, whereas 60 S subunit maturation and export depends on the Noc1p/2p and Noc2p/3p complexes.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 8.   Temperature-sensitive noc4 mutants are defective in 40 S subunit, but not 60 S subunit, export. A, analysis of 40 S and 60 S subunit export in noc4-1 and noc4-2 mutants expressing the Rps2p-GFP and Rpl25p-GFP reporter constructs. Cells were shifted for 5 h to 37 °C before pictures were taken in the fluorescence microscope. B, Rps2p-GFP does not accumulate in the nucleus in thermosensitive noc1, noc2, and noc3 mutants. ts strains noc1-1, noc2-1, and noc3-1, transformed with the Rpl25p-GFP large subunit reporter, were shifted for 5 h to 37 °C before they were viewed in the fluorescence microscope and under Nomarski optics. C, Rps2p-GFP remains associated with pre-ribosomal particles in noc4 ts mutants upon shift to the restrictive temperature. Sucrose gradient centrifugation of whole cell lysates derived from the noc4-1 mutants grown at the permissive temperature or shifted for 4 h to the restrictive temperature. A260 nm profiles of sucrose gradients (40 S, 60 S, and 80 S ribosomes and polysomes) are indicated. The fractions from the sucrose gradient were analyzed by SDS-PAGE and Western blotting using an anti-GFP-antibody to detect Rps2p-GFP.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

To date little is known about how 40 S subunits assemble in the nucleolus and are exported in the cytoplasm. We could demonstrate that Noc4p is part of the stable Noc4p-Nop14p heterodimer and is specifically involved in maturation of the 40 S subunit, which is closely linked to pre-40 S subunit transport from the nucleolus to the cytoplasm. In contrast, the related Noc1p-Noc2p and Noc2p-Noc3p complexes have specific roles in biogenesis and transport of the 60 S subunits. In particular, we have developed a fluorescence-based in vivo assay, which allows us to monitor specifically 40 S nuclear export and to directly compare it to 60 S subunit export. Both in vivo export assays use functional GFP-tagged ribosomal proteins of the small (Rps2p-eGFP) and large subunit (Rpl25p-eGFP). In agreement with its specific role in 40 S subunit export, Noc4p is involved in rRNA processing of 18 S, but not of 25 S and 5.8 S, rRNA. Thus, the Noc4p-Nop14p complex adds to a growing list of related complexes that play a role in maturation-coupled transport processes of different pre-ribosomal particles.

A homology observed between Noc1p and a novel and uncharacterized protein termed Noc4p was the basis to identify the novel Noc4-Nop14p heterodimer. Thus, several Noc-complexes (Noc1p-Noc2p, Noc2p-Noc3p, Noc4p-Nop14p) have now been characterized. The capability to form separate Noc heterodimers points to an interesting principle in ribosome biogenesis; Noc complexes can either participate in subsequent steps during biogenesis of a distinct precursor species (e.g. 60 S pre-ribosomes) or function in the biogenesis of different pre-ribosomal particles (i.e. 60 S and 40 S subunits). Thus, Noc complexes may perform both common and different functions, thereby coupling intranuclear assembly and movement of pre-ribosomal particles with export into the cytoplasm.

Possible functions of Noc complexes are to accompany their cognate pre-ribosomal particle during maturation, actively mediate maturation, actively promote transport from the nucleolus to the nuclear pore, or overcome intranucleolar/intranuclear retention sites. A common structural element within several Noc proteins is the Noc domain, which could trigger some of these events. Notably, a change in Noc complex composition, which correlates with association to different particles and with different nuclear locations, was observed for the Noc2p-containing complexes. When Noc2p is associated with Noc1p, it is predominantly nucleolar and interacts both with 66 S and 90 S pre-ribosomes; however, when Noc3p is bound to Noc2p, the complex is also found in the nucleoplasm and exclusively associated with 66 S pre-ribosomes (20). In analogy, the Noc4-Nop14p heterodimer could function in distinct steps during 40 S subunit biogenesis/transport like the Noc1p-Noc2p complex that performs its role in 60 S subunit formation. Whether a second stable Nop14p-containing complex exists that is analogous to the Noc2p-Noc3p complex and functions in a later step during 40 S subunit biogenesis remains unknown.

The association of the Noc4p-Nop14p complex with 90 S particles might suggest that it is involved in an early step during 40 S subunit biogenesis. This conclusion is also supported by the observation that early pre-rRNA processing at sites A0, A1, and A2 is inhibited in both noc4 and nop14 ts mutants (see also Ref. 21). Moreover, rRNA processing and transport events leading to mature 60 S subunits are not significantly inhibited in noc4 ts mutants. This suggests that the cleavages leading to the release of pre-rRNA to 25 S rRNA are not dependent on the Noc4-Nop14p complex. It appears that the activities of the different Noc protein are clearly separated to either 60 S or 40 S biogenesis, which supports previous findings that 60 S and 40 S biogenesis can proceed independently from each other (38). At which particular stage pre-40 S subunit export is blocked in noc4 mutants and what causes the delayed and/or aberrant cleavages remains unclear; the latter could be because of either a primary effect on the RNA cleavage reaction or a feedback mechanism, because pre-40 S subunits cannot be properly assembled and/or transported. Whether the impaired transport is a consequence or a prerequisite of the inhibited cleavages at sites A0, A1, and A2 has to be elucidated. It is also possible that Noc4-Nop14p complexes function in several subsequent steps of 40 S biogenesis.

Interestingly, Noc4p and Nop14p have also been found in association with highly purified nuclear pore complexes (39). This could indicate that these proteins follow the 40 S pre-ribosomes from the nucleolus to the nuclear pore complexes where they might directly or indirectly mediate the interaction between the pre-ribosomes and the nuclear pore (for discussion see also Refs. 11 and 15). Another candidate that could follow pre-40 S particles through different maturation steps is Emg1p, a 40 S biogenesis factor, which was described recently to interact with Nop14p (21). Interestingly, the nuclear distribution of Emg1p is dependent on the presence of functional Nop14p (21), which indicates that at least some components of the network involved in nuclear pre-40 S biogenesis also have the potential to shuttle between cytoplasm and nucleus.

In a recently published large scale approach to characterize yeast multiprotein complexes Noc4p was identified in complexes that also contained Nop14p and Emg1p, as well as many other proteins that participate in 40 S biogenesis (40-42) (see also www.pre-ribosome.de/). Further analyses of these components revealed that they are associated with early pre-ribosomal particles that contain the 35S pre-rRNA primary transcript and U3 small nucleolar RNA (14). Moreover, these 90 S pre-ribosomal particles consist of a core of 35 non-ribosomal proteins, including proteins associated with U3 small nucleolar RNA and other factors required for 18 S rRNA synthesis. Among these core components are also Noc4p and Nop14p (14). Thus, our data presented here are fully consistent with a role of the Noc4p-Nop14p heterodimer as a component of 90 S pre-ribosomal particles required for 40 S subunit formation and export.

Which precise role the remarkable stable association between Noc4p and Nop14p plays in the pathway of 40 S formation remains to be elucidated. Future work will address the questions of how the many non-ribosomal factors including the Noc4-Nop14p heterodimer coordinate maturation and transport of 40 S pre-ribosomes from the nucleolus to the cytoplasm.

    ACKNOWLEDGEMENTS

We thank Dr. G. Dieci for providing antibodies against ribosomal proteins and I. Eckstein for yeast cultivation. The excellent technical assistance of E. Draken is gratefully acknowledged.

    FOOTNOTES

* This work was supported by funds of the Deutsche Forschungsgemeinschaft and of the Human Frontier Science Project Organization and by the Association pour la Recherche contre le cancer (to P. M. and N. G.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Present address: Laboratoire de Biologie Moleculaire Eucaryote, F-32062 Toulouse, France.

§ Both authors contributed equally to this work.

|| To whom correspondence may be addressed. Tel.: 49-6221-544173; Fax: 49-6221-544369; E-mail: cg5@ix.urz.uni-heidelberg.de.

** To whom correspondence may be addressed. Tel.: 49-6221-544149; Fax: 49-6221-544366; E-mail: IM4@ix.urz.uni-heidelberg.de.

Published, JBC Papers in Press, November 20, 2002, DOI 10.1074/jbc.M208898200

    ABBREVIATIONS

The abbreviations used are: GFP, green fluorescent protein; WT, wild-type; ts, thermosensitive; ProtA, protein A.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Woolford, J. L., Jr. (1991) Adv. Genet. 29, 63-118[Medline] [Order article via Infotrieve]
2. Trapman, J., Retel, J., and Planta, R. J. (1975) Exp. Cell Res. 90, 95-104[CrossRef][Medline] [Order article via Infotrieve]
3. Stevens, A., Hsu, C. L., Isham, K. R., and Larimer, F. W. (1991) J. Bacteriol. 173, 7024-7028[Abstract/Free Full Text]
4. Venema, J., and Tollervey, D. (1999) Annu. Rev. Genet. 33, 261-311[CrossRef][Medline] [Order article via Infotrieve]
5. Kressler, D., Linder, P., and de la Cruz, J. (1999) Mol. Cell. Biol. 19, 7897-7912[Free Full Text]
6. Kruiswijk, T., Planta, R. J., and Krop, J. M. (1978) Biochim. Biophys. Acta 517, 378-389[Medline] [Order article via Infotrieve]
7. Hadjiolov, A. (1985) Cell Biol. Monogr. 12, 1-268
8. Trapman, J., and Planta, R. J. (1976) Biochim. Biophys. Acta 442, 265-274[Medline] [Order article via Infotrieve]
9. Udem, S. A., and Warner, J. R. (1973) J. Biol. Chem. 248, 1412-1416[Abstract/Free Full Text]
10. Harnpicharnchai, P., Jakovljevic, J., Horsey, E., Miles, T., Roman, J., Rout, M., Meagher, D., Imai, B., Guo, Y., Brame, C. J., Shabanowitz, J., Hunt, D. F., and Woolford, J. L., Jr. (2001) Mol. Cell 8, 505-515[CrossRef][Medline] [Order article via Infotrieve]
11. Bassler, J., Grandi, P., Gadal, O., Lessmann, T., Petfalski, E., Tollervey, D., Lechner, J., and Hurt, E. (2001) Mol Cell 8, 517-529[CrossRef][Medline] [Order article via Infotrieve]
12. Saveanu, C., Bienvenu, D., Namane, A., Gleizes, P. E., Gas, N., Jacquier, A., and Fromont-Racine, M. (2001) EMBO J. 20, 6475-6484[CrossRef][Medline] [Order article via Infotrieve]
13. Dragon, F., Gallagher, J. E., Compagnone-Post, P. A., Mitchell, B. M., Porwancher, K. A., Wehner, K. A., Wormsley, S., Settlage, R. E., Shabanowitz, J., Osheim, Y., Beyer, A. L., Hunt, D. F., and Baserga, S. J. (2002) Nature 417, 967-970[CrossRef][Medline] [Order article via Infotrieve]
14. Grandi, P., Rybin, V., Bassler, J., Petfalski, E., Strauss, D., Marzioch, M., Schafer, T., Kuster, B., Tschochner, H., Tollervey, D., Gavin, A. C., and Hurt, E. (2002) Mol. Cell 10, 105-115[CrossRef][Medline] [Order article via Infotrieve]
15. Warner, J. R. (2001) Cell 107, 133-136[CrossRef][Medline] [Order article via Infotrieve]
16. Fath, S., Milkereit, P., Podtelejnikov, A. V., Bischler, N., Schultz, P., Bier, M., Mann, M., and Tschochner, H. (2000) J. Cell Biol. 149, 575-590[Abstract/Free Full Text]
17. Gadal, O., Strauss, D., Kessl, J., Trumpower, B., Tollervey, D., and Hurt, E. (2001) Mol. Cell. Biol. 21, 3405-3415[Abstract/Free Full Text]
18. Hurt, E., Hannus, S., Schmelzl, B., Lau, D., Tollervey, D., and Simos, G. (1999) J. Cell Biol. 144, 389-401[Abstract/Free Full Text]
19. Moy, T. I., and Silver, P. A. (1999) Genes Dev. 13, 2118-2133[Abstract/Free Full Text]
20. Milkereit, P., Gadal, O., Podtelejnikov, A., Trumtel, S., Gas, N., Petfalski, E., Tollervey, D., Mann, M., Hurt, E., and Tschochner, H. (2001) Cell 105, 499-509[CrossRef][Medline] [Order article via Infotrieve]
21. Liu, P. C., and Thiele, D. J. (2001) Mol. Biol. Cell 12, 3644-3657[Abstract/Free Full Text]
22. Santos-Rosa, H., Moreno, H., Simos, G., Segref, A., Fahrenkrog, B., Pante, N., and Hurt, E. (1998) Mol. Cell. Biol. 18, 6826-6838[Abstract/Free Full Text]
23. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
24. Hellmuth, K., Lau, D. M., Bischoff, F. R., Kunzler, M., Hurt, E., and Simos, G. (1998) Mol. Cell. Biol. 18, 6374-6386[Abstract/Free Full Text]
25. Longtine, M. S., McKenzie, A., III, Demarini, D. J., Shah, N. G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J. R. (1998) Yeast 14, 953-961[CrossRef][Medline] [Order article via Infotrieve]
26. Strasser, K., and Hurt, E. (2000) EMBO J. 19, 410-420[CrossRef][Medline] [Order article via Infotrieve]
27. Milkereit, P., Schultz, P., and Tschochner, H. (1997) Biol. Chem. 378, 1433-1443[Medline] [Order article via Infotrieve]
28. Flanagan, P. M., Kelleher, R. J., III, Tschochner, H., Sayre, M. H., and Kornberg, R. D. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7659-7663[Abstract/Free Full Text]
29. All-Robyn, J. A., Brown, N., Otaka, E., and Liebman, S. W. (1990) Mol. Cell. Biol. 10, 6544-6553[Abstract/Free Full Text]
30. Schmitt, M. E., Brown, T. A., and Trumpower, B. L. (1990) Nucleic Acids Res. 18, 3091-3092[Free Full Text]
31. Zanchin, N. I., Roberts, P., DeSilva, A., Sherman, F., and Goldfarb, D. S. (1997) Mol. Cell. Biol. 17, 5001-5015[Abstract]
32. Köhrer, K., and Domdey, H. (1991) Methods Enzymol. 194, 398-407[Medline] [Order article via Infotrieve]
33. Siniossoglou, S., Wimmer, C., Rieger, M., Doye, V., Tekotte, H., Weise, C., Emig, S., Segref, A., and Hurt, E. C. (1996) Cell 84, 265-275[CrossRef][Medline] [Order article via Infotrieve]
34. Kressler, D., de la Cruz, J., Rojo, M., and Linder, P. (1997) Mol. Cell. Biol. 17, 7283-7294[Abstract]
35. Edskes, H. K., Ohtake, Y., and Wickner, R. B. (1998) J. Biol. Chem. 273, 28912-28920[Abstract/Free Full Text]
36. Stade, K., Ford, C. S., Guthrie, C., and Weis, K. (1997) Cell 90, 1041-1050[CrossRef][Medline] [Order article via Infotrieve]
37. Ho, J. H., Kallstrom, G., and Johnson, A. W. (2000) J. Cell Biol. 151, 1057-1066[Abstract/Free Full Text]
38. Liang, W.-Q., and Fournier, M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 2864-2868[Abstract/Free Full Text]
39. Rout, M. P., Aitchison, J. D., Suprapto, A., Hjertaas, K., Zhao, Y., and Chait, B. T. (2000) J. Cell Biol. 148, 635-651[Abstract/Free Full Text]
40. Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick, J. M., Michon, A. M., Cruciat, C. M., Remor, M., Hofert, C., Schelder, M., Brajenovic, M., Ruffner, H., Merino, A., Klein, K., Hudak, M., Dickson, D., Rudi, T., Gnau, V., Bauch, A., Bastuck, S., Huhse, B., Leutwein, C., Heurtier, M. A., Copley, R. R., Edelmann, A., Querfurth, E., Rybin, V., Drewes, G., Raida, M., Bouwmeester, T., Bork, P., Seraphin, B., Kuster, B., Neubauer, G., and Superti-Furga, G. (2002) Nature 415, 141-147[CrossRef][Medline] [Order article via Infotrieve]
41. Ho, Y., Gruhler, A., Heilbut, A., Bader, G. D., Moore, L., Adams, S. L., Millar, A., Taylor, P., Bennett, K., Boutilier, K., Yang, L., Wolting, C., Donaldson, I., Schandorff, S., Shewnarane, J., Vo, M., Taggart, J., Goudreault, M., Muskat, B., Alfarano, C., Dewar, D., Lin, Z., Michalickova, K., Willems, A. R., Sassi, H., Nielsen, P. A., Rasmussen, K. J., Andersen, J. R., Johansen, L. E., Hansen, L. H., Jespersen, H., Podtelejnikov, A., Nielsen, E., Crawford, J., Poulsen, V., Sorensen, B. D., Matthiesen, J., Hendrickson, R. C., Gleeson, F., Pawson, T., Moran, M. F., Durocher, D., Mann, M., Hogue, C. W., Figeys, D., and Tyers, M. (2002) Nature 415, 180-183[CrossRef][Medline] [Order article via Infotrieve]
42. Milkereit, P., Kühn, H., Gas, N., and Tschochner, H. (2003) Nucleic Acids Res., in press


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
A. Perreault, C. Bellemer, and F. Bachand
Nuclear export competence of pre-40S subunits in fission yeast requires the ribosomal protein Rps2
Nucleic Acids Res., November 1, 2008; 36(19): 6132 - 6142.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
C. R. Houchens, A. Perreault, F. Bachand, and T. J. Kelly
Schizosaccharomyces pombe Noc3 Is Essential for Ribosome Biogenesis and Cell Division but Not DNA Replication
Eukaryot. Cell, September 1, 2008; 7(9): 1433 - 1440.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. White, Z. Li, R. Sardana, J. M. Bujnicki, E. M. Marcotte, and A. W. Johnson
Bud23 Methylates G1575 of 18S rRNA and Is Required for Efficient Nuclear Export of Pre-40S Subunits
Mol. Cell. Biol., May 15, 2008; 28(10): 3151 - 3161.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
B. R. Strub, M. B.K. Eswara, J. B. Pierce, and D. Mangroo
Utp8p Is a Nucleolar tRNA-binding Protein That Forms a Complex with Components of the Nuclear tRNA Export Machinery in Saccharomyces cerevisiae
Mol. Biol. Cell, October 1, 2007; 18(10): 3845 - 3859.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
C. Dez, M. Dlakic, and D. Tollervey
Roles of the HEAT repeat proteins Utp10 and Utp20 in 40S ribosome maturation
RNA, September 1, 2007; 13(9): 1516 - 1527.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Perez-Fernandez, A. Roman, J. De Las Rivas, X. R. Bustelo, and M. Dosil
The 90S Preribosome Is a Multimodular Structure That Is Assembled through a Hierarchical Mechanism
Mol. Cell. Biol., August 1, 2007; 27(15): 5414 - 5429.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. V. Rosado, D. Kressler, and J. d. l. Cruz
Functional analysis of Saccharomyces cerevisiae ribosomal protein Rpl3p in ribosome synthesis
Nucleic Acids Res., June 13, 2007; (2007) gkm388v1.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
R. Bax, H. A. Raue, and J. C. Vos
Slx9p facilitates efficient ITS1 processing of pre-rRNA in Saccharomyces cerevisiae
RNA, November 1, 2006; 12(11): 2005 - 2013.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. J. Combs, R. J. Nagel, M. Ares Jr., and S. W. Stevens
Prp43p Is a DEAH-Box Spliceosome Disassembly Factor Essential for Ribosome Biogenesis
Mol. Cell. Biol., January 15, 2006; 26(2): 523 - 534.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
X. Du, M. R.K. S. Rao, X. Q. Chen, W. Wu, S. Mahalingam, and D. Balasundaram
The Homologous Putative GTPases Grn1p from Fission Yeast and the Human GNL3L Are Required for Growth and Play a Role in Processing of Nucleolar Pre-rRNA
Mol. Biol. Cell, January 1, 2006; 17(1): 460 - 474.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. D. Miles, J. Jakovljevic, E. W. Horsey, P. Harnpicharnchai, L. Tang, and J. L. Woolford Jr
Ytm1, Nop7, and Erb1 Form a Complex Necessary for Maturation of Yeast 66S Preribosomes
Mol. Cell. Biol., December 1, 2005; 25(23): 10419 - 10432.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. de la Cruz, E. Sanz-Martinez, and M. Remacha
The essential WD-repeat protein Rsa4p is required for rRNA processing and intra-nuclear transport of 60S ribosomal subunits
Nucleic Acids Res., October 12, 2005; 33(18): 5728 - 5739.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
E. THOMSON and D. TOLLERVEY
Nop53p is required for late 60S ribosome subunit maturation and nuclear export in yeast
RNA, August 1, 2005; 11(8): 1215 - 1224.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
K. A. Bernstein, J. E. G. Gallagher, B. M. Mitchell, S. Granneman, and S. J. Baserga
The Small-Subunit Processome Is a Ribosome Assembly Intermediate
Eukaryot. Cell, December 1, 2004; 3(6): 1619 - 1626.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. W. Loar, R. M. Seiser, A. E. Sundberg, H. J. Sagerson, N. Ilias, P. Zobel-Thropp, E. A. Craig, and D. E. Lycan
Genetic and Biochemical Interactions Among Yar1, Ltv1 and RpS3 Define Novel Links Between Environmental Stress and Ribosome Biogenesis in Saccharomyces cerevisiae
Genetics, December 1, 2004; 168(4): 1877 - 1889.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. E.G. Gallagher, D. A. Dunbar, S. Granneman, B. M. Mitchell, Y. Osheim, A. L. Beyer, and S. J. Baserga
RNA polymerase I transcription and pre-rRNA processing are linked by specific SSU processome components
Genes & Dev., October 15, 2004; 18(20): 2506 - 2517.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
M. DLAKIC and D. TOLLERVEY
The Noc proteins involved in ribosome synthesis and export contain divergent HEAT repeats
RNA, March 1, 2004; 10(3): 351 - 354.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. Oeffinger, M. Dlakic, and D. Tollervey
A pre-ribosome-associated HEAT-repeat protein is required for export of both ribosomal subunits
Genes & Dev., January 15, 2004; 18(2): 196 - 209.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
I. Fingerman, V. Nagaraj, D. Norris, and A. K. Vershon
Sfp1 Plays a Key Role in Yeast Ribosome Biogenesis
Eukaryot. Cell, October 1, 2003; 2(5): 1061 - 1068.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Steiner-Mosonyi, D. M. Leslie, H. Dehghani, J. D. Aitchison, and D. Mangroo
Utp8p Is an Essential Intranuclear Component of the Nuclear tRNA Export Machinery of Saccharomyces cerevisiae
J. Biol. Chem., August 22, 2003; 278(34): 32236 - 32245.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/6/4072    most recent
M208898200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Milkereit, P.
Right arrow Articles by Tschochner, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Milkereit, P.
Right arrow Articles by Tschochner, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement