|
Originally published In Press as doi:10.1074/jbc.M208898200 on November 20, 2002
J. Biol. Chem., Vol. 278, Issue 6, 4072-4081, February 7, 2003
A Noc Complex Specifically Involved in the Formation and Nuclear
Export of Ribosomal 40 S Subunits*
Philipp
Milkereit §,
Daniela
Strauss§,
Jochen
Bassler,
Olivier
Gadal,
Holger
Kühn,
Sylvia
Schütz,
Nicole
Gas¶,
Johannes
Lechner,
Ed
Hurt , and
Herbert
Tschochner**
From the Biochemie-Zentrum Heidelberg, Im Neuenheimer Feld 328, 69120 Heidelberg, Germany and ¶ Laboratoire de Biologie
Moleculaire Eucaryote, F-32062 Toulouse, France
Received for publication, August 30, 2002, and in revised form, November 18, 2002
 |
ABSTRACT |
Formation and nuclear export of 60 S
pre-ribosomes requires many factors including the heterodimeric
Noc1-Noc2 and Noc2-Noc3 complexes. Here, we report another Noc complex
with a specific role in 40 S subunit biogenesis. This complex consists
of Noc4p, which exhibits the conserved Noc domain and is homologous to
Noc1p, and Nop14p, a nucleolar protein with a role in 40 S subunit
formation. Moreover, noc4 thermosensitive mutants
are defective in 40 S biogenesis, and rRNA processing is inhibited at
early cleavage sites A0, A1, and
A2. Using a fluorescence-based visual assay for 40 S
subunit export, we observe a strong nucleolar accumulation of the
Rps2p-green fluorescent protein reporter in noc4 ts
mutants, but 60 S subunit export was normal. Thus, Noc4p and
Nop14p form a novel Noc complex with a specific role in nucleolar 40 S
subunit formation and subsequent export to the cytoplasm.
 |
INTRODUCTION |
Eukaryotic ribosome biogenesis is spatially organized into
different subcellular compartments. Most steps in the pathway leading to mature ribosomes occur in the nucleolus, a specialized nuclear substructure, which includes transcription of the rDNA by RNA polymerase I, modification of the synthesized precursor RNA, and the
assembly of both many ribosomal and non-ribosomal proteins with
pre-ribosomal RNA (1). In the yeast Saccharomyces cerevisiae the resulting large ribonucleoprotein complex forms the 90 S
pre-ribosome, which is split into precursor particles for the mature 40 S and 60 S ribosomal subunit (2). During or after their maturation the
pre-ribosomes leave the nucleolus, move toward the nuclear pore, gain
export competence, and are finally exported into the cytoplasm. Some
maturation steps like processing of the 20 S rRNA intermediate within
the 40 S subunit and the association of a few ribosomal proteins to the
ribosomes occur rather late, even in the cytoplasm (3).
Many factors known to be involved in biosynthesis and maturation of
ribosomes were identified and characterized in S. cerevisiae (4, 5). This organism represents a well suited model organism to study
eukaryotic ribosome biogenesis, because homologues of the factors
required are found in many eukaryotes. Of the more than 70 non-ribosomal proteins that participate in generation of ribosomes,
most have been described to be required for modification of rRNA or
removal of the external and internal spacer sequences from the
precursor 35S pre-RNA. End products of the rRNA processing
pathways are the 18 S rRNA, which is present in the 40 S subunit and
the 25 S and 5.8 S rRNA, as well as the RNA polymerase III-encoded 5 S
rRNA, which are the rRNA constituents of the 60 S subunit. Among the transacting factors involved to produce mature 40 S and 60 S subunits are nucleases, putative RNA helicases, RNA modifying proteins, and
proteins associated with small nucleolar RNAs (4, 5) (see also
www.expasy.ch/linder/proteins.html).
Folding, processing, and maturation of the rRNA is coordinated with the
association of ribosomal proteins, with the assembly and disassembly of
transacting factors, and with the movement of the ribosomal particles
toward the nuclear pore (6, 7). Different pre-ribosomal particles are
generated, which differ in their sedimentation behavior on sucrose
density gradients and in both their incorporated rRNA intermediates and
(non-)ribosomal proteins. The 35S pre-rRNA, which is the
primary rDNA transcript, is a constituent of the 90 S pre-ribosome.
Precursor particles of the 40 S ribosomal subunit co-sediment with a
size of ~43 S and contain 20 S pre-rRNA, whereas 60 S precursors
co-sediment with ~66 S and contain 27 S or 25 S, 5 S, and 7 S
pre-rRNA (2, 8, 9). The components associated with the different
pre-ribosomal particles are thought to comprise the machineries
required for ribosomal subunits formation and their regulation, as well
as for quality control steps and for the movement of pre-ribosomes from
the nucleolus to the cytoplasm. These protein complexes are transiently
associated with nascent ribosomes. Recently, it became possible to
purify large precursor assemblies employing (tandem-)affinity
purification strategies under mild ionic strength using tagged
non-ribosomal precursor subunits. Several 60 S and 40 S pre-ribosome
intermediates could be isolated, which differ in their subunit
composition (10-14) and probably reflect a snapshot of nascent
ribosomes at a particular stage of development (15).
Biochemical purification of a subnucleolar structure and development of
visual screens helped to identify factors that couple 60 S ribosome
maturation to the nuclear export of the precursor particles (16-19).
Recently, we have identified three novel nucleolar proteins that can be
isolated in two heterodimeric complexes; Noc1p-Noc2p is associated with
90 S and 66 S pre-ribosomes in the nucleolus, whereas Noc2p-Noc3p
assembles with 66 S particles throughout the whole nucleus (20). The
dynamic interaction of the Noc proteins appeared to be crucial for
maturation and intranuclear movement of pre-ribosomes leading to the
mature 60 S subunit. A common feature of Noc1p and Noc3p is a conserved
stretch of 45 amino acids, which is also present in a third yeast
protein, which we termed Noc4p (20). Here, we analyze the properties of
Noc4p and show that it is required for maturation and transport of the
40 S, but not the 60 S, subunit. Noc4p localizes to the nucleolus
and forms a stable heterodimer with Nop14, which was recently described
to be involved in 40 S subunit biogenesis (21). Apparently, formation
of different pairs of related Noc proteins represents a common theme in
ribosome biogenesis; they participate in distinct steps of either
pre-40 S or pre-60 S ribosome assembly, which is directly linked
to ribosomal precursor transport.
 |
EXPERIMENTAL PROCEDURES |
Yeast Strains, DNA Recombinant Work, and Microbiological
Techniques--
Yeast strains used in this study are given in
Table I. Microbiological techniques,
plasmid transformation and recovery, mating, sporulation of
diploids, and tetrad analysis were done essentially as described (22).
DNA recombinant work was performed according to Ref. 23.
Plasmid Constructions--
Plasmids pNOPPA1L and pNOPGFP1L were
described previously (24). Noc4 with its authentic 5' and 3'
untranslated region was amplified by PCR from yeast genomic DNA using
5'144c1F-HindIII and 3'144c1R-KpnI
oligonucleotides as primers. The derived fragment was cut with
HindIII and KpnI and cloned into YCplac33 using
the same sites, generating YCplac33-NOC4.
A protein A-tagged version of NOC4 was generated by cloning the Noc4
gene amplified by PCR with their authentic 3' into pNOPPA1L. NOC4 was amplified using oligonucleotides
5'144c2F-HindIII and 3'144c2R-XhoI and cloned
using HindIII and XhoI sites of pNOPPA1L, generating pNOPPA1L-NOC4. pNOPGFP1L-NOC4 was generated utilizing the same restriction sites and oligonucleotides as for
pNOPA1L-NOC4.
Strain Construction--
Strain NOC4 shuffle was
obtained by transforming plasmid Ycplac33-NOC4 into strain BY4743.
After tetrad analysis KAN+ URA+ spores were
selected. Strain ProtA-NOC4 and GFP-NOC4
were obtained by transforming NOC4 shuffle with plasmids
pNOPPA1L-NOC4 and pNOPGFP1L-NOC4 and shuffling out of the
URA3 containing vector using 5-fluoro-orotic acid.
Functionality of these tagged version of Noc proteins was tested, and
no growth defects were observed. Genomic integration of
GFP1 or protein A in-frame
with NOC4 and Nop14, respectively, was obtained as described previously
(25). Generation of noc4 temperature-sensitive strain was
performed by random PCR-mediated mutagenesis using plasmid
pNOPPA1L-NOC4 and oligonucleotides o_nocup and o_nocdo as described
previously (26). Both noc4 ts mutants stopped growth at
37 °C after one doubling time.
Mass Spectrometry and Protein Identification--
Mass
spectrometry was performed as described previously (11).
Affinity Purification of Protein A-tagged Noc
Proteins--
Affinity purification of protein A-tagged Noc proteins
was performed as described previously (20). Preparation of yeast cell
extracts was according to Ref. 27. Briefly, 20 liters of yeast cultures
were grown in YPD to A600 of 1-2 (2 × 1011 cells), harvested by centrifugation, washed with
ice-cold distilled water, resuspended in ice-cold lysis buffer (0.5 ml/g of cell paste) (0.15 M Hepes, pH 7.8, 60% glycerol,
0.5 M (NH4)2SO4, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl
fluoride, 2 mM benzamidine), and frozen in liquid nitrogen.
Subsequent manipulations were done at 5 °C. After thawing the cells,
the equal volume dilution buffer (0.1 M Hepes, pH 7.8, 20 mM MgCl2, 200 mM
(NH4)2SO4, 1 mM
dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 2 mM benzamidine) was added, and cells were broken with glass
beads as described (28), using four cycles of bead beating for 20 s. Glass beads and cellular debris was removed by centrifugation at
14000 × g for 20 min, and the supernatant was
clarified by centrifugation at 100,000 × g for 90 min.
Ribosomes Purification by Sucrose Density Gradient Centrifugation
Analysis--
Analysis of polysomes by sucrose density gradient
centrifugation was performed as described (20). To disrupt the
ribosomal subunits, cells were not incubated with cycloheximide before
breakage, and cell breakage and sucrose gradient analysis were
performed in 20 mM Hepes, pH 7.8, 100 mM NaCl,
20 mM EDTA, and 1 mM dithiothreitol.
Construction of the Rps2p-eGFP Reporter--
The plasmid
pRS316-Rps2p-eGFP was obtained by replacing the RPL25 open
reading frame with the RPS2 gene (29) in plasmid pRS316-RPL25-eGFP (17). RPS2, which consists of the entire
open reading frame plus 500 nucleotides of its 5' untranslated region including the promoter region, was amplified from genomic DNA by PCR
using the primers AAAAAAGAGCTCGCTTATTCACTAAGGATTCTTAAGGTTT and
TTTTTTGGATCCGAATCTCTTCTTTTGAGCAGAAGCTTCA. The 1.3-kb PCR product was digested with the restriction enzymes BamHI and
SacI and cloned into the 5.9-kb
SacI-BamHI cut vector pRS316-RPL25-eGFP.
Complementation of the rsp2 disruption strain by the
Rps2p-eGFP reporter construct was tested in the following way: a
diploid yeast strain, which is heterozygous for the rsp2
disruption (obtained from Euroscarf), was transformed with
pRS316-RPS2-eGFP on synthetic-dextrose complete medium lacking
uracil plates, and subsequently transformants were sporulated. After
tetrad analysis, spores carrying the rsp2 disruption and
the pRS316-RPS2-eGFP plasmid were selected and tested for complementation by growth on YPD plates at 30 and 37 °C.
Fluorescence Microscopy to Detect the Rps2p-GFP Reporter in
Living Cells--
Plasmids pRS315-RPS2-eGFP or pRS315-RPL25-eGFP were
introduced into yeast cells by transformation and selected on
synthetic-dextrose complete medium lacking leucine plates. Individual
transformants were grown on SDC-leu plates for 4-5 days at 23 °C
before transfer in liquid YPD medium and shift to 37 °C for the
indicated times. After centrifugation, cells were resuspended in water,
mounted on a slide, and viewed in the fluorescent channel of a Zeiss
Axioskop fluorescence microscope. Pictures were obtained with a Xillix Microimager CCD camera. Digital pictures were processed by the Improvision software program (Open lab) and Photoshop 4.0.1 (Adobe).
RNA Extraction and Northern Blot Analysis--
RNA was prepared
according to Ref. 30. Briefly, 20 ml of yeast culture were harvested
and resuspended in 0.4 ml of buffer AE (50 mM sodium
acetate, pH 5.3, 10 mM EDTA). 0.04 ml of 10% SDS and 0.440 ml of phenol (equilibrated in buffer AE) was added, and after mixing
the suspension was incubated for 4 min at 65 °C. After cooling for
10 s in ethanol/dry ice, phenol and cellular material was spun
down for 2 min at 14000 × g. The aqueous phase was
extracted once with phenol and once with chloroform; RNA was precipitated by addition of 0.1 volume of 3 M sodium
acetate, pH 5.3, and 2.5 volumes ethanol.
20 µg of the resulting pelleted RNA were resolved by denaturating
agarose gel electrophoresis and blotted onto a Hybond-N membrane
(Amersham Biosciences) according to Ref. 23. Hybridization with
radiolabeled oligonucleotides was carried out overnight at 30 °C in
50% formamide, 5× SSC, 50 mM sodium phosphate, pH 6.5, 0.4% SDS, 0.1 mg/ml salmon sperm DNA, 5× Denhardt's solution. To
detect 27 S rRNA and 7 S rRNA, 20 S rRNA and actin-mRNA end-labeled oligonucleotides 5'C2-site, 5'A2-site, and actin, respectively, were
used. After hybridization the blot was washed twice with 2× SSC and
twice with 0.1% SDS in 2× SSC for 30 min at 30 °C and exposed to
x-ray films.
Pulse-Chase Labeling of rRNA--
Pulse-chase labeling of rRNA
was performed with minor modifications as described by Zanchin et
al. (31). Cells of strains ProtA-NOC4 and noc4-1 were
grown to early log phase at 25 °C in YPD and then incubated for
3.5 h at 37 °C. The cultures were harvested by centrifugation
and resuspended in 1/5 volume of YNB complemented by histidine,
lysine, methionine, and 2% glucose. Following a 5-min incubation at
37 °C, 10 µl of 5,6-3H-uracil (45 Ci/mmol, 1mCi/ml;
Amersham Biosciences) were added per ml of culture. After 3 min the
chase was started by adding unlabeled uracil to a final concentration
of 200 µg/ml. Samples of 1 ml were frozen in liquid nitrogen just
after starting the chase at the time points indicated. Total RNA was
isolated from the cells by the hot-phenol method (32), separated on
1.2% agarose/6% formaldehyde gels, and transferred to Hybond-N+
membranes (Amersham Biosciences). After treatment with
En3hance spray (PerkinElmer Life Sciences) the
membrane was exposed overnight to an X-OMAT AR film (Amersham
Biosciences) at 80 °C.
Miscellaneous--
SDS-PAGE and Western blot analysis were
performed according to Ref. 33. Polyclonal antibodies Noc1p and Noc3p
were described in Ref. 20. Polyclonal antiserum against S8 and L16 were
a kind gift of G. Dieci (Parma). Rabbit peroxidase-anti-peroxidase
(Jackson ImmunoResearch) was used in 1:5000 dilution to detect protein A tag in Western blot analysis.
Oligonucleotides used for cloning, PCR, and detection of RNA were as
follows: 5'C2-site, GGC CAG CAA TTT CAA GTT A; 5'A2-site, GCT CTC ATG
CTC TTG CC; actin, GGA GCG TCG TCA CCG GCA AAA CCG GC (oligonucleotides
ON2, ON3, ON4, ON6, ON7, and ON9 were according to Ref. 34); o_nocup,
CAA TAA CTC CGA TCA AAT TAA CTC AAA TCA AC; o_nocdo, GCA GTG AGC GCA
ACG CAA TTA ATG TGA G; 5'144c1F-HindIII, TTT TTT AAG CTT GCG
TCC TTG TCA TTC TTA AGA ATG; 3'144c1R-KpnI, TTT TTT GGT ACC
TAA TAA CGC GGG GAT CAG CGG T; 5'144c2F-HindIII, TTT TTT AAG
CTT ATG GTA TTG CTT ATA TCA GAA ATT AAA G; 3'144c2R-XhoI, TTT TTT CTC GAG TAA TAA CGC GGG GAT CAG CGG T.
 |
RESULTS |
Noc4p Is a Nucleolar Protein with a "Noc
Domain"--
The short and conserved Noc domain (~45 amino acids
in length) is found in Noc1p and Noc3p, two nuclear proteins with a
role in transport and maturation of ribosomal 60 S subunits.
Interestingly, an uncharacterized yeast protein named Noc4p also
exhibits such a Noc domain (20). To find out whether Noc4p is involved
in ribosome biogenesis, we sought to characterize Noc4p, which is an
essential protein of 63 kDa. Together with the other Noc proteins, Noc4p is enriched in the previously isolated large nucleolar subcomplex (data not shown) that contains many factors involved in rDNA
transcription and ribosome biogenesis (16). Consistent with this
biochemical data, chromosomally encoded Noc4p-GFP is located in the
nucleolus (Fig. 1A). Because
Noc4p not only has the short Noc domain (residue 447-488 in Noc4p) but
shows an extended homology throughout a large part of the Noc1 sequence
(Fig. 1B), Noc4p and Noc1p could perform a related function.
Moreover, Noc4p orthologs exist in other organisms including
Schizosaccharomyces pombe and human (Fig.
1B). Taken together these data suggest that Noc4p is a
further member of the Noc protein family with a role in ribosome
biogenesis.

View larger version (96K):
[in this window]
[in a new window]
|
Fig. 1.
The nucleolar protein Noc4p and its
homologues. A, Noc4p is located in the
nucleolus. Noc4p-GFP was expressed in the noc4 null strain
and visualized by fluorescence microscopy. To show nucleolar location,
the DsRed-Nop1 marker was co-expressed in the cells. The Noc4p-GFP and
DsRed-Nop1p pictures were merged to observe colocalization.
B, Noc4p and Noc1p homologues are structurally related.
Sequence comparison of S. cerevisiae Noc4p and Noc1p and
their homologues in S. pombe and Homo sapiens.
Black or gray rectangles indicate invariant or
homologues residues, respectively. The stretch of 45 amino acids of the
Noc domain is marked. GenBankTM accession numbers
for Noc4p and homologues are as follows: S. cerevisiae
(S69032; systematic name Ypr144c), S. pombe (T39508), and
H. sapiens (mRNA; MGC3162). GenBankTM
accession numbers for Noc1p are as follows: S. cerevisiae
(S54044), S. pombe (T38813), and H. sapiens
(A36368).
|
|
Noc4p Stably Associates with Nop14p--
Previous work showed that
Noc1p and Noc2p form a stable heterodimeric complex, which is
associated with 60 S pre-ribosomes and required for ribosome maturation
and nuclear export. When functional ProtA-tagged Noc4p was
affinity-purified under the same stringent conditions that yielded the
Noc1p-Noc2p heterodimer, another protein of ~98 kDa was co-enriched
(Fig. 2, lane 3). Mass spectrometry analysis identified this protein as Nop14p, which was shown previously to play a role in 40 S subunit biogenesis (21).
Subsequently, we generated a chromosomally integrated Nop14p-ProtA and
affinity-purified it under the same stringent conditions. This revealed
that the major band co-purifying with Nop14p-ProtA is Noc4p (Fig. 2,
lane 4). Other bands found in the Nop14p-ProtA eluate were
Noc4p or Nop14p breakdown products and heat shock proteins (possible
contaminants). Notably, antibodies raised against the N-terminal domain
of Noc2p detect Nop14p on Western blots, suggesting a structural
relationship between both proteins, despite the fact that Nop14p and
Noc2p do not exhibit an apparent sequence homology (data not shown).
Taken together, our data show that Noc4p and Nop14p form a
heterodimeric complex, reminiscent of the previously characterized
Noc1p-Noc2p and Noc3-Noc2p complexes.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2.
Dimeric Noc complexes.
Functional fusion proteins ProtA-Noc1p and ProtA-Noc4p expressed in the
corresponding null strains and chromosomal encoded Nop14-ProtA were
affinity-purified on IgG-Sepharose beads. Co-purifying proteins were
separated by SDS-PAGE, visualized by Coomassie staining, and identified
by mass spectrometry. The triangle indicates a heat shock
protein present in all three purifications.
|
|
Noc4p Is Required for 40 S Subunit Biogenesis--
Previous work
showed that Nop14p plays a role in 40 S subunit biogenesis (21), yet
Noc1p, which is related to Noc4p (see Fig. 1B), is involved
in 60 S subunit biogenesis (20, 35). Therefore, we sought to generate
temperature-sensitive noc4 mutants to test them for defects
in rRNA processing, ribosome formation, and nuclear export. Two
noc4 ts mutants, noc4-1 and noc4-2,
which grow well at 24 °C, but not at 37 °C, were obtained (Fig.
3A). The mutated noc4-1
protein has amino acid exchanges at position 283 (Ser Pro), 344 (Ile Val), 463 (Leu Gln), and 550 (Val Ala).
Strikingly, the amount of free 40 S subunits significantly decreased in
the noc4-1 mutant upon shift to the restrictive
temperature, whereas the amount of 60 S subunits increased. In
contrast, the noc1-1 mutant shows opposite effects with a
loss of 60 S and an increase of 40 S subunits (Fig. 3, B and
C). Similar results were obtained when a noc4 ts
mutant was used that exhibits a mutation in the Noc domain (data not
shown).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 3.
noc4 ts mutants are impaired in 40 S ribosome biogenesis. A, growth defect of
noc4 ts mutants at elevated temperature. Dilutions of strain
ProtA-Noc4 and yeast strains bearing the noc4-1 and
noc4-2 mutation were spotted onto YPD plates and incubated
at the temperature indicated. B, UV profiles of polysome
gradients. A260 nm of polysome sucrose
gradients derived from wild-type (WT) cells,
noc1-1 and noc4-1 mutants at permissive
(25 °C), and 3.5 h after shift to restrictive (37 °C)
temperature. The Western blot depicted below the profile of
the noc4 ts mutant (37 °C) documents the sedimentation of
the 60 S subunit (antibodies directed against Rpl3). C, UV
profiles of ribosomal particles from strain noc4-1 on
sucrose gradients in the presence of EDTA. Whole cell extracts were
separated on a sucrose gradient in the presence of 20 mM
EDTA to disrupt the two ribosomal subunits.
|
|
Noc4p Is Required for Processing of 18 S rRNA--
To test whether
and at which specific steps Noc4p is involved in the processing pathway
leading to 18 S rRNA, the rRNA component of the 40 S subunit, we
performed Northern analysis (Fig. 4,
B and C) and pulse-chase experiments (Fig.
4D). After a 4-h shift to restrictive temperature
(37 °C), the total amount of mature 18 S rRNA was significantly
reduced in the noc4-1 mutant, whereas the 25 S rRNA level
remained almost unaffected (Fig. 4C). Fig. 4B
also depicts that noc4 ts mutants are defective in the
pathway leading to mature 18 S rRNA but not to 25 S and 5.8 S rRNA; the 20 S pre-rRNA (the immediate precursor to mature 18 S rRNA) was significantly decreased in the noc4-1 mutant, whereas the
35S pre-rRNA was more pronounced after shift to the
restrictive temperature; in contrast, after an initial reduction
briefly after the temperature shift, the amounts of 27 S and 7 S
pre-rRNA (precursors of the mature 25 S and 5.8 S rRNA, respectively)
raised again to wild-type levels (Fig. 4B). To compare the
precise processing steps that are affected in noc4 and in noc1 mutants,
we used different probes complementary to certain regions of the rRNA
transcript. The reduction in the 20 S, 32 S, and 27 S A2
rRNA species in the noc4 mutants clearly indicates blocks at the early
cleavage steps at A0, A1, and A2,
respectively. Furthermore, an intermediate could be detected that
corresponds in size to the 23 S product, a presumably aberrant species
when processing at the early sites A0-A2 are
blocked. Interestingly, this 23 S species was only slightly accumulated
when compared with other yeast strains defective in 18 S processing.
This could be because of a reduced stability of this intermediate in
noc4 ts mutants. Appearance of the 27SA/27SB rRNA
intermediate underlines that later cleavage steps still occur and
that the processing of 25 S and 5.8 S rRNA is not affected in the
noc4-1 mutant. By contrast, the noc1-1 mutant
showed cleavage at sites A1 and A2 (the 20 S
species is still detectable) but is impaired in 25 S processing,
because all 27 S intermediates are clearly reduced.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
noc4 ts mutants are impaired in
processing of 18 S rRNA. A, scheme of rRNA processing.
The probes for Northern analysis are indicated in the upper two
levels. B, Northern analysis of pre-rRNA processing.
Left panel, noc4-1 was analyzed following growth
at 24 °C (0 and 4-h samples) and 1, 2, and 4 h after transfer
to 37 °C. Pre-rRNA species detected are indicated. The probes for
hybridization were used simultaneously (oligos 5'A2, 7, and actin).
Right panel, quantification of the noc4-1
pre-rRNAs after shift to 37 °C. The signals were normalized using
actin mRNA as an internal standard. C, comparison of
pre-rRNA cleavages in WT cells and noc1-1 and
noc4-1 mutants. rRNA levels were analyzed at time points 0 and 4 h after shift to 37 °C for WT strains and
noc1-1 mutants and at 1, 2, and 4 h for
noc4-1, respectively. rRNA species used and probes used are
indicated. D, pulse-chase labeling of rRNA (intermediates)
in WT cells and noc4-1 mutants. Cells were grown at
24 °C, shifted at 37 °C for 3.5 h, and pulse-labeled with
3H-uracil for 3 min. The cells were chased for the time
points indicated with an excess of unlabeled uracil. Equal amounts of
extracted RNA were loaded on each lane of a denaturing 1.2% agarose
gel. Positions of mature and intermediate forms of rRNA are
indicated.
|
|
Pulse-chase experiments confirmed the results obtained by Northern
analysis. After a 3.5-h shift to non-permissive temperature, cells were
labeled with 3H-uracil and chased for certain time periods
with an excess of cold uracil. As expected, comparison of the time
course of rRNA processing between wild-type and noc4-1 mutant cells
revealed a delayed cleavage of the 35S rRNA and a strong
reduction of the 18 S rRNA in the mutant strain, whereas processing to
the mature 25 S rRNA still occurs although it is delayed. Thus, our
data demonstrate that Noc4p and Noc1p, although structurally related,
participate in two different ribosome biogenesis pathways that lead to
40 S and 60 S subunits, respectively.
The Noc4p-Nop14p Heterodimer Associates with 40 S Pre-ribosomal
Particles--
As Noc4p and Nop14p participate in 40 S subunit
biogenesis, we wanted to know whether they associate with pre-ribosomal
particles to the 40 S subunit. Therefore, we performed sucrose gradient centrifugation of yeast lysates containing ribosomal and pre-ribosomal particles and looked for co-fractionation with Noc4p-ProtA and Nop14p-ProtA. This revealed that Noc3p co-sediments with 66 S pre-ribosomes, and Noc1p co-sediments with 66 S and 90 S pre-ribosomes (see also Ref. 20). Apparently, Noc4p does not co-peak with 66 S
particles but is detected in fractions of higher density, which could
correspond to 90 S particles (Fig. 5,
upper panel). Moreover, a small fraction of ProtA-tagged
Noc4p is present in the part of the gradient that contains 43 S
pre-ribosomes and 40 S subunits, which becomes evident upon a longer
exposure of the Western blot (data not shown). A similar sedimentation
behavior on sucrose gradients was also observed for Nop14p-ProtA,
although this fusion protein tends to be partly degraded during
overnight centrifugation in fractions with rather high protein
concentrations (data not shown). We conclude that Noc4p and Nop14p are
associated with precursor particles to the 40 S subunit.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 5.
Sedimentation behavior of Noc4p and Nop14p
proteins and (pre-)ribosomal particles on sucrose gradients.
Analysis of polysomal fractions derived from strain ProtA-NOC4 grown at
30 °C was performed as described under "Experimental
Procedures." Aliquots of the fractions were analyzed by Western blot
analysis with polyclonal antisera directed against ribosomal protein S8
or affinity-purified antibodies directed against either Noc1p or Noc3p.
The fractions containing 40 S, 60 S, and 90 S ribosomal subunits are
marked.
|
|
Nucleolar Location of Nop14p Depends on Intact Noc4p--
Previous
work showed that the Noc proteins Noc1-3 exhibit a dynamic
intranuclear distribution (20). To find out whether the Noc4-Nop14p
complex also has the capability to migrate between the nucleolus and
nucleoplasm, we sought to analyze the intranuclear location of
Nop14p-GFP in noc4 ts mutants. In wild-type cells, Nop14p-GFP like Noc4p-GFP is mainly located in the nucleolus (Fig. 6). However, Nop14p-GFP is significantly
found in the nucleoplasm in the noc4-1 mutant upon shift to
the restrictive temperature (Fig. 6; see merge between the Noc4-eGFP
and DNA staining). This suggests that an intact Noc4p is required for
steady-state nucleolar location of Nop14p.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 6.
In Vivo localization of Nop14p-GFP
in wild-type cells and in the noc4-1 ts mutant after
shift to the non-permissive temperature. Shown are fluorescence
microscopy photographs of Nop14p-GFP in wild-type
(NOC4+) and noc4-1 ts cells shifted
for 4 h to 37 °C. Cells were also stained for DNA, and the GFP-
and 4',6'-diamidino-2-phenylindole-stained pictures were
merged.
|
|
A Fluorescence-based in Vivo Assay Reveals That noc4 ts Mutants Are
Defective in 40 S Subunit Export--
Previous studies revealed that
the Noc1-Noc2 and Noc2-Noc3 complexes are involved in intranuclear
transport and nuclear export of 60 S pre-ribosomal subunits (20). We
sought to analyze whether the Noc4p-Nop14p complex plays a role in the
export of 40 S subunits from the nucleolus into the cytoplasm. To this
end, we developed a visual in vivo assay for 40 S small
subunit export exploiting a GFP-tagged version of a ribosomal protein
of the 40 S subunit. This assay, together with the previously
established 60 S subunit export assay (18), allows us to study under
comparable conditions which factors are involved in ribosomal export
and which affect large and small subunit export differently.
Furthermore, it can be determined whether and which (mal)function in 40 S biogenesis is coupled to 40 S transport. Recently, another test
system for 40 S subunit export was reported; however, this assay was
based on in situ hybridization of rRNA (19).
The essential ribosomal protein Rps2p served as a suitable reporter for
the in vivo small subunit assay. Importantly, GFP-tagged Rps2p (Rps2p-eGFP) efficiently complements the non-viable
rps2 null mutant (Fig.
7A). Furthermore, Rps2p-eGFP
is exclusively located in the cytoplasm, with nuclear and vacuolar
exclusion, as revealed by fluorescence microscopy (Fig.
7B). Moreover, Rps2p-eGFP effectively assembles into 40 S
subunits and thus is also found in 80 S ribosome and polysome fractions
(Fig. 7C). Finally, it was tested whether Rps2p-eGFP
accumulates in the nucleus of a bona fide export mutant.
Recently, it was shown that Xpo1p, which is the export receptor for
nuclear export signal-containing export cargoes (36), is involved in 60 S (17, 37) and 40 S subunit export (19). As expected, the
xpo1-1 ts mutant exhibits a strong nuclear accumulation of
the Rps2p-eGFP reporter after shift to the restrictive temperature
(Fig. 7D).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 7.
A fluorescence-based in vivo
assay for 40 S subunit export. A, growth of the
Rps2p-GFP strain. The disruption strain rps2 complemented
by Rps2p-GFP and an isogenic wild-type strain were grown at 30 and
37 °C for 4 days. Precultures were diluted in growth medium, and
equivalent amounts of cells (diluted in 10-1 steps) were spotted onto
YPD plates. For description of strains, see "Experimental
Procedures" and Table I. B, fluorescence microscopy
of the rps2 disruption strain complemented by Rps2p-GFP.
The corresponding Nomarski picture is also shown. C,
Rps2p-GFP associates with 40 S subunits, 80 S ribosomes, and polysomes.
The UV profiles (A260 nm) of the sucrose
gradient are depicted, and 40 S subunits, 60 S, subunits, 80 S
ribosomes, and polysomes are indicated. The fractions from the sucrose
gradient were analyzed by SDS-PAGE and Western blotting using an
anti-GFP-antibody, which detects the Rps2p-GFP reporter protein.
D, Rps2p-GFP accumulates in the nucleus in the
temperature-sensitive xpo1-1 mutant. Rps2p-GFP was
expressed in xpo1-1 cells, which were shifted for 1 h
to the non-permissive temperature (37 °C) before the fluorescence
picture was taken.
|
|
We next tested whether nuclear export of 40 S and 60 S subunits is
impaired in the noc4 ts mutant, using the fluorescence-based in vivo export assays for 40 S (Rps2-eGFP) and 60 S subunits
(Rpl25-eGFP) (Fig. 8). Whereas Rps2p-eGFP
significantly accumulates in the nucleus of two different
noc4 ts mutants upon shift to the non-permissive temperature, nuclear export of the large subunit reporter Rpl25p-eGFP is not impaired (Fig. 8A). To test whether Noc1p, Noc2p, and
Noc3p are required for 40 S subunit export, the ts mutants
noc1-1, noc2-1, and noc3-1 were
transformed with the Rps2p-eGFP reporter. However, no nuclear
accumulation of the small subunit reporter was seen in these
noc mutants after shift to the non-permissive temperature (Fig. 8B). Previous work showed nuclear accumulation of
Rpl25p-eGFP in noc1, noc2, and noc3 ts
mutants (20). To find out whether the Rps2-GFP reporter remains
associated with pre-ribosomal particles at the restrictive condition,
we performed sucrose gradient centrifugation of whole cell lysates
derived from the noc4-1 (Fig. 8C) and
noc4-2 (not shown) ts mutants grown at the permissive
temperature or shifted for 4 h to the restrictive temperature.
Western blot analysis of these sucrose gradient fractions revealed no
free Rps2-eGFP reporter in the upper part of the gradient, and
Rps2-eGFP was exclusively found in the lower part of the gradient,
which contains ribosomes and pre-ribosomal particles (Fig.
8C). These data show that the small subunit reporter
Rps2-GFP remains associated with 40 S pre-ribosomes upon shift of the
noc4 ts mutants to the non-permissive temperature. Moreover,
the amount of 40 S subunits is decreased whereas that of 60 S subunits
is increased in both noc4 ts mutants upon shift to the
restrictive temperature (see also Fig. 3). All ts mutants yet analyzed
that are impaired in 40 S biogenesis also exhibited a defect in the
small subunit export assay (data not shown). Apparently, 40 S subunit
maturation is closely linked to its transport, and it is not yet
distinguishable whether accumulation of the Rps2-GFP reporter construct
in the nucleolus is because of the blockage of 40 S biogenesis, the
missing relief of a retention signal, or the direct inhibition of
transport. We conclude that maturation and nuclear export of 40 S
pre-ribosomes requires the Noc4-Nop14p complex, whereas 60 S subunit
maturation and export depends on the Noc1p/2p and Noc2p/3p
complexes.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 8.
Temperature-sensitive noc4
mutants are defective in 40 S subunit, but not 60 S subunit,
export. A, analysis of 40 S and 60 S subunit export in
noc4-1 and noc4-2 mutants expressing the Rps2p-GFP and
Rpl25p-GFP reporter constructs. Cells were shifted for 5 h to
37 °C before pictures were taken in the fluorescence microscope.
B, Rps2p-GFP does not accumulate in the nucleus in
thermosensitive noc1, noc2, and noc3
mutants. ts strains noc1-1, noc2-1, and
noc3-1, transformed with the Rpl25p-GFP large subunit
reporter, were shifted for 5 h to 37 °C before they were viewed
in the fluorescence microscope and under Nomarski optics. C,
Rps2p-GFP remains associated with pre-ribosomal particles in
noc4 ts mutants upon shift to the restrictive temperature.
Sucrose gradient centrifugation of whole cell lysates derived from the
noc4-1 mutants grown at the permissive temperature or
shifted for 4 h to the restrictive temperature.
A260 nm profiles of sucrose gradients (40 S, 60 S, and 80 S ribosomes and polysomes) are indicated. The fractions from
the sucrose gradient were analyzed by SDS-PAGE and Western blotting
using an anti-GFP-antibody to detect Rps2p-GFP.
|
|
 |
DISCUSSION |
To date little is known about how 40 S subunits assemble in the
nucleolus and are exported in the cytoplasm. We could demonstrate that
Noc4p is part of the stable Noc4p-Nop14p heterodimer and is
specifically involved in maturation of the 40 S subunit, which is
closely linked to pre-40 S subunit transport from the nucleolus to the
cytoplasm. In contrast, the related Noc1p-Noc2p and Noc2p-Noc3p complexes have specific roles in biogenesis and transport of the 60 S
subunits. In particular, we have developed a fluorescence-based in vivo assay, which allows us to monitor specifically 40 S
nuclear export and to directly compare it to 60 S subunit export. Both in vivo export assays use functional GFP-tagged ribosomal
proteins of the small (Rps2p-eGFP) and large subunit (Rpl25p-eGFP). In agreement with its specific role in 40 S subunit export, Noc4p is
involved in rRNA processing of 18 S, but not of 25 S and 5.8 S, rRNA.
Thus, the Noc4p-Nop14p complex adds to a growing list of related
complexes that play a role in maturation-coupled transport processes of
different pre-ribosomal particles.
A homology observed between Noc1p and a novel and uncharacterized
protein termed Noc4p was the basis to identify the novel Noc4-Nop14p
heterodimer. Thus, several Noc-complexes (Noc1p-Noc2p, Noc2p-Noc3p,
Noc4p-Nop14p) have now been characterized. The capability to form
separate Noc heterodimers points to an interesting principle in
ribosome biogenesis; Noc complexes can either participate in subsequent
steps during biogenesis of a distinct precursor species (e.g. 60 S pre-ribosomes) or function in the biogenesis of
different pre-ribosomal particles (i.e. 60 S and 40 S
subunits). Thus, Noc complexes may perform both common and different
functions, thereby coupling intranuclear assembly and movement of
pre-ribosomal particles with export into the cytoplasm.
Possible functions of Noc complexes are to accompany their cognate
pre-ribosomal particle during maturation, actively mediate maturation,
actively promote transport from the nucleolus to the nuclear pore, or
overcome intranucleolar/intranuclear retention sites. A common
structural element within several Noc proteins is the Noc domain, which
could trigger some of these events. Notably, a change in Noc complex
composition, which correlates with association to different particles
and with different nuclear locations, was observed for the
Noc2p-containing complexes. When Noc2p is associated with Noc1p, it is
predominantly nucleolar and interacts both with 66 S and 90 S
pre-ribosomes; however, when Noc3p is bound to Noc2p, the complex is
also found in the nucleoplasm and exclusively associated with 66 S
pre-ribosomes (20). In analogy, the Noc4-Nop14p heterodimer could
function in distinct steps during 40 S subunit biogenesis/transport like the Noc1p-Noc2p complex that performs its role in 60 S subunit formation. Whether a second stable Nop14p-containing complex exists that is analogous to the Noc2p-Noc3p complex and functions in a later
step during 40 S subunit biogenesis remains unknown.
The association of the Noc4p-Nop14p complex with 90 S particles might
suggest that it is involved in an early step during 40 S subunit
biogenesis. This conclusion is also supported by the observation that
early pre-rRNA processing at sites A0, A1, and
A2 is inhibited in both noc4 and
nop14 ts mutants (see also Ref. 21). Moreover, rRNA
processing and transport events leading to mature 60 S subunits are not
significantly inhibited in noc4 ts mutants. This suggests
that the cleavages leading to the release of pre-rRNA to 25 S rRNA are
not dependent on the Noc4-Nop14p complex. It appears that the
activities of the different Noc protein are clearly separated to either
60 S or 40 S biogenesis, which supports previous findings that 60 S and
40 S biogenesis can proceed independently from each other (38). At
which particular stage pre-40 S subunit export is blocked in
noc4 mutants and what causes the delayed and/or aberrant
cleavages remains unclear; the latter could be because of either a
primary effect on the RNA cleavage reaction or a feedback mechanism,
because pre-40 S subunits cannot be properly assembled and/or
transported. Whether the impaired transport is a consequence or a
prerequisite of the inhibited cleavages at sites A0,
A1, and A2 has to be elucidated. It is also
possible that Noc4-Nop14p complexes function in several subsequent steps of 40 S biogenesis.
Interestingly, Noc4p and Nop14p have also been found in association
with highly purified nuclear pore complexes (39). This could indicate
that these proteins follow the 40 S pre-ribosomes from the nucleolus to
the nuclear pore complexes where they might directly or indirectly
mediate the interaction between the pre-ribosomes and the nuclear pore
(for discussion see also Refs. 11 and 15). Another candidate that could
follow pre-40 S particles through different maturation steps is Emg1p,
a 40 S biogenesis factor, which was described recently to interact with
Nop14p (21). Interestingly, the nuclear distribution of Emg1p is
dependent on the presence of functional Nop14p (21), which indicates
that at least some components of the network involved in nuclear pre-40
S biogenesis also have the potential to shuttle between cytoplasm and nucleus.
In a recently published large scale approach to characterize yeast
multiprotein complexes Noc4p was identified in complexes that also
contained Nop14p and Emg1p, as well as many other proteins that
participate in 40 S biogenesis (40-42) (see also
www.pre-ribosome.de/). Further analyses of these components revealed
that they are associated with early pre-ribosomal particles that
contain the 35S pre-rRNA primary transcript and U3 small
nucleolar RNA (14). Moreover, these 90 S pre-ribosomal particles
consist of a core of 35 non-ribosomal proteins, including proteins
associated with U3 small nucleolar RNA and other factors required for
18 S rRNA synthesis. Among these core components are also Noc4p and
Nop14p (14). Thus, our data presented here are fully consistent with a
role of the Noc4p-Nop14p heterodimer as a component of 90 S pre-ribosomal particles required for 40 S subunit formation and export.
Which precise role the remarkable stable association between Noc4p and
Nop14p plays in the pathway of 40 S formation remains to be elucidated.
Future work will address the questions of how the many non-ribosomal
factors including the Noc4-Nop14p heterodimer coordinate maturation and
transport of 40 S pre-ribosomes from the nucleolus to the cytoplasm.
 |
ACKNOWLEDGEMENTS |
We thank Dr. G. Dieci for providing
antibodies against ribosomal proteins and I. Eckstein for yeast
cultivation. The excellent technical assistance of E. Draken is
gratefully acknowledged.
 |
FOOTNOTES |
*
This work was supported by funds of the Deutsche
Forschungsgemeinschaft and of the Human Frontier Science Project
Organization and by the Association pour la Recherche contre le cancer
(to P. M. and N. G.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Present address: Laboratoire de Biologie Moleculaire Eucaryote,
F-32062 Toulouse, France.
§
Both authors contributed equally to this work.
To whom correspondence may be addressed. Tel.: 49-6221-544173;
Fax: 49-6221-544369; E-mail: cg5@ix.urz.uni-heidelberg.de.
**
To whom correspondence may be addressed. Tel.: 49-6221-544149; Fax:
49-6221-544366; E-mail: IM4@ix.urz.uni-heidelberg.de.
Published, JBC Papers in Press, November 20, 2002, DOI 10.1074/jbc.M208898200
 |
ABBREVIATIONS |
The abbreviations used are:
GFP, green
fluorescent protein;
WT, wild-type;
ts, thermosensitive;
ProtA, protein
A.
 |
REFERENCES |
| 1.
|
Woolford, J. L., Jr.
(1991)
Adv. Genet.
29,
63-118[Medline]
[Order article via Infotrieve]
|
| 2.
|
Trapman, J.,
Retel, J.,
and Planta, R. J.
(1975)
Exp. Cell Res.
90,
95-104[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Stevens, A.,
Hsu, C. L.,
Isham, K. R.,
and Larimer, F. W.
(1991)
J. Bacteriol.
173,
7024-7028[Abstract/Free Full Text]
|
| 4.
|
Venema, J.,
and Tollervey, D.
(1999)
Annu. Rev. Genet.
33,
261-311[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Kressler, D.,
Linder, P.,
and de la Cruz, J.
(1999)
Mol. Cell. Biol.
19,
7897-7912[Free Full Text]
|
| 6.
|
Kruiswijk, T.,
Planta, R. J.,
and Krop, J. M.
(1978)
Biochim. Biophys. Acta
517,
378-389[Medline]
[Order article via Infotrieve]
|
| 7.
|
Hadjiolov, A.
(1985)
Cell Biol. Monogr.
12,
1-268
|
| 8.
|
Trapman, J.,
and Planta, R. J.
(1976)
Biochim. Biophys. Acta
442,
265-274[Medline]
[Order article via Infotrieve]
|
| 9.
|
Udem, S. A.,
and Warner, J. R.
(1973)
J. Biol. Chem.
248,
1412-1416[Abstract/Free Full Text]
|
| 10.
|
Harnpicharnchai, P.,
Jakovljevic, J.,
Horsey, E.,
Miles, T.,
Roman, J.,
Rout, M.,
Meagher, D.,
Imai, B.,
Guo, Y.,
Brame, C. J.,
Shabanowitz, J.,
Hunt, D. F.,
and Woolford, J. L., Jr.
(2001)
Mol. Cell
8,
505-515[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Bassler, J.,
Grandi, P.,
Gadal, O.,
Lessmann, T.,
Petfalski, E.,
Tollervey, D.,
Lechner, J.,
and Hurt, E.
(2001)
Mol Cell
8,
517-529[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Saveanu, C.,
Bienvenu, D.,
Namane, A.,
Gleizes, P. E.,
Gas, N.,
Jacquier, A.,
and Fromont-Racine, M.
(2001)
EMBO J.
20,
6475-6484[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Dragon, F.,
Gallagher, J. E.,
Compagnone-Post, P. A.,
Mitchell, B. M.,
Porwancher, K. A.,
Wehner, K. A.,
Wormsley, S.,
Settlage, R. E.,
Shabanowitz, J.,
Osheim, Y.,
Beyer, A. L.,
Hunt, D. F.,
and Baserga, S. J.
(2002)
Nature
417,
967-970[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Grandi, P.,
Rybin, V.,
Bassler, J.,
Petfalski, E.,
Strauss, D.,
Marzioch, M.,
Schafer, T.,
Kuster, B.,
Tschochner, H.,
Tollervey, D.,
Gavin, A. C.,
and Hurt, E.
(2002)
Mol. Cell
10,
105-115[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Warner, J. R.
(2001)
Cell
107,
133-136[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Fath, S.,
Milkereit, P.,
Podtelejnikov, A. V.,
Bischler, N.,
Schultz, P.,
Bier, M.,
Mann, M.,
and Tschochner, H.
(2000)
J. Cell Biol.
149,
575-590[Abstract/Free Full Text]
|
| 17.
|
Gadal, O.,
Strauss, D.,
Kessl, J.,
Trumpower, B.,
Tollervey, D.,
and Hurt, E.
(2001)
Mol. Cell. Biol.
21,
3405-3415[Abstract/Free Full Text]
|
| 18.
|
Hurt, E.,
Hannus, S.,
Schmelzl, B.,
Lau, D.,
Tollervey, D.,
and Simos, G.
(1999)
J. Cell Biol.
144,
389-401[Abstract/Free Full Text]
|
| 19.
|
Moy, T. I.,
and Silver, P. A.
(1999)
Genes Dev.
13,
2118-2133[Abstract/Free Full Text]
|
| 20.
|
Milkereit, P.,
Gadal, O.,
Podtelejnikov, A.,
Trumtel, S.,
Gas, N.,
Petfalski, E.,
Tollervey, D.,
Mann, M.,
Hurt, E.,
and Tschochner, H.
(2001)
Cell
105,
499-509[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Liu, P. C.,
and Thiele, D. J.
(2001)
Mol. Biol. Cell
12,
3644-3657[Abstract/Free Full Text]
|
| 22.
|
Santos-Rosa, H.,
Moreno, H.,
Simos, G.,
Segref, A.,
Fahrenkrog, B.,
Pante, N.,
and Hurt, E.
(1998)
Mol. Cell. Biol.
18,
6826-6838[Abstract/Free Full Text]
|
| 23.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 24.
|
Hellmuth, K.,
Lau, D. M.,
Bischoff, F. R.,
Kunzler, M.,
Hurt, E.,
and Simos, G.
(1998)
Mol. Cell. Biol.
18,
6374-6386[Abstract/Free Full Text]
|
| 25.
|
Longtine, M. S.,
McKenzie, A., III,
Demarini, D. J.,
Shah, N. G.,
Wach, A.,
Brachat, A.,
Philippsen, P.,
and Pringle, J. R.
(1998)
Yeast
14,
953-961[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Strasser, K.,
and Hurt, E.
(2000)
EMBO J.
19,
410-420[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Milkereit, P.,
Schultz, P.,
and Tschochner, H.
(1997)
Biol. Chem.
378,
1433-1443[Medline]
[Order article via Infotrieve]
|
| 28.
|
Flanagan, P. M.,
Kelleher, R. J., III,
Tschochner, H.,
Sayre, M. H.,
and Kornberg, R. D.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
7659-7663[Abstract/Free Full Text]
|
| 29.
|
All-Robyn, J. A.,
Brown, N.,
Otaka, E.,
and Liebman, S. W.
(1990)
Mol. Cell. Biol.
10,
6544-6553[Abstract/Free Full Text]
|
| 30.
|
Schmitt, M. E.,
Brown, T. A.,
and Trumpower, B. L.
(1990)
Nucleic Acids Res.
18,
3091-3092[Free Full Text]
|
| 31.
|
Zanchin, N. I.,
Roberts, P.,
DeSilva, A.,
Sherman, F.,
and Goldfarb, D. S.
(1997)
Mol. Cell. Biol.
17,
5001-5015[Abstract]
|
| 32.
|
Köhrer, K.,
and Domdey, H.
(1991)
Methods Enzymol.
194,
398-407[Medline]
[Order article via Infotrieve]
|
| 33.
|
Siniossoglou, S.,
Wimmer, C.,
Rieger, M.,
Doye, V.,
Tekotte, H.,
Weise, C.,
Emig, S.,
Segref, A.,
and Hurt, E. C.
(1996)
Cell
84,
265-275[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Kressler, D.,
de la Cruz, J.,
Rojo, M.,
and Linder, P.
(1997)
Mol. Cell. Biol.
17,
7283-7294[Abstract]
|
| 35.
|
Edskes, H. K.,
Ohtake, Y.,
and Wickner, R. B.
(1998)
J. Biol. Chem.
273,
28912-28920[Abstract/Free Full Text]
|
| 36.
|
Stade, K.,
Ford, C. S.,
Guthrie, C.,
and Weis, K.
(1997)
Cell
90,
1041-1050[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Ho, J. H.,
Kallstrom, G.,
and Johnson, A. W.
(2000)
J. Cell Biol.
151,
1057-1066[Abstract/Free Full Text]
|
| 38.
|
Liang, W.-Q.,
and Fournier, M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2864-2868[Abstract/Free Full Text]
|
| 39.
|
Rout, M. P.,
Aitchison, J. D.,
Suprapto, A.,
Hjertaas, K.,
Zhao, Y.,
and Chait, B. T.
(2000)
J. Cell Biol.
148,
635-651[Abstract/Free Full Text]
|
| 40.
|
Gavin, A. C.,
Bosche, M.,
Krause, R.,
Grandi, P.,
Marzioch, M.,
Bauer, A.,
Schultz, J.,
Rick, J. M.,
Michon, A. M.,
Cruciat, C. M.,
Remor, M.,
Hofert, C.,
Schelder, M.,
Brajenovic, M.,
Ruffner, H.,
Merino, A.,
Klein, K.,
Hudak, M.,
Dickson, D.,
Rudi, T.,
Gnau, V.,
Bauch, A.,
Bastuck, S.,
Huhse, B.,
Leutwein, C.,
Heurtier, M. A.,
Copley, R. R.,
Edelmann, A.,
Querfurth, E.,
Rybin, V.,
Drewes, G.,
Raida, M.,
Bouwmeester, T.,
Bork, P.,
Seraphin, B.,
Kuster, B.,
Neubauer, G.,
and Superti-Furga, G.
(2002)
Nature
415,
141-147[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Ho, Y.,
Gruhler, A.,
Heilbut, A.,
Bader, G. D.,
Moore, L.,
Adams, S. L.,
Millar, A.,
Taylor, P.,
Bennett, K.,
Boutilier, K.,
Yang, L.,
Wolting, C.,
Donaldson, I.,
Schandorff, S.,
Shewnarane, J., Vo, M.,
Taggart, J.,
Goudreault, M.,
Muskat, B.,
Alfarano, C.,
Dewar, D.,
Lin, Z.,
Michalickova, K.,
Willems, A. R.,
Sassi, H.,
Nielsen, P. A.,
Rasmussen, K. J.,
Andersen, J. R.,
Johansen, L. E.,
Hansen, L. H.,
Jespersen, H.,
Podtelejnikov, A.,
Nielsen, E.,
Crawford, J.,
Poulsen, V.,
Sorensen, B. D.,
Matthiesen, J.,
Hendrickson, R. C.,
Gleeson, F.,
Pawson, T.,
Moran, M. F.,
Durocher, D.,
Mann, M.,
Hogue, C. W.,
Figeys, D.,
and Tyers, M.
(2002)
Nature
415,
180-183[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
| Milkereit, P., Kühn, H., Gas, N., and Tschochner, H. (2003)
Nucleic Acids Res., in press
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Perreault, C. Bellemer, and F. Bachand
Nuclear export competence of pre-40S subunits in fission yeast requires the ribosomal protein Rps2
Nucleic Acids Res.,
November 1, 2008;
36(19):
6132 - 6142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. R. Houchens, A. Perreault, F. Bachand, and T. J. Kelly
Schizosaccharomyces pombe Noc3 Is Essential for Ribosome Biogenesis and Cell Division but Not DNA Replication
Eukaryot. Cell,
September 1, 2008;
7(9):
1433 - 1440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. White, Z. Li, R. Sardana, J. M. Bujnicki, E. M. Marcotte, and A. W. Johnson
Bud23 Methylates G1575 of 18S rRNA and Is Required for Efficient Nuclear Export of Pre-40S Subunits
Mol. Cell. Biol.,
May 15, 2008;
28(10):
3151 - 3161.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. R. Strub, M. B.K. Eswara, J. B. Pierce, and D. Mangroo
Utp8p Is a Nucleolar tRNA-binding Protein That Forms a Complex with Components of the Nuclear tRNA Export Machinery in Saccharomyces cerevisiae
Mol. Biol. Cell,
October 1, 2007;
18(10):
3845 - 3859.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Dez, M. Dlakic, and D. Tollervey
Roles of the HEAT repeat proteins Utp10 and Utp20 in 40S ribosome maturation
RNA,
September 1, 2007;
13(9):
1516 - 1527.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Perez-Fernandez, A. Roman, J. De Las Rivas, X. R. Bustelo, and M. Dosil
The 90S Preribosome Is a Multimodular Structure That Is Assembled through a Hierarchical Mechanism
Mol. Cell. Biol.,
August 1, 2007;
27(15):
5414 - 5429.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. V. Rosado, D. Kressler, and J. d. l. Cruz
Functional analysis of Saccharomyces cerevisiae ribosomal protein Rpl3p in ribosome synthesis
Nucleic Acids Res.,
June 13, 2007;
(2007)
gkm388v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Bax, H. A. Raue, and J. C. Vos
Slx9p facilitates efficient ITS1 processing of pre-rRNA in Saccharomyces cerevisiae
RNA,
November 1, 2006;
12(11):
2005 - 2013.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Combs, R. J. Nagel, M. Ares Jr., and S. W. Stevens
Prp43p Is a DEAH-Box Spliceosome Disassembly Factor Essential for Ribosome Biogenesis
Mol. Cell. Biol.,
January 15, 2006;
26(2):
523 - 534.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Du, M. R.K. S. Rao, X. Q. Chen, W. Wu, S. Mahalingam, and D. Balasundaram
The Homologous Putative GTPases Grn1p from Fission Yeast and the Human GNL3L Are Required for Growth and Play a Role in Processing of Nucleolar Pre-rRNA
Mol. Biol. Cell,
January 1, 2006;
17(1):
460 - 474.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. D. Miles, J. Jakovljevic, E. W. Horsey, P. Harnpicharnchai, L. Tang, and J. L. Woolford Jr
Ytm1, Nop7, and Erb1 Form a Complex Necessary for Maturation of Yeast 66S Preribosomes
Mol. Cell. Biol.,
December 1, 2005;
25(23):
10419 - 10432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. de la Cruz, E. Sanz-Martinez, and M. Remacha
The essential WD-repeat protein Rsa4p is required for rRNA processing and intra-nuclear transport of 60S ribosomal subunits
Nucleic Acids Res.,
October 12, 2005;
33(18):
5728 - 5739.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. THOMSON and D. TOLLERVEY
Nop53p is required for late 60S ribosome subunit maturation and nuclear export in yeast
RNA,
August 1, 2005;
11(8):
1215 - 1224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Bernstein, J. E. G. Gallagher, B. M. Mitchell, S. Granneman, and S. J. Baserga
The Small-Subunit Processome Is a Ribosome Assembly Intermediate
Eukaryot. Cell,
December 1, 2004;
3(6):
1619 - 1626.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Loar, R. M. Seiser, A. E. Sundberg, H. J. Sagerson, N. Ilias, P. Zobel-Thropp, E. A. Craig, and D. E. Lycan
Genetic and Biochemical Interactions Among Yar1, Ltv1 and RpS3 Define Novel Links Between Environmental Stress and Ribosome Biogenesis in Saccharomyces cerevisiae
Genetics,
December 1, 2004;
168(4):
1877 - 1889.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E.G. Gallagher, D. A. Dunbar, S. Granneman, B. M. Mitchell, Y. Osheim, A. L. Beyer, and S. J. Baserga
RNA polymerase I transcription and pre-rRNA processing are linked by specific SSU processome components
Genes & Dev.,
October 15, 2004;
18(20):
2506 - 2517.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. DLAKIC and D. TOLLERVEY
The Noc proteins involved in ribosome synthesis and export contain divergent HEAT repeats
RNA,
March 1, 2004;
10(3):
351 - 354.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Oeffinger, M. Dlakic, and D. Tollervey
A pre-ribosome-associated HEAT-repeat protein is required for export of both ribosomal subunits
Genes & Dev.,
January 15, 2004;
18(2):
196 - 209.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Fingerman, V. Nagaraj, D. Norris, and A. K. Vershon
Sfp1 Plays a Key Role in Yeast Ribosome Biogenesis
Eukaryot. Cell,
October 1, 2003;
2(5):
1061 - 1068.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Steiner-Mosonyi, D. M. Leslie, H. Dehghani, J. D. Aitchison, and D. Mangroo
Utp8p Is an Essential Intranuclear Component of the Nuclear tRNA Export Machinery of Saccharomyces cerevisiae
J. Biol. Chem.,
August 22, 2003;
278(34):
32236 - 32245.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|