|
Originally published In Press as doi:10.1074/jbc.M210387200 on November 20, 2002
J. Biol. Chem., Vol. 278, Issue 6, 4216-4226, February 7, 2003
GRIP Domain-mediated Targeting of Two New Coiled-coil
Proteins, GCC88 and GCC185, to Subcompartments of the
trans-Golgi Network*
Michael R.
Luke,
Lars
Kjer-Nielsen,
Darren L.
Brown ,
Jennifer L.
Stow , and
Paul A.
Gleeson§
From The Russell Grimwade School of Biochemistry and Molecular
Biology, The University of Melbourne, Melbourne, Victoria 3010, Australia and Institute for Molecular Bioscience and
School of Molecular and Microbial Science, University of
Queensland, Brisbane 4072, Queensland, Australia
Received for publication, October 10, 2002, and in revised form, November 8, 2002
 |
ABSTRACT |
The GRIP domain is a targeting sequence
found in a family of coiled-coil peripheral Golgi proteins. Previously
we demonstrated that the GRIP domain of p230/golgin245 is specifically
recruited to tubulovesicular structures of the trans-Golgi
network (TGN). Here we have characterized two novel Golgi
proteins with functional GRIP domains, designated GCC88 and GCC185.
GCC88 cDNA encodes a protein of 88 kDa, and GCC185 cDNA encodes
a protein of 185 kDa. Both molecules are brefeldin A-sensitive
peripheral membrane proteins and are predicted to have extensive
coiled-coil regions with the GRIP domain at the C terminus. By
immunofluorescence and immunoelectron microscopy GCC88 and GCC185, and
the GRIP protein golgin97, are all localized to the TGN of HeLa cells.
Overexpression of full-length GCC88 leads to the formation of large
electron dense structures that extend from the trans-Golgi.
These de novo structures contain GCC88 and co-stain for the
TGN markers syntaxin 6 and TGN38 but not for 2,6-sialyltransferase,
-COP, or cis-Golgi GM130. The formation of these
abnormal structures requires the N-terminal domain of GCC88. TGN38,
which recycles between the TGN and plasma membrane, was
transported into and out of the GCC88 decorated structures. These data
introduce two new GRIP domain proteins and implicate a role for
GCC88 in the organization of a specific TGN subcompartment involved
with membrane transport.
 |
INTRODUCTION |
The trans-Golgi network
(TGN)1 is a highly dynamic
and complex membrane network that represents a major protein sorting
compartment of the secretory pathway. From the TGN, proteins are
shunted into distinct transport carriers for transport to the plasma
membrane, regulated secretory granules, different populations of
endosomes, or earlier compartments of the secretory pathway (1, 2). A
fundamental, unresolved question in cell biology is how the Golgi
apparatus is formed and in particular how the TGN maintains a highly
dynamic tubulovesicular structure and generates the diverse populations
of TGN-derived transport carriers. A number of Golgi matrix proteins
have been identified, for example GRASP55 and Golgin-45, which may be
involved in the maintenance of the medial-Golgi structure (3, 4).
Little, however, is known about a matrix associated with the
trans-Golgi responsible for generating or maintaining the
tubulovesicular structure of the TGN (5-7). There is growing evidence
that components of the Golgi matrix interface with components of the
trafficking machinery (8, 9). Unique sets of accessory molecules
dictate the budding of transport vesicles and their subsequent docking
on specific membrane domains. Many of these proteins are peripheral
membrane proteins that are recruited to the donor membrane in a highly
regulated manner. For example, on the TGN the AP-1 adaptor complex is
involved in the formation of clathrin-coated vesicles whereas other
heterotetrameric adaptors, AP-3 and AP-4, and the GGA
(Golgi-localizing, -adaptin ear homology,
ARF-binding) proteins are recruited to distinct TGN domains
involved in the formation of both clathrin and non-clathrin-coated vesicles (10, 11). However, the specific membrane association of many
of these components and the basis for the domain-specific organization
of the TGN is poorly defined.
Recently we and others (12-14) have identified a family of Golgi
coiled-coil peripheral membrane proteins in animal and yeast cells that
contain a conserved ~42-amino acid sequence at the C terminus, called
the GRIP domain. The level of sequence identity between the GRIP
domains is only modest; however, functional assays have demonstrated
that a number of different GRIP sequences can specifically target
reporter molecules to the Golgi apparatus. By analysis of chimeric
green fluorescent proteins (GFP), the GRIP domain has been shown to be
both necessary and sufficient for Golgi targeting in animal cells
(12-15). Furthermore, the GRIP domain of one family member, p230, has
been shown to target specifically to the TGN of mammalian cells (16).
In addition, we have also identified recently a coiled-coil protein
with a GRIP sequence in protozoan parasites and shown that the GRIP
domain was specifically recruited to the TGN in the trypanosomatid
parasite, Leishmania mexicana (17). The identification of
GRIP domain proteins associated with the TGN of this very primitive
protozoan eukaryotic cell suggests that these coiled-coil proteins play
a fundamental role in the organization and/or function of this highly
dynamic Golgi compartment.
In Saccharomyces cerevisiae, only one coiled-coil protein
with a GRIP domain has been identified. This protein, Imh1p, is a
suppressor of a temperature-sensitive yeast strain that lacks a
functional GTPase Rab6 homologue, Ypt6p (18, 19). In contrast a number
of proteins with potential GRIP domains have been identified in
mammalian cells, including the two characterized Golgi proteins, p230/golgin245 and golgin97. p230/golgin245 binds to the TGN in a
brefeldin A-sensitive manner (15, 20). Recent studies have shown that
endogenous p230 and a GFP chimera containing the p230-GRIP sequence
binds to a subdomain of the TGN that forms highly dynamic tubular
vesicular extensions that have the characteristics of transport
carriers (16, 20). Furthermore, the GFP-p230GRIP chimera
has been shown to be associated with a population of in vitro generated vesicles that lack markers ( -COP, -adaptin, Rab6, and p200/myosin II) associated with other TGN-derived vesicles (16). The extended coiled-coil structure of the GRIP domain proteins
links them to the broader family of Golgi coiled-coil proteins known as
golgins, which are proposed to function as molecular tethers in the
docking of transport vesicles with a target membrane and in the
maintenance of Golgi structure (21).
In addition to p230 and golgin97, data base searches also identified
two other putative human coiled-coil proteins with GRIP domains,
referred to previously as GCC1p (Golgi localized
coiled-coil protein) and KIAA0336
(13). By the analysis of GFP fusion proteins, the GRIP domain of GCC1p
was shown to function as a Golgi targeting signal in transfected cells.
The predicted GCC1p sequence was derived from a DNA cosmid sequence
(g1572c101) and required prediction of exon/intron boundaries (13). The
human expressed sequence tag sequence, KIAA0336
(GenBankTM accession number AB002334), is predicted
to encode a coiled-coil protein of 1583 amino acids. The GRIP sequence
of KIAA0336 has not yet been analyzed experimentally; however it is
predicted to contain the highly conserved Tyr (or Phe) residues at
positions 4 and 12 of the domain, aromatic residues that are essential
for the GRIP domain to function in Golgi targeting. These findings raised a number of questions. First, are GCC1p and KIAA0336 bona fide Golgi proteins? Second, in view of the modest sequence
similarity between GRIP domains, are the different GRIP domains
localized to the same or different regions of the Golgi apparatus?
Third, how many mammalian GRIP proteins are found in one particular
cell type? Finally, do all the mammalian GRIP proteins have similar functions? In the present study we report on the full-length sequences of both novel human GRIP proteins, which we now call GCC88 (for GCC1p)
and GCC185 (for KIAA0336), and demonstrate that they are both localized
to the TGN in HeLa cells, along with the other two GRIP family members
p230 and golgin97. Altogether, our data show that four different
brefeldin A-sensitive GRIP proteins are associated with the TGN of
mammalian cells. We further show that GCC88 overexpression results in a
major perturbation of a domain of the TGN associated with the membrane
transport of TGN38.
 |
EXPERIMENTAL PROCEDURES |
Antibodies--
Human autoantibodies to p230 have been described
(22). The 9E10 mouse monoclonal antibody specific for the myc
epitope has been described (23). The P5D4 mouse monoclonal antibody
that recognizes the VSV-G epitope was described by Kries (24).
Rabbit polyclonal antibodies to -COP were kindly provided by Dr. R. Teasdale (University of Queensland, Brisbane, Queensland, Australia). A
monoclonal antibody to GFP, purchased from Roche Molecular
Biochemicals, was used at dilutions of 1/1000 for
immunoblotting. Monoclonal antibodies to golgin97, syntaxin 6, GM130,
and TGN38 were purchased from Transduction Laboratories (Lexington,
KY). For electron microscopy, a polyclonal anti-GFP (Molecular Probes)
was used at 1/500 dilution. Sheep anti-rabbit Ig-FITC, sheep anti-mouse
Ig-FITC, and sheep anti-human IgG-FITC were purchased from Silenus
Laboratories (Melbourne, Victoria, Australia), goat anti-rabbit
IgG-Texas Red, goat anti-mouse IgG-Texas Red, goat anti-mouse IgG-Alexa
Fluor 568, and goat anti-human IgG-Alexa Fluor 594 were from Molecular
Probes. Horseradish peroxidase-conjugated rabbit anti-mouse Ig and
porcine anti-rabbit Ig were obtained from DAKO corporation
(Carpinteria, CA).
Cell Culture and Transfection--
HeLa, COS, and normal rat
kidney (NRK) cells were maintained as monolayers in Dulbecco's
modified Eagle's medium (DMEM), supplemented with 5% fetal calf
serum, 2 mM glutamine, and 100 µg/ml
penicillin/streptomycin, in a humidified 37 °C incubator with 10%
CO2. Stable HeLa cells expressing 2,6-sialyltransferase
(SialylT) tagged at the C terminus with a VSV-G epitope (25) were
generously supplied by Dr. T. Nilsson and were grown in the above
medium supplemented with 500 µg/ml G418 (Invitrogen).
Transient transfections of cells were performed using FuGENE
transfection reagent (Roche Molecular Biochemicals) as described
previously (16).
Reverse Transcriptase Polymerase Chain Reaction and Cloning of
GCC88--
HeLa cell RNA was isolated using the RNAqueous kit
according to the manufacturer's instructions (GeneWorks).
cDNA was prepared from HeLa RNA using Superscript (Invitrogen) and
oligo(dT) (Promega) primer. GCC88 cDNA was amplified as four
overlapping fragments that collectively spanned the entire length of
the open reading frame predicted from the genomic sequence. Fragment 1 (bases 1-783) was amplified using the primers
CCGGAATTCCACCATGGAGAAGTTTGGGATG and
CGCGGATCCGCGCTGGGTCCTCTCCTCCTG. Fragment 2 (bases 715-1293) was
amplified using the primers CCGGAATTCCGAGCAGAGTGACCATGCCTTG and
CGCGGATCCGACATTGACATCCAGACTGGA. Fragment 3 (bases 1189-1798) was
amplified using the primers CCGGAATTCCCGCATTCTGCAGCTGGAC and CGCGGATCCCTTCTCGGTGAGCACAGCTAG. Fragment 4 (bases 1729-2328) was amplified using the primers CCGGAATTCCCGCACACTGAAACTGGAG and
CGCGGATCCTCATCTCTTGCCAGAAGG. Sequences 5' to the predicted ATG
start codon of GCC88 were amplified using the 5' rapid amplification of
cDNA ends method (Invitrogen). Each PCR product was subcloned into
the EcoRI/BamHI sites of pGEX-6P-3, except for
fragment 4, which was subcloned into the
EcoRI/BamHI sites of pEGFP-C1
(Clontech), and both strands were sequenced using
automated DNA sequencing. Fragments were then assembled into
full-length cDNA using convenient restriction sites and cloned into
pCIneo (Promega).
DNA Constructs--
GFP-GCC88GRIP,
GFP-p230GRIP, and GFP-golgin97GRIP were
described previously (13, 15). A construct encoding the full-length GCC88 with a triple myc epitope tag fused to the N terminus was generated by subcloning the full-length coding region of GCC88 from
pCIneo-GCC88 into pCMU-3xMyc (supplied by Dr. Rohan Teasdale).
To generate a construct that lacked 279 amino acids from the N terminus
of GCC88, pCMU-3xMyc-GCC88 was digested with BamHI and
NdeI to remove an 885-bp fragment between the 3' end of the c-myc coding region and the NdeI site within GCC88.
Following Klenow treatment to fill recessed 3' ends, the digested
vector was self-ligated.
The sequence encoding the C-terminal 82 amino acids of GCC185 was
amplified from pBluescript-SK+-KIAA0336 (provided by Kazusa
DNA Research Institute) using the primers
CCGGAATTCCTTGGAAAGGAATCAAGAG and
CCGGAATTCCTATCGAAGTCCAGACCA. The PCR product was digested with
EcoRI and cloned into the EcoRI site of pEGFP-C1
(GFP-GCC185GRIP). The full-length 6.8-kb GCC185 cDNA
was subcloned into pCIneo (Promega) using XhoI and
SacII.
Glutathione S-transferase (GST) fusion proteins were
constructed using pGEX-6P-3 (Pharmacia). The sequence encoding the
C-terminal 82 amino acids of GCC185 was subcloned from the
pEGFP-GCC185GRIP plasmid into the EcoRI site of
the pGEX-6P-3 plasmid (GST-GCC185GRIP). The sequence
encoding the C-terminal 199 amino acids of GCC88, derived from a PCR
product, was subcloned into the EcoRI/SmaI site
of pGEX-6P-3 (GST-GCC88C199aa).
Generation of Anti-GCC88 and Anti-GCC185
Antibodies--
Polyclonal anti-GCC185 antiserum was prepared by
immunizing a rabbit with the GST-GCC185GRIP fusion protein,
comprising the C-terminal 82 amino acids of GCC185 fused to the C
terminus of GST. The GST fusion protein was purified from a bacterial
extract on a column of glutathione-agarose (Sigma) by the method
described (22).
Polyclonal rabbit anti-GCC88 antiserum was prepared by immunizing a
rabbit with the C-terminal 199 residues of GCC88. This immunogen was
produced by first generating a fusion protein comprising the C-terminal
199 amino acids of GCC88 fused to the C terminus of GST
(GST-GCC88C199aa). GCC88C199aa polypeptide was
then cleaved from the purified GST fusion protein using Prescission
Protease (Amersham Biosciences) and purified.
Rabbits were immunized three times with 50-100 µg of immunogen
emulsified with Freund's complete adjuvant or Freund's incomplete adjuvant. A terminal bleed was collected by cardiac puncture 12 days
after the final injection.
Immunofluorescence--
Cells were processed for
immunofluorescence as described previously (15) and examined by
confocal microscopy using a Bio-Rad MRC-1024 imaging system. For dual
labeling, images were collected independently to ensure there was no
spillover of fluorescence between channels.
Membrane Fractionation--
Subconfluent monolayers of HeLa
cells were detached by scraping into PBS and washed in chilled
hypotonic-sucrose buffer (250 mM sucrose, 10 mM
HEPES, pH 7.4), containing Complete Protease Inhibitors (Roche
Molecular Biochemicals, Germany). Cells were resuspended in 500 µl of
hypotonic-sucrose buffer and passaged 20 times through a 26-gauge
needle. Intact cells and nuclei were removed by centrifugation at
2,700 × g for 10 min, and the resulting supernatant
was centrifuged at 100,000 × g at 2 °C for 60 min. The resulting microsome pellet was resuspended in hypotonic sucrose buffer. Equivalent proportions of each fraction were analyzed by
SDS-PAGE and immunoblotting.
Brefeldin A Treatment--
Cell monolayers were treated with 5 µg/ml brefeldin A (Calbiochem) diluted in complete DMEM at 37 °C.
Following treatment, cells were washed three times in PBS, fixed, and
processed for immunofluorescence.
Immunoblotting--
Cell extracts were dissolved in
reducing sample buffer and subjected to SDS-PAGE. Proteins were then
transferred to nitrocellulose membrane, and the membrane was blocked
with 5% skim milk powder in PBS for 2 h. Antibodies were diluted
in PBS containing 5% (w/v) skim milk powder and incubated on the
membrane for 1 h, followed by three 10-min washes in 0.05% Tween
20/PBS. Membranes were then incubated with peroxidase-conjugated
anti-mouse or rabbit antibodies, as appropriate, and bound antibodies
were detected by enhanced chemiluminescence (PerkinElmer Life
Sciences) as described (20).
Immunogold Labeling and Electron Microscopy--
For immunogold
labeling, subconfluent monolayers of untransfected or transfected HeLa
cells were washed with PBS and fixed with buffered 4% paraformaldehyde
(electron microscopy grade; ProSciTech), containing 0.2 M sucrose and then scraped from the dishes and resuspended
in 10% gelatin and infiltrated with 15% polyvinyl-pyrrolidone (Sigma)
in 1.7 M sucrose before snap freezing. Preparation of ultra
thin cryosections and immunogold labeling were carried out as described
previously (16). Sections were labeled with antibodies to GFP, myc,
syntaxin 6, and GCC88, either singly or in combination. Rabbit
antibodies were detected with protein A-gold conjugates (gift from Dr.
J. Slot, University of Utrecht), and mouse antibodies were labeled with
goat anti-mouse gold (British Biocell).
TGN38 Internalization--
NRK cells, grown on coverslips
in complete DMEM, were transfected with myc-GCC88 24-36 h before
treatment. Cells were then washed twice in PBS and incubated in
serum-free DMEM containing 1.25 µg/ml mouse anti-TGN38 monoclonal
antibody for the indicated time period at 37 °C or on ice. As
controls, cells were incubated in either serum-free DMEM alone or
irrelevant antibody (anti-VSV-G epitope monoclonal antibody P5D4) at
37 °C for 90 min. Monolayers were then washed four times in PBS and
fixed immediately in 4% paraformaldehyde/PBS for 15 min. Cells were
processed as for immunofluorescence and stained with sheep anti-mouse
Ig-FITC, followed by rabbit anti-GCC88 and finally goat anti-rabbit
IgG-Texas Red.
 |
RESULTS |
Identification of Two Novel Golgi Proteins with Functional GRIP
Domains, GCC185 and GCC88--
Previously, we established that the
defined Golgi proteins, p230/golgin245 and golgin97, contained
functional GRIP domains (13). Data base searches identified two other
putative human proteins with similar GRIP domains that are predicted to
contain extensive coiled-coil regions. One of the putative proteins was predicted from genomic sequences and referred to previously as GCC1p
(Golgi localized coiled-coil
protein). We established that the GRIP sequence of this
putative protein represented a functional Golgi targeting domain, as a
fusion with GFP was efficiently targeted to the Golgi of transfected
COS cells (13). As the predicted GCC1p protein was based on the
sequence of a putative gene within the human genomic cosmid g1572c101
(GenBankTM accession number HSAC000357), requiring
prediction of intron/exon boundaries, we have analyzed the sequence of
this protein. cDNA clones of GCC1p were obtained by reverse
transcriptase PCR using HeLa cell RNA as described under
"Experimental Procedures." 5' sequence of the mRNA was obtained
using rapid amplification of cDNA ends. Together the clones
comprise 2522 bp, and an open reading frame of GCC1 cDNA spans an
in-frame ATG initiation codon at nucleotide position 194 bp and a TGA
termination at nucleotide position 2519 bp. The open reading frame
encodes a protein of 775 amino acids with an expected molecular
mass of 87.8 kDa (Fig.
1B); therefore we now call
this protein GCC88. A plot of hydrophilicity suggests GCC88 is a
predominantly hydrophilic structure, with no evidence for a signal
sequence or hydrophobic transmembrane domain, consistent with a
peripheral membrane protein. Analysis of the sequence for coiled coils
showed that a considerable portion (>80%) of the molecule had a high
probability of assuming a coiled-coil structure, typical of other GRIP
proteins. There are a number of interruptions in the predicted
coiled-coil structure, suggesting GCC88 adopts a rod-like structure
with periodic flexible joints. Non-coiled-coil regions of the molecule
include a ~75 residue segment close to the N terminus and the
C-terminal GRIP domain (Fig. 1C).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 1.
Analysis of the sequences of GCC88 and
GCC185. A, alignment of the GRIP sequences of g1572c101
(GCC1p/GCC88), KIAA0336 (GCC185), golgin97, and p230.
Asterisks indicate identity, and single and
double dots represent degrees of similarity. B,
predicted amino acid sequence of GCC88 based on cDNA sequence. The
GRIP domain is shaded. C, prediction of
coiled-coil segments of GCC88 and GCC185 based on the method of Lupas
et al. (32). D, confocal fluorescence images of
COS cells transfected with GFP-GCC185GRIP,
GFP-GCC88GRIP, or GFP-p230GRIP, as indicated.
Cells were fixed 48 h after transfection. Bar, 10 µm.
|
|
The second putative human protein with a predicted GRIP domain was
based on the sequence of an expressed sequence tag, KIAA0336, and is
predicted to encode a protein of 1583 amino acids (calculated molecular
mass of 185 kDa) with extensive coiled-coil domains spanning almost the
entire length of the protein and a potential non-coiled-coil GRIP
domain at its C terminus (Fig. 1C). We call this protein
GCC185. The lack of a signal sequence or transmembrane domain is
consistent with it also being a peripheral membrane protein. In view of
the low sequence similarity between the GRIP domain sequences (Fig.
1A) it is important to determine whether the GRIP domain of
GCC185 is a functional Golgi targeting sequence. The cDNA encoding
the 200 C-terminal residues of KIAA0336 was isolated by reverse
transcriptase PCR of HeLa cell RNA, and the sequence of the GRIP domain
was shown to be identical to that found in the data base. We
constructed a chimeric cDNA encoding the non-coiled-coil C-terminal
domain of GCC185 (82 residues), which includes the GRIP domain, fused
to the C terminus of GFP. COS cells transfected with the
GFP-GCC185-GRIP construct showed targeting of GFP fluorescence to the
Golgi region of the transfected cells, as indicated by the concentrated
juxtanuclear fluorescence, with a similar staining pattern to
GFP-GCC88GRIP and GFP-p230GRIP. Therefore, even
though the sequence similarity between the GRIP domains is modest, the
GRIP sequence of GCC185 is a functional Golgi targeting motif.
To determine whether the two novel human proteins are bona
fide Golgi proteins, we generated rabbit antisera to the
C-terminal domains of either GCC88 or GCC185 as described under
"Experimental Procedures." Because the antibodies were generated to
sequences that included GRIP domains, we were cognizant of the
possibility for cross-reactivity of the antiserum with other members of
the GRIP family. Therefore, we assessed the ability of the antisera to
cross-react with GRIP domains of the other mammalian members of the
family (p230, golgin97, GCC88, and GCC185). Fusions with GFP were
analyzed to avoid cross-reactivity of antibodies with the GST. COS
cells were transiently transfected with GFP constructs, and cell
extracts were immunoblotted with the antisera. As expected, the
antisera raised to GCC88C199aa reacted strongly to the
47-kDa GFP-GCC88C199aa, and importantly no cross-reactivity
was observed with GFP-GCC185GRIP, GFP-p230GRIP,
or GFP-golgin97GRIP fusion protein (Fig. 2A).
Blotting with anti-GFP antibodies demonstrated the presence of abundant
levels of each fusion protein on the membrane blot (Fig.
2A). Likewise, antibodies to
GCC185 showed a strong reactivity to the 35-kDa
GFP-GCC185GRIP fusion protein but no cross-reactivity to
fusion proteins containing GRIP sequence of p230, golgin97, or GCC88
(Fig. 2B). The band observed at 32 kDa with the anti-GCC185
serum, which does not correspond to sizes of any of the GFP fusion
proteins, is nonspecific.

View larger version (64K):
[in this window]
[in a new window]
|
Fig. 2.
Specificity of rabbit anti-GCC88 and
anti-GCC185 antibodies. Immunoblot analysis of anti-GCC88
(A) and anti-GCC185 (B) with extracts of COS
cells transfected with wild type GFP, GFP-GCC88GRIP,
GFP-GCC185GRIP, GFP-p230GRIP,
GFP-golgin97GRIP, or with GFP fused to the C-terminal 199 residues of GCC88 (GFP-GCC88C199aa). Blots were
incubated with either anti-GFP or anti-GCC antibodies, as indicated,
followed by peroxidase-Ig conjugates, and the bound antibodies were
detected by chemiluminescence.
|
|
Immunofluorescence of transfected COS cells was also performed to
ensure the two antisera did not cross-react with other GRIP domains in
native rather than denatured proteins. COS cells transfected with
GFP-GCC88GRIP stained strongly with the anti-GCC88
antibody, and the anti-GCC88 staining co-localized with the GFP
fluorescence, demonstrating that the antibody was binding to the GFP
fusion protein. On the other hand, COS cells expressing
GFP-GCC185GRIP, GFP-p230GRIP, or
GFP-golgin97GRIP showed no staining with the anti-GCC88
antibody (not shown). Similarly, the anti-GCC185 antibody recognized
the GFP-GCC185GRIP fusion protein in transfected COS cells
but showed no cross-reactivity with the other three GFP-GRIP fusion
proteins (not shown). Collectively, these data demonstrate that the
anti-GCC88 and anti-GCC185 antibodies are specific for the proteins
against which they were raised.
Immunoblotting of HeLa cell extracts with anti-GCC88 antibody detected
a single specific component of ~ 105 kDa, an apparent molecular
mass slightly larger than the predicted 88 kDa. Fractionation of HeLa
cells showed that the 105-kDa component was associated with both the
membrane and cytosolic fraction, indicative of a peripheral membrane
protein (Fig. 3A). To ensure
that the cDNA encoding GCC88 we had isolated was full-length, we
expressed the GCC88 cDNA in COS cells and immunoblotted cell
extracts with anti-GCC88 antibody. In untransfected COS cells, a weak
band of 105 kDa was detected, and in extracts of transfected cells we
detected a highly abundant component of identical size (105 kDa),
showing that the GCC88 cDNA encoded a protein of identical size as
the endogenous GCC88 (Fig. 3C). The additional, smaller
components, detected in the transfected cell extracts, probably
represent degradation products of the overexpressed GCC88.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 3.
Membrane association of endogenous GCC88 and
GCC185 and expression of transfected cDNAs. A and
B, analysis of membrane association of GCC88 and GCC185.
Triton X-100 cell extracts, total membranes, and cytosol fractions were
prepared from HeLa cells, separated by SDS-PAGE, and subjected to
immunoblot analysis using pre-immune and immune rabbit sera to GCC88
(A) or GCC185 (B). C, COS cells were
transiently transfected with pCIneo-GCC88 or pCIneo-GCC185, and the
extracts were immunoblotted. Untransfected and transfected cell
extracts were immunoblotted with anti-GCC88 and anti-GCC185, as
indicated. The ratio of untransfected to transfected cell extracts
loaded was 500:1 for GCC88 transfected cells and 1:1 for GCC185
transfected cells.
|
|
Anti-GCC185 antibodies detected a specific component of ~175 kDa in
HeLa cell extracts by immunoblotting, and like GCC88, was also
associated with both membrane and cytosolic fractions (Fig.
3B). A size of 175 kDa is consistent with the expected size of GCC185. The additional band observed at 130 kDa was considered nonspecific as it was also detected in the control blots with pre-immune serum and varied in intensity between samples. The anti-GCC185 antibodies also recognized a specific 175-kDa component in
COS cell extracts and, furthermore, showed strong reactivity with an
identical 175-kDa-sized component in COS cells transfected with the
full-length GCC185 (Fig. 3C). These data confirm that the
antibody raised to the GST fusion protein specifically recognizes endogenous GCC185 and that the cDNA clone is full-length.
Four Human GRIP Proteins Are Localized to the TGN of HeLa
Cells--
By immunofluorescence, anti-GCC88 antibodies showed strong
juxtanuclear staining of HeLa cells (Fig.
4, A and B), a
typical staining of the Golgi apparatus. Staining of HeLa cells with
rabbit antibodies to GCC88 and human autoantibodies to p230 showed that GCC88 co-localized extensively with p230, a known TGN protein (20). On
the other hand, GCC88 showed only minimum overlap with the
cis-Golgi marker GM130 (Fig. 4B), indicating that
GCC88 is localized to the trans region of the Golgi
apparatus. Likewise, endogenous GCC185 and golgin97 also co-localize to
a large extent with p230 (Fig. 4, C and D),
indicating that all four golgins may be targeted to the membranes of
the trans-Golgi/TGN.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 4.
Endogenous GCC88, GCC185,and golgin97
colocalize with p230 in HeLa cells. Semiconfluent HeLa cell
monolayers were fixed, permeabilized, and stained for GCC88 and p230
(A), GCC88 and GM130 (B), GCC185 and p230
(C), and golgin97 and p230 (D), using rabbit
anti-GCC88, human anti-p230 antibody, mouse monoclonal anti-GM130,
rabbit anti-GCC185, and mouse monoclonal anti-golgin97 antibody. Bound
antibody was detected with either anti-rabbit IgG-Texas Red or
anti-rabbit Ig-FITC or Alexa594- or FITC-anti-human IgG.
A-C, monolayers were fixed in paraformaldehyde
and in cold methanol (D). Confocal images were collected
with identical iris settings. Superimposed images (Overlay)
reveal regions of co-localization. Control incubations demonstrated no
cross-reactivity between the anti-Ig conjugates or between the anti-Ig
conjugates and the irrelevant primary antibody. Similar results were
obtained irrespective of the order of the primary antibodies.
Bar, 10 µm.
|
|
To more precisely localize GCC88 and GCC185 in HeLa cells, cryofixed
HeLa cells were labeled by the immunogold technique. Only very limited
labeling for endogenous GCC88 and GCC185 was observed (not shown),
therefore HeLa cells were transfected with myc-tagged full-length
constructs, and transfected cells were labeled with anti-myc
antibodies. For GCC88, gold labeling was found specifically associated
with one side of the Golgi stack (Fig.
5A). The labeled region was
identified as the TGN by the presence of co-labeling of syntaxin 6, a
TGN-specific soluble N-ethylmaleimide-sensitive factor
attachment protein receptor (SNARE) (26) that labeled membranes in the
same region (Fig. 5B). myc-GCC185 was also found associated
with tubulovesicular structures in the TGN, consistent with the
immunofluorescence data (Fig. 5C). Antibodies to golgin97
were unsuitable for immunogold labeling of cryosections. GFP labeling
of cryofixed GFP-golgin97GRIP-transfected HeLa cells was
located to one side, the TGN side, of the Golgi stack associated with
tubulovesicular structures (Fig. 5D). The majority of the
Golgi cisternae were unlabeled. We have shown previously (16, 20) that
p230 and the p230 GRIP domain are localized to the TGN. Taken together,
these data show that all four GRIP proteins are localized to the
trans-Golgi/TGN.

View larger version (131K):
[in this window]
[in a new window]
|
Fig. 5.
myc-tagged GCC88 and GCC185 and
GFP-golgin97GRIP localize to the
trans-Golgi/TGN. Cells transiently transfected
with myc-GCC88, myc-GCC185, or GFP-golgin97GRIP were fixed
by paraformaldehyde and processed for cryoelectron microscopy. Ultra
thin cryosections were labeled with monoclonal antibody 9E10
(myc) alone (A-C) or antibodies to
GFP alone (D) or double labeled with monoclonal antibodies
to myc and to syntaxin 6 (syn6) (B). Antibodies
were detected with 5-15 nm protein A gold particles or goat anti-mouse
gold conjugates. Note that in each case gold labeling is found in the
vicinity of the Golgi complex (G) concentrated on the TGN
side of the stack. Syntaxin 6 (arrowheads) and anti-myc
antibodies labeled membranes of the TGN. Bars, 100 nm.
|
|
Golgi Membrane Binding of GCC88 and GCC185 Is Brefeldin
A-sensitive--
Previously, we showed that p230 is slowly dissociated
from HeLa Golgi membranes in the presence of brefeldin A (20). We have
compared the dissociation rate of p230, GCC88, and GCC185 from Golgi
membranes in the presence of this drug. Immunofluorescence staining was
carried out on HeLa cells treated with brefeldin A for various times.
There was no effect on the perinuclear localization of GCC88 after a
5-min brefeldin A treatment; by 15 min of treatment, however, there was
a reduction in perinuclear staining of GCC88, together with an increase
in the cytoplasmic staining (Fig. 6). Similar rates of dissociation of GCC185 from Golgi membranes were observed in the presence of brefeldin A (not shown). In contrast, and
as expected, -COP was mostly dissociated from Golgi membranes within
2 min of treatment (Fig. 6). The relatively slow rate of dissociation
of GCC88 and GCC185 is similar to that observed previously for p230 and
distinguishes these proteins from most other brefeldin A-sensitive
peripheral membrane Golgi proteins that dissociate from the membrane
rapidly.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 6.
GCC88 dissociates slowly from Golgi membranes
after brefeldin A treatment of HeLa cells. HeLa cells were either
untreated (0 min) or incubated for 2 min, 5 min, 10 min, or
15 min with 5 µg/ml brefeldin A at 37 °C. Cells were then fixed,
permeabilized, and stained for GCC88 or -COP, as indicated.
|
|
Overexpression of Full-length GCC88 Results in an Abnormal
Structure of a Domain of the TGN--
In the course of experiments
expressing full-length GCC88 we noted that although low levels of
expression showed GCC88 localized to the typical juxtanuclear Golgi
pattern, at higher levels of expression GCC88-labeled structures began
to extend out from the Golgi region. The size of these structures was
dependent on the level of expression of GCC88. Fig.
7 shows a series of three-dimensional reconstructions of Z-series images to illustrate the topology of these
structures and the relationship to the level of GCC88 protein. The
GCC88-labeled structures extend from the Golgi, and at high levels of
protein, the GCC88 structures totally enclose the nucleus (see Fig. 7).
By immunofluorescence these GCC88-labeled structures resemble the
appearance of "cauliflowers." The transfected HeLa cells
containing the cauliflower-like structures were viable, as determined
by propidium iodide staining 48 h after transfection.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 7.
Overexpression of GCC88 results in a
morphological phenotype. HeLa cells were transfected with
myc-GCC88, fixed, permeabilized, and stained with anti-myc monoclonal
antibody followed by FITC-anti-mouse Ig. Nuclei were stained with
propidium iodide. Shown are a series of three-dimensional
reconstructions of Z-series images of transfected cells expressing low
to high levels of GCC88. Bar, 10 µm.
|
|
The formation of the cauliflower phenotype was not observed with the
GFP-GCC88GRIP fusion protein. Overexpression of
GFP-GCC88GRIP results in saturation of Golgi membrane
binding sites, and excess fusion protein is found in the cytoplasm. In
contrast the high levels of full-length GCC88 appear to be inevitably
recruited to the abnormal structures. To exclude the possibility that
the myc epitope was contributing to the formation of the abnormal structures we examined COS cells expressing untagged GCC88, as well as
FLAG-tagged and GFP-tagged GCC88. Substitution of the myc tag with
either FLAG or GFP resulted in the formation of the structures, as did
expression of untagged full-length GCC88 (not shown).
Next we examined the localization of a range of markers in cells
overexpressing GCC88, to identify molecules that were affected by the
cauliflower phenotype. GM130 staining was unaffected in cells
expressing high levels of GCC88, demonstrating that the Golgi stack was
not perturbed (Fig. 8A). The
resident TGN membrane protein, SialylT, was examined using a
stable HeLa cell line expressing VSV-G epitope-tagged SialylT (25). The
SialylT expressing HeLa cells were transiently transfected with GCC88.
In transfected cells expressing low levels of GCC88, there was almost
complete co-localization of GCC88 and SialylT, consistent with the TGN location of GCC88 (Fig. 8B, arrows). In
transfected cells displaying a mild cauliflower phenotype SialylT
remained tightly perinuclear and showed little overlap with GCC88 (Fig.
8B, inset). In transfected cells with a more
extreme cauliflower phenotype the SialylT staining pattern showed a
more punctate staining pattern; however, the SialylT staining pattern
did not overlap with the GCC88-labeled structures (Fig. 8B).
These results indicate that the TGN resident membrane protein SialylT
is not recruited into the GCC88-labeled structures.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 8.
Distribution of Golgi markers in HeLa cells
expressing high levels of GCC88. HeLa cells were transiently
transfected with myc-GCC88, fixed, permeabilized, and co-stained for
GCC88 and GM130 (A), p230 (C), golgin97
(D), or -COP (E). In B, HeLa cells,
stably expressing SialylT fused to the VSV-G epitope, were transiently
transfected with myc-GCC88, fixed, permeabilized, and co-stained for
GCC88 and VSV-G epitope-tagged SialylT. In F, NRK cells were
transiently transfected with myc-GCC88, fixed, permeabilized, and
co-stained for GCC88 and TGN38. GCC88 was detected with rabbit
anti-GCC88 antibodies followed by Texas Red-goat anti-rabbit IgG.
GM130, epitope-tagged SialylT, golgin97, -COP, and TGN38 were
detected with mouse monoclonal antibodies, and bound antibodies were
detected with FITC-labeled sheep anti-mouse Ig. In C, p230
was detected with human anti-p230 antibodies and FITC-goat anti-human
IgG. In each case, the marker was labeled first and GCC88 was labeled
second. Shown are images of transfected cells expressing high levels of
GCC88. Superimposed images (Overlay) reveal regions of
co-localization. In B, arrows indicate cells
expressing low levels of GCC88. Control incubations demonstrated no
cross-reactivity between the anti-Ig conjugates and the irrelevant
primary antibody. Bars, 10 µm.
|
|
Dual labeling of high expressing GCC88 cells for endogenous p230 and
golgin97 showed considerable co-staining, whereas, the coat protein
-COP retained its typical staining pattern and was not localized to
the GCC88-labeled cauliflower structures (Fig. 8,
C-E). To investigate whether molecules that
recycle through the TGN were incorporated into the cauliflower
structures we stained GCC88-transfected NRK cells for the membrane
protein TGN38. At low levels of GCC88 expression, extensive
co-localization of GCC88 and TGN38 was observed (not shown). This
result was expected as TGN38 is predominantly located within the TGN
(27). Significantly, at high levels of GCC88 expression, TGN38 was also
localized within the cauliflower structures (Fig. 8F),
clearly demonstrating that the GCC88-labeled structures include
recycling membrane proteins.
By electron microscopy, myc-tagged GCC88 transfected cells displayed
electron dense structures in close proximity to the
trans-face of the Golgi, and in some cells these structures
were found to extend some distance from the Golgi stack (Fig.
9, A and B).
Immunolabeling for GCC88 with anti-myc antibodies revealed GCC88
decorated tubulovesicular structures associated with the TGN, as well
as giving heavy labeling of the electron dense structures adjacent to
the TGN membranes. Both the tubulovesicular structures and the electron
dense structures were co-labeled with syntaxin 6, confirming that the
GCC88-labeled structures are either TGN membranes or derived therefrom.
The large electron dense structures are highly ordered and label very strongly with either anti-myc antibodies or anti-GCC antibodies (Fig.
9A). Labeling of GCC88 was observed predominantly on the outside of the high density protein arrays. The structures are composed
of highly ordered electron dense arrays, and lipid bilayers were not
readily visible in these structures. The high level of immunogold
labeling indicates that the electron dense structures in these
transfected cells are because of close packing of GCC88 molecules.

View larger version (139K):
[in this window]
[in a new window]
|
Fig. 9.
Overexpression of GCC88 leads to the
formation of aberrant structures extending from the TGN. HeLa
cells were transfected with myc-GCC88 and cells fixed with
glutaraldehyde and processed for cryoelectron microscopy. Ultra thin
cryosections were double labeled with monoclonal antibodies to myc and
rabbit polyclonal antibodies to GCC88 (A) or double labeled
with monoclonal antibodies to myc and to syntaxin 6 (syn6)
(arrows) (B) or labeled with antibodies to
syntaxin 6 or myc alone (C and D, respectively).
Antibodies were detected with 5-10 nm protein A gold particles.
Inset in A shows lower magnification of electron
dense GCC88-labeled structures. Note the labeling of structures that
are in close proximity to the TGN. Bars, 100 nm.
|
|
Cauliflower Phenotype Is Dependent on Coiled-coil Regions and the N
Terminus of GCC88--
Overexpression of GFP-GCC88GRIP
does not result in the generation of abnormal phenotype, rather at high
levels of expression of the GRIP fusion protein the membrane binding
sites are saturated, and excess GFP fusion protein is found distributed
throughout the cytoplasm (Fig. 10). To
determine whether the N-terminal domain is required for the formation
of the cauliflower structures, a deletion mutant was constructed
lacking the 279 N-terminal residues. The myc-GCC88280-775
mutant showed Golgi localization, as expected, but high levels of
expression showed no evidence of abnormal Golgi staining, and the GCC88
deletion mutant was localized both on the Golgi and in the cytoplasm,
analogous to the behavior of the GFP-GRIP fusion protein (Fig. 10).
Therefore, the non-coiled-coil N-terminal domain is required to
generate the abnormal phenotype.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 10.
Aberrant structures induced by high levels
of GCC88 are dependent on the N-terminal domain of GCC88. Confocal
fluorescence images of fixed COS cells transfected with
GFP-GCC88GRIP, myc-GCC881-775, or
myc-GCC88280-775 as indicated. myc-GCC88 products were
detected with anti-myc monoclonal antibody followed by FITC-anti-mouse
Ig. Transfected cells were fixed 48 h after transfection.
Bars, 10 µm.
|
|
TGN38 Traffics through GCC88-labeled Structures--
The
localization of TGN38 to the GCC88-labeled cauliflower structures may
represent a pool of TGN38 molecules that are blocked in transport or
alternatively may represent TGN38 molecules that are in transit through
a subdomain of the TGN. To determine whether the cauliflower structures
can receive membrane cargo molecules, we traced TGN38 molecules from
the cell surface of NRK cells to the TGN by incubation of live cells
with anti-TGN38 monoclonal antibody. After the incubation, cells were
washed to remove unbound antibody, and the TGN38/antibody complexes
were detected using FITC-anti-mouse Ig. Incubation of NRK cells with
anti-TGN38 antibodies on ice showed low level staining of cell surface
TGN38 and no co-localization of TGN38 and the GCC88-stained structures
(Fig. 11A). Incubation of
untransfected cells with anti-TGN38 antibody at 37 °C showed
co-localization of TGN38 with endogenous GCC88, confirming the movement
of TGN38 from the cell surface to the TGN (Fig. 11F).
Incubation of GCC88-transfected NRK cells with anti-TGN38 antibody at
37 °C for 10 min resulted in the localization of the antibody-TGN38
complex within GCC88-labeled cauliflower structures (Fig.
11B). Further incubation at 37 °C for 90 min showed an
increase in antibody-TGN38 complex detected within the GCC88 structures
(Fig. 11C). On the other hand, incubation of the cells at
37 °C for 90 min with an irrelevant monoclonal antibody showed only
a low level internalization of the antibody, demonstrating that the
uptake of anti-TGN38 antibody was specific (Fig. 11E). This
result demonstrates that TGN38 is transported from the cell surface
into the subdomain of the TGN that has been perturbed by the
overexpression of full-length GCC88.

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 11.
Cell surface TGN38 is transported into
enlarged GCC88-labeled structures. NRK cells were transfected with
myc-GCC88. The cells were then washed in PBS and incubated in
serum-free medium containing anti-TGN38 (1.25 µg/ml)
(A-D) or a control monoclonal antibody
(E) on ice for 10 min (A), 37 °C for 10 min
(B), or 37 °C for 90 min (C and E).
In D, NRK cells transfected with myc-GCC88 were incubated
with anti-TGN38 antibodies for 90 min at 37 °C and then washed and
incubated further for 45 min at 37 °C in serum-free medium
containing 0.2 µM bafilomycin A1. F,
untransfected cells were incubated with anti-TGN38 antibody at 37 °C
for 90 min. Monolayers were fixed and permeabilized, and the TGN38-Ig
complex was detected with FITC-anti-mouse Ig and stained for GCC88
using rabbit anti-GCC88 antibodies followed by Texas Red goat
anti-rabbit IgG. Bars, 10 µm.
|
|
To determine whether TGN38 can be transported out of the cauliflower
structures, live transfected NRK cells were loaded with antibody to
TGN38, incubated at 37 °C for 90 min to chase the antibody-TGN38
complexes into the TGN/cauliflowers, washed to remove unbound antibody
in the medium, and then incubated further for 45 min in the presence of
bafilomycin A1. If antibody-TGN38 complexes can be transported out of
the GCC88-labeled structures, their subsequent transport from endosomes
should then be blocked by balifolmycin A1 (28). Incubation of
antibody-loaded GCC88-transfected cells in the presence of balifolmycin
A showed a significant reduction of TGN38 in the cauliflower structures
with additional staining in endosomes (Fig. 11D). This
result indicates that the TGN38 molecules that had been transported
into the GCC88-labeled structures could be transported from these
structures to the plasma membrane and then internalized into endosomes.
Thus, the GCC88 decorated cauliflowers appear to represent a subdomain
of the TGN that can accommodate movement of membrane cargo molecules.
 |
DISCUSSION |
Based on the presence of putative Golgi targeting GRIP sequences,
we have identified two novel human trans-Golgi/TGN proteins, designated GCC88 and GCC185. Both proteins have structural features similar to other members of the GRIP family of proteins, namely extensive coiled-coil regions throughout the polypeptide and the GRIP
domain located at the C terminus. We have demonstrated that the GRIP
domains of GCC88 and GCC185 are functional Golgi targeting sequences
and furthermore, that these proteins and another member of the GRIP
family, golgin97, are localized, together with p230, to the
trans-Golgi/TGN. Thus we can conclude that there are four human proteins with GRIP domains associated with the TGN of HeLa cells.
Overexpression of GCC88 induced a dramatic enlargement of a domain of
the TGN through which the membrane protein TGN38 could recycle,
suggesting that GCC88 may function to maintain the organization of a
TGN domain involved with membrane transport.
GCC88 was initially identified based on a GRIP sequence in the data
base. Here we isolated cDNA clones and established that the clones
encode the full-length sequence of GCC88, as rabbit antibodies raised
against a bacterial fusion protein recognized an endogenous protein in
HeLa and COS cell extracts of the same size as that encoded by the
cloned cDNA. Likewise, we established that the human cDNA clone
(HG1120; gene name KIAA0336) encodes a protein of the same size as the
endogenous GCC185 protein, confirming that the clone is full-length.
GCC88 and GCC185 were shown to be bona fide Golgi proteins
with similar membrane binding characteristics as p230. GCC88 and GCC185
are peripheral membrane proteins as both (1) are associated with both
cytosol and membrane fractions, (2) dissociate from Golgi membranes in
the presence of brefeldin A, and (3) lack a signal sequence or
membrane-spanning domain. The relatively slow rate of brefeldin
A-induced dissociation of GCC88 and GCC185 from Golgi membranes is very
similar to the behavior of p230 (20, 22) and clearly distinguishes the
GRIP proteins from many other brefeldin A-sensitive proteins, such as
-COP, that dissociate rapidly (<2 min) after treatment. The
membrane binding of the different GRIP proteins therefore appears to be regulated in a similar, as yet undefined, manner. The kinetics of GRIP
protein dissociation from the Golgi indicates that the action of
brefeldin A on the G protein, ARF, occurs considerably upstream from
GRIP protein dissociation or that there are additional undefined
targets of brefeldin A.
The sequence similarity between the GRIP domains is only modest.
The data presented here and elsewhere (12-14) collectively show that
four different human GRIP sequences are functional Golgi targeting
signals. In view of the modest sequence similarity between GRIP domains
it was possible that different GRIPs may have distinct fine
specificities and may be localized to different regions of the Golgi.
By immunofluorescence and immunogold labeling we demonstrated that
GCC88, GCC185, and the GRIP domain of golgin97 are all localized to the
trans-Golgi/TGN. A TGN localization for GCC88 and golgin97 is consistent with earlier studies that showed that GFP fused to the
GRIP domain of GCC88 (previously GCC1p) or golgin97 was able to
displace endogenous p230 from Golgi membranes when present at high
levels in transfected cells (13). The finding here that the four GRIP
proteins are indeed localized to the TGN raises the possibility that
the different family members may compete for the same TGN membrane
determinants. The mechanism of GRIP binding to Golgi membranes appears
to be highly conserved throughout evolution as GRIP sequences are also
functional in yeast (14) and the primitive eucaryotic organism,
Leishmania (17). However, the membrane determinants for GRIP
domains remain to be identified.
The function of GRIP proteins has not been clearly defined. The
predominance of coiled-coil structures is highly suggestive of rod-like
molecules and furthermore links the GRIP proteins to other coiled-coil
proteins of the golgin family that are proposed to function in the
organization of the Golgi and as molecular tethers in the docking of
transport vesicles with target membranes (21). Recent studies have
shown that endogenous p230 and a GFP fusion protein containing the
p230-GRIP sequence are recruited to a subdomain of the TGN that forms
dynamic tubular extensions that have the characteristics of transport
carriers (16). In addition, GFP-p230 GRIP associates with a population
of in vitro generated vesicles (16), consistent with a
potential role of p230 as a tethering molecule for vesicle docking or
for attachment of the transport carriers to the cytoskeleton. A
membrane transport role has also been implicated for Imh1p, a GRIP
protein from S. cerevisiae (19).
Surprisingly, the overexpression of GCC88 in transfected cells induced
considerable morphological change, namely a dramatic enlargement of
Golgi-associated structures. The development of these cauliflower
structures was independent of cell type and the epitope tag present on
the full-length GCC88. The abnormal structures, which extended from the
trans-face of the Golgi apparatus, contained large amounts
of GCC88 protein that appeared as regularly packed arrays in electron
micrographs. Although no membrane bilayers could be seen in the arrays
in cryosections, the presence of TGN38 and syntaxin 6 clearly indicates
the inclusion of membrane in these structures. The high content of
GCC88 on these structures indicates that full-length GCC88 may be able
to self-associate to form highly ordered oligomers, possibly via their
coiled-coil regions, on the surface of the membrane, in contrast to the
GFP fusion protein containing only the GRIP domain, which readily saturates the Golgi membrane binding sites. Analysis of deletion mutants showed that the N-terminal domain of GCC88 is required to
induce the morphological change in the TGN. The requirement for the
non-coiled-coil N-terminal domain raises the possibility that the
interaction of full-length GCC88 with other molecules is necessary to
generate the perturbation of the TGN. Overall, our data show that the
organization of the TGN is dependent on maintaining the appropriate
level of GCC88 in the cell.
At the light microscopic level the GCC88-labeled structures resemble
abnormal outgrowths of endoplasmic reticulum membranes produced by
overexpression of the cis-Golgi membrane protein p23/24 (29). At the ultrastructural level, however, there is little similarity
between the p23 and GCC88 structures. Significantly, both abnormal
structures are examples of how compartments can be morphologically
perturbed by changing levels of critical organizational proteins.
Overexpression of GCC88 did not affect the entire TGN compartment as
the membrane resident protein SialylT did not co-localize with the
cauliflower structures whereas TGN38 can move into and from the GCC88
decorated structures. These findings imply that resident TGN proteins
may be sorted into domain(s) distinct from membrane molecules in
transit through the TGN. The finding that a resident TGN protein is
excluded from the abnormal structures suggests that the GCC88 decorated
cauliflowers are derived from TGN domains associated with membrane
transport. Other studies have also indicated that the TGN exists as
subdomains; for example the TGN-associated proteins p230 and
p200/myosin II are found on distinct tubulovesicular structures (20);
however, the underlying molecular basis for maintaining the complex
network of tubular structures is poorly understood. The behavior of
GCC88 suggests that this molecule may be involved in maintaining the
organization of a subdomain of the TGN.
The basis for the formation of the cauliflower structures remains
unclear. The GCC88 decorated structures are not sensitive to brefeldin
A,2 suggesting that
GCC88 overexpression may result in oligomers that are insensitive to G
protein regulation, thereby perturbing dissociation of GCC88 from the
membrane. Of note is that overexpression of other Golgi molecules
involved in linking membranes to the cytoskeleton, such as CLIPR-59 and
GMAP-210, also dramatically affects Golgi morphology (30, 31). One
possibility is that GCC88 is involved in maintaining the tubular
network of the TGN compartment via interactions with the membrane and
cytoskeleton. High levels of GCC88 may result in drawing TGN membranes
from a tightly packed network into an open structure as a result of enhanced interactions with the cytoskeleton. Such an open structure would occupy a larger unit volume of the cell compared with a compact
tubular network, consistent with the appearance of the GCC88-labeled
structures. Thus, GCC88 may function as a TGN matrix protein to help
maintain the tubular extensions of the TGN, structures likely to be
required for efficient sorting and transport. The cauliflower-like
structures present in cells expressing high levels of GCC88 clearly
allow the transport of cargo, but it is possible that the efficiency of
sorting and/or transport may be affected. Further experiments to
determine the rates of recycling and exocytosis from the TGN will be
required to address these possibilities.
Why are four different GRIP proteins expressed in one cell type? Each
of the GRIP proteins may have a different function, or alternatively,
there may be overlap between the functions of the four members. Further
experiments defining the molecular basis for the generation of abnormal
TGN structures by GCC88 should provide insight into the precise role of
GCC88 and other GRIP proteins in maintaining the complex organization
of the TGN.
 |
ACKNOWLEDGEMENTS |
The electron microscopy was performed at the
Centre for Microscopy and Microanalysis at the University of
Queensland. We thank Rohan Teasdale (University of Queensland) for
helpful discussions and reagents and the Kazusa DNA Research Institute
(Chiba, Japan) for the KIAA0336 cDNA clone.
 |
FOOTNOTES |
*
This work was supported by funding from the Australian
Research Council (to P. A. G.) and the Australian National Health and Medical Research Council (to J. L. S.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF525417.
§
To whom correspondence should be addressed: Dept. of Biochemistry
and Molecular Biology, The University of Melbourne, Melbourne, Victoria
3010, Australia. Tel.: 61-3-8344-5912; Fax: 61-3-9347-7730; E-mail:
pgleeson@unimelb.edu.au.
Published, JBC Papers in Press, November 20, 2002, DOI 10.1074/jbc.M210387200
2
M. Luke and P. Gleeson, unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
TGN, trans-Golgi network;
GFP, green fluorescent protein;
NRK, normal rat kidney;
PBS, phosphate-buffered saline;
SialylT, 2,6-sialyltransferase;
FITC, fluorescein isothiocyanate;
DMEM, Dulbecco's modified Eagle's medium;
GST, glutathione
S-transferase;
VSV-G, vesicular stomatitis virus G
protein.
 |
REFERENCES |
| 1.
|
Keller, P.,
and Simons, K.
(1997)
J. Cell Sci.
110,
3001-3009[Abstract]
|
| 2.
|
Traub, L. M.,
and Kornfeld, S.
(1997)
Curr. Opin. Cell Biol.
9,
527-533[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Pfeffer, S. R.
(2001)
J. Cell Biol.
155,
873-875[Abstract/Free Full Text]
|
| 4.
|
Short, B.,
Preisinger, C.,
Korner, R.,
Kopajtich, R.,
Byron, O.,
and Barr, F. A.
(2001)
J. Cell Biol.
155,
877-883[Abstract/Free Full Text]
|
| 5.
|
Griffiths, G.,
and Simons, K.
(1986)
Science
234,
438-443[Abstract/Free Full Text]
|
| 6.
|
Ladinsky, M. S.,
Kremer, J. R.,
Furcinitti, P. S.,
McIntosh, J. R.,
and Howell, K. E.
(1994)
J. Cell Biol.
127,
29-38[Abstract/Free Full Text]
|
| 7.
|
Ladinsky, M. S.,
Mastronarde, D. N.,
McIntosh, J. R.,
Howell, K. E.,
and Staehelin, L. A.
(1999)
J. Cell Biol.
144,
1135-1149[Abstract/Free Full Text]
|
| 8.
|
Nakamura, N.,
Lowe, M.,
Levine, T. P.,
Rabouille, C.,
and Warren, G.
(1997)
Cell
89,
445-455[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Seemann, J.,
Jokitalo, E.,
Pypaert, M.,
and Warren, G.
(2000)
Nature
407,
1022-1026[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Black, M. W.,
and Pelham, H. R.
(2001)
Curr. Biol.
11,
R460-462[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Robinson, M. S.,
and Bonifacino, J. S.
(2001)
Curr. Opin. Cell Biol.
13,
444-453[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Barr, F. A.
(1999)
Curr. Biol.
9,
381-384[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Kjer-Nielsen, L.,
Teasdale, R. D.,
van Vliet, C.,
and Gleeson, P. A.
(1999)
Curr. Biol.
9,
385-388[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Munro, S.,
and Nichols, B. J.
(1999)
Curr. Biol.
9,
377-380[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Kjer-Nielsen, L.,
van Vliet, C.,
Erlich, R.,
Toh, B. H.,
and Gleeson, P. A.
(1999)
J. Cell Sci.
112,
1645-1654[Abstract]
|
| 16.
|
Brown, D. L.,
Heimann, K.,
Lock, J.,
Kjer-Nielsen, L.,
van Vliet, C.,
Stow, J. L.,
and Gleeson, P. A.
(2001)
Traffic
2,
336-344[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
McConville, M. J.,
Ilgoutz, S. C.,
Teasdale, R. D.,
Foth, B. J.,
Matthews, A.,
Mullin, K. A.,
and Gleeson, P. A.
(2002)
Eur. J. Cell Biol.
81,
485-495[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Li, B.,
and Warner, J. R.
(1996)
J. Biol. Chem.
271,
16813-16819[Abstract/Free Full Text]
|
| 19.
|
Tsukada, M.,
Will, E.,
and Gallwitz, D.
(1999)
Mol. Biol. Cell
10,
63-75[Abstract/Free Full Text]
|
| 20.
|
Gleeson, P. A.,
Anderson, T. J.,
Stow, J. L.,
Griffiths, G.,
Toh, B. H.,
and Matheson, F.
(1996)
J. Cell Sci.
109,
2811-2821[Abstract]
|
| 21.
|
Chan, E.,
and Fritzler, M.
(1998)
Elec. J. Biotech.
1,
1-10
|
| 22.
|
Kooy, J.,
Toh, B. H.,
Pettitt, J. M.,
Erlich, R.,
and Gleeson, P. A.
(1992)
J. Biol. Chem.
267,
20255-20263[Abstract/Free Full Text]
|
| 23.
|
Evan, G. I.,
Lewis, G. K.,
Ramsay, G.,
and Bishop, J. M.
(1985)
Mol. Cell. Biol.
5,
3610-3616[Abstract/Free Full Text]
|
| 24.
|
Kries, T. E.
(1986)
EMBO J.
5,
931-941[Medline]
[Order article via Infotrieve]
|
| 25.
|
Rabouille, C.,
Hui, N.,
Hunte, F.,
Kieckbusch, R.,
Berger, E. G.,
Warren, G.,
and Nilsson, T.
(1995)
J. Cell Sci.
108,
1617-1627[Abstract]
|
| 26.
|
Bock, J. B.,
Klumperman, J.,
Davanger, S.,
and Scheller, R. H.
(1997)
Mol. Biol. Cell
8,
1261-1271[Abstract]
|
| 27.
|
Bos, K.,
Wraight, C.,
and Stanley, K. K.
(1993)
EMBO J.
12,
2219-2228[Medline]
[Order article via Infotrieve]
|
| 28.
|
Clague, M. J.,
Urbe, S.,
Aniento, F.,
and Gruenberg, J.
(1994)
J. Biol. Chem.
269,
21-24[Abstract/Free Full Text]
|
| 29.
|
Rojo, M.,
Emery, G.,
Marjomaki, V.,
McDowall, A. W.,
Parton, R. G.,
and Gruenberg, J.
(2000)
J. Cell Sci.
113,
1043-1057[Abstract]
|
| 30.
|
Infante, C.,
Ramos-Morales, F.,
Fedriani, C.,
Bornens, M.,
and Rios, R. M.
(1999)
J. Cell Biol.
145,
83-98[Abstract/Free Full Text]
|
| 31.
|
Perez, F.,
Pernet-Gallay, K.,
Nizak, C.,
Goodson, H. V.,
Kreis, T. E.,
and Goud, B.
(2002)
J. Cell Biol.
156,
631-642[Abstract/Free Full Text]
|
| 32.
|
Lupas, A.,
Van Dyke, M.,
and Stock, J.
(1991)
Science
252,
1162-1164[Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. L Lee, J. J Kohler, and S. R Pfeffer
Association of {beta}-1,3-N-acetylglucosaminyltransferase 1 and {beta}-1,4-galactosyltransferase 1, trans-Golgi enzymes involved in coupled poly-N-acetyllactosamine synthesis
Glycobiology,
June 1, 2009;
19(6):
655 - 664.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. L. Hayes, F. C. Brown, A. K. Haas, R. M. Nottingham, F. A. Barr, and S. R. Pfeffer
Multiple Rab GTPase Binding Sites in GCC185 Suggest a Model for Vesicle Tethering at the Trans-Golgi
Mol. Biol. Cell,
January 1, 2009;
20(1):
209 - 217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Z. Lieu, J. G. Lock, L. A. Hammond, N. L. La Gruta, J. L. Stow, and P. A. Gleeson
A trans-Golgi network golgin is required for the regulated secretion of TNF in activated macrophages in vivo
PNAS,
March 4, 2008;
105(9):
3351 - 3356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. G. Ganley, E. Espinosa, and S. R. Pfeffer
A syntaxin 10 SNARE complex distinguishes two distinct transport routes from endosomes to the trans-Golgi in human cells
J. Cell Biol.,
January 10, 2008;
180(1):
159 - 172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Z. Lieu, M. C. Derby, R. D. Teasdale, C. Hart, P. Gunn, and P. A. Gleeson
The Golgin GCC88 Is Required for Efficient Retrograde Transport of Cargo from the Early Endosomes to the Trans-Golgi Network
Mol. Biol. Cell,
December 1, 2007;
18(12):
4979 - 4991.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Yilmaz Dejgaard, A. Murshid, K. M. Dee, and J. F. Presley
Confocal Microscopy-based Linescan Methodologies for Intra-Golgi Localization of Proteins
J. Histochem. Cytochem.,
July 1, 2007;
55(7):
709 - 719.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. V. Reddy, A. S. Burguete, K. Sridevi, I. G. Ganley, R. M. Nottingham, and S. R. Pfeffer
A Functional Role for the GCC185 Golgin in Mannose 6-Phosphate Receptor Recycling
Mol. Biol. Cell,
October 1, 2006;
17(10):
4353 - 4363.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Jiang, S. W. Rhee, P. A. Gleeson, and B. Storrie
Capacity of the Golgi Apparatus for Cargo Transport Prior to Complete Assembly
Mol. Biol. Cell,
September 1, 2006;
17(9):
4105 - 4117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Eisman, N. Stewart, D. Miller, and T. C. Kaufman
centrosomin's beautiful sister (cbs) encodes a GRIP-domain protein that marks Golgi inheritance and functions in the centrosome cycle inDrosophila
J. Cell Sci.,
August 15, 2006;
119(16):
3399 - 3412.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Sztul and V. Lupashin
Role of tethering factors in secretory membrane traffic
Am J Physiol Cell Physiol,
January 1, 2006;
290(1):
C11 - C26.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Snyder, G. A. Mardones, M. S. Ladinsky, and K. E. Howell
GMx33 Associates with the Trans-Golgi Matrix in a Dynamic Manner and Sorts within Tubules Exiting the Golgi
Mol. Biol. Cell,
January 1, 2006;
17(1):
511 - 524.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Yoshino, S. R. G. Setty, C. Poynton, E. L. Whiteman, A. Saint-Pol, C. G. Burd, L. Johannes, E. L. Holzbaur, M. Koval, J. M. McCaffery, et al.
tGolgin-1 (p230, golgin-245) modulates Shiga-toxin transport to the Golgi and Golgi motility towards the microtubule-organizing centre
J. Cell Sci.,
May 15, 2005;
118(10):
2279 - 2293.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. D. Ciccarelli, C. von Mering, M. Suyama, E. D. Harrington, E. Izaurralde, and P. Bork
Complex genomic rearrangements lead to novel primate gene function
Genome Res.,
March 1, 2005;
15(3):
343 - 351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Oka and M. Krieger
Multi-Component Protein Complexes and Golgi Membrane Trafficking
J. Biochem.,
February 1, 2005;
137(2):
109 - 114.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Safaei, K. Katano, B. J. Larson, G. Samimi, A. K. Holzer, W. Naerdemann, M. Tomioka, M. Goodman, and S. B. Howell
Intracellular Localization and Trafficking of Fluorescein-Labeled Cisplatin in Human Ovarian Carcinoma Cells
Clin. Cancer Res.,
January 15, 2005;
11(2):
756 - 767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Derby, C. van Vliet, D. Brown, M. R. Luke, L. Lu, W. Hong, J. L. Stow, and P. A. Gleeson
Mammalian GRIP domain proteins differ in their membrane binding properties and are recruited to distinct domains of the TGN
J. Cell Sci.,
November 15, 2004;
117(24):
5865 - 5874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Natarajan and A. D. Linstedt
A Cycling cis-Golgi Protein Mediates Endosome-to-Golgi Traffic
Mol. Biol. Cell,
November 1, 2004;
15(11):
4798 - 4806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Lu, G. Tai, and W. Hong
Autoantigen Golgin-97, an Effector of Arl1 GTPase, Participates in Traffic from the Endosome to the Trans-Golgi Network
Mol. Biol. Cell,
October 1, 2004;
15(10):
4426 - 4443.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Larocca, R. A. Shanks, L. Tian, D. L. Nelson, D. M. Stewart, and J. R. Goldenring
AKAP350 Interaction with cdc42 Interacting Protein 4 at the Golgi Apparatus
Mol. Biol. Cell,
June 1, 2004;
15(6):
2771 - 2781.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Laurie, N. L. La Gruta, N. Koch, I. R. van Driel, and P. A. Gleeson
Thymic Expression of a Gastritogenic Epitope Results in Positive Selection of Self-Reactive Pathogenic T Cells
J. Immunol.,
May 15, 2004;
172(10):
5994 - 6002.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Yoshino, B. M. Bieler, D. C. Harper, D. A. Cowan, S. Sutterwala, D. M. Gay, N. B. Cole, J. M. McCaffery, and M. S. Marks
A role for GRIP domain proteins and/or their ligands in structure and function of the trans Golgi network
J. Cell Sci.,
November 1, 2003;
116(21):
4441 - 4454.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|