|
Originally published In Press as doi:10.1074/jbc.M207335200 on December 5, 2002
J. Biol. Chem., Vol. 278, Issue 7, 4740-4746, February 14, 2003
Targeted Replacement of Mouse Apolipoprotein A-I with Human
ApoA-I or the Mutant ApoA-IMilano
EVIDENCE OF APOA-IM IMPAIRED HEPATIC
SECRETION*
Cinzia
Parolini §,
Giulia
Chiesa ,
Yiwen
Zhu¶,
Trudy
Forte¶,
Silvia
Caligari ,
Elisabetta
Gianazza ,
Maria
Grazia
Sacco ,
Cesare R.
Sirtori , and
Edward M.
Rubin¶
From the Department of Pharmacological Sciences,
University of Milan, 20133 Milan, Italy, Istituto di
Tecnologie Biomediche-Consiglio Nazionale delle Ricerche, 20090 Segrate, Milan, Italy, the ¶ Genome Sciences Department,
Lawrence Berkeley National Laboratory,
Berkeley, California 94720
Received for publication, July 22, 2002, and in revised form, November 26, 2002
 |
ABSTRACT |
Despite a pro-atherogenic profile,
individuals carrying the molecular variant (R173C) of apolipoprotein
(apo)A-I, named apoA-IMilano (apoA-IM),
appear to be at reduced risk for cardiovascular disease. To develop an
in vivo system to explore, in a controlled manner, the
effects of apoA-IM on lipid metabolism, we have used the
gene targeting technology, or "gene knock-in" (gene k-in), to
replace the murine apoA-I gene with either human apoA-I or
apoA-IM genes in embryonic stem cells. As in human
carriers, mice expressing apoA-IM (A-IM k-in)
are characterized by low concentrations of the human apolipoprotein and
reduced high density lipoprotein cholesterol levels, compared with A-I
k-in animals. The aim of the present study was to investigate the basic
mechanisms of hypoalphalipoproteinemia associated with the
apoA-IM mutation. ApoA-I and apoA-IM mRNA expression, as assessed by Northern blot analysis and quantitative real
time reverse transcription-PCR, did not exhibit significant differences in either liver or intestine. Moreover, human
apolipoprotein synthesis rates were similar in the k-in lines. When the
secretion rate of the human apolipoproteins was assessed in cultured
hepatocytes from the mouse lines, secretion from
apoA-IM-expressing cells was markedly reduced (42% for
A-IM k-in and 36% for A-I/A-IM k-in mice) as
compared with that of A-I k-in hepatocytes. These results provide the
first evidence that the hypoalphalipoproteinemia in apoA-IM
human carriers may be partially explained by impaired apoA-IM secretion.
 |
INTRODUCTION |
Coronary artery disease is the most common cause of death
in developed countries (1), and high density lipoprotein cholesterol (HDL-C)1 concentrations are a
major predictor of risk. Indeed, nearly half of all patients with
coronary artery disease have low HDL-C (2, 3). Low HDL-C appears to be
associated with, among other factors, an enhanced risk of angioplasty
restenosis (4) and with a number of clinical syndromes such as the
"metabolic syndrome", which combines low HDL with
hypertriglyceridemia and abdominal obesity (5). Raising HDL-C
concentrations may have therapeutic value in reducing risk of
reinfarction and stroke in coronary patients (6, 7). In agreement with
these clinical data, experimental studies indicate that HDL infusions
are able to reduce significantly aortic lipid deposition in established
atherosclerotic lesions (8-10). The cardio-protective role of HDL is,
in part, related to its ability to stimulate cholesterol efflux from
cells (11, 12) and by its anti-inflammatory (13) and anti-oxidant properties (14).
Genetic factors play a key role in regulating HDL-C concentrations.
Changes in a variety of genes including apolipoprotein A-I/CIII (15),
lipoprotein lipase (16), cholesteryl ester transfer protein (17),
hepatic lipase (18), scavenger receptor B1 (19), lecithin-cholesterol
acyltransferase (20), ATP-binding cassette (A1) transporter gene (21),
and others all affect to a variable extent HDL-C concentrations in
humans. Several naturally occurring mutations associated with reduced
plasma HDL-C and apoA-I concentrations have also been described for
human apolipoprotein (apo)A-I (22, 23), the major protein constituent
of HDL. Although some of these hypoalphalipoproteinemic states are
associated with an increased risk of atherosclerotic vascular disease,
others do not seem to predispose to accelerated premature disease (24). One example is the apoA-IMilano (A-IM) mutant;
evaluation of the cardiovascular status in apoA-IM
carriers, compared with control subjects from the same kindred, did not
reveal any evidence of increased vascular disease at the preclinical
level (25, 26).
ApoA-IM is the result of a point mutation, with an arginine
to cysteine substitution at position 173 (27). The carriers of this
mutation are all heterozygotes that exhibit hypertriglyceridemia with
markedly reduced HDL and apoA-I levels. The presence of a cysteine
residue results in the formation of homodimers and heterodimers with
apoA-II.
The kinetic etiology of hypoalphalipoproteinemias associated with
apoA-I mutations have been generally related to accelerated catabolism
rather than to lower synthesis of apoA-I (28, 29). However, a recent
study has shown a reduced secretion rate for the apoA-I variant known
as apoA-IFIN, in addition to its enhanced clearance from
plasma (30). ApoA-I turnover in apoA-IM carriers was
investigated in two different studies (31, 32). Both studies showed
that low apoA-I levels are consequent to the rapid catabolism of apoA-I
and apoA-IM, whereas results on the production rate of both
the normal and mutant forms of apoA-I have remained controversial.
Although mice expressing an A-IM transgene were previously
generated and studied (33, 34), the technical limitations of microinjection (unpredictability of chromosomal location and copy number of the transgene) did not allow definitive establishment of the
molecular mechanisms of the phenotypic expression of the mutation. In
the present study, a gene targeting replacement strategy (gene knock-in
(k-in)) was used to obtain comparable mouse lines expressing either
human apoA-I (A-I k-in) or human apoA-IM (A-IM k-in). Using these mouse models we present evidence that the dominant negative effects on HDL-C concentrations resulting from the
apoA-IM mutation can, in part, be explained by reduced
apoA-IM production. The expression of this mutation does
not appear to affect transcription or mRNA stability but causes
impaired hepatic secretion of the human apolipoprotein by primary hepatocytes.
 |
EXPERIMENTAL PROCEDURES |
Gene Targeting Replacement--
A 3-kb
NotI-KpnI strain 129 mouse genomic fragment
containing sequences upstream of the mouse apoA-I gene (2,633 bp) and including exon 1 and the 5' part of intron 1 (104 bp)
(see Fig. 1B) was generated by PCR using a pV-90 plasmid,
kindly provided by Dr. N. Maeda (35), as a template. A 4.8-kb
EcoRI strain 129 mouse genomic fragment, containing the 3'
half of exon 4 (419 bp) and 3'-flanking sequences (4,381 bp) of the
mouse apoA-I gene was also derived from pV-90 (see Fig. 1B).
Human genomic fragments, containing the 3' part of intron 1 (116 bp)
and exons 2-4 of the human apoA-I gene or the human
apoA-IM gene were isolated by sequential digestion with
KpnI and SalI from pApoA-Ig (36) and
pBSM plasmids (34), respectively. To obtain the targeting
constructs, the 3-kb mouse genomic fragment and the human genomic
fragments were inserted into a pPN2T vector (37) upstream of the
neomycin-resistant gene, whereas the 4.8-kb genomic fragment was
inserted downstream of the neomycin-resistant gene (see Fig.
1B). The targeting constructs were linearized by
NotI digestion, purified, and redissolved in TE
(10mM Tris-Hcl, pH 8, 1 mM EDTA), pH
7.4, for electroporation. A subclone of mouse strain 129 embryonic stem
cell line, ESVJ (Go Germline, GenomeSystems, Inc.), was cultured on
neomycin-resistant mouse fibroblast feeder layers and electroporated
with 20 µg of the linearized human apoA-I or apoA-IM
targeting vectors as described previously (38). Stable integrants were
selected by positive-negative selection, using neomycin
(G418-Geneticin; Invitrogen) at a final concentration of 200 µg/ml
and gancyclovir (FIAU, Moravek Biochemicals, Brea, CA) at
a final concentration of 2 µM. After 10-12 days, the
colonies were transferred into 96-well plates and tested for successful
targeting by Southern blotting using conventional procedures. Approximately 10-15 embryonic stem-targeted cells were injected into
the blastocele cavity of C57BL/6J embryos. Surviving blastocysts were
transferred into the pseudopregnant CD-1 females. Animals chimeric by
coat color were bred to C57BL/6J animals to determine their germ line
competency. Heterozygous mutants were identified by Southern blotting
of DNA isolated from the tail, and brother-sister mating was carried
out to generate homozygous k-in mutant mouse lines expressing human
apoA-I (A-I k-in) or human apoA-IM (A-IM k-in).
Homozygous A-I k-in and A-IM k-in mice were then crossed to
create the heterozygous human apoA-I/A-IM mouse line
(A-I/A-IM k-in).
Lipid/Lipoprotein Analyses--
Lipid and
apolipoprotein analyses were performed on A-I k-in, A-IM
k-in, A-I/A-IM k-in, and C57BL/6J/129 control mice of both sexes, aged 12-16 weeks. Blood was collected after an overnight fast
from the retro-orbital plexus into tubes containing 0.1% (w/v) EDTA
and centrifuged in a microcentrifuge for 10 min at 8000 rpm at
4 °C. Serum total and unesterified cholesterol were measured by
enzymatic methods (Hoffmann La Roche, Basel, Switzerland and Roche
Molecular Biochemicals) (39). Triglyceride concentrations were
corrected for the free glycerol present in serum as described (Sigma-Aldrich) (40). HDL cholesterol levels were measured after precipitation of apoB-containing lipoproteins with PEG 8000 (20% w/v)
in 0.2 M glycine, pH 10 (40). Human apolipoprotein
concentrations were determined by immunoturbidimetric assays, using a
sheep antiserum specific for human apoA-I (Hoffmann La Roche) that also
recognizes apoA-IM (34).
To determine HDL particle size distribution, total lipoproteins
(d < 1.215 g/ml) were isolated by salt gradient
ultracentrifugation (41). Plasma from five fasting mice of each
genotype was pooled and adjusted to a density of 1.215 g/ml with solid
KBr and centrifuged for 6 h at 4 °C at 100,000 rpm in a Beckman
TL100 ultracentrifuge equipped with a Beckman TL100.3 rotor. HDL
particle size distribution was determined by nondenaturing
polyacrylamide gradient gel electrophoresis (GGE) essentially as
described by Nichols et al. (42). Aliquots (20 µl) of the
total lipoprotein fraction were loaded onto a nondenaturing 4-30%
polyacrylamide gradient gel and electrophoresed for 25 h at 125 V
at 4 °C. The proteins were stained with Coomassie R-250, and HDL
particle size was determined by densitometry, as previously described
(42).
Two-dimensional electrophoretic maps of mouse sera were obtained by
immobilized pH gradient gel-Da (43). Serum was prepared by low
speed centrifugation of blood collected from six fasting mice for each
line. The sample load was 15 µl of serum diluted to 50 µl with
either double distilled water for nonreducing conditions or with 2%
mercaptoethanol for reducing conditions. The proteins were first
resolved according to charge on a nonlinear pH 4-10 immobilized pH
gradient gel-Da (44) in the presence of 8 M urea and
0.5% carrier ampholytes. The focused proteins were then fractionated according to size by SDS-PAGE on 7.5-17.5% polyacrylamide
gradients in the discontinuous buffer system of Laemmli (45).
Interfacing between the first and second dimension occurred after
equilibration with 2% SDS for nonreducing conditions or after protein
carboxymethylation in the presence of 2% SDS (46) for reducing
conditions. The anode to cathode distance was 11 cm in the immobilized
pH gradient gel-Da gel; the anodal 8 cm were mounted head to
tail on 16 × 14-cm2 SDS-PAGE slabs. The proteins were
stained with Coomassie R-250.
Northern Blot Analysis--
Total RNA was extracted from mouse
liver according to the method of Chomczynski and Sacchi (47), using
UltraPureTM Trizol Reagent (Invitrogen). For Northern blot
analysis, 15 µg of denatured RNA was separated by
formaldehyde-agarose gel electrophoresis, transferred to nylon
membrane, and hybridized with a human apoA-I probe that spans the
majority of human exon 4; -actin mRNA (Ambion) was used as an
internal standard for normalizing total RNA loads.
Quantitative Real Time RT-PCR--
Total RNA was extracted from
the liver and intestine of 6 mice from each transgenic line using
UltraPureTM Trizol Reagent (Invitrogen). About 2 µg of
total RNA from each sample was treated with Promega RQ1 RNase-free
DNase. About 0.5 µg of DNase-treated total RNA was
reverse-transcribed using TaqMan reverse transcription reagents from
Applied Biosystems. PCR was performed using SYBR Green PCR Master Mix
(Applied Biosystems) on an ABI Prism 7700 sequence detector. The
selected primers used for amplification of human apoA-I cDNA were
AGCTTGCTGAAGGTGGAGGT (in exon 4) and ATCGAGTGAAGGACCTGGC (in exon
3). The primers amplify a 154-bp product. The 18 S internal standard
control was from Ambion (315 bp product). A ratio of 1:1.5 of 18 S
primer pair:18 S competimers was used. All of the procedures and
calculation of the results were carried out according to
manufacturer's recommendations.
Hepatic Human apoA-I or apoA-IM Synthesis and
Secretion Rates--
Apolipoprotein synthesis rate was determined in
primary hepatocytes isolated from A-IM k-in,
A-I/A-IM k-in, and A-I k-in mice. The animals were fasted
for 5 h and anesthetized with 5% sodium pentobarbital, and the
hepatocytes were prepared with slight modifications of a method
described previously (48). Cell viability was assessed by trypan blue
staining, and 500,000 live cells were plated on 35-mm plates. The
culture medium (Williams' medium; Sigma) was changed after 4 h of
incubation at 37 °C. The next day, to assess the human
apolipoprotein synthesis rates, the cells were washed once with
phosphate-buffered saline, preincubated for 1 h in leucine-free Dulbecco's modified Eagle's medium without serum, and then incubated for different time points up to 10 min with 1 ml of the same medium containing 200 µCi/ml [3H]leucine (PerkinElmer Life
Sciences). After incubation, the cells were washed three times with
ice-cold phosphate-buffered saline and subsequently lysed in cold lysis
buffer containing protease inhibitors (phosphate-buffered saline, 1%
Triton X-100, 0.01% phenylmethylsulfonyl fluoride, and 0.005%
aprotinin). As a control, the incorporation of radioactivity into total
protein was determined after trichloroacetic acid precipitation of cell
lysates and was found to be similar among the k-in lines (data not
shown). Radiolabeled human apolipoproteins were quantitatively isolated
from cell lysates by immunoprecipitation using a rabbit
polyclonal anti-human apoA-I antibody (DAKO, Glostrup,
Denmark) that recognizes both human apoA-I and
apoA-IM. The immunoprecipitate was further purified by
SDS-PAGE under reducing conditions. A band corresponding to human
apoA-I was excised from the gel; the label was extracted with Solvable
(Packard Instruments Co., Inc., Meriden, CI) and counted (49).
The results were normalized to cellular protein content of each plate
determined by the method of Bradford (50). The data presented are the
means of triplicate measurements and are representative of three
independent experiments.
To determine apoA-I secretion rate, the cells were isolated, plated,
and incubated essentially as described above except that conditioned
medium was collected after 30, 60, 90, and 120 min. The medium was
centrifuged at 12,000 × g at 4 °C for 5 min to remove cell debris. The human apolipoproteins were quantitatively isolated from the medium by immunoprecipitation and then purified by
SDS-PAGE under reducing conditions. A band corresponding to human
apoA-I was excised from the gel and counted (49). The results were
normalized to the cellular protein content of each plate determined by
the method of Bradford (50). The data presented are the means of
triplicate measurements and are representative of three independent experiments.
Statistical Analysis--
Differences among groups were
evaluated using a one-way analysis of variance followed by a
Bonferroni's post-hoc test. Differences in the synthesis and secretion
rate of human apolipoproteins were evaluated by linear regression.
 |
RESULTS |
Replacement of the Mouse ApoA-I Gene with the Human ApoA-I or
ApoA-IM Gene--
The targeting strategy used to replace
the mouse apoA-I coding exons 2-4 with the human counterpart is
illustrated in Fig. 1. Homologous
recombination between the endogenous mouse apoA-I locus (Fig.
1A) and the targeting construct (Fig. 1B) results in a chimeric gene (Fig. 1C) where all of the mouse coding
sequences have been replaced with sequences coding for human apoA-I or
apoA-IM. This chimeric locus retains all of the normal
mouse regulatory elements in addition to the noncoding mouse exon
1.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 1.
Strategy for targeted replacement of the
mouse apoA-I gene with the human apoA-I or apoA-IM
gene. A, endogenous mouse apoA-I and apoC-III loci,
each with four exons (black boxes). B, the
targeting construct containing the 5' and 3' arms of mouse homology
(black lines and boxes) interrupted by the human
apoA-I or apoA-IM gene (hatched boxes
2', 3', and 4'); the
neomycin-resistant (neo) and thymidine kinase
(T-k) genes are for positive-negative selection of the
targeted cells, and pPN2T is the plasmid vector. C, the
resulting chimeric gene after homologous cross-over now coding human
apoA-I or apoA-IM. The sizes of diagnostic fragments are
indicated. Probes 1 and 2 are a 800-bp
SacI-XbaI fragment and a 350-bp
XbaI-SphI fragment, respectively. Restriction
sites are as follows: H, HindIII; B,
BamHI; E, EcoRI; S,
SacI; N, NotI; K,
KpnI.
|
|
Embryonic stem cell DNA, digested with HindIII and
hybridized with probe 1 (Fig. 1), revealed a 12-kb endogenous band and a 9.1-kb targeted band, resulting from the novel restriction site, demonstrating the correct location of the targeted gene in the 3'
region (Fig. 2A). Similarly,
hybridization with probe 2 (Fig. 1) confirmed correct modification of
the 5' region (data not shown). The modified locus (apoA-I or
apoA-IM) was transmitted to the F1 generation from chimeras
that were made from one of the targeted cell lines. Genotypes of F2
animals were determined using Southern blotting analysis of tail DNA
digested with HindIII and hybridized with probe 2, revealing
a 12-kb endogenous band and a 3.8-kb targeted band (Fig.
2B).

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 2.
Southern blot analysis. A,
Southern blot of genomic DNA from six embryonic stem cell colonies
digested with HindIII and hybridized to probe 1 (see Fig.
1). Parental cell DNA is in lanes 1 and 6; the
12-kb band indicates the presence of the unmodified apoA-I allele.
Lanes 2 and 3 and lanes 4 and
5 contain DNA from human apoA-I and apoA-IM
colonies, respectively, that have been correctly targeted; a 9.1-kb
band is present in addition to the 12-kb band. B, Southern
blot analysis of tail DNA digested with HindIII and
hybridized to probe 2 (see Fig. 1) to identify F2 mice carrying the
targeted allele. A 3.8-kb band indicates the presence of the human
apoA-I allele. Shown are two controls (lanes 1 and
6), two heterozygous (lanes 2 and 5),
and two homozygous (lanes 3 and 4) k-in mice.
Lanes 2 and 3 and lanes 4 and
5 contain tail DNA from A-I and A-IM k-in mice,
respectively.
|
|
Serum Distribution of Human Apolipoproteins--
The expression of
human apoA-I or apoA-IM was assessed by two-dimensional
electrophoretic analysis on mouse serum (Fig.
3). A 28-kDa spot was observed in each
serum analyzed, corresponding either to murine apoA-I (only in control
serum), human apoA-I, or the monomeric form of apoA-IM.
From their sequence, the pI of murine apoA-I is computed at 5.42, the
pI of human apoA-I at 5.27, and the pI of human apoA-IM at
5.19, as indicated in the Fig. 3. The spots marked with superscript
1 correspond to a post-translationally modified form that
differs from the 0 superscript form for a Asn Asp
deamidation event (51). Because the charge difference at pH = pI
is 1 unit both between apoA-I and apoA-IM and between A-I0 and A-I 1, A-IM0
and A-I 1 do overlap (see in Fig. 3 the spot indicated as
A-I 1+A-IM0). As
expected, in A-IM k-in and A-I/A-IM k-in serum,
an additional spot (see circles in Fig. 3, upper
panel) corresponding to the dimeric form of apoA-IM
(56 kDa), is visible and disappears upon sample reduction (Fig. 3,
lower panel).

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 3.
Close-up views of two-dimensional
electrophoretic maps of mouse sera pools obtained from control,
A-IM k-in, A-I/A-IM k-in, and A-I k-in mice
under nonreducing (upper panel, 
ME) and reducing (lower panel, +
ME) conditions. The proteins were first resolved
according to charge on a nonlinear pH 4-10 IPG and then
fractionated according to size by SDS-PAGE and stained with Coomassie
R-250. The circles indicate the spot corresponding to the
dimeric form of human apoA-IM.
|
|
Lipid and Apolipoprotein Concentrations--
Mouse plasma lipid
and apolipoprotein concentrations are shown in Table
I. The apoA-IM concentrations
in A-IM k-in mice was ~50% of apoA-I in A-I k-in mice;
the concentration of the human apolipoproteins in the
apoA-I/A-IM k-in mice was the same as in A-IM
k-in. Total cholesterol in A-IM k-in mice was significantly lower than that measured in every other group. The heterozygotes (A-I/A-IM k-in) had total cholesterol values intermediate
to A-IM and A-I k-in mice. Plasma HDL cholesterol
concentrations in A-IM k-in mice were substantially lower
than those observed in A-I k-in and A-I/A-IM k-in mice
( 63% and 50%, respectively). In addition, a significant
increase in plasma unesterified to esterified cholesterol ratio was
observed in A-IM k-in compared with A-I k-in mice
(0.69 ± 0.13 versus 0.41 ± 0.02;
p < 0.001), suggesting impaired cholesterol
esterification in the former. In contrast to changes in cholesterol
concentrations, plasma triglyceride levels were similar in all of the
mouse lines analyzed.
View this table:
[in this window]
[in a new window]
|
Table I
Plasma lipid profiles and human apolipoprotein concentration in k-in
and control mice
The results are expressed as the means ± S.D. TC, total
cholesterol; FC, free cholesterol; TG, triglyceride.
|
|
HDL particle size distribution of k-in mice was investigated by
nondenaturing GGE. As seen in Fig. 4, HDL
from A-I k-in mice has a homogeneous population of large particles
(10.79 nm). Control mice had a similar HDL size distribution (data not
shown). The GGE profile of A-IM k-in mice is heterogeneous,
exhibiting a major HDL subpopulation of smaller particles (8.96 nm) and
minor populations at 9.81 and 10.79 nm. In contrast, the GGE profile of
A-I/A-IM k-in mice is characterized by a bimodal size
distribution with a major population at 10.79 nm and a minor one at
8.96 nm.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4.
Nondenaturing GGE of mouse lipoproteins.
Total lipoproteins (d < 1.215 g/ml) were loaded onto a
nondenaturing 4-30% polyacrylamide gradient gel, and the proteins
were stained with Coomassie R-250. Computer-assisted scanning
densitometry of the gel was used to determine electrophoretic pattern
and particle size as described under "Experimental Procedures." HDL
particle size distribution of A-IM k-in (solid
line), A-I/A-IM k-in (dashed line), and A-I
k-in (dotted line) mice.
|
|
Human Apolipoprotein Expression--
Apolipoprotein A-I or
A-IM gene expression was assessed by Northern blot analysis
on livers of six mice, matched for age and sex, from each one of the
three lines (A-IM k-in, A-I/A-IM k-in, and A-I
k-in). The data were normalized to the constitutively expressed
-actin, and the average values are shown in Fig.
5. No significant differences were
observed between human apoA-I and apoA-IM mRNA levels
in the three k-in lines. This lack of difference in the human
apolipoprotein expression was confirmed by quantitative real time
RT-PCR. In fact, the apoA-I/A-IM mRNA expression
(normalized to the endogenous control 18 S) was 0.633 ± 0.159 for
A-I k-in mice and 0.593 ± 0.244 for A-IM k-in mice (p = 0.778).

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 5.
Quantitative Northern blot analysis of apoA-I
gene expression in liver. RNA was prepared from livers of
A-IM, A-I/A-IM and A-I k-in mice, Northern
blotted, and hybridized with a human apoA-I probe that spans the
majority of human exon 4. The bar graph in the upper
panel shows the amount of apoA-I mRNA corrected for the amount
of constitutively expressed -actin mRNA. In the lower
panel, representative blots from each of the three mouse genotypes
are shown. The bar graphs represent the means ± S.D.
|
|
Quantitative real time RT-PCR was also performed on total RNA extracted
from mouse intestine; in each mouse line, intestinal expression of the
human apolipoproteins contributed for 28-32% of the total amount
expressed. Similarly to what was observed in livers, no differences
were detected among the lines (p > 0.05).
Analysis of Human ApoA-I or ApoA-IM
Production--
Synthesis and secretion rates of the human
apolipoproteins were assessed in cultured primary hepatocytes isolated
from A-IM k-in, A-I/A-IM k-in, and A-I k-in
mice. For the evaluation of synthesis rate, the appearance of
intracellular radiolabeled human apolipoproteins was measured at
different time points and was found to be linear along the experimental
period. The synthesis rates, calculated as the slope of the regression
lines, were not different among the k-in lines (2.92 cpm/µg/min for
A-IM k-in, 2.78 cpm/µg/min for A-I/A-IM k-in,
and 2.89 cpm/µg/min for A-I k-in mice). For the secretion rate,
radiolabeled apoA-I or apoA-IM was quantified in culture
medium at 30, 60, 90, and 120 min after the addition of
[3H]leucine. As shown in Fig.
6, secretion of apoA-I/A-IM
was linear for all of the k-in mouse lines (r = 0.906 for A-I k-in mice, r = 0.934 for A-I/A-IM
k-in mice, and r = 0.964 for A-IM k-in mice
p < 0.01). Secretion rates, however, differed
dramatically between A-I k-in mice and the other mouse lines, where
secretion by apoA-IM and apoA-I/A-IM cells was
58 and 64% (p < 0.05), respectively, of that
calculated for apoA-I hepatocytes.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 6.
In vitro analysis of apoA-I or
apoA-IM secretion from primary hepatocytes. The
hepatocytes were prepared from A-IM k-in,
A-I/A-IM k-in, and A-I k-in mice, and the presence of the
human apolipoproteins in the medium (normalized to cell protein
content) was determined at 30, 60, 90, and 120 min after addition of
[3H]leucine. , apoA-IM secretion; ,
apoA-I/A-IM secretion; , apoA-I secretion. The data are
representative of three separate experiments; each point is the
mean ± S.D. of triplicate measurements.
|
|
 |
DISCUSSION |
In contrast to classical transgenic approaches, gene targeting
replacement strategies (52) for manipulating the mouse genome allow
precise location of the transgene, thus permitting direct comparisons
between different genes at the same chromosomal location. This
procedure has allowed, for the first time, the generation of two animal
models that differ only in the biochemical nature of the apoA-I,
i.e. carrying in one case the human wild type apoA-I gene
(A-I k-in) and, in the other, the apoA-IM gene
(A-IM k-in). These mice provide a means to study the
molecular mechanisms responsible for the lipoprotein abnormalities
noted in apoA-IM human carriers.
The lipid/lipoprotein profile of A-IM k-in and
A-I/A-IM k-in mice is, in many respects, similar to that of
human carriers, i.e. characterized by low plasma total and
HDL-C levels compared with A-I k-in mice. Reduction in HDL-C
concentrations are also associated with the appearance of a
heterogeneous population of HDL particles not present in control and
A-I k-in mice. Nevertheless, most noteworthy are the differences
observed between A-IM k-in and A-I/A-IM k-in
mouse lines. We found that the expression of apoA-I in the
A-IM k-in mouse background did not increase the plasma
apolipoprotein concentrations but did increase plasma total and HDL-C
levels and altered HDL size distribution. This difference could be
explained by the fact that the absence of apoA-I, a better cofactor for
LCAT activity (53, 54), may impair cholesterol esterification in
A-IM k-in mice, as suggested by the unesterified/esterified cholesterol ratio measured in this mouse line (0.69 ± 0.13 versus 0.33 ± 0.04 in A-I/A-IM k-in mice),
allowing the formation of cholesterol-poor HDL particles (34). In
addition, the decreased formation of cholesteryl esters may result in a
diminished core of HDL particles and hence in a reduced HDL particle size.
Differently from the apoA-IM clinical condition (55) and
the transgenic model previously generated, expressing both human apoA-IM and apoA-II (33, 34), a clear rise of triglycerides in the A-IM k-in model was not observed. In the
A-IM k-in line, triglyceride elevation was, in fact,
of minimal degree and did not attain statistical significance.
Moreover, A-IM k-in mice displayed an HDL size distribution
that lacks a subpopulation of very small particles present in both
human carriers (55) and in the previously generated
A-IM/A-II transgenic mice (33, 34). A possible explanation
for these differences may reside in the absence of human apoA-II in
A-IM k-in mice. Overexpression of human apoA-II has been
shown, in fact, to be associated with hypertriglyceridemia and small
HDL particles (56). Moreover, in human carriers and in
A-IM/A-II transgenic mice the presence of human apoA-II
allows the formation of A-IM/A-II heterodimers, because the
human apoA-II contains a free cysteine residue not present in the
murine apoA-II. Franceschini et al. (55) found a correlation
between hypertriglyceridemia and abundance of small HDL particles
(HDL3b), enriched in A-IM/A-II heterodimers.
Furthermore, experimental data have shown that the expression of human
apoA-II in apoA-I transgenic mice increased plasma triglyceride levels and restricted HDL particle size (40). In summary, although speculative, in the absence of human apoA-II, i.e. in the
present k-in mouse model, triglyceride metabolism is not affected by
the presence of the apoA-I mutant, thus accounting for normal
triglyceride levels in A-IM k-in and A-I/A-IM
k-in mice.
A major objective of the present study was to utilize the k-in mice to
explore the possibility that hypoalphalipoproteinemia associated with
apoA-IM is due to defective expression of the human
apoA-IM gene. Quantitative real time RT-PCR on liver
mRNA, coherent with Northern blot analysis, did not show any
significant difference in the apoA-I and apoA-IM gene
expression, revealing that neither transcription nor mRNA stability
is responsible for the low apoA-IM plasma levels. Moreover,
because the intestine contributes significantly to the apoA-I
expression, we have also performed quantitative real time RT-PCR on
mouse intestine, and having obtained similar results among the mouse
lines, we could demonstrate that differences between the plasma levels
of apoA-I and A-IM are not a consequence of a lower
intestinal apoA-IM mRNA expression. Differences in
apolipoprotein plasma levels cannot also be attributed to an altered
apoA-IM synthesis rate, because experiments performed in
primary hepatocytes demonstrated comparable results among the k-in
lines. In contrast, secretion of human apolipoproteins into the medium
was reduced in both apoA-IM and apoA-I/A-IM
hepatic cells compared with apoA-I hepatocytes, reflecting the
apolipoprotein levels detected in mouse plasma. These data suggest that
an impaired apoA-IM hepatic secretion contributes to the
reduction of apoA-IM plasma levels observed in human
carriers. Although speculative, reduced apoA-IM secretion
may be related to a different intracellular processing (i.e.
dimerization) and/or transport of the mutant apolipoprotein.
The possible kinetic basis for the decreased plasma apoA-I and
A-IM levels in apoA-IM carriers was previously
examined by radiolabeling normal and mutant apoA-I and injecting them
into normal and apoA-IM subjects (31). This study has shown
that the hypoalphalipoproteinemia in apoA-IM carriers is
apparently caused by the rapid catabolism of both apoA-I and
apoA-IM, with a normal production rate of the normal and
mutant forms of apoA-I. ApoA-IM also appeared to be
catabolized more rapidly as a monomer than as a dimer. The clinical
study was thus not wholly consistent with our observation that
apoA-IM secretion is impaired. Further, a more recent study
by Perez-Mendez et al. (32) evaluating the turnover kinetics
of apoA-I- and apoA-IM-specific subclasses using stable
isotope techniques also corroborated these earlier findings by
indicating that hypercatabolism of apoA-I and apoA-IM
accounted for a major reduction in apoA-I and HDL in human carriers,
whereas the total apoA-I production rate appeared not to be altered.
However, detailed examination of the data also indicates that
production rates for apoA-IM monomers and
apoA-IM dimers are considerably lower than for normal
apoA-I. These observations are consistent with our finding that the
hepatic secretion of apoA-IM is impaired. In conclusion, we
suggest that both factors, i.e. reduced secretion of
apoA-IM and rapid catabolism of normal and mutant apoA-I,
are major contributors to the hypoalphalipoproteinemia found in human apoA-IM carriers.
 |
FOOTNOTES |
*
This work was supported in part by the NHLBI, National
Institutes of Health Grants HL18574 and HL55493, by Department of
Energy Contract DE-AC0376SF00098 (to the University of California,
Berkeley, CA), by Ministero dell'Università e della Ricerca
Scientifica e Tecnologica of Italy Grant 9806174392, by Istituto
Superiore di Sanità Grants 96/H/T15 and 93-99/H/T12, by a grant
from Esperion Therapeutics (Ann Arbor, MI), and by funds from Fondo per
gli Investimenti della Ricerca di Base/Ministero dell'Istruzione, dell'Università e della Ricerca Scientifica (to P. V.) and
from Associazione Italiana per la Ricerca sul Cancro (to M. G. S.). This is manuscript No. 65 of the Genoma 2000 Project
funded by Cassa di Risparmio delle Province Lombarde.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dept. of
Pharmacological Sciences, University of Milan, via Balzaretti 9, 20133 Milan, Italy. Tel.: 39-02-50318328; Fax: 39-02-50318284;
E-mail: cinzia.parolini@unimi.it.
Published, JBC Papers in Press, December 5, 2002, DOI 10.1074/jbc.M207335200
 |
ABBREVIATIONS |
The abbreviations used are:
HDL, high density
lipoproteins;
C, cholesterol;
apo, apolipoprotein;
A-IM, A-IMilano;
k-in, knock-in;
GGE, gradient gel
electrophoresis;
RT, reverse transcription;
FIAU, 1(1-
2-deoxy-2-fluoro- -Darabinofuransyl)-5-iodouracil.
 |
REFERENCES |
| 1.
|
Murray, C. J. L.,
and Lopez, A. D.
(1997)
Lancet
349,
1269-1276[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Stampfer, M. J.,
Sacks, F. M.,
Salvini, S.,
Willett, W. C.,
and Hennekens, C. H.
(1991)
N. Engl. J. Med.
325,
373-381[Abstract]
|
| 3.
|
Genest, J., Jr.,
McNamara, J. R.,
Ordovas, J. M.,
Jenner, J. L.,
Silberman, S. R.,
Anderson, K. M.,
Wilson, P. W.,
Salem, D. N.,
and Schaefer, E. J.
(1992)
J. Am. Coll. Cardiol.
19,
792-802[Abstract]
|
| 4.
|
Colyvas, N.,
Rapp, J. H.,
Phillips, N. R.,
Stoney, R.,
Perez, S.,
Kane, J. P.,
and Havel, R. J.
(1992)
Circulation
85,
1286-1292[Abstract/Free Full Text]
|
| 5.
|
Grundy, S. M.
(1998)
Am. J. Cardiol.
81,
18B-25B[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Robins, S. J.,
Collins, D.,
Wittes, J. T.,
Papademetriou, V.,
Deedwania, P. C.,
Schaefer, E. J.,
McNamara, J. R.,
Kashyap, M. L.,
Hershman, J. M.,
Wexler, L. F.,
and Rubins, H. B.
(2001)
J. Am. Med. Assoc.
285,
1585-1591[Abstract/Free Full Text]
|
| 7.
|
Rubins, H. B.,
Davenport, J.,
Babikian, V.,
Brass, L. M.,
Collins, D.,
Wexler, L.,
Wagner, S.,
Papademetriou, V.,
Rutan, G.,
and Robins, S. J.
(2001)
Circulation
103,
2828-2833[Abstract/Free Full Text]
|
| 8.
|
Badimon, J. J.,
Fuster, V.,
and Badimon, L.
(1992)
Circulation
86,
III86-III94
|
| 9.
|
Miyazaki, A.,
Sakuma, S.,
Morikawa, W.,
Takiue, T.,
Miake, F.,
Terano, T,
Sakai, M.,
Hakamata, H.,
Sakamoto, Y.,
Naito, M.,
Ruan, Y.,
Takahashi, K.,
Ohta, T.,
and Horiuchi, S.
(1995)
Arterioscler. Thromb. Vasc. Biol.
15,
1882-1888[Abstract/Free Full Text]
|
| 10.
|
Chiesa, G.,
Monteggia, E.,
Marchesi, M.,
Lorenzon, P.,
Laucello, M.,
Lorusso, V., Di,
Mario, C.,
Karvouni, E.,
Newton, R. S.,
Bisgaier, C. L.,
Franceschini, G.,
and Sirtori, C. R.
(2002)
Circ. Res.
90,
974-980[Abstract/Free Full Text]
|
| 11.
|
Fielding, C. J.,
and Fielding, P. E.
(1995)
J. Lipid Res.
36,
211-228[Abstract]
|
| 12.
|
Stein, O.,
and Stein, Y.
(1999)
Atherosclerosis
144,
285-301[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Cockerill, G. W.,
Huehns, T. Y.,
Weerasinghe, A.,
Stocker, C.,
Lerch, P. G.,
Miller, N. E.,
and Haskard, D. O.
(2001)
Circulation
103,
108-111[Abstract/Free Full Text]
|
| 14.
|
Sorenson, R. C.,
Bisgaier, C. L.,
Aviram, M.,
Hsu, C.,
Billecke, S.,
and La Du, B. N.
(1999)
Arterioscler. Thromb. Vasc. Biol.
19,
2214-2225[Abstract/Free Full Text]
|
| 15.
|
Talmud, P., Ye S.,
and Humphries, S.
(1982)
Genet. Epidemiol.
45,
161-179
|
| 16.
|
Reymer, P. W.,
Gagne, E.,
Groenemeyer, B. E.,
Zhang, H.,
Forsyth, I.,
Jansen, H.,
Seidell, J. C.,
Kromhout, D.,
Lie, K. E.,
and Kastelein, J. A.
(1995)
Nat. Genet.
10,
28-34[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Kuivenhoven, J. A.,
de Knijff, P.,
Boer, J. M. A.,
Smalheer, H. A.,
Botma, G. J.,
Seidell, J. C.,
Kastelein, J. J.,
and Pritchard, P. H.
(1997)
Arterioscler. Thromb. Vasc. Biol.
17,
560-568[Abstract/Free Full Text]
|
| 18.
|
Breckenridge, W. C.,
Little, J. A.,
Alaupovic, P.,
Wang, C. S.,
Kuksis, A.,
Kakis, G.,
Lindgren, F.,
and Gardiner, G.
(1982)
Atherosclerosis
45,
161-179[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Lopez, D.,
Sandhoff, T. W.,
and McLean, M. P.
(1999)
Endocrinology
140,
3034-3044[Abstract/Free Full Text]
|
| 20.
|
Kuivenhoven, J. A.,
Pritchard, H.,
Hill, J.,
Frohlich, J.,
Assmann, G.,
and Kastelein, J.
(1997)
J. Lipid Res.
38,
191-205[Abstract]
|
| 21.
|
Brooks-Wilson, A.,
Marcil, M.,
Clee, S. M.,
Zhang, L. H.,
Roomp, K.,
van Dam, M., Yu, L.,
Brewer, C.,
Collins, J. A.,
Molhuizen, H. O.,
Loubser, O.,
Ouelette, B. F.,
Fichter, K.,
Ashbourne-Excoffon, K. J.,
Sensen, C. W.,
Scherer, S.,
Mott, S.,
Denis, M.,
Martindale, D.,
Frohlich, J.,
Morgan, K.,
Koop, B.,
Pimstone, S.,
Kastelein, J. J.,
Genest, J., Jr.,
and Hayden, M. R.
(1999)
Nat. Genet.
22,
336-345[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Assmann, G.,
von Eckardstein, A.,
and Funke, H.
(1993)
Circulation
87,
28-34
|
| 23.
|
Franceschini, G.
(1996)
Eur. J. Clin. Invest.
26,
733-746[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Rader, D. J.,
Ikewaki, K.,
Duverger, N.,
Feuerstein, I.,
Zech, L.,
Connor, W.,
and Brewer, H. B., Jr.
(1993)
Lancet
342,
1455-1458[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Gualandri, V.,
Franceschini, G,
Sirtori, C. R.,
Gianfranceschi, G.,
Orsini, G. B.,
Cerrone, A.,
and Menotti, A.
(1985)
Am. J. Hum. Genet.
37,
1083-1097[Medline]
[Order article via Infotrieve]
|
| 26.
|
Sirtori, C. R.,
Calabresi, L.,
Franceschini, G.,
Baldassarre, D.,
Amato, M.,
Johansson, J.,
Salvetti, M.,
Monteduro, C.,
Zulli, R.,
Muiesan, M. L.,
and Agabiti-Rosei, E.
(2001)
Circulation
103,
1949-1954[Abstract/Free Full Text]
|
| 27.
|
Weisgraber, K. H.,
Bersot, T. P.,
Mahley, R. W.,
Franceschini, G.,
and Sirtori, C. R.
(1980)
J. Clin. Invest.
66,
901-907[Medline]
[Order article via Infotrieve]
|
| 28.
|
Rader, D. J.,
Gregg, R. E.,
Meng, M. S.,
Schaefer, J. R.,
Zech, L. A.,
Benson, M. D.,
and Brewer, H. B., Jr.
(1992)
J. Lipid Res.
33,
755-763[Abstract]
|
| 29.
|
Tilly-Kiesi, M.,
Lichtenstein, A. H.,
Ordovas, J. M.,
Dolnikowski, G.,
Malmstrom, R.,
Taskinen, M. R.,
and Schaefer, E. J.
(1997)
Arterioscler. Thromb. Vasc. Biol.
17,
873-880[Abstract/Free Full Text]
|
| 30.
|
McManus, D. C.,
Scott, B. R.,
Franklin, V.,
Sparks, D. L.,
and Marcel, Y. L.
(2001)
J. Biol. Chem.
276,
21292-21302[Abstract/Free Full Text]
|
| 31.
|
Roma, P.,
Gregg, R. E.,
Meng, M. S.,
Ronan, R.,
Zech, L. A.,
Franceschini, G.,
Sirtori, C. R.,
and Brewer, H. B., Jr.
(1993)
J. Clin. Invest.
91,
1445-1452[Medline]
[Order article via Infotrieve]
|
| 32.
|
Perez-Mendez, O.,
Bruckert, E.,
Franceschini, G.,
Duhal, N.,
Lacroix, B.,
Bonte, J. P.,
Sirtori, C.,
Fruchart, J. C.,
Turpin, G.,
and Luc, G.
(2000)
Atherosclerosis
148,
317-325[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Bielicki, J. K.,
Forte, T. M.,
McCall, M. R.,
Stoltzfus, L. J.,
Chiesa, G.,
Sirtori, C. R.,
Franceschini, G.,
and Rubin, E. M.
(1997)
J. Lipid Res.
38,
2314-2321[Abstract]
|
| 34.
|
Chiesa, G.,
Stoltzfus, L. J.,
Michelagnoli, S.,
Bielicki, J. K.,
Santi, M.,
Forte, T. M.,
Sirtori, C. R.,
Franceschini, G.,
and Rubin, E. M.
(1998)
Atherosclerosis
136,
139-146[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Williamson, R.,
Lee, D.,
Hagaman, J.,
and Maeda, N.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
7134-7138[Abstract/Free Full Text]
|
| 36.
|
Walsh, A.,
Ito, Y.,
and Breslow, J. L.
(1989)
J. Biol. Chem.
264,
6488-6494[Abstract/Free Full Text]
|
| 37.
|
Paszty, C.,
Mohandas, N,
Stevens, M. E.,
Loring, J. F.,
Liebhaber, S. A.,
Brion, C. M.,
and Rubin, E. M.
(1995)
Nat. Genet.
11,
33-39[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Koller, B. H.,
Kim, H. S.,
Latour, A. M.,
Brigman, K.,
Boucher, R, C., Jr.,
Scambler, P.,
Wainwright, B.,
and Smithies, O.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
10730-10734[Abstract/Free Full Text]
|
| 39.
|
Allain, C. C.,
Poon, L. S.,
Chan, C. S.,
Richmond, W.,
and Fu, P. C.
(1974)
Clin. Chem.
20,
470-475[Abstract]
|
| 40.
|
Schultz, J. R.,
Gong, E. L.,
McCall, M. R.,
Nichols, A. V.,
Clift, S. M.,
and Rubin, E. M.
(1992)
J. Biol. Chem.
267,
21630-21636[Abstract/Free Full Text]
|
| 41.
|
Havel, R. J.,
Eder, H. A.,
and Bragdon, J. H.
(1955)
J. Clin. Invest.
34,
1345-1353[Medline]
[Order article via Infotrieve]
|
| 42.
|
Nichols, A. V.,
Krauss, R. M.,
and Musliner, T. A.
(1986)
Methods Enzymol.
128,
417-431[Medline]
[Order article via Infotrieve]
|
| 43.
|
Gianazza, E.
(2002)
in
The Protein Protocol Handbook
(Wlaker, J. M., ed)
, pp. 169-180, Humana Press, Totowa, NJ
|
| 44.
|
Gianazza, E.,
Giacon, P.,
Sahlin, B.,
and Righetti, P. G.
(1985)
Electrophoresis
6,
53-56
|
| 45.
|
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Görg, A.,
Postel, W.,
Weser, J.,
Günther, S.,
Strahel, S. R.,
Hanash, S. M.,
and Somerlit, L.
(1987)
Electrophoresis
8,
122-124[CrossRef]
|
| 47.
|
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159[Medline]
[Order article via Infotrieve]
|
| 48.
|
Hayek, T.,
Ito, Y.,
Azrolan, N.,
Verdery, R. B.,
Aalto-Setala, K.,
Walsh, A.,
and Breslow, J. L.
(1993)
J. Clin. Invest.
91,
1665-1671[Medline]
[Order article via Infotrieve]
|
| 49.
|
Azrolan, N.,
Odaka, H.,
Breslow, J. L.,
and Fisher, E. A.
(1995)
J. Biol. Chem.
270,
19833-19838[Abstract/Free Full Text]
|
| 50.
|
Bradford, M. M.
(1976)
Anal. Biochem.
72,
248-254[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Ghiselli, G.,
Rohde, M. F.,
Tanenbaum, S.,
Krishnan, S.,
and Gotto, A. M., Jr.
(1985)
J. Biol. Chem.
260,
15662-15668[Abstract/Free Full Text]
|
| 52.
|
Capecchi, M. R.
(1989)
Science
244,
1288-1292[Abstract/Free Full Text]
|
| 53.
|
Franceschini, G.,
Baio, M.,
Calabresi, L.,
Sirtori, C. R.,
and Cheung, M. C.
(1990)
Biochim. Biophys. Acta
1043,
1-6[Medline]
[Order article via Infotrieve]
|
| 54.
|
Calabresi, L.,
Franceschini, G.,
Burkybile, A.,
and Jonas, A.
(1997)
Biochem. Biophys. Res. Commun.
232,
345-349[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Franceschini, G.,
Calabresi, L.,
Tosi, C.,
Sirtori, C. R.,
Fragiacomo, C.,
Noseda, G.,
Gong, E.,
Blanche, P.,
and Nichols, A. V.
(1987)
Arteriosclerosis
7,
426-435[Abstract/Free Full Text]
|
| 56.
|
Marzal-Casacuberta, A.,
Blanco-Vaca, F.,
Ishida, B. Y.,
Julve-Gil, J.,
Shen, J.,
Calvet-Marquez, S.,
Gonzalez-Sastre, F.,
and Chan, L.
(1996)
J. Biol. Chem.
271,
6720-6728[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. J. Rader
Gain-of-Function Mutations and Therapeutic Implications: Lipoprotein Lipase S447X to the Rescue
Arterioscler. Thromb. Vasc. Biol.,
October 1, 2005;
25(10):
2018 - 2019.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bhat, M. Zabalawi, M. C. Willingham, G. S. Shelness, M. J. Thomas, and M. G. Sorci-Thomas
Quality control in the apoA-I secretory pathway: deletion of apoA-I helix 6 leads to the formation of cytosolic phospholipid inclusions
J. Lipid Res.,
July 1, 2004;
45(7):
1207 - 1220.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|