|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 7, 4770-4777, February 14, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Vascular Biology Research Center, Institute of Molecular
Medicine and Division of Hematology, Department of Internal
Medicine, University of Texas Health Science Center,
Houston, Texas 77030
Received for publication, September 10, 2002, and in revised form, December 4, 2002
It is well established that p300 plays an
important role in mediating gene expressions. However, it is less clear
how its binding is influenced by physiological stimuli and how its
altered binding affects transactivator acetylation and binding. In this study, we determined p300 binding to a core cyclooxygenase-2 (COX-2) promoter region by chromatin immunoprecipitation and
streptavidin-agarose pull-down assays in basal and tumor necrosis
factor- Cyclooxygense-2 (COX-2)1
catalyzes the synthesis of robust prostaglandins and thromboxane (1).
It is highly inducible in many cell types by cytokines and oncogenic
and mitogenic factors (2). COX-2 has been shown to play an important
role in inflammation, angiogenesis, and tumorigenesis (3-7). Its
involvement in these pathophysiological processes depends largely on
its transcriptional activation by diverse stimuli. Its promoter
activation by pro-inflammatory mediators has been extensively
investigated. Several regulatory elements located at the 5'-flanking
untranslated region including a cyclic AMP response element (CRE) at
Plasmids--
A promoter region of human COX-2 gene ( Cell Culture and Treatment--
Human foreskin fibroblasts (HFb)
were cultured in Dulbecco's modified Eagle's medium supplemented with
10% fetal bovine serum and a 1:100 dilution of an
antibiotic-antimycotic solution. For all experiments, 80-90%
confluent cells were cultured in serum-free medium for 24 h,
washed with phosphate-buffered saline, and incubated in fresh medium in
the presence or absence of 10 ng/ml TNF Transient Transfection--
The transfection procedure was
performed as previously described (10). In brief, 10 µl of
LipofectAMINE 2000 reagent (Invitrogen) and 4 µg of luciferase
expression constructs were mixed, and the mixture was slowly added to
each well of HFb grown in a 6-well plate and incubated for 24 h.
The cells were washed, incubated in serum-free medium, and treated with
TNF Western Blot Analysis--
Western blot analysis was performed
as previously described with minor modifications (25). In brief, cell
pellets were lysed with lysis buffer containing 50 mM
Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, 5 µg/ml aprotinin, 1% Nonidet P-450, 0.5% sodium deoxycholae, and
0.1% SDS. The lysate was centrifuged, and the supernatant was
collected and boiled for 5 min. The protein concentration was
determined. The lysate proteins were separated by electrophoresis in a
4-15% SDS-PAGE minigel (Bio-Rad) and then electrophoretically transferred to a nitrocellulose membrane (Amersham Biosciences). Western blots were probed with a specific rabbit polyclonal anti-p300 antibody (Santa Cruz Biotechnology). The protein bands were detected by
enhanced chemiluminescence (Pierce).
Immunoprecipitation--
Nuclear extracts were prepared from HFb
by a method previously described (26). 800 µg of nuclear extracts
were incubated with a specific rabbit polyclonal antibody against p300,
c-Jun, CREB-2, C/EBP DNA-Protein Binding Assay--
Binding of p300 to COX-2 promoter
DNA sequence was assayed by a technique recently described (12).
80-90% confluent HFb were incubated in serum-free medium with 10 ng/ml TNF Chromatin Immunoprecipitation (ChIP)--
The assay was done as
described with minor modifications (27). 80-90% confluent HFb were
serum-starved for 24 h and treated with or without TNF Acetylation of Transactivators--
p50, p65, C/EBP Up-regulation of p300 Binding to COX-2 Promoter by TNF
We next used the streptavidin-agarose pull-down assay,
which provides quantitative information of transactivator binding, to
evaluate the effect of TNF
Interaction of p300 with COX-2 promoter-bound transactivators was
determined by immunoprecipitation of nuclear extract proteins with
antibodies against c-Jun, CREB-2, C/EBP Attenuation of COX-2 Promoter Activation by p300 HAT Deletion
Mutation--
HFb expressed a low basal level of p300 (Fig.
4). Transient transfection of p300
increased its level, which was accompanied by a large increase in basal
COX-2 promoter activity (Fig. 5), a
result consistent with the reported data (12-14). Overexpression of a
p300 HAT deletion mutant by transient transfection to a level similar
to that of the overexpressed wild type (WT) protein also increased the
basal COX-2 promoter activity, but the increase was only about 30% of
that induced by WT p300 (Fig. 5). TNF Selective p50 Acetylation by p300--
It is well
established that p300 HAT contributes to promoter activation by
acetylating core histones in chromatin structure. In this study, we
investigated whether it acetylates COX-2 promoter-bound transactivators. p50, p65, CREB-2, and C/EBP transactivators were immunoprecipitated with their respective antibodies, and the acetylated proteins were detected by Western blots using an antibody specific for
acetylated lysine. A low level of acetylated p50 was detected at basal
state and was increased by TNF
To determine whether p50 acetylation was correlated with an increased
p50 binding to the COX-2 promoter, we measured p50 binding to the
biotinylated COX-2 promoter in HFb transduced by WT, Inhibition of p50 Acetylation by E1A--
As adenoviral E1A is a
potent inhibitor of p300 co-activator activities (28), we evaluated its
effect on p50 acetylation and binding. Its overexpression suppressed
COX-2 promoter activities stimulated by TNF Results from this study show a low level of p300 recruited
to the COX-2 promoter-bound transactivators in resting human
fibroblasts. p300 recruitment was enhanced in cells treated with TNF NF- There is a large body of data supporting the notion that p300
recruitment to DNA-bound transactivators is essential for transcription of many genes. However, there is little information about the role of
increased p300 binding in gene transcription under physiological conditions. In this study, our results demonstrate increased p300 binding to chromatin as well as naked COX-2 promoter sequence by TNF We thank Dr. Joan Boyes (Chester Beatty
Laboratories at the Institute of Cancer Research, London, UK) and Dr.
Pradip Raychaudhuri (University of Illinois, Chicago, IL) for providing
valuable plasmid constructs.
*
This work was supported by NHLBI, National Institutes of
Health Grant R01 HL-50675 and NINDS, National Institutes of Health Grant P50 NS-23327.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Vascular Biology
Research Center, Institute of Molecular Medicine and Division of
Hematology, Dept. of Internal Medicine, University of Texas Health
Science Center, 6431 Fannin, Houston, TX 77030. Tel.:
713-500-6801; Fax: 713-500-6812; E-mail:
Kenneth.K.Wu@uth.tmc.edu.
Published, JBC Papers in Press, December 5, 2002, DOI 10.1074/jbc.M209286200
The abbreviations used are:
COX-2, cyclooxygenase-2;
TNF
Up-regulation of p300 Binding and p50 Acetylation in Tumor
Necrosis Factor-
-induced Cyclooxygenase-2 Promoter Activation*
, and
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(TNF
)-treated human foreskin fibroblasts. We found basal
binding of p300, p50/p65 NF-
B, cyclic AMP regulatory element-binding
protein-2, CCAAT/enhancer-binding protein
, and c-Jun. p50/p65 and
p300 binding was selectively increased by TNF
. Immunoprecipitation
confirmed direct interaction of p300 with NF-
B and the other
involved transactivators. p50 acetylation was detected in resting cells
and was increased by TNF
or lipopolysaccharide. Overexpression of
p300 augmented p50 acetylation, which was attenuated by deletion of its
histone acetyltransferase domain. Enhanced p50 acetylation correlated
with increased p50 binding to COX-2 promoter and transcriptional
activation. Co-transfection of E1A with p300 abrogated p50 acetylation
and p50 binding. These findings suggest that up-regulation of p300
binding and its acetylation of NF-
B occupies a central position in
COX-2 promoter activation.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
53 to
59, a CCCAAT/enhancer-binding protein (C/EBP) element at
124 to
132, and two NF-
B sites at
438 to
447 and
213 to
222 are involved in human COX-2 transactivation (8, 9). We have
recently demonstrated binding of CREB, C/EBP
, and NF-
B to their
respective binding sites in this region (10, 11). Our results indicate
that COX-2 induction in human fibroblasts and endothelial cells
requires binding of multiple transactivators. p300/CREB-binding protein
overexpression has been shown to up-regulate COX-2 transcription
(12-14), suggesting an important role for p300 in bridging the
multiple DNA-bound transactivators with general transcription factors
to initiate COX-2 transcription. p300 belongs to a large class of
transcription co-activators, which serve as adaptors for
transcriptional activation of diverse genes (for a review see Refs.
15-17). It is a 2414-amino acid protein containing several domains for
binding to transactivators, adenoviral E1A, and general transcription
factors. It is a histone acetyltransferase (HAT) that acetylates
histone and induces chromatin remodeling to facilitate transactivation
(18). p300 has been shown to acetylate transactivators and enhance
their binding to DNA (19, 20). Because p300 is capable of binding to
CREB (21), C/EBP
(22), and NF-
B (23), it is likely to be a major
co-activator for COX-2 transcriptional activation. However, there was
little reported data about p300 binding to COX-2 promoter, nor was
there information about p300 acetylation of COX-2-bound
transactivators. In this study, we determined p300 interaction with
transactivators bound to the core COX-2 promoter region and assessed
the role of p300 HAT in regulating COX-2 transcriptional activity in
human fibroblasts stimulated with tumor necrosis factor-
(TNF
).
Our results show that TNF
up-regulated binding of p50/p65 NF-
B,
which correlated with enhanced p300 recruitment to the promoter
complex. Deletion mutation of p300 HAT reduced p300 recruitment and
severely attenuated its ability to enhance basal and TNF
-induced
COX-2 promoter activity. Our results further show that p300 acetylated
p50 NF-
B but not p65, C/EBP
, or CREB-2. These findings indicate
that p300 mediates and regulates COX-2 transactivation by multiple
mechanisms including a selective acetylation of p50 NF-
B.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
891 to +9
from the transcription start site) was constructed into the luciferase
reporter vector pGL3 as previously described (8). The expression
vectors containing full-length p300 (pCL.p300) and its HAT deletion
mutant (CL.p300
HAT,
1472-1522) (19) were provided by Dr. Joan
Boyes. The E1A expression vector (24) was provided by Dr. Pardip Raychaudhuri.
(Sigma), 100 nM
of phorbol 12-myristate 13-acetate (Sigma), or 2 µg/ml of
lipopolysaccharide (Escherichia coli 026:B6, Sigma) at
37 °C for 4 h. After washing with chilled phosphate-buffered
saline three times, the cells were harvested and processed to prepare cell lysates or nuclear extracts. All of the tissue culture reagents were obtained from Invitrogen.
(10 ng/ml). The expressed luciferase activity was measured in a
luminometer (TD-20/20). To evaluate the effect of p300 or p300
HAT
on COX-2 promoter activation, 2 µg of pCL.p300, pCL.p300
HAT, or
pCL.vector plus 4 µg of luciferase expression constructs were mixed
with 15 µl of LipofectAMINE 2000 reagent, and the mixture was added
slowly to cells cultured in a 6-well plate. To evaluate the effect of p300 overexpression on p50 acetylation or binding, 10 µg of pCL constructs were mixed with 25 µl of LipofectAMINE 2000 reagent, and
the mixture was added to cells cultured in a 10-cm dish.
Co-transfection of E1A and p300 was performed by mixing 4 µg of E1A
plasmid construct with 6 µg of p300 construct and 25 µl of
LipofectAMINE, and the mixture was slowly added to ~90% confluent
cells in serum-free medium in a 10-cm dish and incubated for 3 h.
10% fetal bovine serum was added and incubated for an additional
21 h. The cells were washed and incubated in serum-free medium for
24 h prior to the addition of TNF
or vehicle control.
, p50, or p65 (all from Santa Cruz
Biotechnology) at a final concentration of 4 µg/ml each overnight at
4 °C. Protein A/G plus agarose (Santa Cruz) was then added for
2 h at 4 °C. The beads were washed four times in RIPA buffer
(50 mM Tris, pH 8.0, 150 mM NaC1, 2 mM NaF, 1 mM EDTA, 1 mM EGTA, 1 mM NaVO4, 1% Triton X-100) containing protease
inhibitors (Roche Molecular Biochemicals), and the immunoprecipitated
proteins were separated by SDS-PAGE and analyzed by Western blotting.
Control immunoprecipitation was performed with a nonimmune rabbit
normal immunoglobulin (Santa Cruz).
for 4 h before the nuclear extracts were prepared.
The biotin-labeled double-stranded oligonucleotides were synthesized by
integrated DNA technologies based on human COX-2 promoter sequence
30
to
453 (8). A nonrelevant biotinylated sequence
5'-AGAGTGGTCACTACCCCCTCTG-3' was included as a control. The binding
assay was performed by mixing 600 µg of HFb nuclear extract proteins,
6 µg of biotin-labeled DNA oligonucleotides, and 60 µl of
streptavidin-agarose beads (4%) with 70% slurry. The mixture was
incubated at room temperature for 1 h with shaking. The beads were
pelleted and washed with cold phosphate-buffered saline three times.
The binding proteins were separated by SDS-PAGE followed by Western
blot analysis probed with specific antibodies.
(10 ng/ml) at 37 °C for 4 h. 1% formaldehyde was added to the
culture medium, and after incubation for 20 min at 37 °C, the cells
were washed twice in phosphate-buffered saline, scraped, and lysed in
lysis buffer (1% SDS, 10 mM Tris-HCl, pH 8.0, with 1 mM phenylmethylsulfonyl fluoride, pepstatin A, and aprotinin) for 10 min at 4 °C. The lysates were sonicated five times
for 10 s each time, and the debris was removed by centrifugation. One-third of the lysate was used as DNA input control. The remaining two-thirds of the lysate were diluted 10-fold with a dilution buffer
(0.01% SDS, 1% Triton X-100, 1 mM EDTA, 10 mM
Tris-HCl, pH 8.0, and 150 mM NaCl) followed by incubation
with antibodies against p300, c-Jun, C/EBP
, CREB-2, p50, p65
NF-
B, or a nonimmune rabbit IgG (Santa Cruz) overnight at 4 °C.
Immunoprecipitated complexes were collected by using protein A/G plus
agarose beads. The precipitates were extensively washed and incubated
in an elution buffer (1% SDS and 0.1 M NaHCO3)
at room temperature for 20 min. Cross-linking of protein-DNA complexes
was reversed at 65 °C for 5 h, followed by treatment with 100 µg/ml proteinase K for 3 h at 50 °C. DNA was extracted three
times with phenol/chloroform and precipitated with ethanol. The pellets
were resuspended in TE buffer and subjected to PCR amplification
using specific COX-2 promoter primers: 5' primer,
709CTGTTGAAAGCAACTTAGCT
690, and 3' primer
32AGACTGAAAACCAAGCCCAT
51. The
resulting product of 678 bp in length was separated by agarose gel electrophoresis.
, or
CREB-2 in nuclear extracts was immunoprecipitated with a specific
antibody, and the immunoprecipitates were collected by using protein
A/G plus agarose beads. After extensive washing the proteins were
separated by SDS-PAGE, and acetylated transactivators were detected on
Western blots using a monoclonal antibody against acetylated lysine
(1:1000 dilution; Cell Signaling Technology).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
--
To
determine whether p300 recruitment to COX-2 promoter-transactivator
complex was altered by TNF
stimulation, we evaluated p300 binding in
unstimulated as well as TNF
-stimulated HFb by ChIP. Chromatin was
immunoprecipitated with a p300 antibody, and a COX-2 promoter-enhancer
region (
32 to
709) containing the essential binding sites for
promoter activation was amplified by PCR. Vector-transfected HFb, like
native HFb, shows trace p300 binding at basal state that was increased
by TNF
treatment (Fig. 1). ChIP assays
using specific transactivator antibodies also detected binding of
c-Jun, CREB-2, C/EBP
, p50, and p65 NF-
B to the core COX-2
promoter region in chromatin structure in unstimulated cells, and
TNF
treatment resulted in a significant increase only in p50 and p65
NF-
B binding (Fig. 1). Binding of p300 and transactivators to COX-2
promoter was specific as immunoprecipitation with a normal rabbit IgG
did not show detectable COX-2 promoter fragment (Fig. 1).

View larger version (27K):
[in a new window]
Fig. 1.
TNF
increased p300
and p50/p65 NF-
B binding to chromatin COX-2
promoter region. Chromatin fragments prepared from HFb treated
without or with TNF
were immunoprecipitated (IP) with
specific antibodies against p300, c-Jun, CREB-2, C/EBP
, p50, or p65,
and the COX-2 promoter region (
32 to
709) in the chromatin
precipitate was amplified by PCR under identical conditions. Rabbit
nonimmune IgG was included as a negative control. a, a
representative set of results. b, densitometric analysis of
basal versus TNF
-treated samples from three experiments.
Each bar denotes the mean ± S.D. Only the difference
in p300, p50, and p65 binding was statistically significant
(p < 0.05 for each).
on transactivator and p300 binding to a
biotinylated COX-2 promoter sequence (
453 to
30). Nuclear extracts
from HFb treated with and without TNF
were incubated with the
biotinylated probe and streptavidin-agarose beads. Transactivators and
p300 present in the complex were analyzed by Western blots. Consistent
with the ChIP assays, c-Jun, CREB-2, C/EBP
, and p50/p65 NF-
B as
well as p300 were detected in resting cells, and only p300 and p50/p65
NF-
B binding was increased by TNF
stimulation (Fig.
2).

View larger version (16K):
[in a new window]
Fig. 2.
TNF
increased p300,
p50, and p65 binding to a biotinylated COX-2 promoter probe.
Nuclear extracts from HFb were incubated with streptavidin-agarose
beads and a biotinylated COX-2 promoter sequence
30 to
453.
Proteins in the complex were analyzed by Western blots. a,
results from a representative experiment. b, comparison of
the densitometry of basal versus TNF
-treated samples in
three experiments. Each bar is the mean ± S.D. Only
the difference in p300, p50, and p65 binding levels was statistically
significant (p < 0.05).
, p50, p65, or nonimmune IgG
and analysis of p300 in the complex by Western blots. p300 was
co-precipitated with each of the transactivators in resting and
TNF
-treated cells (Fig.
3a). p300 complexion with each
transactivator tended to be increased by TNF
. However, quantitation
of binding is difficult because of large p300 molecular mass and slow
mobility in gel electrophoresis. Interaction of p300 with these
transactivators was confirmed by immunoprecipitation of nuclear extract
proteins with anti-p300 antibodies and identification of
transactivators by Western blot analysis (Fig. 3b).
Together, these results provide direct evidence for recruitment and
binding of p300 to COX-2 promoter in resting cells and an up-regulation
of p300 binding as a result of increased p50/p65 binding to the
promoter following TNF
stimulation.

View larger version (17K):
[in a new window]
Fig. 3.
Co-immunoprecipitation of p300 with
transactivators. a, nuclear extract proteins were
immunoprecipitated (IP) with the indicated specific
antibody, and proteins in the immunoprecipitates were detected by
Western blot (WB) analysis using a p300 antibody. This
figure is from one of two experiments with similar results.
b, nuclear extracts were immunoprecipitated with a p300
antibody, and transactivators in the complex were detected by their
respective antibodies. This figure is from one of two experiments with
similar results. IP control denotes
immunoprecipitation with a normal rabbit IgG.
did not
significantly increase native or transduced p300 levels (Fig. 4).
However, p300 overexpression augmented COX-2 promoter activity stimulated with TNF
, and this augmenting effect was greatly
attenuated when p300 HAT domain was deleted (Fig. 5). Because the HAT
domain of p300 is situated close to transactivator binding domains, its deletion (
1472-1522) may influence p300 binding. We therefore compared recruitment of WT and
HAT p300 to the biotinylated probe by
the streptavidin bead pull-down assay. The
HAT mutant did not bind
as well as WT p300, and its binding was close to the basal p300 binding
(Fig. 6). Together, these results suggest
that p300 plays a major role in regulating COX-2 promoter activity, and
its HAT activity is crucial for the regulation of COX-2 transactivation and p300 recruitment.

View larger version (14K):
[in a new window]
Fig. 4.
TNF
did not
influence the protein levels of p300 in HFb. p300 proteins were
determined by Western blot analysis. The upper panel shows a
representative Western blot. The lower panel shows
densitometric analysis of Western blots from three experiments. Each
bar denotes the mean ± S.D.

View larger version (13K):
[in a new window]
Fig. 5.
p300 HAT deletion mutation attenuated COX-2
promoter activity. HFb were transfected with WT p300,
HAT, or
vector followed by treatment with or without TNF
. COX-2 promoter
activity was expressed as the number of relative light units
(RLU)/µg of cell lysate proteins. Each bar
denotes the mean ± S.D. of three experiments.

View larger version (15K):
[in a new window]
Fig. 6.
Deletion of HAT reduced p300 binding.
Nuclear extracts from HFb treated with or without TNF
stimulation
were incubated with biotinylated COX-2 promoter probe and
streptavidin-agarose beads. p300 in the complex was detected by Western
blots. Control denotes the use of a nonrelated biotinylated
sequence as the probe. a, Western blot of a representative
experiment. b, densitometric analysis of three experiments.
Each bar is the mean ± S.D.
stimulation (Fig.
7a). Neither p65 nor other
transactivators were acetylated. Acetylated p50 was increased slightly
by stimulation with phorbol 12-myristate 13-acetate (100 nM) for 4 h and was significantly increased by stimulation with lipopolysaccharide (2 µg/ml) for 4 h (Fig.
7b). To determine whether p50 acetylation was mediated by
p300, we overexpressed WT or
HAT p300 and assayed p50 acetylation.
At the basal state, p300 transfection increased p50 acetylation, whereas
HAT caused a much less increase (Fig.
8a). p300 overexpression augmented TNF
-induced p50 acetylation, which was attenuated by HAT
deletion mutation (Fig. 8). As expected, p50 protein levels at basal
state were low and were increased by TNF
stimulation. Neither p300
nor p300
HAT transfection altered p50 protein levels (Fig.
8b).

View larger version (16K):
[in a new window]
Fig. 7.
TNF
and
lipopolysaccharide increased p50 acetylation. a,
nuclear extracts from HFb treated with or without TNF
for 4 h
were immunoprecipitated with CREB-2, C/EBP
, p50, or p65 antibodies
or a nonimmune rabbit IgG, and the acetylated transactivator in the
precipitate was detected by Western blot analysis. IP
control denotes immunoprecipitation of nuclear extracts from
TNF
treated cells with nonimmune IgG. Only acetylated p50 was
detected in unstimulated cells which was increased by TNF
.
Densitometric analysis of acetylated p50 (Ac-p50) shows a
significant increase in Ac-p50 in TNF
-treated cells
(n = 3, p < 0.05). b,
nuclear extracts from cells treated with or without phorbol
12-myristate 13-acetate (PMA, 100 nM) or
lipopolysaccharide (LPS, 2 µg/ml) for 4 h were
immunoprecipitated with a normal rabbit IgG (IP control) or
a specific p50 antibody. Acetylated p50 was detected by Western blots
using an acetylated lysine antibody. LPS significantly increased Ac-p50
over the basal level (n = 3, p < 0.05), whereas phorbol 12-myristate 13-acetate did not significantly
increase acetylated p50.

View larger version (20K):
[in a new window]
Fig. 8.
p300 overexpression increased p50
acetylation. Nuclear extracts were immunoprecipitated with an
anti-p50 antibody. Acetylated p50 (Ac-p50, a) and
total p50 (b) were analyzed by Western blots using an
anti-acetylated lysine antibody and an anti-p50 antibody, respectively.
The upper panels show a representative Western blot, and the
lower panels show densitometric analysis of three
experiments.
HAT, or its
control vector. At the basal state, p300 overexpression increased p50
binding by more than 2-fold, whereas
HAT overexpression exerted a
lesser increase (Fig. 9). TNF
increased p50 binding, which was augmented by WT but not
HAT p300
overexpression (Fig. 9). ChIP assays were performed to evaluate the
effect of p300 overexpression on p50 binding to chromatin COX-2
promoter region. Corresponding to the results of in vitro
binding experiments shown in Fig. 9, overexpression of wild type p300
augmented p50 binding to COX-2 promoter region in the chromatin
structure of resting and TNF
-stimulated cells (Fig.
10).
HAT overexpression attenuated the increase in p50 binding (Fig. 10).

View larger version (16K):
[in a new window]
Fig. 9.
p300 overexpression increased p50
binding. Binding was carried out by streptavidin-agarose pull-down
assay using a biotinylated COX-2 promoter sequence (
30 to
453) as
the probe. a, a representative Western blot. b,
densitometric analysis of three experiments. Each bar is the
mean ± S.D. Control denotes the use of a nonrelevant
probe in the assay.

View larger version (18K):
[in a new window]
Fig. 10.
p300 overexpression increased p50 binding to
chromatin COX-2 promoter. Chromatin was immunoprecipitated with a
specific p50 antibody or a nonimmune rabbit IgG, and the COX-2 promoter
region was amplified by PCR. a, a representative gel showing
COX-2 promoter fragments. Nonimmune IgG denotes
immunoprecipitation with a normal rabbit IgG of chromatin from
p300-transfected cells treated with TNF
for 4 h. b,
densitometric analysis of COX-2 promoter fragments in chromatin
complexes immunoprecipitated with a p50 antibody. Each bar
represents the mean ± S.D. of three experiments.
and p300 overexpression
(data not shown). Overexpression of E1A by transient transfection
abrogated p50 acetylation induced by p300 overexpression in the
presence or absence of TNF
without altering the p50 level (Fig.
11). Inhibition of p50 acetylation by
E1A was correlated with reduction of p50 binding to a COX-2 promoter
probe (Fig. 12a) and to the
chromatin COX-2 promoter region (Fig. 12b).

View larger version (15K):
[in a new window]
Fig. 11.
E1A transfection abrogated acetylated
p50 stimulated by p300. HFb co-transfected with E1A and
p300 were treated with or without TNF
. Nuclear extracts were
immunoprecipitated (IP) with a p50 antibody or a control
IgG. Acetylated p50 (Ac-p50, a) and p50 levels
(b) were detected by Western blot analysis using antibodies
specific for acetylated lysine (a) or p50 (b).
Densitometric analysis shows the means ± S.D. from three
experiments.

View larger version (15K):
[in a new window]
Fig. 12.
Inhibition of p50 binding to naked COX-2
promoter (a) and chromatin COX-2 promoter
(b). The binding assays are described under
"Experimental Procedures." Control probe is a 22-bp
biotinylated nonrelevant sequence. Each bar represents the
mean ± S.D. of three experiments.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and further augmented by p300 overexpression. Enhanced p300 binding was
correlated with an up-regulation of COX-2 promoter activities. These
enhancing activities of p300 were abrogated by E1A, an inhibitor of
p300. These results indicate that p300 plays a crucial role in
regulating COX-2 transcription. Our findings further indicate that
p300-mediated COX-2 transcriptional activation depends on HAT. Deletion
of the HAT domain resulted in a more than 60% reduction in COX-2
promoter activity induced by p300. p300 HAT is capable of acetylating
the N-terminal lysine residues of core histones, thereby modifying the
chromatin structure (15-17). This property of p300 is likely contributing to accessibility of COX-2 promoter regulatory elements for
transactivator binding. In this study, our results shed light on
another important property of p300 that enhances NF-
B dependent COX-2 transcription. Our results indicate that p300 HAT is capable of
acetylating p50, thereby increasing p50/p65 NF-
B binding to COX-2
promoter. p300 has previously been shown to acetylate p53 (19) and
GATA (20). To our knowledge, this is the first report of
p300-mediated p50 acetylation under physiological conditions. Interestingly, p50 acetylation by p300 was demonstrated as a mechanism by which human immunodeficiency virus-1 replicates in host lymphocytes (29). Binding of host p50/p65 NF-
B to a viral long terminal repeat
region has been shown to play a key role in viral genome transcription.
In the presence of a viral protein Tat, p300 HAT acetylates p50 at
several lysine residues, which results in enhanced p50 binding to its
cognate sites. Our results show p50 acetylation in TNF
-treated cells
in the absence of the viral Tat. It is unclear whether under
physiological conditions, p50 acetylation by p300 also depends on a
Tat-like co-factor. That p300 HAT acetylates p50 without a concurrent
acetylation of C/EBP
, CREB-2, c-Jun, or p65 suggests a stringent
requirement of an appropriate lysine structural environment in p50 and
possibly also p53 and GATA-1 for the action of p300 HAT.
B is a heterodimer typically comprising a p50 subunit that binds
to promoter and a p65 subunit that interacts with p300. NF-
B is
sequestered in cytosol, and upon stimulation, it translocates to the
nucleus where it binds to its cognate sites. NF-
B has been shown to
play a key role in COX-2 transcriptional activation stimulated by
TNF
, lipopolysaccharide, and other pathophysiological stresses.
There are two NF-
B sites at the core promoter region of human COX-2,
and mutation of either site results in loss of response to TNF
stimulation (10). In this study, our results show that TNF
selectively increased NF-
B binding to these sites, which was
accompanied by enhanced p300 recruitment and binding to the COX-2
promoter complex. In view of augmented p50/p65 binding and
p300 recruitment by p300 overexpression and the requirement of HAT for
the p300-induced binding activities, we propose that p300 binding to
DNA-bound NF-
B is limited by a low level of p300 in cells and that
TNF
is capable of augmenting p300 binding by a positive feedback
loop driven by p50 acetylation. p50 acetylation by HAT of p300 bound to
the complex leads to an increased p50/p65 binding, which in turn
recruits additional p300 to the complex. This autoregulatory loop
ensures up-regulation of NF-
B-mediated gene expression. Because
NF-
B plays a key role in transcriptional activation of myriad
proinflammatory genes, this regulatory mechanism has important
implications in inflammation, tissue injury, and tumorigenesis.
stimulation. Increased p300 binding correlated closely with an enhanced
p50/p65 binding. Our results provide further evidence for complex
formation between p300, and each involved transactivator and an
up-regulation of p300 and p50/p65 in the complex by TNF
. Together
with our previously reported results (10-12), these findings indicate
that at the basal state, p300 is recruited to COX-2 promoter by
interacting with constitutively bound CREB and c-Jun at the CRE site,
C/EBP
at CRE and C/EBP sites, and p50/p65 NF-
B at both NF-
B
sites. TNF
stimulation increases p50/p65 binding via p50
acetylation, and the increased NF-
B bound to its specific sequence
recruits additional p300 leading to amplified transcriptional
activation. TNF
stimulation could therefore serve as a model for
understanding COX-2 transcriptional stimulation by diverse cytokines,
growth factors, angiogenic factors, and environmental stress. These
agonists induce COX-2 transcription by up-regulating the binding of
distinct groups of transactivators, which in turn recruit p300. p300
binding to transactivators drives the transcriptional initiation
complex via interaction with general transcriptional factors.
Furthermore, p300 acetylates core histone, notably H3 and H4 lysines,
to modify chromatin structure and increase transactivator binding. In
addition, p300 acetylates selective classes of transactivators, such as
p50, thereby further increasing transactivator binding and amplifying
transactivation of genes. Increased transactivator binding results in
recruiting additional p300, thus creating a positive regulatory loop
for COX-2 transactivation. p300 thus occupies a central position in
regulating COX-2 promoter activation through its pleiotropic actions.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
Present address: College of Life Science, Wuhan University, Wuhan,
Hubei 430072, China.
![]()
ABBREVIATIONS
, tumor necrosis factor
;
CRE, cyclic AMP
response element;
CREB, CRE-binding protein;
HAT, histone
acetyltransferase;
HAT, HAT deletion mutant;
WT, wild type;
HFb, human foreskin fibroblasts;
C/EBP, CCAAT/enhancer-binding
protein;
ChIP, chromatin immunoprecipitation.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Smith, W. L.,
Garavito, R. M.,
and Dewitt, D. L.
(1996)
J. Biol. Chem.
271,
33157-33160 2.
Wu, K. K.
(1995)
Adv. Pharmacol.
33,
179-207
3.
Vane, J. R.,
Mitchell, J. A.,
Appleton, I.,
Tomlinson, A.,
Bishop-Bailey, D.,
Croxtall, J.,
and Willoughby, D. A.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
2046-2050 4.
Siebert, K.,
Zhang, Y.,
Leahy, K.,
Hauser, S.,
Masferrer, J.,
Perkins, W.,
Lee, L.,
and Isakson, P.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
12013-12017 5.
Tsujii, M.,
and DuBois, R. N.
(1995)
Cell
83,
493-501[CrossRef][Medline]
[Order article via Infotrieve]
6.
Tsujii, M.,
Kawano, S.,
Tsujii, S.,
Sawaoka, H.,
Hori, M.,
and DuBois, R. N.
(1998)
Cell
93,
705-716[CrossRef][Medline]
[Order article via Infotrieve]
7.
Tsujii, M.,
Kawano, S.,
and DuBois, N. R.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
3336-3340 8.
Tazawa, R., Xu, X. M., Wu, K. K.,
and Wang, L. H.
(1994)
Biochem. Biophys. Res. Commun.
203,
190-199[CrossRef][Medline]
[Order article via Infotrieve]
9.
Inoue, H.,
Nanayama, T.,
Hara, S.,
Yokoyama, C.,
and Tanabe, T.
(1994)
FEBS Lett.
350,
51-54[CrossRef][Medline]
[Order article via Infotrieve]
10.
Saunders, M. A.,
Sansores-Garcia, L.,
Gilroy, D. W.,
and Wu, K. K.
(2001)
J. Biol. Chem.
276,
18897-18904 11.
Schrör,
Zhu, Y.,
Saunders, M. A.,
Deng, W.-G.,
Xu, X.-M.,
Meyer-Kirchrath, J.,
and Wu, K. K.
(2002)
Circulation
105,
2760-2765 12.
Zhu, Y.,
Saunders, M.,
Yeh, H.,
Deng, W.-G.,
and Wu, K. K.
(2002)
J. Biol. Chem.
277,
6923-6928 13.
Subbaramiah, K.,
Lin, D. T.,
Hart, J. C.,
and Dannenberg, A.-J.
(2001)
J. Biol. Chem.
276,
12440-12448 14.
Subbaramiah, K.,
Cole, P. A.,
and Dannenberg, A. J.
(2002)
Cancer Res.
62,
2522-2530 15.
Shikama, N.,
Lyon, J.,
and LaThange, N. B.
(1997)
Trends Cell Biol.
7,
230-236
16.
Ciles, R. H.,
Peters, D. J. M.,
and Breuning, M. H.
(1998)
Trend Genet.
14,
178-183[CrossRef][Medline]
[Order article via Infotrieve]
17.
Janknecht, R.,
and Hunter, T.
(1996)
Nature
383,
22-23[CrossRef][Medline]
[Order article via Infotrieve]
18.
Ogryzko, V. V.,
Schiltz, R. L.,
Russsanova, V.,
Howard, B. H.,
and Nakatani, Y.
(1996)
Cell
87,
9553-9559
19.
Boyes, J.,
Byfield, P.,
Nakatani, Y.,
and Ogryzko, V.
(1998)
Nature
396,
594-598[CrossRef][Medline]
[Order article via Infotrieve]
20.
Gu, W.,
and Roeder, R. G.
(1997)
Cell
90,
595-606[CrossRef][Medline]
[Order article via Infotrieve]
21.
Arias, J.,
Alberts, A. S.,
Brindle, P.,
Claret, F. X.,
Smeal, T.,
Karin, M.,
Feramisco, J.,
and Montiminy, M.
(1994)
Nature
70,
226-229
22.
Mink, S.,
Haenig, B.,
and Klempnauer, K. H.
(1997)
Mol. Cell. Biol.
17,
6609-6617[Abstract]
23.
Gerritsen, M. E.,
Williams, A. J.,
Neish, A. S.,
Moore, S.,
Shi, Y.,
and Collins, T.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2927-2932 24.
Raychaudhuri, P.,
Bagchi, S.,
Neill, S. D.,
and Nevins, J. R.
(1990)
J. Virol.
64,
2702-2710 25.
Deng, W.-G.,
Saunders, M. A.,
Gilroy, D. W., He, X.-Z.,
Yeh, H.,
Zhu, Y.,
Shtivelband, M. I.,
Ruan, K-H.,
and Wu, K. K.
(2002)
FASEB J.
16,
1286-1288 26.
Liou, J-Y.,
Deng, W.-G.,
Gilroy, D. W.,
Shyue, S.-K.,
and Wu, K. K.
(2001)
J. Biol. Chem.
276,
34975-34982 27.
Luo, R. X.,
Postigo, A. A.,
and Dean, D. C.
(1998)
Cell
92,
463-473[CrossRef][Medline]
[Order article via Infotrieve]
28.
Eckner, R.,
Ewen, M. E.,
Newsome, D.,
Gerdes, M.,
DeCaprio, J. A.,
Lawrence, J. B.,
and Livingston, D. M.
(1994)
Genes Dev.
8,
869-884 29.
Furia, B.,
Deng, L., Wu, K.,
Baylor, S.,
Kehn, K., Li, H.,
Donnelly, R.,
Coleman, T.,
and Kashanchi, F.
(2002)
J. Biol. Chem.
277,
4973-4980
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
C.-W. Lee, C.-C. Lin, S.-F. Luo, H.-C. Lee, I.-T. Lee, W. C. Aird, T.-L. Hwang, and C.-M. Yang Tumor Necrosis Factor-{alpha} Enhances Neutrophil Adhesiveness: Induction of Vascular Cell Adhesion Molecule-1 via Activation of Akt and CaM Kinase II and Modifications of Histone Acetyltransferase and Histone Deacetylase 4 in Human Tracheal Smooth Muscle Cells Mol. Pharmacol., May 1, 2008; 73(5): 1454 - 1464. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Buerki, K. M. Rothgiesser, T. Valovka, H. R. Owen, H. Rehrauer, M. Fey, W. S. Lane, and M. O. Hottiger Functional relevance of novel p300-mediated lysine 314 and 315 acetylation of RelA/p65 Nucleic Acids Res., March 1, 2008; 36(5): 1665 - 1680. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Cao, P. A. Bromberg, and J. M. Samet COX-2 Expression Induced by Diesel Particles Involves Chromatin Modification and Degradation of HDAC1 Am. J. Respir. Cell Mol. Biol., August 1, 2007; 37(2): 232 - 239. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-G. Deng, A. J. Montero, and K. K. Wu Interferon-{gamma} Suppresses Cyclooxygenase-2 Promoter Activity by Inhibiting C-Jun and C/EBP{beta} Binding Arterioscler. Thromb. Vasc. Biol., August 1, 2007; 27(8): 1752 - 1759. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Granja, P. Sabina, M. L. Salas, M. Fresno, and Y. Revilla Regulation of Inducible Nitric Oxide Synthase Expression by Viral A238L-Mediated Inhibition of p65/RelA Acetylation and p300 Transactivation. J. Virol., November 1, 2006; 80(21): 10487 - 10496. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Kwon, K. A Kim, S. O. Kim, R. Ha, W. K. Oh, M. S. Kim, H. S. Kim, G. D. Kim, J. W. Kim, M. Jung, et al. NF-{kappa}B inhibition increases chemosensitivity to trichostatin A-induced cell death of Ki-Ras-transformed human prostate epithelial cells Carcinogenesis, November 1, 2006; 27(11): 2258 - 2268. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cao, X. Zhang, J. P. Edwards, and D. M. Mosser NF-{kappa}B1 (p50) Homodimers Differentially Regulate Pro- and Anti-inflammatory Cytokines in Macrophages J. Biol. Chem., September 8, 2006; 281(36): 26041 - 26050. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-G. Deng, S.-T. Tang, H.-P. Tseng, and K. K. Wu Melatonin suppresses macrophage cyclooxygenase-2 and inducible nitric oxide synthase expression by inhibiting p52 acetylation and binding Blood, July 15, 2006; 108(2): 518 - 524. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Rahman and I. M. Adcock Oxidative stress and redox regulation of lung inflammation in COPD. Eur. Respir. J., July 1, 2006; 28(1): 219 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Wang, C.-Y. Ko, L.-C. Chen, W.-L. Wang, and W.-C. Chang Functional role of NF-IL6{beta} and its sumoylation and acetylation modifications in promoter activation of cyclooxygenase 2 gene |