|
Originally published In Press as doi:10.1074/jbc.M207397200 on December 6, 2002
J. Biol. Chem., Vol. 278, Issue 7, 4786-4791, February 14, 2003
Targeted Disruption of the PEPT2 Gene Markedly
Reduces Dipeptide Uptake in Choroid Plexus*
Hong
Shen ,
David E.
Smith §,
Richard F.
Keep¶ ,
Jianming
Xiang¶, and
Frank C.
Brosius III **
From the Department of Pharmaceutical Sciences,
College of Pharmacy, Departments of ¶ Neurosurgery,
Physiology, and ** Internal Medicine, the
University of Michigan, Ann Arbor, Michigan 48109
Received for publication, July 23, 2002, and in revised form, November 25, 2002
 |
ABSTRACT |
The presence of multiple oligopeptide
transporters in brain has generated considerable interest as to their
physiological role in neuropeptide homeostasis, pharmacologic
importance, and potential as a target for drug delivery through the
blood-brain and blood-cerebrospinal fluid barriers. To understand
further the purpose of specific peptide transporters in brain, we have generated PEPT2-deficient mice by targeted gene disruption.
Homozygous PepT2 null mice lacked expression of PEPT2
mRNA and protein in choroid plexus and kidney, tissues in which
PepT2 is normally expressed, whereas heterozygous mice displayed PepT2
expression levels that were intermediate between those of wild-type and
homozygous null animals. Mutant PepT2 null mice were found to be
viable, grew to normal size and weight, and were without obvious kidney or brain abnormalities. Notwithstanding the lack of apparent biological effects, the proton-stimulated uptake of 1.9 µM
glycylsarcosine (a model, hydrolysis-resistant dipeptide) in isolated
choroid plexus was essentially ablated (i.e. residual
activity of 10.9 and 3.9% at 5 and 30 min, respectively). These novel
findings provide strong evidence that, under the experimental
conditions of this study, PEPT2 is the primary member of
the peptide transporter family responsible for dipeptide uptake in
choroid plexus tissue.
 |
INTRODUCTION |
Four mammalian proton-dependent oligopeptide
transporters (POT)1 have been
cloned from a variety of animal species, including rabbit (1, 2), rat
(3-6), human (7, 8), and mouse (9, 10). These transporters
(i.e. PEPT1, PEPT2, PHT1,
and PHT2) are operationally similar in that they are
electrogenic, coupling substrate influx to proton movement down an
inwardly directed electrochemical proton gradient. PEPT1 was
the first one cloned, from a rabbit intestinal cDNA library (1),
and was shown to be of high capacity and low affinity for di- and tripeptides (11, 12). This is the only POT in the intestine and is
responsible for the absorption of small peptides arising from digestion
of dietary proteins. PEPT2 was subsequently cloned from a
human kidney cDNA library (8) and, in contrast to PEPT1, was found to be a low capacity, high affinity transporter (13). Although both PEPT1 and PEPT2 are expressed in
kidney (14, 15), PEPT2 is believed to play a more dominant
role with respect to conservation of peptide-bound amino acids.
PEPT1 and PEPT2 display overlapping, broad
substrate selectivity and have pharmacologic significance in their
ability to facilitate the movement of peptidomimetic drugs
(e.g. -lactam antibiotics, angiotensin-converting enzyme inhibitors, and antiviral nucleoside prodrugs) across biological membranes (11, 12, 16-18).
Two newer members of the POT family were cloned from a rat brain
cDNA library, the peptide/histidine transporters PHT1 (5) and PHT2
(6). These transporters are unique in that they transport both small
peptides and histidine. PHT1 displayed a high affinity for histidine
when expressed in Xenopus oocytes and was expressed strongly
in the brain and eye. In contrast, PHT2 was expressed primarily in the
lymphatic system and detected faintly in the brain. Their homology to
either rat PEPT1 or PEPT2 was weak (less than
25% amino acid identity). Interestingly, a third peptide transporter
was cloned from rat brain but found to be identical to that of rat
kidney PEPT2 (19). Still, the physiological role of POT
members in the brain remains to be determined.
The presence of multiple peptide transporters within the brain has
generated substantial interest regarding their precise anatomical
location, role in neuropeptide homeostasis, pharmacologic potential,
and relative importance. Preliminary studies from our laboratory
indicate that PEPT2, but not PEPT1, is present in
rat choroid plexus epithelial cells in primary culture and that
PEPT2 is functionally active at the apical membrane surface
(20). In addition, our studies in isolated rat choroid plexus suggest that PEPT2 has a major role in the uptake of
5-aminolevulinic acid (21), GlySar (22), and carnosine (23)
(i.e. on the order of 30-60%). However, these results are
far from conclusive. In this regard, targeted disruption of the
PEPT2 gene in mouse would allow one to determine the
significance of this POT relative to others present in brain
(i.e. PHT1 and PHT2 but not PEPT1). The
generation of transgenic PEPT2-deficient mice would also
provide a powerful tool to probe the physiological and pharmacological functions of PEPT2 in other cells types or tissues.
In this study, we have developed heterozygous and homozygous
PEPT2-deficient mice, and we clearly demonstrated that
PEPT2 / mice have impaired uptake of dipeptide in choroid
plexus relative to that observed in wild-type animals. Almost all of
the uptake of GlySar was eliminated in null mice, demonstrating for the
first time that, under the experimental conditions of this study,
PEPT2 is the primary member of the peptide transporter
family responsible for trafficking of peptides/mimetics at the
blood-cerebrospinal fluid (CSF) barrier.
 |
MATERIALS AND METHODS |
Disruption of the PEPT2 Gene in Embryonic Stem (ES)
Cells--
To clone the mouse PEPT2 gene, a partial
complementary DNA probe was prepared by PCR after reverse transcription
of total RNA isolated from mouse kidney. The PCR primer sequences were designed on the basis of homology between human, rat, and rabbit PEPT2 cDNA sequences (2, 4, 8): 5' primer
(ATTGCCTTCATCGTGGTGAATGAATTCTGCGA) and 3' primer
(ACCAAGAA(T/G)ACAAGGCTCTGATGACTTGCTG). The resulting 2065-bp partial cDNA fragment corresponds to the region of the PEPT2 transporter protein extending from the putative first
membrane-spanning domain through the carboxyl terminus.
This probe was used to screen a mouse ES-129/SvJ BAC genomic library
(Genome Systems, St. Louis). Hybridizing BAC clones were isolated,
restriction-mapped, and partially sequenced. To create a targeted
PEPT2 gene with an in-frame lacZ reporter gene
under the control of the endogenous PEPT2 gene promoter, a
3.5-kb EcoRI fragment containing exon 1 was subcloned into
pBluescript KS (Stratagene Inc., La Jolla, CA). Then a 300-bp PCR
fragment (ClaI-KpnI) was generated to create a
novel KpnI site in the translation start codon (ATG) of the
PEPT2 gene. DNA sequence of the PCR fragment was identical
to the original sequence of PEPT2 genomic clone except for
the KpnI site. The 300-bp PCR fragment
(ClaI-KpnI) was utilized as a linker to the
upstream 2.9-kb PEPT2 gene fragment (EcoRI-ClaI). The entire 3.2-kb 5' homologous arm
of PEPT2 gene was then inserted into the
KpnI-NheI sites upstream of the lacZ reporter gene in the pNZTK2 vector (gift of Dr. Richard Palmiter). The
4.4-kb 3' PEPT2 genomic fragment, including exons 4 and 5, was cloned downstream of the Neo cassette in pNZTK2. Thus, genomic sequence from the amino terminus to the second transmembrane domain (5.2-kb fragment) was deleted in the PEPT2 gene targeting vector.
The targeting vector was linearized at a unique AscI site
and then electroporated into 129/SvJ/R1 ES cells (Stem Cell Facility of
the University of Michigan). The stably transfected cells were selected
by culturing in G418 and ganciclovir. Targeted ES cell clones were
identified by the presence of a 3.3-kb PCR product using the PCR
primers indicated by arrows in Fig. 1B (Expand
Long Template PCR System, Roche Molecular Biochemicals). PCR-positive clones were expanded and confirmed by Southern analysis using the 3'
outside probe and 5' inside probe shown in Fig. 1B.
Generation of PEPT2-deficient Mice--
Targeted ES cells were
introduced into C57BL/6 mouse blastocysts. Male chimeras were mated
with C57BL/6 females (the Jackson Laboratory, Bar Harbor, ME) to
identify germ line-competent chimeras capable of transferring the
genetically modified ES cell genome to their offspring. The targeted
PEPT2 allele was detected in offspring of these crosses by
PCR and Southern blot analysis of genomic DNA isolated from tail
biopsies using the 5' probe shown in Fig. 1B. Offspring
carrying the mutant allele were intercrossed to obtain animals that
were homozygous for targeted mutation (PEPT2 / ).
Northern Blot Analysis--
Northern analyses were performed as
described previously (24). Briefly, total RNA was isolated from mouse
kidney using Tri-Reagent (Molecular Research Center, Cincinnati, OH).
The total RNA (25 µg/lane) was then resolved on a 1% agarose
formaldehyde denaturing gel, transferred to a nylon membrane, and
hybridized at high stringency with 32P-labeled oligolabeled
cDNA probes corresponding to various coding regions of
PEPT2.
Reverse Transcription-PCR Analysis--
Total RNA was isolated
from mouse choroid plexus with Tri-Reagent (Molecular Research Center,
Cincinnati, OH) according to the manufacturer's protocol. RNA was
reverse-transcribed as described previously (14) using oligo(dT) as a
primer. PCR was performed with the PEPT2 primers (Fig.
1A): 5' primer, ATTGCCTTCATCGTGGTGAATGAATTCTGCGA-3'; 3' primer, ACCAAGAA(T/G)ACAAGGCTCTGATGACTTGCTG-3'); and
-actin control primers, 5' primer, AACCGCGAGAAGATGACCCAGATCATGTTT,
and 3' primer, AGCAGCCGTGGCCATCTCTTGCTCGAAGTC.
PCR was initiated at 94 °C for 3 min, followed by 35 cycles
(denaturation at 94 °C for 30 s, annealing at 55 °C for
30 s, and extension at 72 °C for 60 s), and terminated by
a final extension of 7-min duration.
Membrane Preparation and Immunoblot Analysis--
Apical
membrane vesicles were prepared from the kidneys of
PEPT2+/+, PEPT2+/ , and PEPT2 /
mice, as described previously for rabbit renal apical membrane vesicles
(25, 26). The membrane proteins were resolved on 7.5% SDS-PAGE,
transferred to a nitrocellulose membrane, and blotted with a rabbit
polyclonal anti-PEPT2 antibody raised against a purified
PEPT2 GST fusion protein, as described previously (15).
Oligopeptide Uptake Assay--
Whole tissue choroid plexus
uptake studies were performed in 30-50-day-old-mice, as described
previously in rats for 5-aminolevulinic acid (21) and GlySar (22).
Lateral ventricle and fourth ventricle choroid plexuses were harvested
from anesthetized mice, weighed, and transferred to bicarbonate
artificial cerebrospinal fluid buffer (127 mM NaCl, 20 mM NaHCO3, 2.4 mM KCl, 0.5 mM KH2PO4, 1.1 mM
CaCl2, 0.85 mM MgCl2, 0.5 mM Na2SO4, and 5 mM
glucose (pH 7.4)) which was continuously bubbled with 5%
CO2, 95% O2. After 5 min of recovery, the
choroid plexuses were transferred to 0.95 ml of Tris-MES buffer (147 mM NaCl, 2.4 mM KCl, 0.5 mM
KH2PO4, 1.1 mM CaCl2,
0.85 mM MgCl2, 0.5 mM
Na2SO4, 5.0 mM glucose, and 10 mM Tris, and/or MES (pH 6.5)) and continuously bubbled with 100% O2 for 0.5 min. Transport was initiated by addition
of 0.05 ml of Tris-MES buffer which contained ~0.2 µCi of
[14C]GlySar and 0.2 µCi of [3H]mannitol
(an extracellular marker), resulting in a final GlySar concentration of
1.9 µM. Transport was terminated after 5 or 30 min by
transferring the plexuses to ice-cold buffer and filtering under
reduced pressure. The filters (118-µm mesh, Tetko, Kansas City, MO)
were washed three times with the same buffer. The filters and choroid
plexuses were then soaked in 0.33 ml of 1 M hyamine hydroxide (a tissue solubilizer) for 30 min before the addition of
scintillation mixture (Cytoscint) and counting with a dual-channel liquid scintillation counter (Beckman LS 3801; Fullerton, CA).
Statistical Analysis--
Data are expressed as the mean ± S.E. of four experiments, unless otherwise noted. Each experiment
consisted of choroid plexuses (i.e. lateral and fourth)
pooled from two animals. Statistical comparisons were made between
litter-mate wild-type (Pept2+/+) and homozygous transgenic
mice (Pept2 / ) at each time point (i.e. 5 and
30 min) using a two-sample t test. A p value
of 0.05 was considered significant.
 |
RESULTS |
Targeted Disruption of the Pept2 Gene--
The Pept2
gene spanned ~33 kb as reported previously by Rubio-Aliaga et
al. (10) and was totally contained within the BAC construct
22021 (Fig.
1A). To
inactivate the Pept2 gene, we constructed a targeting vector
in which the 3.2 kb of 5' promoter/enhancer and untranslated sequence
and 4.4 kb of sequence encoding part of intron 3, exons 4 and 5, intron
4, and part of intron 5 of the murine Pept2 gene were cloned
into the appropriate sites of pNZTK2 (Fig. 1B). A LacZ
construct was inserted immediately 3' to the Pept2
promoter/enhancer region. The targeted construct was used to disrupt
the Pept2 gene in 129/SvJ/R1 ES cells (Fig. 1, C
and D). The resulting disrupted gene lacked the sequence that encoded the first 112 amino acids of the PEPT2
polypeptide. Germ line transmission of the targeted gene resulted in
mice heterozygous for the disrupted Pept2 gene on a mixed
background of C57BL/6 and 129/SvJ/R1. The heterozygote animals were
mated to produce Pept2 null animals (Fig. 1E). Of
the initial 182 pups born, 44, 100, and 38 animals had
Pept2 / , Pept2+/ , and Pept2+/+
genotypes, respectively (i.e. a ratio of 24:55:21%).
Average litter size was 10 pups, with normal gender distribution.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 1.
Targeted disruption of the PEPT2
gene. A, partial restriction map of the murine
Pept2 gene (top), the relation to the cDNA
probe used to clone the gene (mid), and PEPT2
proteins domains. All HindIII (H) and
XbaI (X) restriction sites and the primers used
in the RT-PCR analyses are indicated. B, targeting of
Pept2 by homologous recombination. The top line
represents the normal Pept2 allele, the middle
line the pPNZTK2-PEPT2 targeting vector, and the bottom
line the targeted allele. Arrowheads denote sites for
PCR primers used for ES cell screening analysis. The locations of the
probes used in Southern blot analysis are indicated. The outside probe
(out. probe) was a 0.9-kb fragment external to the targeting
vector. The inside probe (in. probe) was a 1.4-kb fragment.
C, Southern blot analysis of targeted ES cell clones.
Genomic DNA (15 µg) derived from untransfected ES cells (R1 wt+/+) or
from targeted clones (+/ ) was digested with SalI
(S) and NcoI (N), blotted, and
hybridized with the outside probe. The sizes of genomic DNA fragments
expected from the normal and disrupted alleles are shown in
B. D, Southern blot analysis of targeted ES cell
clones was performed as described for C but was hybridized
with the inside probe. E, genotyping of 3-week-old offspring
from Pept2+/ × Pept2+/ matings by Southern
blot analysis. The inside probe cDNA was hybridized to
NcoI-restricted tail genomic DNA. Wild-type (+/+) and
heterozygous (+/ ) animals exhibited a 6.5-kb band that is absent in
null ( / ) mutant mice. Disruption of the Pept2 allele
produced a 4.7-kb band.
|
|
PEPT2 Expression Levels--
Northern blot analysis demonstrated
that PEPT2 mRNA expression was absent in the kidneys
from Pept2 / mice and that expression in the
Pept2+/ mice was ~50% of the levels found in
Pept2+/+ mice (Fig.
2A). Similarly, RT-PCR
analysis showed no detectable PEPT2 mRNA in choroid
plexus from Pept2 / mice (Fig. 2B).
Immunoblots showed complete absence of immunoreactive PEPT2
in kidney brush border vesicle preparations from Pept2 /
animals. Protein levels in renal apical membranes of
Pept2+/ mice were ~50% of that found in
Pept2+/+ animals (Fig. 2C). The amount of protein
obtained from the mouse choroid plexus was too small to evaluate by
immunoblotting.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 2.
PEPT2 gene expression.
A, Northern blot analysis of total RNA from kidney of
Pept2+/+, Pept2+/ , and Pept2 /
mice. Total RNA (25 µg) was blotted onto a nylon membrane and
hybridized sequentially with 32P-labeled mouse
PEPT2 (upper panel) and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
(lower panel) cDNA probes. B, RT-PCR of total
choroid plexus RNA from Pept2+/+, Pept2+/ , and
Pept2 / mice. Total RNA (2 µg) was reverse-transcribed
and PCR-amplified. An aliquot of each PCR product was electrophoresed
on 1% agarose gels and visualized with ethidium bromide. C,
immunoblot analysis of kidney apical membrane vesicles from
Pept2+/+, Pept2+/ , and Pept2 /
mice and a Sprague-Dawley rat. Apical membrane vesicles were pooled
from five 8-week-old mice kidneys (100 µg) or made from a single rat
kidney (10 µg), subjected to SDS-PAGE, transferred to nitrocellulose,
and the blots incubated with a rabbit polyclonal anti-rat
PEPT2 antibody. Molecular mass standards are
indicated.
|
|
PEPT1 Expression Levels--
PEPT1 is an oligopeptide transporter
with ~50% homology to PEPT2. PEPT1 is
expressed in kidney along the apical membrane of epithelia in the
proximal portion of the proximal tubule, whereas PEPT2 is
expressed in the more distal portion of the proximal tubule (15). We
investigated whether there was any compensatory up-regulation of the
Pept1 gene in Pept2 / animals. Immunoblotting showed only a minor increase in PEPT1 expression between
Pept2 / and Pept+/+ animals (Fig.
3).

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 3.
PEPT1 expression in kidney.
PEPT1 immunoblots of kidney apical membrane vesicles were
performed as in Fig. 2C except that a rabbit polyclonal
anti-rat PEPT1 antibody was utilized.
|
|
Initial Phenotypic Analysis--
Pept2 / mice appeared normal
and grew to normal adult weight (Table
I). Base-line blood and urine chemistries
were comparable with those from Pept2+/+ animals (Table I).
There was no obvious behavioral or neurological phenotype. Gross and
light microscopic morphology of the kidneys and choroid plexus appeared
normal. Choroid plexus weights did not vary between
Pept2 / and Pept+/+ mice.
View this table:
[in this window]
[in a new window]
|
Table I
Base-line characteristics of PEPT2+/+, PEPT2+/ , and
PEPT / mice
Results are means ± S.E. (n = number of mice
analyzed).
|
|
Dipeptide Uptake in Choroid Plexus from PEPT2 / and PEPT2+/+
Animals--
Based on functional studies of GlySar uptake in rat
choroid plexus whole tissue (22), phenotypic analyses were performed at
either 5 or 30 min to approximate linear and plateau conditions, respectively. As also shown in the previous study, a Tris-MES buffer
(pH 6.5) is optimal to probe the proton-dependent uptake mechanisms of relevant oligopeptide transporters. As shown in Fig.
4, virtually all of the uptake of GlySar
in choroid plexus tissue was eliminated in Pept2 / mice.
In this regard, only 10.9 and 3.9% of the residual activity was still
present at 5 and 30 min, respectively (p < 0.001 for
both analyses).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 4.
Oligopeptide uptake. Uptake of 1.9 µM [14C]GlySar was performed for 5 and 30 min in choroid plexuses pooled from Pept2+/+ and
Pept2 / mice. Uptakes were performed on four different
pools (n = 4). * p < 0.001 versus PepT2 +/+ uptake.
|
|
 |
DISCUSSION |
Cellular, molecular, and physiological studies have made major
contributions toward our understanding of transport phenomena and the
role of membrane transporters. However, these experimental approaches
are often limited by their in vitro design and lack of blood
supply, overlapping substrate specificities, and contribution of
multiple transport systems, some of which are unknown at the time of
study. As a result, it is difficult, if not impossible, to define the
function of a single specific protein and its significance in relation
to other possible proteins that are present in the tissue or organ of
interest. Such is the situation in brain in which multiple oligopeptide
transporters are present (e.g. PEPT2, PHT1, and PHT2).
A detailed description of PEPT2 mRNA distribution in the
rat nervous system was first reported by Berger and Hediger (27). By
using nonisotopic in situ hybridization techniques, they
found that PEPT2 was expressed in brain by astrocytes,
subependymal cells, ependymal cells, and epithelial cells of choroid
plexus. In a subsequent study using immunoblot analyses and
immunofluorescent confocal microscopy, Shu et al. (20)
demonstrated that PEPT2, but not PEPT1, protein
was present in the apical membrane of rat choroid plexus epithelial
cells. They also observed that GlySar accumulation and transepithelial
transport were 3 to 4 times higher when introduced from the apical as
opposed to the basal side of the cell monolayers. This study and other
studies from our laboratory (21-23) suggest that PEPT2 may
have a role in the efflux of neuropeptides, peptide fragments, and
peptidomimetics from cerebrospinal fluid to the blood. Based on whole
tissue studies, in the presence and absence of sodium, it has been
estimated that PEPT2-mediated transport may account for
about 30-60% of the total transport processes in rat choroid plexus.
However, this estimate is far from certain because PHT1 (5) and PHT2
(6) transcripts have been reported in the brain, with PHT1 being
especially abundant in the hippocampus, choroid plexus, cerebellum, and
pontine nucleus. Moreover, it is unknown if other as yet unidentified
peptide transporters are expressed and functionally active in brain.
Thus, a transgenic PEPT2-deficient model would be a valuable
tool in delineating the role and relative importance of this specific
transporter at the blood-CSF interface.
In the present study, a PEPT2-deficient mouse model was
successfully generated by targeted gene disruption in embryonic stem cells. The Southern analyses confirm that this novel mutant mouse strain does not produce the gene for PEPT2. Moreover, RT-PCR
analyses confirm that PEPT2 transcripts are absent from the
choroid plexus, kidney, and brain of null mice, while being retained in
wild-type and to a lesser extent in PEPT2+/ mice. As
expected, the low affinity peptide transporter, PEPT1, was
retained in kidney. Surprisingly, PEPT2 null mice were
viable and grew at a normal rate. There were no obvious biochemical
changes nor morphologic abnormalities in the kidneys and choroid plexus
of PEPT2 / animals. Despite the large number of possible
di- and tripeptide substrates in brain, and the putative physiological
role of PEPT2 as an efflux pump for neuropeptides (and/or
fragments), no apparent pathologies were observed. Nevertheless,
dipeptide uptake studies in isolated rat choroid plexus revealed a
markedly dysfunctional process. As clearly demonstrated, the transport
activity of GlySar in PEPT2 / mice was essentially
ablated, with less than 10% residual function on average.
Several factors may explain the 10% residual activity for dipeptide
uptake in PEPT2 null mice. Most notably, the activity may
reflect the presence of a low affinity carrier. This possibility is
consistent with the study of Shu et al. (20), in which a pH-independent, low affinity transporter (i.e. Km of 1.4 mM for GlySar) was observed at the basolateral membrane
of rat choroid plexus epithelial cells in primary culture. Although the
molecular properties of this protein were not delineated, the
basolateral carrier was distinct from that of PEPT1 and PEPT2 and was
involved in the coordinated efflux of GlySar across the cell
monolayers. We subsequently performed a temperature-dependent study in null mice and found that 1.9 µM GlySar uptake
was reduced at 5 min (0.111 ± 0.013 µl/mg at 37 °C
versus 0.069 ± 0.007 µl/mg at 4 °C;
p < 0.05). Thus, there is some
temperature-dependent uptake in the choroid plexus of null
mice, but it is small (0.042 µl/mg in Pept2 / compared
with a total uptake of 1.02 ± 0.05 µl/mg in Pept2+/+
at 37 °C). Whether or not this process reflects the basolateral low
affinity transporter is unclear. Some of the residual activity might
also be explained by other factors. Integrity of the radiolabel was
considered, but GlySar had a radiochemical purity of 98-99%. This
dipeptide has also been shown to be stable in rat choroid plexus (20,
22). Although tissue binding might occur, this effect would be minimal,
at best, based on our GlySar uptake time profiles in whole tissue rat
choroid plexus (22). Finally, a nonspecific,
non-temperature-dependent process (i.e. diffusion) may be operational to a minor extent in the absence of PEPT2 protein.
Brain homeostasis depends upon the composition of both brain
interstitial fluid and cerebrospinal fluid (28-30). Whereas the former
is largely controlled by the blood-brain barrier, the latter is
regulated by a highly specialized blood-CSF interface, the choroid
plexus epithelium. Similar to other epithelia, the choroid plexus is
polar with distinct brush border (CSF-facing) and basolateral (blood-facing) surfaces. The polarity of the cell has distinct characteristics, and in particular, transporters are uniquely distributed among the two membrane surfaces. More recent studies (31,
32) have shown that choroid plexuses participate in a variety of
functions in addition to their traditional roles of controlling the
volume and ionic composition of cerebrospinal fluid. In this regard,
they have specialized transport systems that allow blood to brain
influx of micronutrients or brain to blood efflux of harmful
neurotransmitter metabolites. The choroidal epithelium is also a source
of and a target for hormones and other neuroactive or neuromodulating
compounds. Moreover, the presence of drug-metabolizing enzymes in the
cerebral capillaries, choroidal epithelium, and nervous tissue suggests
a concerted mechanism of brain protection by which substrates are
inactivated and then cleared from the cerebrospinal fluid (28, 33).
Peptide transporters may, therefore, serve a nutritive function (as in
the intestine and kidney) by supplying small peptides from the blood
circulation to choroid plexus tissue and cerebrospinal fluid.
Alternatively, they may serve as a clearance mechanism to remove
unwanted neuropeptides (and peptide fragments) from the CSF. Finally,
they may also affect the disposition of peptidomimetic drugs and toxic
agents in the CSF and brain.
The lack of an observable pathological phenotype in PEPT2
null mice suggests that other transporter and/or metabolic systems can
compensate for this loss of function. It may also mean that PEPT2 plays an insignificant role in the disposition of
neuropeptides (and/or fragments) in choroid plexus and that its main
role is in protecting the organism from toxic xenobiotics. This last
scenario is analogous to P-glycoprotein-deficient mdr1a( / ) mice in
which no obvious phenotypic abnormalities were observed other than
hypersensitivity to drugs (34). In this case, nearly all of the
mdr1( / ) mice died by a chance encounter with the anthelmintic
pesticide ivermectin. Although the role of PEPT2 in choroid
plexus has not been conclusively determined, our initial findings in
PEPT2-deficient mice have important implications. Thus, as
PEPT2 appears to mediate the efflux of peptides and
peptidomimetics from cerebrospinal fluid (20), improved central nervous
system delivery of therapeutic agents may be achieved by specific
blocking agents or by designing therapeutic agents with limited
PEPT2 affinity.
In conclusion, results from this study provide strong evidence that,
under the experimental conditions of this study, PEPT2 is
the primary member of the POT family responsible for dipeptide uptake
in brain choroid plexus tissue. As a result, these findings may have
significant implications in the design, delivery, and targeting of
peptidomimetic drugs for the treatment of central nervous system
disorders. Although PEPT2 null mice were without obvious
visible abnormalities, further testing for biological phenotypes is
being performed. Notwithstanding this surprising lack of physiological
and/or pathological change, the development of transgenic
PEPT2-deficient mice provides a unique opportunity for
probing its in vivo role and relative importance in the
brain, kidney, and other tissues of interest.
 |
FOOTNOTES |
*
This work was supported in part by Grants R01 GM035498 (to
D. E. S.), R01 NS034709, and P01 HL018575 (to R. F. K.) from the National Institutes of Health and by an Upjohn Research Award from the
University of Michigan College of Pharmacy.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: 4302A Upjohn Center,
1310 E. Catherine St., the University of Michigan, Ann Arbor, MI
48109-0504. Tel.: 734-647-1431; Fax: 734-763-3438; E-mail: smithb@umich.edu.
Published, JBC Papers in Press, December 6, 2002, DOI 10.1074/jbc.M207397200
 |
ABBREVIATIONS |
The abbreviations used are:
POT, proton-dependent oligopeptide transporter;
CSF, cerebrospinal fluid;
GlySar, glycylsarcosine;
MES, 2-(N-morpholino)ethanesulfonic acid;
RT, reverse
transcription;
ES, embryonic stem.
 |
REFERENCES |
| 1.
|
Fei, Y.-J.,
Kanai, Y.,
Nussberger, S.,
Ganapathy, V.,
Leibach, F. H.,
Romero, M. F.,
Singh, S. K.,
Boron, W. F.,
and Hediger, M. A.
(1994)
Nature
368,
563-566[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Boll, M.,
Herget, M.,
Wagener, M.,
Weber, W. M.,
Markovich, D.,
Biber, J.,
Clauss, W.,
Murer, H.,
and Daniel, H.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
284-289[Abstract/Free Full Text]
|
| 3.
|
Saito, H.,
Okuda, M.,
Terada, T.,
Sasaki, S.,
and Inui, K.
(1995)
J. Pharmacol. Exp. Ther.
275,
1631-1637[Abstract/Free Full Text]
|
| 4.
|
Saito, H.,
Terada, T.,
Okuda, M.,
Sasaki, S.,
and Inui, K.
(1996)
Biochim. Biophys. Acta
1280,
173-177[Medline]
[Order article via Infotrieve]
|
| 5.
|
Yamashita, T.,
Shimada, S.,
Guo, W.,
Sato, K.,
Kohmura, E.,
Hayakawa, T.,
Takagi, T.,
and Tohyama, M.
(1997)
J. Biol. Chem.
272,
10205-10211[Abstract/Free Full Text]
|
| 6.
|
Sakata, K.,
Yamashita, T.,
Maeda, M.,
Moriyama, Y.,
and Shimada, S.
(2001)
Biochem. J.
356,
53-60[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Liang, R.,
Fei, Y.-J.,
Prasad, P. D.,
Ramamoorthy, S.,
Han, H.,
Yang-Feng, T. L.,
Hediger, M. A.,
Ganapathy, V.,
and Leibach, F. H.
(1995)
J. Biol. Chem.
270,
6456-6463[Abstract/Free Full Text]
|
| 8.
|
Liu, W.,
Liang, R.,
Ramamoorthy, S.,
Fei, Y.-J.,
Ganapathy, M. E.,
Hediger, M. A.,
Ganapathy, V.,
and Leibach, F. H.
(1995)
Biochim. Biophys. Acta
1235,
461-466[Medline]
[Order article via Infotrieve]
|
| 9.
|
Fei, Y.-J.,
Sugawara, M.,
Liu, J. C., Li, H. W.,
Ganapathy, V.,
Ganapathy, M. E.,
and Leibach, F. H.
(2000)
Biochim. Biophys. Acta
1492,
145-154[Medline]
[Order article via Infotrieve]
|
| 10.
|
Rubio-Aliaga, I.,
Boll, M.,
and Daniel, H.
(2000)
Biochem. Biophys. Res. Commun.
276,
734-741[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Leibach, F. H.,
and Ganapathy, V.
(1996)
Annu. Rev. Nutr.
16,
99-119[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Daniel, H.
(1996)
J. Membr. Biol.
154,
197-203[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Daniel, H.,
and Herget, M.
(1997)
Am. J. Physiol.
273,
F1-F8[Abstract/Free Full Text]
|
| 14.
|
Smith, D. E.,
Pavlova, A.,
Berger, U. V.,
Hediger, M. A.,
Yang, T.,
Huang, Y. G.,
and Schnermann, J. B.
(1998)
Pharm. Res. (N. Y.)
15,
1244-1249
|
| 15.
|
Shen, H.,
Smith, D. E.,
Yang, T.,
Huang, Y. G.,
Schnermann, J. B.,
and Brosius, F. C., III
(1999)
Am. J. Physiol.
276,
F658-F665[Abstract/Free Full Text]
|
| 16.
|
Zhu, T.,
Chen, X.-Z.,
Steel, A.,
Hediger, M. A.,
and Smith, D. E.
(2000)
Pharm. Res. (N. Y.)
17,
526-532
|
| 17.
|
Ganapathy, M. E.,
Huang, W.,
Wang, H.,
Ganapathy, V.,
and Leibach, F. H.
(1998)
Biochem. Biophys. Res. Commun.
246,
470-475[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Sugawara, M.,
Huang, W.,
Fei, Y.-J.,
Leibach, F. H.,
Ganapathy, V.,
and Ganapathy, M. E.
(2000)
J. Pharm. Sci.
89,
781-789[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Wang, H.,
Fei, Y.-J.,
Ganapathy, V.,
and Leibach, F. H.
(1998)
Am. J. Physiol.
275,
C967-C975[Abstract/Free Full Text]
|
| 20.
|
Shu, C.,
Shen, H.,
Teuscher, N. S.,
Lorenzi, P. J.,
Keep, R. F.,
and Smith, D. E.
(2002)
J. Pharmacol. Exp. Ther.
301,
820-829[Abstract/Free Full Text]
|
| 21.
|
Novotny, A.,
Xiang, J.,
Stummer, W.,
Teuscher, N. S.,
Smith, D. E.,
and Keep, R. F.
(2000)
J. Neurochem.
75,
321-328[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Teuscher, N. S.,
Novotny, A.,
Keep, R. F.,
and Smith, D. E.
(2000)
J. Pharmacol. Exp. Ther.
294,
494-499[Abstract/Free Full Text]
|
| 23.
|
Teuscher, N. S.,
Keep, R. F.,
and Smith, D. E.
(2001)
Pharm. Res. (N. Y.)
18,
807-813
|
| 24.
|
Shen, H.,
Smith, D. E.,
and Brosius, F. C., III
(2001)
Pediatr. Res.
49,
789-795[Medline]
[Order article via Infotrieve]
|
| 25.
|
Akarawut, W.,
Lin, C.-J.,
and Smith, D. E.
(1998)
J. Pharmacol. Exp. Ther.
287,
684-690[Abstract/Free Full Text]
|
| 26.
|
Lin, C.-J.,
Akarawut, W.,
and Smith, D. E.
(1999)
Pharm. Res. (N. Y.)
16,
609-615
|
| 27.
|
Berger, U. V.,
and Hediger, M. A.
(1999)
Anat. Embryol.
199,
439-449[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Strazielle, N.,
and Ghersi-Egea, J.-F.
(1999)
J. Neurosci.
19,
6275-6289[Abstract/Free Full Text]
|
| 29.
|
Hakvoort, A.,
Haselbach, M.,
Wegener, J.,
Hoheisel, D.,
and Galla, H. J.
(1998)
J. Neurochem.
71,
1141-1150[Medline]
[Order article via Infotrieve]
|
| 30.
|
Laterra, J.,
Keep, R.,
Betz, L.,
and Goldstein, G. W.
(1999)
in
Basic Neurochemistry: Molecular, Cellular and Medical Aspects
(Siegel, G. J.
, Agranoff, B. W.
, Albers, R. W.
, Fisher, S. K.
, and Uhler, M. D., eds)
, pp. 671-689, Lippincott-Raven Publishers, Philadelphia
|
| 31.
|
Johanson, C. E.
(1995)
in
Neuroscience in Medicine
(Conn, P. M., ed)
, pp. 171-196, J. B. Lippincott Co., Philadelphia
|
| 32.
|
Johanson, C. E.
(1999)
in
Encyclopedia of Neuroscience
(Adelman, G.
, and Smith, B. H., eds), Vol. 1
, pp. 384-397, Elsevier Science Publishing Co., Inc., New York
|
| 33.
|
Ghersi-Egea, J. F.,
Leininger-Muller, B.,
Cecchelli, R.,
and Fenstermacher, J. D.
(1995)
Toxicol. Lett.
82/83,
645-653
|
| 34.
|
Schinkel, A. H.
(1997)
Semin. Cancer Biol.
8,
161-170[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. A. Kamal, H. Jiang, Y. Hu, Richard. F. Keep, and D. E. Smith
Influence of genetic knockout of Pept2 on the in vivo disposition of endogenous and exogenous carnosine in wild-type and Pept2 null mice
Am J Physiol Regulatory Integrative Comp Physiol,
April 1, 2009;
296(4):
R986 - R991.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. D. Klaassen and H. Lu
Xenobiotic Transporters: Ascribing Function from Gene Knockout and Mutation Studies
Toxicol. Sci.,
February 1, 2008;
101(2):
186 - 196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Shen, S. M. Ocheltree, Y. Hu, R. F. Keep, and D. E. Smith
Impact of Genetic Knockout of PEPT2 on Cefadroxil Pharmacokinetics, Renal Tubular Reabsorption, and Brain Penetration in Mice
Drug Metab. Dispos.,
July 1, 2007;
35(7):
1209 - 1216.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Mitsuoka, Y. Kato, Y. Kubo, and A. Tsuji
Functional Expression of Stereoselective Metabolism of Cephalexin by Exogenous Transfection of Oligopeptide Transporter PEPT1
Drug Metab. Dispos.,
March 1, 2007;
35(3):
356 - 362.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. M. Frey, I. Rubio-Aliaga, A. Siewert, D. Sailer, A. Drobyshev, J. Beckers, M. H. de Angelis, J. Aubert, A. B. Hen, O. Fiehn, et al.
Profiling at mRNA, protein, and metabolite levels reveals alterations in renal amino acid handling and glutathione metabolism in kidney tissue of Pept2-/- mice
Physiol Genomics,
February 12, 2007;
28(3):
301 - 310.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Daniel, B. Spanier, G. Kottra, and D. Weitz
From Bacteria to Man: Archaic Proton-Dependent Peptide Transporters at Work
Physiology,
April 1, 2006;
21(2):
93 - 102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Romano, G. Kottra, A. Barca, N. Tiso, M. Maffia, F. Argenton, H. Daniel, C. Storelli, and T. Verri
High-affinity peptide transporter PEPT2 (SLC15A2) of the zebrafish Danio rerio: functional properties, genomic organization, and expression analysis
Physiol Genomics,
February 23, 2006;
24(3):
207 - 217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Shen, R. F. Keep, Y. Hu, and D. E. Smith
PEPT2 (Slc15a2)-Mediated Unidirectional Transport of Cefadroxil from Cerebrospinal Fluid into Choroid Plexus
J. Pharmacol. Exp. Ther.,
December 1, 2005;
315(3):
1101 - 1108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Ocheltree, H. Shen, Y. Hu, R. F. Keep, and D. E. Smith
Role and Relevance of Peptide Transporter 2 (PEPT2) in the Kidney and Choroid Plexus: In Vivo Studies with Glycylsarcosine in Wild-Type and PEPT2 Knockout Mice
J. Pharmacol. Exp. Ther.,
October 1, 2005;
315(1):
240 - 247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Groneberg, A. Fischer, K. F. Chung, and H. Daniel
Molecular Mechanisms of Pulmonary Peptidomimetic Drug and Peptide Transport
Am. J. Respir. Cell Mol. Biol.,
March 1, 2004;
30(3):
251 - 260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Ocheltree, H. Shen, Y. Hu, J. Xiang, R. F. Keep, and D. E. Smith
Mechanisms of Cefadroxil Uptake in the Choroid Plexus: Studies in Wild-Type and PEPT2 Knockout Mice
J. Pharmacol. Exp. Ther.,
February 1, 2004;
308(2):
462 - 467.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|