![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 7, 4906-4911, February 14, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
29 Early Protein p17
,From the Centro de Biologia Molecular "Severo Ochoa" (CSIC-UAM), Universidad Autonoma, Canto Blanco, 28049 Madrid, Spain
Received for publication, October 8, 2002, and in revised form, December 11, 2002
| |
ABSTRACT |
|---|
|
|
|---|
Gene 17 of the Bacillus
subtilis phage Processes like DNA replication, transcription, compaction, or
recombination occur in all organisms, and all of them have to be
regulated and coordinated in order to obtain biological activity. Factors involved in these regulations are found in both eukaryotes and
prokaryotes. In eukaryotes there are proteins like HMG-1 (renamed HMGB1) and HMG-2 that enhance the DNA binding of a variety of proteins
(1-4). In prokaryotes, there are histone-like proteins that can
function in global regulation, acting as transcriptional modulators in
multiprotein complexes with DNA. For example, H-NS influences
transcription of a number of genes involved in diverse biological
processes (5-9). Another histone-like protein, HU, has been shown to
stimulate the action of different DNA-binding proteins (10-12), to
repress promoters together with other proteins forming high order
multiprotein complex (13), to participate in the initiation of DNA
replication assisting other replication proteins (14), or to be
involved in post-transcriptional regulation (15). Generally, regulation
requires homo- and/or hetero-protein-protein interactions, and
different domains involved in these associations have been described:
coiled-coiled (16), the RING-B box coiled-coil, renamed recently TRIM
(17), EHV1 motif (18), or the Eps15 homology domain (19).
Bacillus subtilis phage
29 is expressed early after infection, and it
has been shown to be required at the very beginning of phage
replication under conditions of low but not high multiplicity of
infection. It has been proposed that, at the beginning of the
infection, protein p17 could be recruiting limiting amounts of
initiation factors at the viral origins. Once the infection process is
established and the replication proteins reach optimal concentration,
protein p17 becomes dispensable. In this paper we focused, on the one
hand, on the study of protein p17 dimerization and the role of a
putative coiled-coil region. On the other hand, we focused on its
interaction with the viral origin-binding protein p6. Based on our
results we propose that protein p17 function is to optimize binding of
protein p6 at the viral DNA ends, thus favoring the initiation of
replication and negatively modulating its own transcription.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
29 has a linear double-stranded
DNA with a terminal protein
(TP)1 covalently linked to
the 5' ends.
29 DNA replication starts by recognition of the origins
of replication, i.e. the TP-containing DNA ends, by a TP/DNA
polymerase heterodimer (20). Protein p6 is a viral nonspecific
DNA-binding protein that is involved in different DNA processes forming
a nucleoprotein complex that plays an essential role in the initiation
of
29 DNA replication activating the replication origins (21, 22).
This complex has been shown to cover most of the
29 genome,
suggesting that p6 may also have a structural role in organizing the
genome (23). Also, it has been demonstrated that protein p6 is involved
in regulating the viral transcription; binding of protein p6 to the
right genomic end represses transcription from the early C2
promoter (see Fig. 1) (24-26). In
addition, it cooperates with the regulatory viral protein p4 in the
switch from early to late transcription (27, 28); as a result, the A2b
and A2c early promoters are repressed, and the late A3 promoter is
activated. Thus, proteins like p4 or p6 help to coordinate and regulate
the main viral processes. On the other hand, under conditions of
limiting amounts of the viral DNA and replication proteins (DNA
polymerase, TP, single-stranded DNA-binding protein, and protein p6),
in vitro
29 DNA amplification is stimulated by the
presence of the gene 17 product, protein p17 (29).

View larger version (13K):
[in a new window]
Fig. 1.
Genetic and transcriptional map of
29. The promoters are shown, and the
directions of transcription are indicated by filled arrows.
Genes are indicated by numbers above the map.
Gene 17, located at the right end of the
29 DNA molecule
(30), encodes a 19-kDa protein involved in the in vivo viral
DNA replication. In fact, when a B. subtilis non-suppressor
strain (su
) was infected with the
29 mutant
sus17 (112), a reduced phage yield and viral DNA synthesis
were observed (30-32). Moreover, when the infection was in solid
medium,
29 mutant sus17 (112) showed a "leaky"
phenotype, characterized by the late appearance of very tiny lysis
plaques, suggesting that protein p17 can be partially dispensable (33).
We have shown that gene 17 is dispensable under conditions
of high m.o.i., but it is indispensable at low m.o.i., which are
probably the natural conditions for infection (29).
The C2 promoter controls protein p17 transcription and is strongly inhibited by the viral histone-like protein p6, both in vivo and in vitro (24-26). This fact is probably because of the formation of a p6-DNA nucleoprotein complex at the right end of the viral genome (34). Thus, protein p17 is synthesized very early after infection, and its synthesis declines later on due to the inhibition of the C2 promoter by protein p6.
At late times after
29 infection, the number of copies of protein p6
in B. subtilis cells has been calculated to be enough to
cover the entire viral DNA progeny (35). The self-association ability
of protein p6 was studied by analytical ultracentrifugation at the
in vivo protein p6 concentration. Protein p6 shows a
monomer-dimer equilibrium that shifts to higher order association at
the highest concentrations. These oligomeric structures have been
proposed to act as a scaffold for the DNA into the appropriate
configuration (36).
We were interested in analyzing the role of p17 at early infection times, when protein p6 is still limiting in the host cell. In these conditions, protein p17 seems to be required for viral DNA replication (29). To understand further the function of protein p17, we studied its capacity to self-interact and to bind to the viral DNA-binding protein p6 under conditions that can parallel those of the beginning of infection: limiting amount of protein p6 and high amount of protein p17.
In this paper we show that protein p17 self-associates both in
vivo and in vitro, independently from other viral or
host factors. Protein prediction suggests the existence of a 28-amino
acid-long coiled-coil region, possibly involved in in vivo
self-association. We also show that protein p17 interacts with the
viral protein p6, facilitating the binding of protein p6 to the
29
DNA ends, thus probably favoring the initiation of replication and
negatively modulating its own transcription.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Materials--
GGH cross-linking agent was purchased from Sigma,
and DSS was from Pierce. Pre-stained high molecular weight protein
markers were from Invitrogen. IPTG and ampicillin were from Sigma.
Restriction enzymes HindIII, EcoRV, and
BamHI, T4 ligase, Vent polymerase, and DNase I were from New
England Biolabs; oligonucleotides were from Genset SA; dNTPs,
[
-32P]dATP (3000 Ci/mmol), and
[
-32P]ATP (3000 Ci/mmol) were from Amersham Biosciences.
Bacteriophage and Bacteria--
The wt
29 bacteriophage was
obtained as described (31, 37). B. subtilis 110NA
(try
, spoA
,
su
) was used as a host (31).
In Vivo Protein p17 Cross-linking--
B. subtilis
110NA cells were grown at 30 °C in LB medium to an
A560 of 0.4 and infected with wt
29 at m.o.i.
5 as described (29). Infected cells were harvested 30 min after
infection, washed once with 50 mM Hepes, pH 8.0, and
concentrated 20-fold in the permeabilization buffer (50 mM
Hepes, pH 8.0, 10 mM EDTA, pH 8.0, 20% sucrose).
Cross-linking reaction was carried out in 100 µl with DSS at the
indicated concentration, incubated for 20 min at room temperature, and
quenched with 50 mM Tris-HCl, pH 7.5. After addition of 25 µl of SDS-PAGE loading buffer (38), samples were sonicated, and 15 µl of each reaction mixture was run onto 12% Tris-glycine SDS-PAGE
to be electrophoretically transferred to PVDF membrane (Immobilon-P,
Millipore) and probed with polyclonal antibody
p17 as described
(29).
Construction of Phage
cI Repressor Fusions--
Plasmid pBF21
containing the
cI gene under control of a tandem
lacUV5 promoter-operator region (39) was digested with
HindIII and EcoRV to remove the cI
gene fragment encoding for the oligomerization domain (OD). Plasmid
p
cI17w and mutants p
cIL70A, p
cIL70R, and p
cIL84P were
constructed by PCR from gene 17 cloned in plasmid pET17
(29). A silent mutation in gene 17 was introduced to
eliminate an internal HindIII restriction site in a two-step
PCR procedure. PCR conditions are as follows: 1 µM
oligonucleotides, 0.1 µg of plasmid pET17 as template, 100 µM dNTPs, and 2 units of Vent polymerase on its reaction
buffer. Gene 17 was first amplified in two steps as
follows: the first step with primer 5'G17 (TAGGAaagcttACACATGAATAACTAT) containing a HindIII external restriction site, and
3'consLys (CCTGGCTACAAGTTTATTGATCTC) having a single nucleotide
substitution to eliminate the HindIII restriction site
internal to the gene; the second step with primer 5'consLys
(GAGATCAATAAACTTGTAGCCAAG) having a single mutation to substitute the
HindIII site internal to the gene, and TG17
(GTTGTAACGgatatcTTACTTGTT) to introduce an EcoRV
external site. Fragments were purified from agarose gel and used
in a second step of PCR with external primers 5'G17 and TG17. The PCR
product, consisting in gene 17 lacking internal HindIII site, was purified from agarose gel, and after
digestion with HindIII and EcoRV was cloned into
digested pBF21, to generate plasmid p
cI17w, that contains a
chimerical gene encoding for the DNA binding domain from the cI
repressor cI(DBD) fused with the gene coding for protein p17. Gene
17 point mutants of lysine at positions 70 and 84 were
obtained with the same two-step PCR procedure, using the following
internal primers: for mutant L70A, primers L70A (GTTGAAGAGGCAGGCACACAA)
and L70Ac (TTGTGTGCCTGCCTCTTCAAC) were used; for mutant L70R, primers
L70R (GTTGAAGAGCGAGGCACACAA) and L70Rc (TTGTGTGCCTCGCTCTTCAAC); and for
mutant L84P, primers L84P (TTAGAAGATCGAGACGGTGAAA) and L84Pc
(TTTCACCGTCTCGATCTTCTAA). Amplified fragments were cloned as
described above for gene 17 lacking the internal
HindIII restriction site.
Phage Development--
Escherichia coli 71-18 lacIq cells were electrotransformed with the plasmids
described above and grown at 37 °C up to A620 of 0.6 in LB medium containing ampicillin (100 µg/ml). The production of chimeric proteins was induced by addition of 250 µl of 100 mM IPTG to 0.4 ml of culture. After induction, cells were
infected with
146 hypervirulent phage (40) essentially as described (39). At the indicated times, 0.4-ml aliquots were centrifuged, and the
plaque-forming unit/ml was determined in each supernatant using
E. coli 71-18 lacIq as recipient strain.
Sedimentation Equilibrium Analysis-- The experiments were performed in a Beckman Optima XL-A analytical ultracentrifuge using an An60Ti rotor. Protein p17 was equilibrated in 50 mM Tris-HCl, pH 7.5 (90 µl of 70 µM), and centrifuged at 15,000 rpm, and absorbance scans at 280 nm were taken at sedimentation equilibrium. The equilibrium temperature was 4 °C. High speed sedimentation (42,000 rpm) was conducted afterward for base-line correction.
Whole-cell apparent weight average molecular weights
(
w,a) were determined by fitting a
sedimentation equilibrium model for a single sedimenting solute to
individual data sets with the program EQASSOC (supplied by Beckman
Instruments; see Ref. 41). The partial specific volume of protein p17
was 0.737 ml/g, and the monomer relative molecular mass was taken as
19,173, both of them calculated from the amino acid composition of the
protein, deduced from the gene 17 sequence (42). A value of
5,800 M
1 cm
1 was used for the
extinction coefficient of protein p17 at 280 nm (43).
In Vitro Cross-linking-- Purified protein p17 in phosphate buffer, pH 7.0 (15 µM final concentration), was incubated in 50 µl containing 100 µM GGH-Ni(II) as cross-linking agent, at the indicated NaCl concentrations, for 5 min at room temperature. The reaction was quenched with 20 mM Tris-HCl, pH 7.5, and, after addition of SDS-PAGE loading buffer, loaded onto 12% SDS-PAGE gel, and after electrophoresis stained with Coomassie Blue. When cross-linking was performed in the presence of protein p6 (12 µM final concentration, equimolar to that of protein p17), the gel was electrophoretically transferred to PVDF membrane (Immobilon-P, MilliporeTM) and probed with polyclonal antibodies as described (29).
DNase I Footprinting--
DNase I footprinting was carried out
essentially as described (44). Right and left
29 DNA terminal
fragments, obtained from clones in pBluescript vectors (obtained from
V. Gonzalez-Huici), were end-labeled at the 3' end by Klenow filling of
BamHI protruding strand. In a final volume of 25 µl
containing 10 mM MgCl2, DNA fragments were
added to protein p6 or to protein p6 preincubated with protein p17 at
the indicated concentrations and incubated for 5 min at room
temperature, before addition of 2 ng of DNase I to initiate the
reaction. The digestion was allowed to proceed for 5 min at room
temperature and stopped with 20 mM EDTA final concentration. DNA was ethanol-precipitated in the presence of carrier
tRNA and run onto 8 M urea 6% PAGE.
| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
Protein p17 Self-association--
The viral protein p17 is
required in vivo to infect B. subtilis at low
m.o.i. and shows a stimulatory effect on in vitro
29 DNA
amplification. As a step to understand protein p17 function, we have
studied its oligomerization state. Extracts of B. subtilis cells infected with wt
29 were collected and treated with DSS as
cross-linking agent and analyzed by Western blotting with
p17
polyclonal antibodies as described under "Experimental Procedures." Fig. 2 shows protein p17 dimers formation
at increasing DSS concentration. In addition, higher molecular weight
complexes containing protein p17 could be detected in the presence of
increasing concentrations of DSS. The high molecular weight material
could correspond to protein p17 homocomplexes, although we cannot rule
out the formation of heterocomplexes with other proteins.
|
To check whether protein p17 self-association capacity was influenced
by other viral and/or host components, we performed in vitro
analytical ultracentrifugation using purified protein p17 (see
"Experimental Procedures"). The theoretical value for the wt
protein p17 monomer is 19,173, calculated from the amino acid
composition of the protein deduced from the gene 17 sequence (42). Purified protein p17, at a concentration of 70 µM,
was shown to be a dimer in solution with an average molecular weight (
w,a) of 39,304 ± 400 (Fig.
3). Thus, we can conclude that protein p17 self-associates independently from other components.
|
The in vivo accumulated protein p17 was calculated to be
15,000 molecules at 30 min post-infection (29), which is almost 45 µM intracellular protein p17 concentration taking into
account the cell volume of 10
15 liters determined (35).
Our in vitro results at 70 µM protein concentration demonstrate that protein p17 forms dimers, in agreement with the finding of dimers in vivo.
Data obtained by cross-linking with GGH-Ni(II) suggested that
oligomerization of protein p17 was favored at high salt concentration. Fig. 4A shows in
vitro increasing of p17 dimer as well as oligomer formation from
50 to 200 mM salt concentration. To confirm this effect on
protein p17 self-association, we performed sedimentation equilibrium
studies at 50 and 200 mM NaCl. The results presented in
Fig. 4B show that at 50 mM NaCl the best fit
function (line) is for a single solute of a
w,a = 44,400 ± 200 and at 200 mM NaCl for a single solute of a
w,a = 51,100 ± 100. As NaCl favors self-association, we can suggest that protein p17 self-association is
not dependent on charged residues but possibly on hydrophobic ones.
|
Residues Involved in Self-association of Protein p17--
A
secondary structure prediction program to look for coiled-coil domains
(COILS) (16) revealed that the region of p17 spanning amino acids
Leu63 to Glu92 has a high probability of
forming a coiled-coil structure (see Fig.
5A). This structure is formed
by repetition of seven amino acids, adopting an helical conformation,
in which hydrophobic residues are arranged on one face of the helix
(positions a and d of the repetition), forming a spine (see Ref. 16 for
a review). The hypothetical coiled-coil region of protein p17 is shown
in Fig. 5B. These types of structures (see also leucine
zipper motifs) (45, 46) are involved in protein-protein interactions,
homo- and/or hetero-dimerization, by the facing of hydrophobic spines belonging to two (or more) helices in a parallel or antiparallel orientation.
|
To test for the involvement of the coiled-coil region in protein p17
self-association, we analyzed its behavior in an in vivo system based on the
cI repressor dimerization (39). The
cI repressor is a protein that binds to DNA through a DNA binding domain
(DBD) at the N terminus and dimerizes through an oligomerization domain
(OD) at the C terminus. Dimerization is required for an efficient
binding to the operator, so that E. coli cells
carrying the
cIwt gene are immune to hypervirulent phage
146 infection, whereas those carrying only the
cI(DBD)
are sensitive to the infection (see Fig.
6A). Substitution of cI(OD)
with another protein provides an assay for its self-association
in vivo. By using the plasmid pBF21 (39), expressing the
cI repressor under control of the lac promoter, we
constructed plasmid p
cI17w which encodes for a fusion protein
containing the
cI(DBD) at the N terminus and protein p17 at the C
terminus. E. coli cells bearing plasmid p
cI17w were
induced by IPTG to express the fusion protein and were assayed for
hypervirulent phage
146 development. Cells expressing fusion protein
cI17w were immune to phage infection; this result suggests that
protein p17 was able to self-associate efficiently in this in
vivo system (see Fig. 6A). It is interesting to notice that
phage development was slower in the case of fusion protein
cI17w than in the case of the control
cIwt, suggesting that substitution of the cI(OD) with protein p17 at the C terminus gave rise
to the formation of a complex of high efficiency in repression.
However, the mechanism by which this occurs is unknown. Expression of
the fusion protein
cI17w was confirmed by Western blot analysis
using
p17 antibody (not shown).
|
In order to get more information on specific residues involved in the
coiled-coil region of protein p17, we constructed point mutants to be
tested in the in vivo system described above. Because hydrophobic residues of the helical turn have been shown to be responsible for protein-protein interaction (16), and because hydrophobic forces seem to be involved in p17 self-association (Fig. 4,
A and B), we mutated Leu70 into Ala
and Arg and Leu84 into Pro. Fig. 6B shows the
time course development of phage
146 resulting from infection of
E. coli cells expressing different mutant fusion proteins
versus the fusion protein carrying wt protein p17
(
cI17w). Substitution of Leu70 into Arg and
Leu84 into Pro showed a lytic phenotype. These results
indicate that repression has not been carried out, suggesting that
mutant protein self-association is affected. On the other hand, change
of Leu70 into Ala showed a phenotype similar to that found
in cells carrying
cI17w. Change of Leu84 into Pro could
destroy completely the helical coiled-coil structure and
destabilize the protein local structure. The change of
Leu70 into Arg may alter the surrounding charges
at the helical spine, making self-interaction more difficult,
whereas change of Leu70 into Ala seems not to have
an effect in protein p17 self-association. These results suggest that
Leu70 and Leu84 could be involved in
protein p17 self-association.
Protein p17 Interacts in Vitro with the Viral Protein p6--
To
further investigate protein p17 function, we studied its role in the
viral infection system. It is known that (i) protein p17 is synthesized
early from the C2 promoter; (ii) the viral histone-like
protein p6 represses the C2 promoter and activates initiation of
29 DNA replication by forming a nucleoprotein complex; and (iii) protein p17 stimulates in vitro phage DNA
replication at low doses of DNA and initiation proteins (DNA
polymerase, TP, single-stranded DNA-binding protein, and protein p6).
To underlie the mechanisms by which protein p17 stimulates viral DNA
replication, and because protein p17 does not bind DNA (not shown), we
performed protein-protein in vitro cross-linking experiments
using protein p17 and different proteins involved in
29 initiation
of replication. Equimolar concentrations of proteins p17 and p6 were
cross-linked and analyzed by Western blotting as described under
"Experimental Procedures." The same blotting was first analyzed
with
p6 antibodies and then, after stripping, with
p17 antibodies
to compare hetero-oligomers bands. Fig. 7
shows that when the two proteins are present, two extra bands are
formed (indicated with an asterisk) that can be explained as
the result of an interaction between proteins p6 and p17. It should be
noticed that under the experimental conditions used, protein p6
migrates with an approximate molecular mass of 13 kDa (the
theoretical one is of 11.8 kDa) and protein p17 as 23 kDa. The lower
extra band of ~36 kDa can be due to the formation of an heterodimer
between one molecule of protein p6 and one of protein p17. The upper
extra band (~48 kDa) could result from interaction of two molecules
of protein p6 and one of protein p17. The presence of the
hetero-complexes supports the idea of a direct interaction among
proteins p17 and p6.
|
To investigate further the possible effect of protein p17 on protein p6
function, we performed DNase I footprinting experiments of protein p6
in the absence or in the presence of protein p17 with the left or the
right viral DNA ends. As shown in Fig. 8, the presence of protein p6 at the viral DNA ends produces a
characteristic pattern of DNase I-hypersensitive bands regularly spaced
every 24 bp and protected regions in between. In the presence of
protein p17 less amount of protein p6 is needed to obtain the
characteristic pattern at both DNA ends. This result suggests that
protein p17, through its interaction with protein p6, enhances its
binding to the DNA.
|
Conclusion--
In this study we show that protein p17
self-associates both in vivo and in vitro. This
association seems to involve hydrophobic forces and to occur through an
-helical coiled-coil sequence located between residues
Leu63 and Glu92. In addition, by using an
in vivo system we showed that residues Leu70 and
Leu84, which are located at the hydrophobic d position of
the heptad repeats, are essential for self-association. We have also
demonstrated that protein p17 interacts with the viral histone-like
protein p6 enhancing its DNA binding ability. Because it has been
described that binding of protein p6 to DNA has a dynamic nature (23), we suggest that protein p17 could play an important role at the initial
steps of replication (29) in favoring p6 binding to DNA, when its
concentration is still limiting. This binding could help to activate
viral DNA replication and also to repress the C2 promoter,
giving rise to a negative autoregulation of protein p17.
| |
ACKNOWLEDGEMENT |
|---|
We are very grateful to Dr. G. Rivas for help with the analytical ultracentrifugation experiments.
| |
FOOTNOTES |
|---|
* This work was supported by Research Grant 2R01 GM27242-23 from the National Institutes of Health, by Grant PB98-0645 from the Dirección General de Investigación Científica y Técnica, by Grant ERBFMRX CT97 0125 from the European Union, and by an institutional grant from Fundación Ramón Areces.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Postdoctoral fellow from the European Union. Present address:
Istituto Sperimentale per le Colture Industriali, via di Corticella 133, 40129 Bologna, Italy.
§ Present address: Dept. de Didáctica de las Ciencias, Universidad de Jaén, Campus Las Lagunillas s/n, 23071 Jaén, Spain.
¶ To whom correspondence should be addressed. Tel.: 34-91-3978435; Fax: 34-91-3978490; E-mail: msalas@cbm.uam.es.
Published, JBC Papers in Press, December 11, 2002, DOI 10.1074/jbc.M210289200
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
TP, terminal
protein;
m.o.i., multiplicity of infection;
GGH, tripeptide
glycine-glycine-histidine;
DSS, disuccinimidyl suberate;
IPTG, isopropylthio-
-D-galactoside;
wt, wild type;
PVDF, polyvinylidene fluoride;
OD, oligomerization domain;
DBD, DNA binding
domain;
w, a, apparent weight average
molecular weights.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Oñate, S.,
Prendergast, P.,
Wagner, J. P.,
Nissen, M.,
Reeves, R.,
Pettijohn, D. E.,
and Edwards, D. P.
(1994)
Mol. Cell. Biol.
14,
3376-3391 |
| 2. |
Verrier, C. S.,
Roodi, N.,
Yee, C. J.,
Bailey, L. R.,
Jensen, R. A.,
Bustin, M.,
and Parl, F. F.
(1997)
Mol. Endocrinol.
11,
1009-1019 |
| 3. |
Boonyaratanakornkit, V.,
Melvin, V.,
Prendegast, P.,
Altmann, M.,
Ronfani, L.,
Bianchi, M. E.,
Taraseviciene, L.,
Nordeen, S. K.,
Allegretto, E. A.,
and Edwards, D. P.
(1998)
Mol. Cell. Biol.
18,
4471-4487 |
| 4. | Thomas, J. O., and Travers, A. A. (2001) Trends Biochem. Sci. 26, 167-174[CrossRef][Medline] [Order article via Infotrieve] |
| 5. | Falconi, M., Higgins, N. P., Spurio, R., Pon, C. L., and Gualerzi, C. O. (1993) Mol. Microbiol. 10, 273-282[Medline] [Order article via Infotrieve] |
| 6. | Zuber, F., Kotlarz, D., Rimsky, S., and Buc, H. (1994) Mol. Microbiol. 12, 231-240[CrossRef][Medline] [Order article via Infotrieve] |
| 7. | Atlung, T., and Ingmer, H. (1997) Mol. Microbiol. 24, 7-17[CrossRef][Medline] [Order article via Infotrieve] |
| 8. | Williams, R. M., and Rimsky, S. (1997) FEMS Microbiol. Lett. 156, 175-185[CrossRef][Medline] [Order article via Infotrieve] |
| 9. |
Petersen, C.,
Moller, L. B.,
and Valentin-Hansen, P.
(2002)
J. Biol. Chem.
277,
31373-31380 |
| 10. | Flashner, Y., and Gralla, J. D. (1988) Cell 54, 713-721[CrossRef][Medline] [Order article via Infotrieve] |
| 11. | Betemier, M., Rousseau, P., Alazard, R., and Chandler, M. (1995) J. Mol. Biol. 249, 332-341[CrossRef][Medline] [Order article via Infotrieve] |
| 12. |
Morales, P.,
Rouvière-Yaniv, J.,
and Dreyfus, M.
(2002)
J. Bacteriol.
184,
1565-1570 |
| 13. | Lewis, D. E., Geanacopoulos, M., and Adhya, S. (1999) Mol. Microbiol. 31, 451-461[CrossRef][Medline] [Order article via Infotrieve] |
| 14. | Polaczek, P., Kwan, K., and Campbell, J. L. (1998) Plasmid 39, 77-83[CrossRef][Medline] [Order article via Infotrieve] |
| 15. | Balandina, A., Claret, L., Hengge-Aronis, R., and Rouvière-Yaniv, J. (2001) Mol. Microbiol. 39, 1069-1079[CrossRef][Medline] [Order article via Infotrieve] |
| 16. | Lupas, A. (1996) Trends Biochem. Sci. 21, 375-382[CrossRef][Medline] [Order article via Infotrieve] |
| 17. | Peng, H., Begg, G. E., Schultz, D. C., Friedman, J. R., Jensen, D. E., Speicher, D. W., and Rauscher, F. J., III (2000) J. Mol. Biol. 295, 1139-1162[CrossRef][Medline] [Order article via Infotrieve] |
| 18. | Ball, L. J., Jarchau, T., Oschkinat, H., and Walter, U. (2002) FEBS Lett. 513, 45-52[CrossRef][Medline] [Order article via Infotrieve] |
| 19. | Confalonieri, S., and Di Fiore, P. P. (2002) FEBS Lett. 513, 24-29[CrossRef][Medline] [Order article via Infotrieve] |
| 20. | Salas, M. (1991) Annu. Rev. Biochem. 60, 39-71[CrossRef][Medline] [Order article via Infotrieve] |
| 21. |
Pastrana, R.,
Lázaro, J. M.,
Blanco, L.,
García, J. A.,
Méndez, E.,
and Salas, M.
(1985)
Nucleic Acids Res.
13,
3083-3100 |
| 22. | Serrano, M., Gutiérrez, J., Prieto, I., Hermoso, J. M., and Salas, M. (1989) EMBO J. 8, 1879-1885[Medline] [Order article via Infotrieve] |
| 23. | Gutiérrez, C., Freire, R., Salas, M., and Hermoso, J. M. (1994) EMBO J. 13, 269-276[Medline] [Order article via Infotrieve] |
| 24. | Whiteley, H. R., Ramey, W. D., Spiegelman, G. B., and Holder, R. D. (1986) Virology 155, 392-401[CrossRef][Medline] [Order article via Infotrieve] |
| 25. |
Barthelemy, I.,
Mellado, R. P.,
and Salas, M.
(1989)
J. Virol.
63,
460-462 |
| 26. |
Camacho, A.,
and Salas, M.
(2001)
J. Biol. Chem.
276,
28927-28932 |
| 27. |
Elías-Arnanz, M.,
and Salas, M.
(1999)
Genes Dev.
13,
2502-2513 |
| 28. | Camacho, A., and Salas, M. (2001) EMBO J. 20, 6060-6070[CrossRef][Medline] [Order article via Infotrieve] |
| 29. | Crucitti, P., Lázaro, J. M., Benes, V., and Salas, M. (1998) Gene (Amst.) 223, 135-142[CrossRef][Medline] [Order article via Infotrieve] |
| 30. | Carrascosa, J. L., Camacho, A., Moreno, F., Jiménez, F., Mellado, R. P., Viñuela, E., and Salas, M. (1976) Eur. J. Biochem. 66, 229-241[Medline] [Order article via Infotrieve] |
| 31. | Moreno, F., Camacho, A., Viñuela, E., and Salas, M. (1974) Virology 62, 1-16[CrossRef][Medline] [Order article via Infotrieve] |
| 32. | Jiménez, F., Camacho, A., de la Torre, J., Viñuela, E., and Salas, M. (1977) Eur. J. Biochem. 73, 57-72[Medline] [Order article via Infotrieve] |
| 33. |
Mellado, R. P.,
Moreno, F.,
Viñuela, E.,
Salas, M.,
Reilly, B. E.,
and Anderson, D. L.
(1976)
J. Virol.
19,
495-500 |
| 34. |
Prieto, I.,
Serrano, M.,
Lázaro, J. M.,
Salas, M.,
and Hermoso, J. M.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
314-318 |
| 35. | Abril, A. M., Salas, M., Andreu, J. M., Hermoso, J. M., and Rivas, G. (1997) Biochemistry 36, 11901-11908[CrossRef][Medline] [Order article via Infotrieve] |
| 36. | Abril, A. M., Marco, S., Carrascosa, J. L., Salas, M., and Hermoso, J. M. (1999) J. Mol. Biol. 292, 581-588[CrossRef][Medline] [Order article via Infotrieve] |
| 37. | Talavera, A., Jiménez, F., Salas, M., and Viñuela, E. (1971) Virology 46, 586-595[CrossRef][Medline] [Order article via Infotrieve] |
| 38. | Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY |
| 39. | Spurio, R., Falconi, M., Brandi, A., Pon, C. L., and Gualerzi, C. O. (1997) EMBO J. 16, 1795-1805[CrossRef][Medline] [Order article via Infotrieve] |
| 40. | Bailone, A., and Devoret, R. (1978) Virology 84, 547-550[CrossRef][Medline] [Order article via Infotrieve] |
| 41. | Minton, A. P. (1994) in Modern Analytical Ultracentrifugation (Shuster, T. M. , and Laue, T. M., eds) , pp. 81-93, Birkhauser Boston, Inc., Cambridge, MA |
| 42. | Garvey, K. J., Yoshikawa, H., and Ito, J. (1985) Gene (Amst.) 40, 301-309[CrossRef][Medline] [Order article via Infotrieve] |
| 43. | Perkins, S. J. (1986) Eur. J. Biochem. 157, 169-190[Medline] [Order article via Infotrieve] |
| 44. |
Galas, D. J.,
and Schmitz, A.
(1978)
Nucleic Acids Res.
5,
3157-3170 |
| 45. |
Landshulz, W. H.,
Johnson, P. F.,
and McKnight, S. L.
(1988)
Science
240,
1759-1764 |
| 46. |
O'Shea, E. K.,
Rutkowski, R.,
and Kim, P. S.
(1989)
Science
243,
538-542 |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |