JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M210289200 on December 11, 2002

J. Biol. Chem., Vol. 278, Issue 7, 4906-4911, February 14, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/7/4906    most recent
M210289200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crucitti, P.
Right arrow Articles by Salas, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crucitti, P.
Right arrow Articles by Salas, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Bacteriophage Phi 29 Early Protein p17

SELF-ASSOCIATION AND HETERO-ASSOCIATION WITH THE VIRAL HISTONE-LIKE PROTEIN p6*

Paola CrucittiDagger, Ana M. Abril§, and Margarita Salas

From the Centro de Biologia Molecular "Severo Ochoa" (CSIC-UAM), Universidad Autonoma, Canto Blanco, 28049 Madrid, Spain

Received for publication, October 8, 2002, and in revised form, December 11, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Gene 17 of the Bacillus subtilis phage Phi 29 is expressed early after infection, and it has been shown to be required at the very beginning of phage replication under conditions of low but not high multiplicity of infection. It has been proposed that, at the beginning of the infection, protein p17 could be recruiting limiting amounts of initiation factors at the viral origins. Once the infection process is established and the replication proteins reach optimal concentration, protein p17 becomes dispensable. In this paper we focused, on the one hand, on the study of protein p17 dimerization and the role of a putative coiled-coil region. On the other hand, we focused on its interaction with the viral origin-binding protein p6. Based on our results we propose that protein p17 function is to optimize binding of protein p6 at the viral DNA ends, thus favoring the initiation of replication and negatively modulating its own transcription.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Processes like DNA replication, transcription, compaction, or recombination occur in all organisms, and all of them have to be regulated and coordinated in order to obtain biological activity. Factors involved in these regulations are found in both eukaryotes and prokaryotes. In eukaryotes there are proteins like HMG-1 (renamed HMGB1) and HMG-2 that enhance the DNA binding of a variety of proteins (1-4). In prokaryotes, there are histone-like proteins that can function in global regulation, acting as transcriptional modulators in multiprotein complexes with DNA. For example, H-NS influences transcription of a number of genes involved in diverse biological processes (5-9). Another histone-like protein, HU, has been shown to stimulate the action of different DNA-binding proteins (10-12), to repress promoters together with other proteins forming high order multiprotein complex (13), to participate in the initiation of DNA replication assisting other replication proteins (14), or to be involved in post-transcriptional regulation (15). Generally, regulation requires homo- and/or hetero-protein-protein interactions, and different domains involved in these associations have been described: coiled-coiled (16), the RING-B box coiled-coil, renamed recently TRIM (17), EHV1 motif (18), or the Eps15 homology domain (19).

Bacillus subtilis phage Phi 29 has a linear double-stranded DNA with a terminal protein (TP)1 covalently linked to the 5' ends. Phi 29 DNA replication starts by recognition of the origins of replication, i.e. the TP-containing DNA ends, by a TP/DNA polymerase heterodimer (20). Protein p6 is a viral nonspecific DNA-binding protein that is involved in different DNA processes forming a nucleoprotein complex that plays an essential role in the initiation of Phi 29 DNA replication activating the replication origins (21, 22). This complex has been shown to cover most of the Phi 29 genome, suggesting that p6 may also have a structural role in organizing the genome (23). Also, it has been demonstrated that protein p6 is involved in regulating the viral transcription; binding of protein p6 to the right genomic end represses transcription from the early C2 promoter (see Fig. 1) (24-26). In addition, it cooperates with the regulatory viral protein p4 in the switch from early to late transcription (27, 28); as a result, the A2b and A2c early promoters are repressed, and the late A3 promoter is activated. Thus, proteins like p4 or p6 help to coordinate and regulate the main viral processes. On the other hand, under conditions of limiting amounts of the viral DNA and replication proteins (DNA polymerase, TP, single-stranded DNA-binding protein, and protein p6), in vitro Phi 29 DNA amplification is stimulated by the presence of the gene 17 product, protein p17 (29).


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1.   Genetic and transcriptional map of Phi 29. The promoters are shown, and the directions of transcription are indicated by filled arrows. Genes are indicated by numbers above the map.

Gene 17, located at the right end of the Phi 29 DNA molecule (30), encodes a 19-kDa protein involved in the in vivo viral DNA replication. In fact, when a B. subtilis non-suppressor strain (su-) was infected with the Phi 29 mutant sus17 (112), a reduced phage yield and viral DNA synthesis were observed (30-32). Moreover, when the infection was in solid medium, Phi 29 mutant sus17 (112) showed a "leaky" phenotype, characterized by the late appearance of very tiny lysis plaques, suggesting that protein p17 can be partially dispensable (33). We have shown that gene 17 is dispensable under conditions of high m.o.i., but it is indispensable at low m.o.i., which are probably the natural conditions for infection (29).

The C2 promoter controls protein p17 transcription and is strongly inhibited by the viral histone-like protein p6, both in vivo and in vitro (24-26). This fact is probably because of the formation of a p6-DNA nucleoprotein complex at the right end of the viral genome (34). Thus, protein p17 is synthesized very early after infection, and its synthesis declines later on due to the inhibition of the C2 promoter by protein p6.

At late times after Phi 29 infection, the number of copies of protein p6 in B. subtilis cells has been calculated to be enough to cover the entire viral DNA progeny (35). The self-association ability of protein p6 was studied by analytical ultracentrifugation at the in vivo protein p6 concentration. Protein p6 shows a monomer-dimer equilibrium that shifts to higher order association at the highest concentrations. These oligomeric structures have been proposed to act as a scaffold for the DNA into the appropriate configuration (36).

We were interested in analyzing the role of p17 at early infection times, when protein p6 is still limiting in the host cell. In these conditions, protein p17 seems to be required for viral DNA replication (29). To understand further the function of protein p17, we studied its capacity to self-interact and to bind to the viral DNA-binding protein p6 under conditions that can parallel those of the beginning of infection: limiting amount of protein p6 and high amount of protein p17.

In this paper we show that protein p17 self-associates both in vivo and in vitro, independently from other viral or host factors. Protein prediction suggests the existence of a 28-amino acid-long coiled-coil region, possibly involved in in vivo self-association. We also show that protein p17 interacts with the viral protein p6, facilitating the binding of protein p6 to the Phi 29 DNA ends, thus probably favoring the initiation of replication and negatively modulating its own transcription.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Materials-- GGH cross-linking agent was purchased from Sigma, and DSS was from Pierce. Pre-stained high molecular weight protein markers were from Invitrogen. IPTG and ampicillin were from Sigma. Restriction enzymes HindIII, EcoRV, and BamHI, T4 ligase, Vent polymerase, and DNase I were from New England Biolabs; oligonucleotides were from Genset SA; dNTPs, [alpha -32P]dATP (3000 Ci/mmol), and [gamma -32P]ATP (3000 Ci/mmol) were from Amersham Biosciences.

Bacteriophage and Bacteria-- The wt Phi 29 bacteriophage was obtained as described (31, 37). B. subtilis 110NA (try-, spoA-, su-) was used as a host (31).

In Vivo Protein p17 Cross-linking-- B. subtilis 110NA cells were grown at 30 °C in LB medium to an A560 of 0.4 and infected with wt Phi 29 at m.o.i. 5 as described (29). Infected cells were harvested 30 min after infection, washed once with 50 mM Hepes, pH 8.0, and concentrated 20-fold in the permeabilization buffer (50 mM Hepes, pH 8.0, 10 mM EDTA, pH 8.0, 20% sucrose). Cross-linking reaction was carried out in 100 µl with DSS at the indicated concentration, incubated for 20 min at room temperature, and quenched with 50 mM Tris-HCl, pH 7.5. After addition of 25 µl of SDS-PAGE loading buffer (38), samples were sonicated, and 15 µl of each reaction mixture was run onto 12% Tris-glycine SDS-PAGE to be electrophoretically transferred to PVDF membrane (Immobilon-P, Millipore) and probed with polyclonal antibody alpha p17 as described (29).

Construction of Phage lambda cI Repressor Fusions-- Plasmid pBF21 containing the lambda cI gene under control of a tandem lacUV5 promoter-operator region (39) was digested with HindIII and EcoRV to remove the cI gene fragment encoding for the oligomerization domain (OD). Plasmid pDelta cI17w and mutants pDelta cIL70A, pDelta cIL70R, and pDelta cIL84P were constructed by PCR from gene 17 cloned in plasmid pET17 (29). A silent mutation in gene 17 was introduced to eliminate an internal HindIII restriction site in a two-step PCR procedure. PCR conditions are as follows: 1 µM oligonucleotides, 0.1 µg of plasmid pET17 as template, 100 µM dNTPs, and 2 units of Vent polymerase on its reaction buffer. Gene 17 was first amplified in two steps as follows: the first step with primer 5'G17 (TAGGAaagcttACACATGAATAACTAT) containing a HindIII external restriction site, and 3'consLys (CCTGGCTACAAGTTTATTGATCTC) having a single nucleotide substitution to eliminate the HindIII restriction site internal to the gene; the second step with primer 5'consLys (GAGATCAATAAACTTGTAGCCAAG) having a single mutation to substitute the HindIII site internal to the gene, and TG17 (GTTGTAACGgatatcTTACTTGTT) to introduce an EcoRV external site. Fragments were purified from agarose gel and used in a second step of PCR with external primers 5'G17 and TG17. The PCR product, consisting in gene 17 lacking internal HindIII site, was purified from agarose gel, and after digestion with HindIII and EcoRV was cloned into digested pBF21, to generate plasmid pDelta cI17w, that contains a chimerical gene encoding for the DNA binding domain from the cI repressor cI(DBD) fused with the gene coding for protein p17. Gene 17 point mutants of lysine at positions 70 and 84 were obtained with the same two-step PCR procedure, using the following internal primers: for mutant L70A, primers L70A (GTTGAAGAGGCAGGCACACAA) and L70Ac (TTGTGTGCCTGCCTCTTCAAC) were used; for mutant L70R, primers L70R (GTTGAAGAGCGAGGCACACAA) and L70Rc (TTGTGTGCCTCGCTCTTCAAC); and for mutant L84P, primers L84P (TTAGAAGATCGAGACGGTGAAA) and L84Pc (TTTCACCGTCTCGATCTTCTAA). Amplified fragments were cloned as described above for gene 17 lacking the internal HindIII restriction site.

lambda Phage Development-- Escherichia coli 71-18 lacIq cells were electrotransformed with the plasmids described above and grown at 37 °C up to A620 of 0.6 in LB medium containing ampicillin (100 µg/ml). The production of chimeric proteins was induced by addition of 250 µl of 100 mM IPTG to 0.4 ml of culture. After induction, cells were infected with lambda 146 hypervirulent phage (40) essentially as described (39). At the indicated times, 0.4-ml aliquots were centrifuged, and the plaque-forming unit/ml was determined in each supernatant using E. coli 71-18 lacIq as recipient strain.

Sedimentation Equilibrium Analysis-- The experiments were performed in a Beckman Optima XL-A analytical ultracentrifuge using an An60Ti rotor. Protein p17 was equilibrated in 50 mM Tris-HCl, pH 7.5 (90 µl of 70 µM), and centrifuged at 15,000 rpm, and absorbance scans at 280 nm were taken at sedimentation equilibrium. The equilibrium temperature was 4 °C. High speed sedimentation (42,000 rpm) was conducted afterward for base-line correction.

Whole-cell apparent weight average molecular weights (Mw,a) were determined by fitting a sedimentation equilibrium model for a single sedimenting solute to individual data sets with the program EQASSOC (supplied by Beckman Instruments; see Ref. 41). The partial specific volume of protein p17 was 0.737 ml/g, and the monomer relative molecular mass was taken as 19,173, both of them calculated from the amino acid composition of the protein, deduced from the gene 17 sequence (42). A value of 5,800 M-1 cm-1 was used for the extinction coefficient of protein p17 at 280 nm (43).

In Vitro Cross-linking-- Purified protein p17 in phosphate buffer, pH 7.0 (15 µM final concentration), was incubated in 50 µl containing 100 µM GGH-Ni(II) as cross-linking agent, at the indicated NaCl concentrations, for 5 min at room temperature. The reaction was quenched with 20 mM Tris-HCl, pH 7.5, and, after addition of SDS-PAGE loading buffer, loaded onto 12% SDS-PAGE gel, and after electrophoresis stained with Coomassie Blue. When cross-linking was performed in the presence of protein p6 (12 µM final concentration, equimolar to that of protein p17), the gel was electrophoretically transferred to PVDF membrane (Immobilon-P, MilliporeTM) and probed with polyclonal antibodies as described (29).

DNase I Footprinting-- DNase I footprinting was carried out essentially as described (44). Right and left Phi 29 DNA terminal fragments, obtained from clones in pBluescript vectors (obtained from V. Gonzalez-Huici), were end-labeled at the 3' end by Klenow filling of BamHI protruding strand. In a final volume of 25 µl containing 10 mM MgCl2, DNA fragments were added to protein p6 or to protein p6 preincubated with protein p17 at the indicated concentrations and incubated for 5 min at room temperature, before addition of 2 ng of DNase I to initiate the reaction. The digestion was allowed to proceed for 5 min at room temperature and stopped with 20 mM EDTA final concentration. DNA was ethanol-precipitated in the presence of carrier tRNA and run onto 8 M urea 6% PAGE.

    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Protein p17 Self-association-- The viral protein p17 is required in vivo to infect B. subtilis at low m.o.i. and shows a stimulatory effect on in vitro Phi 29 DNA amplification. As a step to understand protein p17 function, we have studied its oligomerization state. Extracts of B. subtilis cells infected with wt Phi 29 were collected and treated with DSS as cross-linking agent and analyzed by Western blotting with alpha  p17 polyclonal antibodies as described under "Experimental Procedures." Fig. 2 shows protein p17 dimers formation at increasing DSS concentration. In addition, higher molecular weight complexes containing protein p17 could be detected in the presence of increasing concentrations of DSS. The high molecular weight material could correspond to protein p17 homocomplexes, although we cannot rule out the formation of heterocomplexes with other proteins.


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 2.   In vivo cross-linking of protein p17. Cell extracts of B. subtilis infected with wt Phi 29 were cross-linked using DSS, transferred to membrane, and blotted with alpha p17 antibody as described under "Experimental Procedures." -, untreated extract. The positions of protein p17 monomer and dimer are indicated by an arrow. The positions of protein markers are indicated at the right.

To check whether protein p17 self-association capacity was influenced by other viral and/or host components, we performed in vitro analytical ultracentrifugation using purified protein p17 (see "Experimental Procedures"). The theoretical value for the wt protein p17 monomer is 19,173, calculated from the amino acid composition of the protein deduced from the gene 17 sequence (42). Purified protein p17, at a concentration of 70 µM, was shown to be a dimer in solution with an average molecular weight (Mw,a) of 39,304 ± 400 (Fig. 3). Thus, we can conclude that protein p17 self-associates independently from other components.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3.   In vitro self-association of protein p17 determined by sedimentation equilibrium analysis. Sedimentation equilibrium profiles of protein p17 (70 µM) were taken at 15,000 rpm at 4 °C, as described under "Experimental Procedures." Symbols represent experimental results, and the solid line is the best fit function for a single solute at the equilibrium. Mw,a was estimated as 39,304 ± 400. The top panel shows the distributions of residuals for the fits presented in the bottom panel.

The in vivo accumulated protein p17 was calculated to be 15,000 molecules at 30 min post-infection (29), which is almost 45 µM intracellular protein p17 concentration taking into account the cell volume of 10-15 liters determined (35). Our in vitro results at 70 µM protein concentration demonstrate that protein p17 forms dimers, in agreement with the finding of dimers in vivo.

Data obtained by cross-linking with GGH-Ni(II) suggested that oligomerization of protein p17 was favored at high salt concentration. Fig. 4A shows in vitro increasing of p17 dimer as well as oligomer formation from 50 to 200 mM salt concentration. To confirm this effect on protein p17 self-association, we performed sedimentation equilibrium studies at 50 and 200 mM NaCl. The results presented in Fig. 4B show that at 50 mM NaCl the best fit function (line) is for a single solute of a Mw,a = 44,400 ± 200 and at 200 mM NaCl for a single solute of a Mw,a = 51,100 ± 100. As NaCl favors self-association, we can suggest that protein p17 self-association is not dependent on charged residues but possibly on hydrophobic ones.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   In vitro self-association of protein p17 as a function of the salt concentration. A, 20 µM protein p17 was cross-linked with GGH as described under "Experimental Procedures" in the presence of the indicated NaCl concentrations, and the reaction product was run on SDS-PAGE and was Coomassie Blue-stained. Protein p17 monomer and dimer are indicated by an arrow. The positions of protein markers are indicated at the right. B, sedimentation equilibrium profiles of protein p17 (70 µM) taken at 15,000 rpm at 4 °C, as described under "Experimental Procedures" at the indicated NaCl concentrations. Symbols represent experimental results, and lines are the best fit function for a single solute at the equilibrium.

Residues Involved in Self-association of Protein p17-- A secondary structure prediction program to look for coiled-coil domains (COILS) (16) revealed that the region of p17 spanning amino acids Leu63 to Glu92 has a high probability of forming a coiled-coil structure (see Fig. 5A). This structure is formed by repetition of seven amino acids, adopting an helical conformation, in which hydrophobic residues are arranged on one face of the helix (positions a and d of the repetition), forming a spine (see Ref. 16 for a review). The hypothetical coiled-coil region of protein p17 is shown in Fig. 5B. These types of structures (see also leucine zipper motifs) (45, 46) are involved in protein-protein interactions, homo- and/or hetero-dimerization, by the facing of hydrophobic spines belonging to two (or more) helices in a parallel or antiparallel orientation.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5.   Protein p17 internal region has a putative coiled-coil. A, probability that the sequence of protein p17 will adopt a coiled-coil conformation. B, helical wheel projection of the putative coiled-coil region. Substitution of two leucines in position d of the helical structure is indicated.

To test for the involvement of the coiled-coil region in protein p17 self-association, we analyzed its behavior in an in vivo system based on the lambda cI repressor dimerization (39). The lambda cI repressor is a protein that binds to DNA through a DNA binding domain (DBD) at the N terminus and dimerizes through an oligomerization domain (OD) at the C terminus. Dimerization is required for an efficient binding to the operator, so that E. coli cells carrying the lambda cIwt gene are immune to hypervirulent phage lambda 146 infection, whereas those carrying only the lambda cI(DBD) are sensitive to the infection (see Fig. 6A). Substitution of cI(OD) with another protein provides an assay for its self-association in vivo. By using the plasmid pBF21 (39), expressing the lambda cI repressor under control of the lac promoter, we constructed plasmid pDelta cI17w which encodes for a fusion protein containing the lambda cI(DBD) at the N terminus and protein p17 at the C terminus. E. coli cells bearing plasmid pDelta cI17w were induced by IPTG to express the fusion protein and were assayed for hypervirulent phage lambda 146 development. Cells expressing fusion protein Delta cI17w were immune to phage infection; this result suggests that protein p17 was able to self-associate efficiently in this in vivo system (see Fig. 6A). It is interesting to notice that lambda  phage development was slower in the case of fusion protein Delta cI17w than in the case of the control lambda cIwt, suggesting that substitution of the cI(OD) with protein p17 at the C terminus gave rise to the formation of a complex of high efficiency in repression. However, the mechanism by which this occurs is unknown. Expression of the fusion protein Delta cI17w was confirmed by Western blot analysis using alpha p17 antibody (not shown).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6.   In vivo dimerization assay of protein p17 wt and point mutants. Development of lambda 146 phage (as plaque-forming units/ml) as a function of time post-infection (hours). A, cells expressing lambda cIwt repressor (black-square), lambda cI(DBD) (open circle ), or Delta cI17w (); B, cells expressing Delta cI17w (), Delta cIL70A (black-square), Delta cIL70R (black-triangle), or Delta cIL84P ().

In order to get more information on specific residues involved in the coiled-coil region of protein p17, we constructed point mutants to be tested in the in vivo system described above. Because hydrophobic residues of the helical turn have been shown to be responsible for protein-protein interaction (16), and because hydrophobic forces seem to be involved in p17 self-association (Fig. 4, A and B), we mutated Leu70 into Ala and Arg and Leu84 into Pro. Fig. 6B shows the time course development of phage lambda 146 resulting from infection of E. coli cells expressing different mutant fusion proteins versus the fusion protein carrying wt protein p17 (Delta cI17w). Substitution of Leu70 into Arg and Leu84 into Pro showed a lytic phenotype. These results indicate that repression has not been carried out, suggesting that mutant protein self-association is affected. On the other hand, change of Leu70 into Ala showed a phenotype similar to that found in cells carrying Delta cI17w. Change of Leu84 into Pro could destroy completely the helical coiled-coil structure and destabilize the protein local structure. The change of Leu70 into Arg may alter the surrounding charges at the helical spine, making self-interaction more difficult, whereas change of Leu70 into Ala seems not to have an effect in protein p17 self-association. These results suggest that Leu70 and Leu84 could be involved in protein p17 self-association.

Protein p17 Interacts in Vitro with the Viral Protein p6-- To further investigate protein p17 function, we studied its role in the viral infection system. It is known that (i) protein p17 is synthesized early from the C2 promoter; (ii) the viral histone-like protein p6 represses the C2 promoter and activates initiation of Phi 29 DNA replication by forming a nucleoprotein complex; and (iii) protein p17 stimulates in vitro phage DNA replication at low doses of DNA and initiation proteins (DNA polymerase, TP, single-stranded DNA-binding protein, and protein p6). To underlie the mechanisms by which protein p17 stimulates viral DNA replication, and because protein p17 does not bind DNA (not shown), we performed protein-protein in vitro cross-linking experiments using protein p17 and different proteins involved in Phi 29 initiation of replication. Equimolar concentrations of proteins p17 and p6 were cross-linked and analyzed by Western blotting as described under "Experimental Procedures." The same blotting was first analyzed with alpha p6 antibodies and then, after stripping, with alpha p17 antibodies to compare hetero-oligomers bands. Fig. 7 shows that when the two proteins are present, two extra bands are formed (indicated with an asterisk) that can be explained as the result of an interaction between proteins p6 and p17. It should be noticed that under the experimental conditions used, protein p6 migrates with an approximate molecular mass of 13 kDa (the theoretical one is of 11.8 kDa) and protein p17 as 23 kDa. The lower extra band of ~36 kDa can be due to the formation of an heterodimer between one molecule of protein p6 and one of protein p17. The upper extra band (~48 kDa) could result from interaction of two molecules of protein p6 and one of protein p17. The presence of the hetero-complexes supports the idea of a direct interaction among proteins p17 and p6.


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 7.   In vitro cross-linking between proteins p17 and p6. Cross-linking reactions between pure proteins p17 and p6 were run on Tris-glycine 15% acrylamide SDS-PAGE, transferred onto membrane, then blotted with alpha p6 and, upon stripping, with alpha p17. The left panel shows the result of alpha p6 labeling, and the right panel shows that of alpha p17. Monomers of protein p17 and p6 are indicated with a bar, and the putative heterodimer and heterotrimer are indicated with an asterisk.

To investigate further the possible effect of protein p17 on protein p6 function, we performed DNase I footprinting experiments of protein p6 in the absence or in the presence of protein p17 with the left or the right viral DNA ends. As shown in Fig. 8, the presence of protein p6 at the viral DNA ends produces a characteristic pattern of DNase I-hypersensitive bands regularly spaced every 24 bp and protected regions in between. In the presence of protein p17 less amount of protein p6 is needed to obtain the characteristic pattern at both DNA ends. This result suggests that protein p17, through its interaction with protein p6, enhances its binding to the DNA.


View larger version (80K):
[in this window]
[in a new window]
 
Fig. 8.   Effect of protein p17 on protein p6 footprinting. A, Phi 29 DNA left origin: 4.2, 6.3, and 8.4 pmol of protein p6 have been used in the absence or in the presence of 26 pmol of protein p17. B, Phi 29 DNA right origin: 8.4, 10.5, and 12.6 pmol of protein p6 have been used in the absence or in the presence of 26 pmol of protein p17.

Conclusion-- In this study we show that protein p17 self-associates both in vivo and in vitro. This association seems to involve hydrophobic forces and to occur through an alpha -helical coiled-coil sequence located between residues Leu63 and Glu92. In addition, by using an in vivo system we showed that residues Leu70 and Leu84, which are located at the hydrophobic d position of the heptad repeats, are essential for self-association. We have also demonstrated that protein p17 interacts with the viral histone-like protein p6 enhancing its DNA binding ability. Because it has been described that binding of protein p6 to DNA has a dynamic nature (23), we suggest that protein p17 could play an important role at the initial steps of replication (29) in favoring p6 binding to DNA, when its concentration is still limiting. This binding could help to activate viral DNA replication and also to repress the C2 promoter, giving rise to a negative autoregulation of protein p17.

    ACKNOWLEDGEMENT

We are very grateful to Dr. G. Rivas for help with the analytical ultracentrifugation experiments.

    FOOTNOTES

* This work was supported by Research Grant 2R01 GM27242-23 from the National Institutes of Health, by Grant PB98-0645 from the Dirección General de Investigación Científica y Técnica, by Grant ERBFMRX CT97 0125 from the European Union, and by an institutional grant from Fundación Ramón Areces.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Postdoctoral fellow from the European Union. Present address: Istituto Sperimentale per le Colture Industriali, via di Corticella 133, 40129 Bologna, Italy.

§ Present address: Dept. de Didáctica de las Ciencias, Universidad de Jaén, Campus Las Lagunillas s/n, 23071 Jaén, Spain.

To whom correspondence should be addressed. Tel.: 34-91-3978435; Fax: 34-91-3978490; E-mail: msalas@cbm.uam.es.

Published, JBC Papers in Press, December 11, 2002, DOI 10.1074/jbc.M210289200

    ABBREVIATIONS

The abbreviations used are: TP, terminal protein; m.o.i., multiplicity of infection; GGH, tripeptide glycine-glycine-histidine; DSS, disuccinimidyl suberate; IPTG, isopropylthio-beta -D-galactoside; wt, wild type; PVDF, polyvinylidene fluoride; OD, oligomerization domain; DBD, DNA binding domain; Mw, a, apparent weight average molecular weights.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

1. Oñate, S., Prendergast, P., Wagner, J. P., Nissen, M., Reeves, R., Pettijohn, D. E., and Edwards, D. P. (1994) Mol. Cell. Biol. 14, 3376-3391[Abstract/Free Full Text]
2. Verrier, C. S., Roodi, N., Yee, C. J., Bailey, L. R., Jensen, R. A., Bustin, M., and Parl, F. F. (1997) Mol. Endocrinol. 11, 1009-1019[Abstract/Free Full Text]
3. Boonyaratanakornkit, V., Melvin, V., Prendegast, P., Altmann, M., Ronfani, L., Bianchi, M. E., Taraseviciene, L., Nordeen, S. K., Allegretto, E. A., and Edwards, D. P. (1998) Mol. Cell. Biol. 18, 4471-4487[Abstract/Free Full Text]
4. Thomas, J. O., and Travers, A. A. (2001) Trends Biochem. Sci. 26, 167-174[CrossRef][Medline] [Order article via Infotrieve]
5. Falconi, M., Higgins, N. P., Spurio, R., Pon, C. L., and Gualerzi, C. O. (1993) Mol. Microbiol. 10, 273-282[Medline] [Order article via Infotrieve]
6. Zuber, F., Kotlarz, D., Rimsky, S., and Buc, H. (1994) Mol. Microbiol. 12, 231-240[CrossRef][Medline] [Order article via Infotrieve]
7. Atlung, T., and Ingmer, H. (1997) Mol. Microbiol. 24, 7-17[CrossRef][Medline] [Order article via Infotrieve]
8. Williams, R. M., and Rimsky, S. (1997) FEMS Microbiol. Lett. 156, 175-185[CrossRef][Medline] [Order article via Infotrieve]
9. Petersen, C., Moller, L. B., and Valentin-Hansen, P. (2002) J. Biol. Chem. 277, 31373-31380[Abstract/Free Full Text]
10. Flashner, Y., and Gralla, J. D. (1988) Cell 54, 713-721[CrossRef][Medline] [Order article via Infotrieve]
11. Betemier, M., Rousseau, P., Alazard, R., and Chandler, M. (1995) J. Mol. Biol. 249, 332-341[CrossRef][Medline] [Order article via Infotrieve]
12. Morales, P., Rouvière-Yaniv, J., and Dreyfus, M. (2002) J. Bacteriol. 184, 1565-1570[Abstract/Free Full Text]
13. Lewis, D. E., Geanacopoulos, M., and Adhya, S. (1999) Mol. Microbiol. 31, 451-461[CrossRef][Medline] [Order article via Infotrieve]
14. Polaczek, P., Kwan, K., and Campbell, J. L. (1998) Plasmid 39, 77-83[CrossRef][Medline] [Order article via Infotrieve]
15. Balandina, A., Claret, L., Hengge-Aronis, R., and Rouvière-Yaniv, J. (2001) Mol. Microbiol. 39, 1069-1079[CrossRef][Medline] [Order article via Infotrieve]
16. Lupas, A. (1996) Trends Biochem. Sci. 21, 375-382[CrossRef][Medline] [Order article via Infotrieve]
17. Peng, H., Begg, G. E., Schultz, D. C., Friedman, J. R., Jensen, D. E., Speicher, D. W., and Rauscher, F. J., III (2000) J. Mol. Biol. 295, 1139-1162[CrossRef][Medline] [Order article via Infotrieve]
18. Ball, L. J., Jarchau, T., Oschkinat, H., and Walter, U. (2002) FEBS Lett. 513, 45-52[CrossRef][Medline] [Order article via Infotrieve]
19. Confalonieri, S., and Di Fiore, P. P. (2002) FEBS Lett. 513, 24-29[CrossRef][Medline] [Order article via Infotrieve]
20. Salas, M. (1991) Annu. Rev. Biochem. 60, 39-71[CrossRef][Medline] [Order article via Infotrieve]
21. Pastrana, R., Lázaro, J. M., Blanco, L., García, J. A., Méndez, E., and Salas, M. (1985) Nucleic Acids Res. 13, 3083-3100[Abstract/Free Full Text]
22. Serrano, M., Gutiérrez, J., Prieto, I., Hermoso, J. M., and Salas, M. (1989) EMBO J. 8, 1879-1885[Medline] [Order article via Infotrieve]
23. Gutiérrez, C., Freire, R., Salas, M., and Hermoso, J. M. (1994) EMBO J. 13, 269-276[Medline] [Order article via Infotrieve]
24. Whiteley, H. R., Ramey, W. D., Spiegelman, G. B., and Holder, R. D. (1986) Virology 155, 392-401[CrossRef][Medline] [Order article via Infotrieve]
25. Barthelemy, I., Mellado, R. P., and Salas, M. (1989) J. Virol. 63, 460-462[Abstract/Free Full Text]
26. Camacho, A., and Salas, M. (2001) J. Biol. Chem. 276, 28927-28932[Abstract/Free Full Text]
27. Elías-Arnanz, M., and Salas, M. (1999) Genes Dev. 13, 2502-2513[Abstract/Free Full Text]
28. Camacho, A., and Salas, M. (2001) EMBO J. 20, 6060-6070[CrossRef][Medline] [Order article via Infotrieve]
29. Crucitti, P., Lázaro, J. M., Benes, V., and Salas, M. (1998) Gene (Amst.) 223, 135-142[CrossRef][Medline] [Order article via Infotrieve]
30. Carrascosa, J. L., Camacho, A., Moreno, F., Jiménez, F., Mellado, R. P., Viñuela, E., and Salas, M. (1976) Eur. J. Biochem. 66, 229-241[Medline] [Order article via Infotrieve]
31. Moreno, F., Camacho, A., Viñuela, E., and Salas, M. (1974) Virology 62, 1-16[CrossRef][Medline] [Order article via Infotrieve]
32. Jiménez, F., Camacho, A., de la Torre, J., Viñuela, E., and Salas, M. (1977) Eur. J. Biochem. 73, 57-72[Medline] [Order article via Infotrieve]
33. Mellado, R. P., Moreno, F., Viñuela, E., Salas, M., Reilly, B. E., and Anderson, D. L. (1976) J. Virol. 19, 495-500[Abstract/Free Full Text]
34. Prieto, I., Serrano, M., Lázaro, J. M., Salas, M., and Hermoso, J. M. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 314-318[Abstract/Free Full Text]
35. Abril, A. M., Salas, M., Andreu, J. M., Hermoso, J. M., and Rivas, G. (1997) Biochemistry 36, 11901-11908[CrossRef][Medline] [Order article via Infotrieve]
36. Abril, A. M., Marco, S., Carrascosa, J. L., Salas, M., and Hermoso, J. M. (1999) J. Mol. Biol. 292, 581-588[CrossRef][Medline] [Order article via Infotrieve]
37. Talavera, A., Jiménez, F., Salas, M., and Viñuela, E. (1971) Virology 46, 586-595[CrossRef][Medline] [Order article via Infotrieve]
38. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
39. Spurio, R., Falconi, M., Brandi, A., Pon, C. L., and Gualerzi, C. O. (1997) EMBO J. 16, 1795-1805[CrossRef][Medline] [Order article via Infotrieve]
40. Bailone, A., and Devoret, R. (1978) Virology 84, 547-550[CrossRef][Medline] [Order article via Infotrieve]
41. Minton, A. P. (1994) in Modern Analytical Ultracentrifugation (Shuster, T. M. , and Laue, T. M., eds) , pp. 81-93, Birkhauser Boston, Inc., Cambridge, MA
42. Garvey, K. J., Yoshikawa, H., and Ito, J. (1985) Gene (Amst.) 40, 301-309[CrossRef][Medline] [Order article via Infotrieve]
43. Perkins, S. J. (1986) Eur. J. Biochem. 157, 169-190[Medline] [Order article via Infotrieve]
44. Galas, D. J., and Schmitz, A. (1978) Nucleic Acids Res. 5, 3157-3170[Abstract/Free Full Text]
45. Landshulz, W. H., Johnson, P. F., and McKnight, S. L. (1988) Science 240, 1759-1764[Abstract/Free Full Text]
46. O'Shea, E. K., Rutkowski, R., and Kim, P. S. (1989) Science 243, 538-542[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/7/4906    most recent
M210289200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crucitti, P.
Right arrow Articles by Salas, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crucitti, P.
Right arrow Articles by Salas, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.