|
Originally published In Press as doi:10.1074/jbc.M209722200 on November 6, 2002
J. Biol. Chem., Vol. 278, Issue 7, 5029-5034, February 14, 2003
Nuclear Overexpression of NADH:Cytochrome
b5 Reductase Activity Increases the
Cytotoxicity of Mitomycin C (MC) and the Total Number of MC-DNA Adducts
in Chinese Hamster Ovary Cells*
Kathleen M.
Holtz ,
Sara
Rockwell §,
Maria
Tomasz¶, and
Alan C.
Sartorelli
From the Departments of Pharmacology and
§ Therapeutic Radiology and Developmental Therapeutics
Program, Yale Cancer Center, Yale University School of Medicine,
New Haven, Connecticut 06520 and the ¶ Department of Chemistry,
Hunter College, City University of New York,
New York, New York 10021
Received for publication, September 22, 2002, and in revised form, November 4, 2002
 |
ABSTRACT |
NADH:cytochrome b5
reductase (FpD) is an enzyme capable of converting the prodrug
mitomycin C (MC) into a DNA alkylating agent via reduction of its
quininone moiety. In this study, Chinese hamster ovary (CHO) cells were
transfected with a cDNA encoding rat FpD. Despite the
demonstrated ability of this enzyme to reduce MC in vitro,
a modest 5-fold level of overexpression of FpD activity in CHO cells
did not increase the cytotoxicity of the drug over that seen with the
parental cell line under either aerobic or hypoxic conditions. When the
enzyme, which is predominantly localized in the mitochondria, was
instead directed to the nucleus of cells by the fusion of the SV40
large T antigen nuclear localization signal sequence to the amino
terminus of an FpD gene that lacked the membrane
anchor domain, drug sensitivity was significantly enhanced at all
concentrations of MC examined (2-10 µM) under both
aerobic and hypoxic conditions, with greater cell kill occurring under
hypoxia. The marked increase in drug sensitivity under hypoxia at 10 µM MC corresponded to a measurable increase in total
MC-DNA adducts at the same concentration. The results indicate that the cytotoxicity of MC is modulated by the subcellular location of FpD,
with greater cell kill occurring when bioactivation occurs in the
proximity of its target, nuclear DNA.
 |
INTRODUCTION |
Mitomycin C (MC),1 a
natural product antibiotic with antitumor activity, has been used
successfully to eradicate hypoxic tumor cells in head, neck, and cervix
cancers in combination with ionizing radiation (1-4). As a prodrug, MC
can be chemically and enzymatically converted into a reactive species
capable of alkylating a variety of nucleophilic molecules, including
genomic DNA (5). Specifically, the quinone moiety of MC is reduced to
give unstable intermediates that are capable of further transformations
to generate a reactive molecule with two electrophilic carbon centers
(6). Both monofunctional and bifunctional adducts are formed between MC
and DNA (7, 8). The variety of adducts formed between MC and DNA both
in vitro and in drug-treated EMT6 cells have been
extensively characterized (9-13). The majority of these lesions are
monofunctional alkylations occurring on the guanine-N(2) position.
These lesions are considered to be less cytotoxic than the covalent
bifunctional cross-link that forms exclusively in the 5'-CpG-3'
sequence between the N-2 amino groups of two guanines in complementary
strands of the minor groove. This interstrand MC-DNA cross-link
prevents DNA replication, and corresponds directly with cell survival
(14, 15).
Several enzymes have been shown to catalyze the reduction of MC to
reactive intermediates using either a one-electron or a two-electron
mechanism. NADPH:cytochrome P-450 oxidoreductase (EC 1.6.2.4)
(16, 17), NADH:cytochrome b5 oxidoreductase (EC
1.6.2.2; FpD) (18, 19), xanthine:oxygen oxidoreductase (EC
1.1.3.22; xanthine oxidase) (16, 20), and, more recently, nitric-oxide synthase (EC 1.14.13.39) (21, 22) are among the enzymes
using a one-electron reduction mechanism. These enzymes convert MC to
the MC hydroquinone in two, single-electron transfer steps, forming an
oxygen-sensitive semiquinone anion radical intermediate (16-22). A
bimolecular reaction between the anion radical intermediate and oxygen
that regenerates the prodrug occurs that is extremely rapid, close to
the diffusion-controlled rate; however, in the hypoxic regions of
tumors, the low level of oxygen greatly increases the half-life of this
intermediate, allowing sufficient time for disproportionation to the
reactive MC hydroquinone alkylating species. Other enzymes such as
NAD(P)H:quinone oxidoreductase (EC 1.1.1.204; NAD(P)H
dehydrogenase) (23, 24), and xanthine:NAD+
oxidoreductase (EC 1.2.1.37; xanthine dehydrogenase) (25, 26) reduce MC
directly to the MC hydroquinone in one step using a two-electron
process, thereby avoiding redox cycling reactions.
Of the reductases that bioactivate MC, NAD(P)H dehydrogenase, and
NADPH:cytochrome P-450 oxidoreductase have been considered to be the
most important enzymes for the activation of this agent. Overexpression
of these bioreductive enzymes in intact cells has lead to increased
sensitivity to MC under both aerobic and hypoxic conditions, thereby
confirming their importance in the bioactivation of this drug (27-29).
Cell lines overexpressing the one-electron reductase, NADPH:cytochrome
P-450 oxidoreductase, display an oxic/hypoxic differential, with
greater MC sensitivity occurring under hypoxia. In contrast, cell lines
overexpressing the two-electron reductase, NAD(P)H dehydrogenase,
exhibit an increase in MC sensitivity of essentially the same magnitude
under both oxic and hypoxic conditions. This latter phenomenon reflects
the direct formation of an oxygen-insensitive MC hydroquinone
intermediate that is not susceptible to redox cycling reactions that
regenerate the relatively nontoxic MC prodrug. Studies focusing on
NAD(P)H dehydrogenase are to a large extent attributable to experiments
that identified higher levels of this enzyme in tumor cells compared
with normal cells, which might account for preferential activation of
MC in neoplastic cells (30-32). However, attempts to correlate NAD(P)H
dehydrogenase activity with drug sensitivity have led to conflicting
results (31, 33-35).
In contrast to NAD(P)H dehydrogenase and NADPH:cytochrome P-450
oxidoreductase, FpD is present in fairly consistent, relatively low
levels in both normal and tumors cells (30, 31). Apparently for this
reason, FpD has received considerably less attention. However, this
enzyme has been shown to play a role in the activation of MC (19). The
purified enzyme has been shown to reduce MC to a species capable of
alkylating DNA in vitro. In addition, it has been
demonstrated that overexpression of FpD in the cytoplasm of CHO cells
by removal of the membrane binding domain enhances sensitivity to MC
relative to the parental line under both aerobic and hypoxic conditions
(36). To further investigate the importance of the subcellular site of
bioactivation to the cytoxicity of MC, FpD, an enzyme found
predominantly in the outer mitochondrial membrane of CHO cells, was
overexpressed in the nucleus of these cells. The effects of nuclear
localization of FpD on the sensitivity of CHO cells to MC and on the
formation of DNA adducts of the alkylating agent were then assessed.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
CHO-K1/dhfr , the CHO-K1 cell
line deficient in dihydrofolate reductase, was obtained from American
Type Culture Collection (Rockville, MD) and maintained in Iscove's
modified Dulbecco's medium (Invitrogen) supplemented with 10%
fetal bovine serum, 2 mM glutamine, 0.1 mM
hypoxanthine, 0.01 mM thymidine, and antibiotics (penicillin, 100 units/ml; streptomycin, 100 µg/ml). Transfected cell
lines were maintained in the same medium with the addition of G418 (1 mg/ml) to select for the expression vector. Cells were grown as
monolayers at 37 °C under an atmosphere of 95% air, 5% CO2 in a humidified incubator.
Plasmid Construction/Transfections--
The cDNA
for rat NADH:cytochrome b5 reductase
served as the template in the polymerase chain reaction (PCR) using the
following oligonucleotides: 1)
5'-CGCGGTACCAAGCTTGCCACCATGGATAAAGTTTTAAACAGAGAGGAATCTTCTAGTGATGATGAGGCTACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCGCTAGCAAGCTGTTTCAGCGCTCCTCACCG-3'; 2)
5'-CGCGGATCCTCTAGACTAAATACTTGGCCCTGCTTCATCATATTCTTGTT
TGGATATCCACATCCCGAAGGTGAAGCATCGCTCCTTGGG-3'. The forward
primer (1) contains the SV40 large T antigen nuclear localization
signal (NLS, underlined) fused in-frame to the FpD gene
beginning at nucleotide 72 of the coding sequence to remove the
membrane docking sequence. The reverse primer (2) contains a 15-amino
acid sequence for the muscle actin epitope (underlined) fused in-frame
to the sequence for the carboxyl-terminal end of the FpD
gene. The latter primer was used in another PCR reaction with a second
forward primer (3) having a sequence complementary to the
amino-terminal coding region of the FpD gene to generate the
membrane-bound form of the enzyme with the actin epitope: 3)
5'-CGCGGATCCAAGCTTGCCACCATGGGGGCCCAGCTG-3'.
In both forward primers, the ATG translational initiation codon is
shown in bold. PCR products were subcloned into the pRC/CMV eukaryotic expression vector (Invitrogen, Corp.) using the HindIII and
XbaI restriction sites shown in italics. Chinese hamster
ovary cells (CHO-K1/dhfr ) were transfected with plasmids
using Polyfect reagent (Qiagen Inc., Valencia, CA). Stable
transfectants were selected using G418 (1 mg/ml). Candidates were
cloned by flow cytometric single-cell sorting and then rescreened under
selection conditions.
Immunofluorescence Microscopy--
Cells were plated
on poly-D-lysine-coated, six-well glass slides (500-1000
cells/well) and allowed to incubate at 37 °C under an atmosphere of
95% air, 5% CO2 in a humidified incubator for up to
48 h. After fixing in 20% formaldehyde for 15 min and
permeabilizing in cold acetone for 5 min, cells were incubated with
anti-muscle actin monoclonal antibody (HUC-1; ICN, Costa Mesa, CA) at a
dilution of 1:125, washed, and then incubated with fluorescein
isothiocyanate-conjugated anti-mouse IgG (Sigma) at a dilution of
1:200.
Enzymatic Assays--
Trypsinized cells were washed and
resuspended in phosphate-buffered saline for sonication.
Spectrophometric assays were performed on crude cell sonicates at
30 °C as described previously (36). Briefly, FpD activity was
measured by reduction of potassium ferricyanide at 420 nm.
NADPH:cytochrome c (P-450) reductase and
rotenone-insensitive NADH:cytochrome c reductase activities
were monitored by the rate of ferricytochrome c reduction at
550 nm. NAD(P)H dehydrogenase activity was measured as the
dicumarol-inhibitable reduction of dichloroindophenol measured
at 600 nm. Total protein was determined with bicinchoninic protein
assay reagent (Pierce Chemical Co.).
Aerobic/Hypoxic Experiments--
Cells (2.5 × 105) were plated in milk dilution bottles and allowed to
grow at 37 °C under an atmosphere of 95% air, 5% CO2 in a humidified incubator for 72 h. Then exponentially growing cultures were gassed through rubber septums fitted to the glass bottles
for 2 h at 37 °C with 95% N2, 5% CO2
(<1 ppm O2) to induce hypoxia. Graded concentrations of MC
(0, 2.5, 5, and 10 µM) were injected through a rubber
septum in volumes less than 75 µl. After 1 h of treatment, cells
were harvested by trypsinization and assayed for their ability to form
macroscopic colonies. Cells under aerobic conditions were treated in an
identical manner in a humidified atmosphere of 95% air, 5%
CO2. Surviving fractions were calculated using the plating
efficiencies of hypoxic and aerobic vehicle-treated controls.
[3H]Mitomycin C Assay for Total DNA
Adducts--
Suspension cultures were prepared by trypsinization of
exponentially growing monolayers and were cultured at a density of 1 × 107 cells/ml in glass vials fitted with rubber
septums and stir fleas. Cultures (2 ml) were gassed for 2 h with
95% N2, 5% CO2 to induce hypoxia or with 95%
air, 5% CO2 to produce aerobic conditions. Cells were then
exposed to 10 µM [3H]MC (0.18 mCi/µmol)
for 2 h under hypoxic or aerobic conditions. Total genomic DNA was
extracted from 1 × 107 cells using the PUREGENE DNA
purification system (Gentra Systems, Minneapolis, MN) following the
manufacturer guidelines. Briefly, cell lysates were treated with
proteinase K (100 µg/ml) overnight followed by RNase A (20 µg/ml)
for 1 h at 37 °C. Proteins were removed by precipitation. DNA
was then precipitated, washed twice with 70% ethanol to reduce
radioactive counts in the wash to background levels, and then dissolved
in 10 mM Tris-HCl, 1 mM EDTA, pH 7. Radioactivity in the samples was normalized to the total DNA
concentration, as determined by absorbance measurements at 260 nm.
 |
RESULTS |
Isolation and Analysis of Stable CHO Cell Line Transfectants
Overexpressing NADH:Cytochrome b5
Reductase--
Considerable difficulty was encountered in obtaining
stable transfectants of CHO cells that overexpressed FpD either in its normal subcellular environment of the mitochondria and endoplasmic reticulum or in the nucleus. Several hundred clones were screened before a few were found that minimally overexpressed the enzyme compared with the parental cell line. Important oxidoreductase activities of the parental line (CHO-K1/dhfr ) and the
transfectants expressing either a cytosolic membrane-bound enzyme
(CHO-FpD-5) or a nuclear localized form (CHO-NLS-FpD-3) are summarized
in Table I. Based on the
NADH:ferricyanide oxidoreductase activities in crude cell lysates,
clone CHO-NLS-FpD-3 expressed the FpD activity 3-fold over that of the
parental line, whereas clone CHO-FpD-5 expressed the enzyme activity
5-fold over that of the parental line. The rotenone-insensitive
NADH:cytochrome c reductase assay measures the reduction of
cytochrome c via endogenous cytochrome
b5. Thus, the higher activity in this assay for
clone CHO-FpD-5 provides support for FpD overexpression in the
cytosolic membranes of the mitochondria and endoplasmic reticulum.
Compared with the parental line, the levels of other oxidoreductase
activities implicated in MC bioreduction (NADPH:cytochrome P-450
oxidoreductase and NAD(P)H dehydrogenase) remained unchanged in the two
transfected cell lines. The activities of xanthine oxidase and xanthine
dehydrogenase, two additional enzymes known to reduce MC, were not
determined because we have previously shown that the
CHO-K1/dhfr cell line does not express either enzyme
(27). A clone transfected with empty vector (pRC/CMV) was also
characterized in terms of the various oxidoreductase activities, and
was similar to the parental line (results not shown).
View this table:
[in this window]
[in a new window]
|
Table I
Oxidoreductase activities of CHO-K1/dhfr parental
cells and NADH:cytochrome b5 reductase-transfected cell lines
expressing either a mitochondrial/endoplasmic reticulum
(CHO-FpD-5) or a nuclear (CHO-NLS-FpD-3) rat NADH:cytochrome b5
reductase cDNA
|
|
Immunofluorescence Staining of Overexpressed FpD in CHO Cell Line
Transfectants--
The muscle actin epitope was included at the
carboxyl terminus of the FpD gene in the plasmid constructs
to allow for visual detection of the subcellular localization of the
enzyme in transfected cells. Cells of the CHO-FpD-5 transfectant that
expressed a form of FpD unaltered in terms of localization exhibited
primarily cytosolic staining, as shown in Fig.
1A. These results are in agreement with subcellular fractionation studies performed previously in our laboratory, which indicated that FpD is localized primarily in
the mitochondria of CHO cells, with a smaller amount in the endoplasmic
reticulum (36). In contrast, CHO-NLS-FpD-3 cells that expressed the
FpD gene fused with the SV40 large T antigen nuclear
localization signal sequence displayed fluorescence intensity that was
concentrated in the nucleus (Fig. 1B).

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
Immunofluorescence staining of FpD in
CHO-FpD-5 (A) and CHO-NLS-FpD-3 (B)
cells to determine the intracellular localization of overexpressed FpD
activity. Cells were grown as described under "Experimental
Procedures" and stained with the HUC-1 antibody specific for the
muscle actin epitope. Cells were visualized and photographed with a
Nikon Optiphot microscope equipped with a Nikon episcopic-fluorescence
attached EF-D and a Nikon UFX-IIA MicroFlex camera.
|
|
Survival Data for the Parental Line and the Stable CHO Cell Line
Transfectants Expressing FpD under Both Aerobic and Hypoxic
Conditions--
Survival curves for the parental line
(CHO-K1/dhfr ), the stably transfected cell line
overexpressing FpD activity in cytosolic particles (CHO-FpD-5), and the
stably transfected cell line overexpressing FpD activity in the nucleus
(CHO-NLS-FpD-3) are shown in Fig. 2,
A and B, for aerobic and hypoxic conditions,
respectively. The CHO-K1/dhfr cell line is highly
resistant to exposure to 10 µM MC for 1 h under
aerobic conditions but sensitivity increases ~10-fold at 10 µM MC under hypoxia. The survival curves for the
CHO-FpD-5 transfectant, ovexpressing FpD activity by 5-fold, are
virtually superimposable with those of the parental line under both
aerobic and hypoxic conditions. In contrast, the nuclear transfectant, CHO-NLS-FpD-3, overexpressing FpD activity by 3-fold, exhibits a small,
but significant increase in MC sensitivity under aerobic conditions
when compared with the other two cell lines. Furthermore, the nuclear
transfectant is markedly more sensitive to MC under hypoxia, producing
a readily observable oxic/hypoxic differential.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 2.
Survival curves under aerobic
(A) and hypoxic (B) conditions for
the parental line (CHO-K1/dhfr , ), the stably
transfected cell line overexpressing FpD activity in the
mitochondria/endoplasmic reticulum (CHO-FpD-5, ), and the
stably transfected line overexpressing FpD activity in the nucleus
(CHO-NLS-FpD-3, ). Cell lines were treated for 1 h with
graded concentrations of MC under aerobic conditions (95% air, 5%
CO2) or hypoxic conditions (95% N2, 5%
CO2). Points are an average of three to four independent
determinations. Standard deviations are shown where larger than the
points.
|
|
Analysis of the survival data in Fig. 2B was made by
comparing the drug concentrations required for equivalent levels of
survival in the transfected cell lines. The concentration of MC for
10% survival under hypoxia is ~5.5 µM MC for the
transfectant overexpressing mitochondrial/endoplasmic
reticulum-localized FpD, and ~3.8 µM MC for the
transfectant overexpressing nuclear-localized FpD, to yield a
sensitivity ratio of ~1.4. The same analysis performed at 1%
survival yields an identical sensitivity ratio. This comparison is made
between cell lines that overexpress FpD activity at different levels
relative to the parental cell line (3-fold overexpression for
CHO-NLS-FpD-3 cells versus 5-fold overexpression for
CHO-FpD-5 cells). Thus, the oxic/hypoxic differential represented by
the sensitivity ratio should be expected to increase with equivalent overexpression of FpD activity in the nucleus and the
mitochondrial/endoplasmic reticulum.
Total [3H]MC-DNA Adducts in Drug-treated Cell
Lines--
Table II shows the amount of
total [3H]MC-DNA adducts produced in cell lines treated
with 10 µM [3H]MC under aerobic and hypoxic
conditions. In these experiments, the majority of the radioactivity
remained in the medium or associated with cellular debris and proteins,
resulting in total MC-DNA adducts that were in the range of 3-12-fold
over background. Under aerobic conditions, no statistically significant
differences were found between the adduct levels of the three cell
lines that were tested. In contrast, a small, but statistically
significant difference in adduct levels was observed under hypoxia.
Under hypoxia, the genomic DNA isolated from the nuclear transfectant,
CHO-NLS-FpD-3, yielded almost twice the amount of radioactivity as the
DNA from the parental line or the CHO-FpD-5 transfectant. Similar
numbers of MC-DNA adducts occurred in DNA samples from the
parental line and the CHO-FpD-5 transfectant under hypoxia. Based upon
the survival data obtained under hypoxia, shown in Fig. 2B,
the drug sensitivity at 10 µM MC increased more than
10-fold in CHO-NLS-FpD-3 cells compared with CHO-FpD-5 cells, even
though the level of overexpressed FpD activity in the nucleus of
CHO-NLS-FpD-3 cells was less than the level of overexpressed FpD
activity in the mitochondria and endoplasmic reticulum of CHO-FpD-5
cells. Thus, the approximate 1.8-fold increase in the total number of
MC-DNA adducts at 10 µM MC for the nuclear FpD
transfectant relative to both the parental cell line and the
mitochondrial/endoplasmic reticulum FpD transfectant is much less than
the approximate 10-fold increase in sensitivity estimated from the
survival data at the same concentration (see Fig. 2B).
 |
DISCUSSION |
Whereas MC is a highly potent anticancer agent that is clinically
used in combination with radiation and chemotherapy regimens to treat
several cancers, it is extremely toxic to normal tissues. There are
also several factors that limit the efficacy of the drug. The toxic
interstrand cross-link between MC and DNA must compete with
monoalkylation products, as well as with the less damaging oxygen
radicals (i.e. superoxide, hydrogen peroxide, and/or
hydroxyl radical) produced in redox cycling reactions. Furthermore, the
drug, once activated, is highly electrophilic and reacts readily with a
host of nucleophilic cellular components including water. Consequently,
only a very minor fraction of the activated drug reaches nuclear DNA.
As part of an ongoing investigation to address this last issue, the
subcellular site of MC bioactivation was modified by overexpression of
bioreductive enzymes in the nucleus, close to the proposed target
producing cytotoxicity, nuclear DNA.
Little has been done to characterize the impact of bioactivation by FpD
on the cytotoxicity of MC, although previous studies by workers in our
laboratory (36) have shown that a cytosolic form of FpD alters the
sensitivity of CHO cells to MC under both aerobic and hypoxic
conditions. To demonstrate that the intracellular location of the
enzyme modulates cytotoxicity, we generated CHO cell lines that
overexpressed FpD activity in its normal location (i.e.
mitochondria and endoplasmic reticulum) and in the nucleus, without
altering the levels of other oxidoreductases implicated in MC
bioactivation (Table I). Only minimal levels of overexpression of FpD
activity were achieved regardless of the enzyme location. Thus,
CHO-NLS-FpD-3 overexpressed the nuclear-localized enzyme activity by
3-fold whereas CHO-FpD-5 expressed the cytoplasmic membrane-bound form
by 5-fold over that of the parental line, CHO-K1/dhfr .
The difficulty in obtaining higher levels of overexpression of FpD
activity despite the use of a strong promoter (cytomegalovirus) in the constructs agrees with our previous findings (36) and may
reflect the role of this enzyme as a member of an electron transport
chain and the possible requirement for coordinate expression of a
physiological partner. In the case of the mitochondrial/endoplasmic reticulum localized enzyme, a lack of available membrane docking sites
may also limit the level of functional FpD. In both FpD overexpressing
clones, localization of the enzyme was confirmed by immunofluorescence
staining using antibodies directed toward the muscle actin epitope
fused to the carboxyl terminus of the enzyme encoded on the eukaryotic
expression vector (Fig. 1, A and B).
Despite the relatively low level of nuclear overexpression of FpD
activity, transfectant CHO-NLS-FpD-3 caused an increase, albeit modest,
in the cytotoxicity of MC under aerobic conditions and a more
pronounced increase in the cytotoxicity of MC under hypoxia when
compared with the cytoplasmic membrane-bound form of FpD expressed at a
somewhat higher level in the mitochondria and endoplasmic reticulum.
The slight but statistically significant increase in MC cytotoxicity
under aerobic conditions in the transfectant expressing nuclear FpD
activity most likely reflects the production of the reactive alkylating
species closer to its DNA target. Under hypoxia, the marked increase in
cytotoxicity for CHO-NLS-FpD-3 not only reflects the production of the
activated species near nuclear DNA, but also the increased efficiency
of the reactive species because of the absence of redox cycling
reactions that occur from the one-electron reduction of MC under
aerobic conditions. Whereas the increase in cell kill under hypoxia by
nuclear overexpression of FpD activity is substantial, the total
magnitude of the cell death is comparable with that achieved with
cytosolic overexpression of the enzyme activity in a previous study in
our laboratory (36). However, because a greater level of overexpression
of enzyme activity (12-fold) was achieved in the previous study, a
direct comparison between these CHO transfectants cannot be made.
Nonetheless, given that a 3-fold increase in nuclear localized FpD
activity produces a 10-fold increase in MC cytotoxicity, an even
greater increase in cytotoxicty would be expected if greater
overexpression of this enzyme activity could be attained in the nucleus.
The survival curves for the cell line expressing the enzyme activity in
its normal intracellular location also generates some results that
conflict with our previous findings. We have previously shown that
overexpression of membrane-bound FpD in CHO cells by 9-fold results in
a slight decrease in MC sensitivity under aerobic conditions, whereas
the sensitivity under hypoxic conditions remains equal to that of the
parental cell line (36). This protective effect was postulated to be
because of the sequestering of MC electrophiles in the CHO cells,
thereby decreasing nuclear DNA alkylations and reducing cytotoxicity.
In the present study, no apparent change in MC cytotoxicity occurred in
the transfectant overexpressing FpD activity in the
mitochondria/endoplasmic reticulum under either aerobic or hypoxic
conditions relative to the parental cell line. Perhaps the protective
effect demonstrated previously in CHO cells overexpressing FpD activity
by 9-fold was not observed because the enzyme was overexpressed at a
lower level of 5-fold in the present investigation. Alternatively, cell
line drift may be responsible for the difference in MC sensitivities
occurring in these FpD transfectants. In any case, the findings imply
that activation of MC in these cytoplasmic sites limits the ability of
the reactive MC hydroquinone electrophilic species to reach and
interact productively with nuclear DNA. Thus, site-specific activation
in the mitochondrion may lead to the alkylation of mitochondrial DNA or
mitochondrial membrane components. Consequently, the alkylating species
interacts with other molecules or macromolecules to produce less
cytotoxic events, minimizing its diffusion into the nucleus to target DNA.
Previous studies have demonstrated a correlation between cell survival
and MC-DNA cross-links, considered to be the primary cytotoxic lesion
(37). In the present study, total MC-DNA adducts, monoalkylations and
cross-links, were measured using radiolabeled [3H]MC.
Inconsistent with the MC survival assays under aerobic conditions, no
measurable differences in total MC-DNA adducts were found for the
nuclear FpD transfectant relative to the other cell lines. It is likely
that the identical number of MC-DNA adducts produced in parental cells,
CHO-FpD-5 cells, and CHO-NLS-FpD-3 cells under aerobic conditions is a
reflection of the degree of activation by endogenous NAD(P)H
dehydrogenase, a two-electron reducing system not susceptible to the
redox cycling that occurs in air with the one-electron generating
reducing systems NADPH:cytochrome P-450 oxidoreductase and FpD. Because
DNA alkylations by MC are rare events, small differences in the number
of total adducts may be undetectable in the radioactivity assay, yet
produce an observable effect in survival assays. Alternatively, nuclear
activation of MC in aerobic cells overexpressing FpD would produce
increased levels of oxygen radicals in close proximity to DNA resulting in increased DNA damage that could result in increased cell kill.
The increase in total MC-DNA adducts under hypoxia in parental cells
and in CHO-FpD-5 cells presumably reflects the increased generation of
MC hydroquinone through one-electron reductants over that produced by
NAD(P)H dehydrogenase. The statistically significant increase in total
[3H]MC-DNA adducts detected under hypoxia for the
transfectant overexpressing nuclear FpD activity relative to the
parental line and the transfectant overexpressing cytoplasmic
membrane-bound FpD is assumed to be because of activation of MC to
reactive electrophiles by nuclear FpD. The finding that a small
increase in total adducts is capable of producing a significant
increase in cell kill is not unreasonable given that a single
cross-link per bacterial genome is sufficient to produce lethality (14)
and very few cross-links are required to cause marked cell kill of
mammalian cells (15). Thus, incremental changes in the level of DNA
alkylations produced by MC, and in particular, the covalent MC-DNA
cross-link, can have pronounced effects on the cytotoxicity of this drug.
As part of a larger investigation by our laboratory to
improve the efficacy of the anticancer agent MC, this study has
examined the role of the intracellular location of NADH:cytochrome
b5 oxidoreductase on the bioactivation of the
prodrug MC. The results of these experiments indicate that the efficacy
of MC is increased significantly when bioactivation by FpD occurs in
the nucleus, in close proximity to nuclear DNA. Thus, a relatively
minor 3-fold increase in FpD activity in the nucleus leads to a marked
increase in drug sensitivity and in total MC-DNA adducts under hypoxia.
These findings, which have been determined in CHO cells, suggest that
modest changes in the bioactivation of MC can significantly increase
the cytotoxicity of this agent in tumor cells. Thus, FpD may play an
important role in the bioactivation of MC if a method is developed to
increase the expression of the enzyme in the nucleus of tumor cells.
 |
FOOTNOTES |
*
This work was supported by United States Public Health
Service Grant CA-80845 from the NCI, National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of
Pharmacology, Yale University School of Medicine, 333 Cedar Street, New Haven, CT 06520. Tel.: 203-785-4533; Fax: 203-737-2045; E-mail: alan.sartorelli@yale.edu.
Published, JBC Papers in Press, November 6, 2002, DOI 10.1074/jbc.M209722200
 |
ABBREVIATIONS |
The abbreviations used are:
MC, mitomycin C;
FpD, NADH:cytochrome b5 reductase;
CHO, Chinese
hamster ovary;
NLS, nuclear localization signal.
 |
REFERENCES |
| 1.
|
Weissberg, J. B.,
Papac, R. J.,
Son, Y. H.,
Sasaki, C.,
Fischer, D. B.,
Lawerence, R.,
Rockwell, S.,
Sartorelli, A. C.,
and Fischer, J. J.
(1989)
Int. J. Radiat. Oncol. Biol. Phys.
17,
3-9[Medline]
[Order article via Infotrieve]
|
| 2.
|
Haffty, B. G.,
Son, Y. H.,
Sasaki, C. T.,
Papac, R.,
Fischer, D.,
Rockwell, S.,
Sartorelli, A. C.,
and Fischer, J. J.
(1993)
Int. J. Radiat. Oncol. Biol. Phys.
27,
241-250[Medline]
[Order article via Infotrieve]
|
| 3.
|
Haffty, B. G.,
Son, Y. H.,
Papac, R.,
Sasaki, C. T.,
Weissberg, J. B.,
Fischer, D.,
Rockwell, S.,
Sartorelli, A. C.,
and Fischer, J. J.
(1997)
J. Clin. Oncol.
15,
268-276[Abstract/Free Full Text]
|
| 4.
|
Roberts, K. B.,
Urdaneta, N.,
Vera, R.,
Vera, A.,
Gutierrez, E.,
Aguilar, Y.,
Ott, S.,
Medina, I.,
Sempere, P.,
Rockwell, S.,
Sartorelli, A. C.,
Fischer, D. B.,
and Fischer, J. J.
(2000)
Int. J. Cancer Radiat. Oncol. Invest.
90,
206-223
|
| 5.
|
Tomasz, M.
(1995)
Chem. Biol. (Lond.)
2,
575-579
|
| 6.
|
Tomasz, M.,
Chawla, A. K.,
and Lipman, R.
(1988)
Biochemistry
27,
3182-3187[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Kumar, G. S.,
Lipman, R.,
Cummings, J.,
and Tomasz, M.
(1997)
Biochemistry
36,
14128-14136[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Tomasz, M.,
and Palom, Y.
(1997)
Pharmacol. Ther.
76,
73-87[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Tomasz, M.,
Chowdary, D.,
Lipman, R.,
Shimotakahara, S.,
Veiro, D.,
Walker, V.,
and Verdine, G. L.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
6702-6706[Abstract/Free Full Text]
|
| 10.
|
Bizanek, R.,
McGuiness, B. F.,
Nakanishi, K.,
and Tomasz, M.
(1992)
Biochemistry
31,
3084-3091[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Tomasz, M.,
Lipman, R.,
Chowdary, D.,
Pawlak, J.,
Verdine, G. L.,
and Nakanishi, K.
(1987)
Science
235,
1204-1208[Abstract/Free Full Text]
|
| 12.
|
Pan, S., Yu, F.,
and Hipsher, C.
(1993)
Mol. Pharmacol.
43,
870-877[Abstract]
|
| 13.
|
Palom, Y.,
Belcourt, M. F.,
Kumar, G. S.,
Arai, H.,
Kasai, M.,
Sartorelli, A. C.,
Rockwell, S.,
and Tomasz, M.
(1998)
Oncol. Res.
10,
509-521[Medline]
[Order article via Infotrieve]
|
| 14.
|
Syzbalski, W.,
and Iyer, V. N.
(1964)
Fed. Proc.
23,
946-957[Medline]
[Order article via Infotrieve]
|
| 15.
|
Keyes, S. R.,
Loomis, R.,
DiGiovanna, M. P.,
Pristos, C. A.,
Rockwell, S.,
and Sartorelli, A. C.
(1991)
Cancer Commun.
3,
351-356[Medline]
[Order article via Infotrieve]
|
| 16.
|
Pan, S.,
Andrews, P. A.,
Glover, C. J.,
and Bachur, N. R.
(1984)
J. Biol. Chem.
259,
959-966[Abstract/Free Full Text]
|
| 17.
|
Keyes, S. R.,
Fracasso, P. M.,
Heimbrook, D. C.,
Rockwell, S.,
Sligar, S. G.,
and Sartorelli, A. C.
(1984)
Cancer Res.
44,
5638-5643[Abstract/Free Full Text]
|
| 18.
|
Fisher, J.,
and Olsen, R.
(1982)
Dev. Biochem.
21,
240-243
|
| 19.
|
Hodnick, W. F.,
and Sartorelli, A. C.
(1993)
Cancer Res.
53,
4907-4912[Abstract/Free Full Text]
|
| 20.
|
Bachur, N. R.,
Gordon, S. L.,
Gee, M. V.,
and Kon, H.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
954-957[Abstract/Free Full Text]
|
| 21.
|
Jiang, H.-B.,
Ichikawa, M.,
Furukawa, A.,
Tomita, S.,
and Ichikawa, Y.
(2000)
Biochem. Pharmacol.
60,
571-579[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Matsuda, H.,
Kimura, S.,
and Iyanagi, T.
(2000)
Biochim. Biophys. Acta
1459,
106-116[Medline]
[Order article via Infotrieve]
|
| 23.
|
Siegal, D.,
Gibson, N. W.,
Preush, P. C.,
and Ross, D.
(1990)
Cancer Res.
50,
7483-7489[Abstract/Free Full Text]
|
| 24.
|
Begleiter, A.,
Robotham, E.,
and Leith, M. K.
(1992)
Mol. Pharmacol.
41,
677-682[Abstract]
|
| 25.
|
Gustafson, D. L.,
and Pristos, C. A.
(1992)
Cancer Res.
52,
6936-6939[Abstract/Free Full Text]
|
| 26.
|
Pristos, C. A.,
and Gustafson, D. L.
(1994)
Oncol. Res.
6,
477-481[Medline]
[Order article via Infotrieve]
|
| 27.
|
Belcourt, M. F.,
Hodnick, W. F.,
Rockwell, S.,
and Sartorelli, A. C.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
456-460[Abstract/Free Full Text]
|
| 28.
|
Belcourt, M. F.,
Hodnick, W. F.,
Rockwell, S.,
and Sartorelli, A. C.
(1996)
Biochem. Pharmacol.
51,
1669-1678[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Belcourt, M. F.,
Hodnick, W. F.,
Rockwell, S.,
and Sartorelli, A. C.
(1998)
Adv. Enzyme Regul.
38,
111-133[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Marín, A.,
López de Cerain, A.,
Hamilton, E.,
Lewis, A. D.,
Martinez-Peñuela, J. M.,
Idoate, M. A.,
and Bello, J.
(1997)
Br. J. Cancer
76,
923-929[Medline]
[Order article via Infotrieve]
|
| 31.
|
Fitzsimmons, S. A.,
Workman, P.,
Grever, M.,
Paull, K.,
Camalier, R.,
and Lewis, A. D.
(1996)
J. Natl. Cancer Inst.
88,
259-269[Abstract/Free Full Text]
|
| 32.
|
Cresteil, T.,
and Jaiswal, A. K.
(1991)
Biochem. Pharmacol.
42,
1021-1027[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Phillips, R. M.,
Burger, A. M.,
Loadman, P. M.,
Jarrett, C. M.,
Swaine, D. J.,
and Fiebig, H.-H.
(2000)
Cancer Res.
60,
6384-6390[Abstract/Free Full Text]
|
| 34.
|
Nishiyama, M.,
Sacki, S.,
Aogi, K.,
Hirabayashi, N.,
and Toge, T.
(1993)
Int. J. Cancer
53,
1013-1016[Medline]
[Order article via Infotrieve]
|
| 35.
|
Malkinson, A. M.,
Siegel, D.,
Forrest, G. L.,
Gazdar, A. F.,
Oie, H. K.,
Chan, D. C.,
Bunn, P. A.,
Mabry, M.,
Dykes, D. J.,
Harrison, S. D., Jr.,
and Ross, D.
(1992)
Cancer Res.
52,
4752-4757[Abstract/Free Full Text]
|
| 36.
|
Belcourt, M. F.,
Hodnick, W. F.,
Rockwell, S.,
and Sartorelli, A. C.
(1998)
J. Biol. Chem.
273,
8875-8881[Abstract/Free Full Text]
|
| 37.
|
Sartorelli, A. C.,
Tomasz, M.,
and Rockwell, S.
(1993)
Adv. Enzyme Regul.
33,
3-17[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H. A. Seow, M. F. Belcourt, P. G. Penketh, W. F. Hodnick, M. Tomasz, S. Rockwell, and A. C. Sartorelli
Nuclear Localization of NADPH:Cytochrome c (P450) Reductase Enhances the Cytotoxicity of Mitomycin C to Chinese Hamster Ovary Cells
Mol. Pharmacol.,
February 1, 2005;
67(2):
417 - 423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. A. Seow, P. G. Penketh, M. F. Belcourt, M. Tomasz, S. Rockwell, and A. C. Sartorelli
Nuclear Overexpression of NAD(P)H:Quinone Oxidoreductase 1 in Chinese Hamster Ovary Cells Increases the Cytotoxicity of Mitomycin C under Aerobic and Hypoxic Conditions
J. Biol. Chem.,
July 23, 2004;
279(30):
31606 - 31612.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|