|
Originally published In Press as doi:10.1074/jbc.M208268200 on October 30, 2002
J. Biol. Chem., Vol. 278, Issue 7, 5082-5090, February 14, 2003
HLA-E Allelic Variants
CORRELATING DIFFERENTIAL EXPRESSION, PEPTIDE AFFINITIES, CRYSTAL
STRUCTURES, AND THERMAL STABILITIES*
Roland K.
Strong §,
Margaret A.
Holmes ,
Pingwei
Li ,
Laura
Braun¶,
Ni
Lee¶, and
Daniel E.
Geraghty¶
From the Division of Basic Sciences and the
¶ Clinical Research Division, Fred Hutchinson Cancer Research
Center, Seattle, Washington 98109
Received for publication, August 13, 2002, and in revised form, October 28, 2002
 |
ABSTRACT |
Previous studies of HLA-E allelic polymorphism
have indicated that balancing selection may be acting to maintain two
major alleles in most populations, indicating that a functional
difference may exist between the alleles. The alleles differ at only
one amino acid position, where an arginine at position 107 in
HLA-E*0101 (ER) is replaced by a glycine in
HLA-E*0103 (EG). To investigate possible functional
differences, we have undertaken a study of the physical and biochemical
properties of these two proteins. By comparing expression levels, we
found that whereas steady-state protein levels were similar, the two
alleles did in fact differ with respect to cell surface levels. To help
explain this difference, we undertook studies of the relative
differences in peptide affinity, complex stability, and
three-dimensional structure between the alleles. The crystal structures
for HLA-EG complexed with two distinct peptides were
determined, and both were compared with the HLA-ER
structure. No significant differences in the structure of HLA-E were
induced as a result of binding different peptides or by the allelic
substitution at position 107. However, there were clear differences in
the relative affinity for peptide of each heavy chain, which correlated
with and may be explained by differences between their thermal
stabilities. These differences were completely consistent with the
relative levels of the HLA-E alleles on the cell surface and may indeed
correlate with functional differences. This in turn may help explain
the apparent balancing selection acting on this locus.
 |
INTRODUCTION |
The major histocompatibility complex
(MHC)1 in humans includes the
HLA loci, a group of genes encoding glycoproteins that control cell-to-cell interactions and regulate immune responses. These include
the classical class I loci HLA-A, -B, and -C, whose role in
immunological recognition is now well understood (1). In addition to
these genes, the MHC contains three highly homologous, nonclassical
class I genes, HLA-E, -F, and -G, each of which probably plays a
specialized role in the immune response. All three genes are located in
relatively close proximity within the class I region and together with
the classical class I antigens constitute the complete list of active
class I genes in humans (2). The remainder of the class I-like
sequences are apparently pseudogenes (e.g. HLA-H), gene
fragments, and other inactive but structurally homologous sequences.
Each of the nonclassical class I genes can be distinguished from
classical class I genes by their expression levels, as is the case for
HLA-E, which is ubiquitously expressed but at much lower relative
levels (3), or by their tissue-specific expression patterns in the case
of HLA-G (4) and HLA-F (5, 6). Each is hypothesized to have a unique
function in immune responses.
Of the three nonclassical class I genes, the function of HLA-E has been
the most completely elucidated through its interaction with CD94-NKG2
receptors (3, 7). CD94 is a type II glycoprotein that is expressed on
most NK cells and a subset of T lymphocytes (8, 9). It forms a
heterodimer with the NKG2A/B, NKG2C, NKG2E, and NKG2H glycoproteins
(10, 11). Interaction with such CD94 heterodimers can augment, inhibit,
or have no effect on NK cell-mediated cytotoxicity and cytokine
production (12). Surface expression of HLA-E requires, and is therefore
controlled by, the availability of any of a set of highly conserved
nonamer peptides that are available from the signal sequences of other HLA class I molecules including HLA-A, -B, -C, and -G but not HLA-F
(13). When peptide is available, the resultant complex can interact
normally with the CD94-NKG2 complex (3, 7). Further, the ability of
HLA-E complexes to interact with CD94-NKG2 ligands is affected by the
particular nonamer that is available for binding. For example, HLA-E
may gain a novel function when it binds the unique peptide that only
HLA-G can provide (14). Since HLA-E is also expressed in those
placental cells normally expressing HLA-G, such a potentially
activating function is suggestive of a unique role that HLA-E might be
playing in the placenta.
Polymorphism among HLA class I antigens has long been thought of as a
hallmark of the functional diversity required of these molecules (15).
Whereas high levels of polymorphism in HLA class I have been maintained
by overdominant selection (16), in contrast the nonclassical class I
molecules HLA-E, -F, and -G have been under a distinct selective
pressure, exhibiting very low levels of allelic polymorphism. Two
nonsynonymous alleles of HLA-E have been found, E*0101 and E*0103 (17,
18), and although others have been reported, it appears likely that
they are the result of sequencing artifacts (19). The two confirmed
HLA-E alleles have been referred to as HLA-EG (E*0101) and
HLA-ER (E*0103), since they are distinguished by having
either an arginine (-ER) or a glycine (-EG) at
position 107 of the protein, located on a loop between -strands in
the 2 domain of the heavy chain. HLA-EG and
-ER are found at nearly equal frequencies in diverse
populations. Evidence that some form of balancing selection is acting
on this gene to maintain the two alleles of HLA-E has been reported
(20). Such selection would imply that there are functional differences between the two alleles.
In order to investigate the underlying rationale for potential
functional differences, we examined the two HLA-E alleles individually for various characteristics that might affect function. Preliminary evidence had indicated that different levels of surface expression of
HLA-E could alter its ability to protect cells from NK lysis by NKL
cells (3).2 Therefore, we
examined the HLA-E alleles for differential surface expression levels
and, having found evidence for this, undertook experiments to
understand the physical basis for these differences. By comparing
differences in peptide affinity, three-dimensional structure, and
thermal stability of the HLA-EG and -ER in
complex with various peptides, we were able to elucidate important differences in the physical characteristics of these molecules that may
form the basis underlying the effective balancing selection that
appears to have been acting on this locus.
 |
MATERIALS AND METHODS |
Cell Culture--
LCL 721.221 was obtained from the ATCC and
maintained in RPMI 1640 medium supplemented with 10% (v/v) fetal calf
serum, 2 mM L-glutamine, and 1 mM
sodium pyruvate. Transfectants were established by electroporation
using the pNS vector followed by G418 selection at 0.8 mg/ml.
Construction of Plasmid, Protein Expression, and
Refolding--
DNA coding for a glycine-serine linker and a BirA
substrate peptide (21) was fused to DNA encoding the
HLA-EG or -ER heavy chains by PCR with the
5'-primer
(CGCGCGAATTCAGGAGGAATTTAAAATGGGCTCCCACTCCTTG and the
3'-primer
(GCGCAAGCTTTTAACGATGATTCCACACCATTTTCTGTGCATCCAGAATATGATGCAGGGATCCCGGCTTCCATCTCAGGGTGACGGGCTCG containing the underlined EcoRI and HindIII
restriction sites, respectively. The 5' primer also contained a
ribosomal binding site, a translational spacer element, an N-terminal
Met, and the first 5 amino acids of HLA-E exon 2. PCR products were
ligated into pHN1+ vector (22) and expressed in Escherichia
coli strain UBS (23). 2-Microglobulin
( 2m) in pHN1+ was kindly provided by D. C. Wiley
(Harvard University, Cambridge, MA) and expressed in E. coli strain XA90.
Both heavy and light chain ( 2m) inclusion bodies were
isolated from cell pellets, washed repeatedly in detergent, and
solubilized in 8 M urea, 25 mM MES, pH 6.0, 10 mM EDTA, and 0.1 mM dithiothreitol (solubilization buffer) as described (24). Refolding was accomplished using a variation of the method of O'Callaghan and co-workers (25) by
dilution of 12 mg of 2m (in 2 ml of solubilization buffer) into 500 ml of 400 mM L-arginine, 100 mM Tris, pH 8.0, 2 mM EDTA, 0.5 mM
oxidized glutathione, 5 mM reduced glutathione, and 0.2 mM phenylmethylsulfonyl fluoride (refolding buffer). After 1 h at 4 °C, 18.5 mg of heavy chain (in 30 ml of solubilization buffer) and 17 mg of peptide (in Me2SO at 1.7 mg/ml)
were added. The initial molar ratio of heavy
chain/ 2m/peptide was 1:2:30. The refolding mixture was
pulsed three times with additional heavy chain at 12-h intervals. After
48 h, the refolding mixture was concentrated initially on a stir
cell (Amicon, Beverly, MA) and subsequently in a 10-kDa cut-off
Centriprep ultrafiltration unit (Amicon). Refolded HLA-E was separated
from aggregates and buffer exchanged into 50 mM Pipes, pH
7.0, 150 NaCl, 1 mM EDTA, and 0.02% NaN3 on a
Superdex 75 prep-grade size exclusion chromatography column (Amersham Biosciences).
Construction of pNS Vector Expressing Fusion
Proteins--
HLA-ER (E*0101) and HLA-EG
(E*0103) cDNAs were prepared from RNA using B-LCL ER or
EG homozygotes by reverse transcriptase and PCR as
described (26). The mature full-length proteins were fused to exon 1 of
HLA-A2, -B27, -C7, -C14, -C15, or -G, respectively, using PCR and
appropriately designed primers, and the chimeric cDNAs were then
cloned into the pNS vector (27).
Immunofluorescence Staining and FACS Analysis--
Cell surface
expression of different HLA-E constructs was measured by indirect
immunofluorescence staining as previously described (13). Briefly,
cells were preincubated with a saturating concentration of monoclonal
antibody 3D12 followed by washing and labeling with fluorescein
isothiocyanate-conjugated goat F(ab')2 anti-mouse Ig
(BioSource, Camarillo, CA). Samples were analyzed on a FACScan cytometer (Becton Dickinson, Mountain View, CA).
Measurement of Relative Peptide Affinities--
Peptide binding
to HLA-EG and -ER was compared and quantified
using a sandwich enzyme-linked immunosorbent assay method essentially similar to that recently described (28). Briefly, polystyrene (96-well)
plates were coated with 100 µl of HLA-E-specific monoclonal antibody
3D12 (13) diluted in sodium carbonate buffer (pH 9.6) at a
concentration of 20 µg/ml. 100 µl of HLA-E folded with different peptides at 1:250 dilution in 2% bovine serum
albumin/phosphate-buffered saline was added into each well after the
excess of the coating monoclonal antibody was removed, and the
uncoupled sites were blocked with 5% skim milk in phosphate-buffered
saline. Plates were incubated for 1 h at room temperature and
washed three times with 0.05% (v/v) Tween 20 in phosphate-buffered
saline. After a 1-h incubation of 0.2 µg/ml peroxidase-conjugated
rabbit anti-human 2m (Dako) in 2% bovine serum
albumin/phosphate-buffered saline, plates were washed, and 100 µl of
tetramethyl benzidine substrate (BioSource) was added into each well.
15-min incubation at room temperature was stopped by adding 100 µl of
2 M H2SO4 into each well.
To measure peptide-dependent refolding of HLA-E, 2 M of 2m was refolded with 1 M
heavy chain and peptide at various concentrations as the refolding
condition described above, except the refolding mixtures were reacted
for 1 h at 4 °C. The relative amount of HLA-E refolded in the
presence and absence of added peptide was quantified and compared with
maximum assembly achieved using 100 µM VMAPRTLVL (the
HLA-B7 nonamer). Peptide concentrations yielding half-maximum assembly
were read directly from the curve and used to compare relative binding
to EG and ER. This assay thus gives an indirect
estimate of relative affinity as described (28).
Western Blotting and Immunodetection--
Total cell lysate was
prepared and separated on a 14% Tris-glycine gel (Novex, San Diego,
CA) and electroblotted as described (13). HLA-E protein was detected by
monoclonal antibody 7G3 followed by horseradish peroxidase-labeled goat
anti-mouse Igs (BioSource) at 1:5,000 dilution and finally with an
enhanced chemiluminescence system (ECL; Amersham Biosciences).
Densitometry was performed by scanning the x-ray film with a Sharp
JX-320 scanner and quantified with ImageQuant 5.0 software (University
of Virginia ITC-Academic Computing Health Sciences).
CD Thermal Denaturation Curves--
Data were collected with an
AVIV 62A DS CD spectropolarimeter equipped with a thermoelectric cell
holder. Samples consisted of 7 µM protein buffered to a
pH of 7.0 with 10 mM potassium phosphate. Thermal
denaturation curves were collected at 219 nm, the wavelength of the
maximal difference between native and denatured protein CD spectra,
over a temperature range of 25-85 °C using a 1-cm path length
cuvette. The time constant was 1 s, averaging time was 15 s,
and equilibration time was 30 s with a bandwidth of 1 nm. All
curves were normalized to a single reference curve by application of a
simple scalar multiplier. Each curve represents the point-by-point
average of three separate denaturation runs, averaged after
normalization. Melting temperatures (Tm) were
estimated as the inflection point of polynomials fitted to the averaged
curves; we estimate the accuracy of these measurements to be within
0.5 °C.
Crystallization and X-ray Crystallography--
Crystals of
HLA-EG with the HLA-B7 nonamer (VMAPRTVLL;
EG-B7) or HLA-EG with the HLA-B27
peptide (VTAPRTLLL; EG-B27) were grown by vapor diffusion
at 22 °C over a reservoir of 2.2 M
(NH4)2SO4, 2% PEG
(Mr = 400) and 100 mM Tris (pH 8.0), conditions similar to those of O'Callaghan and co-workers (25). Crystals were cryopreserved for data collection by using a mother liquor with 30% (w/w) sucrose. The EG-B7 data set was
collected at 170 °C at beamline 5.0.2 at the Advanced Light Source
(Lawrence Berkeley National Laboratory, Berkeley, CA). The
EG-B27 data set was collected at 170 °C on an in-house
Rigaku Raxis IV area detector. There are two molecules per asymmetric
unit for both complexes. Diffraction data were processed with DENZO and
SCALEPACK (29) (see Table I).
View this table:
[in this window]
[in a new window]
|
Table I
Crystallographic statistics
Values for the highest resolution shell are shown in parentheses.
Rsym |I I |/ I , where I is the
observed intensity and I is the mean intensity of
multiple observations of symmetry-related reflections.
RCryst, RFree Fo| |Fc / |Fo| where Fo and
Fc are the observed and calculated structure factor
amplitudes. RFree is calculated from a randomly
chosen 10% of the HLA-EG/B7 reflections excluded from
refinement (33). Ramachandran values were calculated with PROCHECK
(49). Superpositions were calculated on all common C s: 382 for
ER/ER and ER/EG comparisons and 383 for
EG/EG comparisons. rmsd, root mean square deviation.
|
|
Since the EG-B7 crystals were nearly isomorphous to the
original ER-B7 crystals (25), the coordinates (Brookhaven
Protein Data Bank (30) file 1mhe), stripped of waters and the side
chain of residue 107, were fitted by rigid body refinement using the CNS software package (31). The model was rebuilt using the xfit module
in XtalView (32) against a composite omit map calculated in CNS.
Simulated annealing torsional refinement, using the maximum likelihood
target function mlf in CNS, was followed by alternating rounds of
rebuilding, positional (using the mlf target function), and group
B-factor refinement. The progress of the refinement was confirmed by
the monotonic decrease in both Rcryst and
Rfree (33). Loose noncrystallographic symmetry
restraints were applied globally until it was realized that one loop
differed between molecules in the asymmetric unit, when
noncrystallographic symmetry restraints were removed from that loop.
The electron density maps were clear, unambiguous, and readily
interpretable except in regions where residues have been built as
glycines or alanines due to poor side chain density: heavy chain
residues 17 (molecule 1 only), 54, 176, 196, 225 (molecule 2 only), 226 (molecule 2 only), and 256 and 2m residues 19 and 75. Building and refinement of the EG/B27 structure proceeded
by a similar protocol except that the EG-B7 structure was
used as the starting point. In order to maintain the independence of
the test set, the test reflections for this data set were matched to
the EG-B7 test reflections (34). Both structures include a
single ordered sulfate molecule bound between platform domains. The
same side chains are missing as for HLA-EG-B7, except that
-chain residue 226 of molecule 2 has been modeled. Both structures
include interpretable density for residue 1, not visualizable in the
HLA-ER structures. Refinement statistics for both
structures are given in Table I.
 |
RESULTS |
HLA-E Alleles Are Differentially Expressed at the Cell
Surface--
In previous studies of HLA-E allelic distribution, it was
hypothesized that balancing selection might be acting on the two HLA-E
alleles, possibly reflecting a functional difference between them (20).
In this regard, it was noteworthy that HLA-E allelic variation greatly
affected the intracellular transport and cell surface expression of
HLA-E when transfected into mouse cells (35). In order to gain further
insight into what distinguishes the HLA-EG and
-ER complexes, we constructed a set of hybrid genes similar
to that previously described (13). Each of these hybrid genes contained the signal sequence derived from an HLA-A, -B, -C, or -G gene physically connected to the HLA-EG or -ER
mature protein coding sequences. The HLA signal sequence nonamers available for binding to HLA-E by each of these constructs were representative of those widely available in populations. In addition, the B27 nonamer has been shown to bind poorly to the HLA-ER
protein, and the HLA-C7- and HLA-G-derived nonamers have been shown to
interact differentially with the CD94-NKG2 ligands (14). Thus, a
representative set of HLA-E-nonamer peptide complexes was available for
comparison as discrete complexes.
Each of these cDNA constructs was cloned into vector pNS and
expressed in 721.221 cells in order to look first at the expression levels both intracellularly and on the cell surface. Fig.
1 shows the results of FACS analysis,
which showed that in every case of peptide-HLA-E complex formed, the
ER complex appeared at lower surface levels than did
EG. This was most pronounced in the case of the B27-derived
nonamer, since little or no HLA-ER complex was expressed on
the surface of these cells. These differences were apparently not due
to lower overall levels of HLA-E protein in these cells as evidenced by
Western analysis measuring relative levels of the two allelic heavy
chains as roughly equal (Fig. 1, bottom). The small
differences that were apparent from this measure were significantly
less than those measured on the cell surface (e.g. B27).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 1.
Differential surface expression of
HLA-EG and HLA-ER on transfected .221 cells. Top, hybrid cDNA constructs with various
HLA-A, -B, -C, or -G leader peptides fused to each of the
HLA-EG and HLA-ER mature protein coding
sequences and cloned into vector pNS. Six pairs of constructs were
transfected into class I negative 721.221 cells, and surface expression
was assayed using anti-E-specific reagent 3D12 in FACS analysis.
Boldface traces are from constructs made using
the HLA-EG coding sequence, and dotted
traces represent constructs using the HLA-ER
coding sequence. Shaded traces represent
isotype-matched control antibody staining either transfectant. The
leader sequence used for each construct is indicated in the
upper right corner of each histogram.
Bottom, Western analysis performed on the 12 transfected
cells and untransfected .221 cells showed relatively equal levels of
HLA-E protein in each of the transfectants. Numerical ratios of
densitometry tracings of the pairs connected by lines are indicated
under the Western blot as
HLA-EG/HLA-ER.
|
|
Whereas the transfected hybrid constructs allowed us to measure the
relative expression levels of HLA-ER and -EG
with individual peptides, we examined the relative expression levels in
B LCLs from individuals that were typed as HLA-ER or
-EG homozygous in order to see whether these differences
were reflected in normal cells (where more than one nonamer peptide
might be available). After identifying several lines that were
homozygous, they were further matched with regard to the nonamer
peptides that were available for HLA-E binding. In some cases, this
meant that the HLA-A, -B, and -C allotypes were the same, but in many cases these types were distinct, since the nonamers available for HLA-E
binding are shared among several alleles and even between loci
(e.g. HLA-A1 and -Cw14). Again, the relative differences in
expression levels between the allelic variants were clearly evident; in
each case, the EG homozygous cells expressed higher levels
of HLA-E complex (Fig. 2). There was some
difference in the relative levels depending on the different mix of
nonamer peptides available (e.g. compare A with B). To some
degree, this was reflective of the relative differences found between
the hybrid constructs and individual nonamers. However, it was
interesting to find that not only the nonamer peptide but also the
HLA-A, -B, and -C allotypes appeared to influence surface
expression. The relative surface levels of the two alleles differed
markedly, with highly similar HLA-A, -B, and -C alleles providing
nonamer as shown in Fig. 2C (A*3201, B*4402, and C*0501
providing peptide to HLA-ER and HLA-A*3303, B*44031, and
C*1403 providing peptide to HLA-EG). In contrast, a
significantly narrower difference in surface expression levels was
detected in Fig. 2D despite the fact that the same nonamers
found in Fig. 2C pair were available for binding (HLA-ER with HLA-A*0101, B*3701, and C*0602
versus HLA-A*2902, B*44031, and C*1601 with
HLA-EG-bearing LCLs).

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 2.
Differential surface expression of
HLA-EG and HLA-ER on LCLs expressing various
HLA allotypes. Individuals and their corresponding LCLs were
identified as homozygous for HLA-EG or HLA-ER
as described (19). Cell lines were paired by choosing two LCLs that
were homozygous for each of the HLA-EG and
HLA-ER alleles and also had HLA-A, -B, and -C allotypes,
which provided identical nonamer peptides to HLA-E. FACS analysis of
five pairs of such LCLs are shown each stained with anti-E reagent
3D12. Boldface traces are from cells expressing
only the HLA-EG allele, whereas dotted traces
are from cells expressing only the HLA-ER allele.
Shaded traces are from analysis using
isotype-matched negative control antibody staining. The nonamer
peptides derived from the HLA-A, -B, and -C allotypes and available to
HLA-E for complex formation are listed above the
corresponding FACS profile. The HLA types of the LCLs examined are as
follows. A, HLA-ER: A*0201, B*3501, and C*0401;
HLA-EG: A*6802, B*5301, and C*0401. B,
HLA-EG: A*0101, B*0801, and C*0701; HLA-EG:
A*0101, B*0801, and C*0701. C, HLA-ER: A*3201,
B*4402, and C*0501; HLA-EG: A*3303, B*44031, and C*1403.
D, HLA-ER: HLA-A*0101, B*3701, and C*0602;
HLA-EG, HLA-A*2902, B*44031, and C*1601. E,
HLA-ER: A*0101, B*4101, and C*1801; HLA-EG:
A*0101, B*4901, and C*0701. F, HLA-ER:
A*0202/A*1101, B*1501/B*3501, and C*0401/C*0303; HLA-EG:
A*2403/A*3303, B*4601/B*1512, and C*0102/C*03.
|
|
Measuring Differential Peptide Affinity for HLA-ER and
-EG--
As one of three required components for folding a
functional class I molecule, peptide has the ability to alter complex
formation through the binding energy available, through its interaction with heavy chain, to stabilize the folded structure. Therefore, peptide
affinity is indirectly reflected by complex folding efficiency. We used
a qualitative measurement, based on the ability of peptide at different
concentrations to drive the formation of complex in a refolding mixture
as described (28), as an estimate of the affinity for different
peptides of the EG and ER alleles. The results
of this experiment, using seven distinct nonamer peptides, are shown in
Fig. 3, where increasing peptide concentrations are titrated against constant levels of each of the two
allelic heavy chains and 2m. In each case, the relative affinity of the EG heavy chain for peptide was
significantly greater than that of ER, largely reflecting
the relative differences found in surface levels when single
allele-peptide combinations were examined (Fig. 1). The most dramatic
affect was seen using the HLA-B27-derived nonamer, where little complex
could be formed with the ER heavy chain even at high
peptide concentrations. Higher (but still relatively low) affinity for
the EG allele was apparent, although at high concentrations
both complexes could be refolded and intact complex isolated (see below
for stability measurements).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
Differential peptide affinity for
HLA-EG and HLA-ER. Top, the
results of enzyme-linked immunosorbent assay using antibodies 3D12
plate-bound and peroxidase-conjugated rabbit anti-human
2m (Dako) to assay refolded material are diagrammed for
each of seven pairs of refolding experiments. The concentration
required for refolding was quantified and compared with maximum
assembly achieved using 100 µM VMAPRTLVL. Relative
amounts are indicated on the vertical axis, and
the logarithmic scale of peptide concentrations is indicated on the
horizontal axis. The peptide used in each
refolding is indicated in the upper left
corner of the graph, and the HLA allele from which the
sequence was derived is indicated immediately below.
Bottom, comparison of median peptide concentrations required
for HLA-EG and HLA-ER complex refolding. The
concentration of peptide required to refold 50% of the HLA-E complex
is presented for each of the peptide and HLA-EG and
HLA-ER heavy chain combinations. Peptide sequences used are
indicated at the left of the graph. Solid
bars indicate results using the HLA-EG heavy
chain, and open bars indicate HLA-ER
refolding results. The asterisks indicate that the tested
peptide concentrations did not achieve median refolding levels.
|
|
The relative difference in peptide concentration required to achieve
refolding of the two alleles was substantial as measured by the point
at which 50% of heavy chain was converted to refolded complex (Fig.
3). Differences of over 2 orders of magnitude were apparent between
alleles when the B7-derived nonamer VMAPRTVLL was used. Smaller
relative differences were seen for other nonamers, varying from 7-fold
to over 14-fold. The two poorest drivers of refolded complex formation
were the Cw7- and the B27-derived nonamers; the latter was shown to
yield relatively low levels of the HLA-EG complex on the
cell surface and almost nonexistent surface levels of the
HLA-ER complex. Interestingly, when the HLA-Cw7-derived
nonamer is complexed with HLA-E (either allele), the complex formed is
not functional in the interaction between HLA-E and CD94-NKG2A despite
promoting the formation of stable surface-expressed HLA-E (14).
Thermal Stability of HLA-E in Complex with Different Peptides by
CD--
In order to assess the effect of substitutions at position 107 or in the bound peptide on the thermal stability of HLA-E, we
determined the melting transition temperature (Tm) by following the thermal denaturation of different HLA-E-peptide complexes by CD spectroscopy (see Fig.
4). Three different peptides were used in
these experiments, derived from the leader peptides of HLA-B7
(VMAPRTVLL), HLA-B27 (VTAPRTLLL), and HLA-G (VMAPRTLFL). Data were also
collected from "empty" HLA-E molecules refolded in the absence of
added peptides. Prior studies have shown that classical MHC class I
proteins (H-2Kd) have Tm values in the
range of 52-61 °C depending upon the peptide used, whereas
"empty" molecules have a Tm of 45 °C (36,
37). In these experiments, the HLA-G- and HLA-B7-derived peptides yield
identical Tm values when bound by either HLA-EG (Tm = 52 °C) or
HLA-ER (Tm = 49 °C), suggesting that
these substitutions at positions P7 and P8 do not affect stability.
This is consistent with the results of the crystallographic analyses;
the residue at P7 is either of the relatively conservative pair of
valine or leucine, with the small movements at the C of this peptide residue (<1 Å) correlated more with which position the molecule occupies in the asymmetric unit and not with the identity of the P7
residue (see below); the side chain of residue P8 extends into solvent.
HLA-EG-peptide complexes uniformly display higher
Tm values than the corresponding HLA-ER
complexes: 52 °C for the HLA-EG-B7 complex
versus 49 °C for the HLA-ER-B7 complex, and
49 °C for the HLA-EG-B27 complex versus
43 °C for the HLA-ER-B27. This relationship holds true
for the Tm values of the "empty" molecules:
HLA-EG-empty (44 °C) versus
HLA-ER-empty (40 °C). We would argue that even these
relatively modest differences in Tm are significant,
given the quality of the data as evidenced by the nearly complete
overlap of the G and B7 peptide curves.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 4.
Thermal denaturation curves for HLA-E
molecules. Shown are plots of ellipticity (monitored at 219 nm)
versus temperature for the unfolding transition of
HLA-EG refolded with three different peptides
(top panel); HLA-ER refolded with
three different peptides (middle panel); and
HLA-EG and HLA-ER refolded in the absence of
added peptide (bottom panel). Each curve
represents the average of three separate denaturations. The
gray band indicates the range of
Tm values reported for different classical MHC class
I-peptide complexes, and the dashed line
indicates the Tm of an "empty" complex (36,
37).
|
|
Crystallographic Analysis of HLA-EG--
In order to
determine the structural consequences of (i) the arginine-to-glycine
substitution at position 107 and (ii) the substitutions present in
different HLA leader-derived peptides presented by HLA-E, we determined
the structures of HLA-EG in complex with two different
peptides by x-ray crystallography: VMAPRTVLL (derived from the HLA-B7
leader) and VTAPRTLLL (derived from the HLA-B27 leader). The structures
were determined at resolutions of 2.8 and 3.1 Å, respectively, using
the previously determined HLA-ER-B7 crystal structure (38)
as an initial phasing model. Since there are two molecules per
asymmetric unit for each of the three complexes, which we refer to as
positions 1 and 2, together these analyses yield a total of six
independent views of the HLA-E structure. Great care was taken during
the EG refinements to minimize model bias, including the
stringent use of composite omit maps in the initial phases of rebuilding.
The crystallographic analysis revealed the expected, classic MHC class
I fold (39), with the heavy chain, or -chain, folded into the
peptide-binding 1 2 platform domain and immunoglobulin-like 3
domain, associated with the invariant, immunoglobulin-like light chain
( 2m; see Fig.
5A). The six
independent views of the HLA-E structure are all extremely similar,
with pairwise superposition root mean square deviations, calculated on
all common C s, of between 0.11 and 0.85 Å (Table I). The most
pairwise similar models are the EG-B7 and
EG-B27 molecules sitting at position 1 in the two different
EG asymmetric units, followed closely by the
EG-B7 and EG-B27 molecules sitting at position
2; the largest differences occur between the molecules at position 1 or
2 in either of the two EG structures. The two
ER-B7 molecules (positions 1 and 2) are much more similar
to each other than either pair of EG molecules (positions 1 and 2) because of the application of much tighter noncrystallographic
symmetry restraints in the ER analysis. Differences in
EG structures at the two positions in the asymmetric unit
reflect, in part, the affect of the different crystal environments at
the two positions on flexible loops and side chains of solvent-exposed residues. Differences between EG and ER
structures are probably somewhat influenced by the slight differences in the crystallization regimens.

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 5.
Structures of HLA-E in complex with different
peptides. A, two orthogonal views (left and
middle) of the superposition of ribbon
representations of the six different HLA-E crystal
structures are shown, colored as indicated
(right), with 2m shown in gray.
-Strands are shown as arrows, and -helices are shown
as coils; the bound peptides are shown in stick
style. The two molecules of HLA-ER are from PDB
file 1mhe (38); the four HLA-EG molecules are from the two
independent crystal structures reported here. The arrows
indicate the position of residue 107, with its C shown as a
sphere. The CD8 loops are circled. B,
a ribbon representation of the proposed model of the NKG2A-CD94-HLA-E
complex (41) is shown on the left. The HLA-E chain is
colored by secondary structure (yellow,
-helix; green, -strands; blue, coil),
2m is colored red, CD94 is
colored purple, and NKG2A is colored
blue. -Strands are shown as arrows, and
-helices are shown as coils; the bound peptide is shown
in space-filling style colored by atom type
(carbon (gray), oxygen (red), nitrogen
(blue), and sulfur (yellow)). An arrow
indicates the position of residue 107 (yellow
spheres). In the middle, rotated by 30° around
the vertical axis relative to the view on the
left, the NKG2A-CD94-HLA-E complex model is shown in
space-filling style, colored by domain (NKG2A
(blue), CD94 (purple), 1 2 platform
(orange), 3 (red), and 2m
(gray)). Arg107 is colored
yellow. The bar spans the 12-Å distance between
the nearest atoms of CD94 and Arg107. On the
right is shown a detailed view, in stick
style and colored as in A, of the
interactions residue 107 makes with its neighbors in the six HLA-E
structures. Hydrogen bonds are shown as dotted
green lines. The orientation of the detail view
is similar to that of the middle view. C, a
stereoview of the P2 binding pocket is shown, with the backbone ribbon
of one HLA-EG structure, colored
blue, and the side chains of residues lining the P2 pocket
(in stick style) from all six different HLA-E
structures, colored as in A. The side chains and
the P2 peptide residue are labeled. D, left, a
representation of the HLA-A2-CD8 complex structure (PDB file 1ajk
(40)) is shown, with HLA-A2 shown in a ribbon
representation as in B and with the two domains
of CD8 shown in space-filling style and colored
either blue or purple. The CD8 binding
loops (residues 222-229, within the white dashed circle) from all six HLA-E
structures (colored as in A) and the
H-2Kb-CD8 complex structure (gray; PDB
file 1bqh) are superimposed on the HLA-A2-CD8 complex structure
(loop colored black). Right, a
detailed view of the CD8 loops is shown.
|
|
The largest differences among the HLA-E structures (Fig. 5A)
occur at the loop corresponding to the region of classical MHC class I
proteins associated with CD8 binding (residues 222-229) (40). The
backbone of this loop moves by up to 4.6 Å between matching C s
between the molecules at positions 1 and 2 in the two EG
complex structures, although this loop retains a similar conformation in both molecules at either position 1 or 2 in the two structures. The
loop adopts a similar conformation in both ER molecules
(positions 1 and 2), again probably due to the tighter noncrystallographic symmetry restraints, intermediate between the
conformation seen in either of the molecules at position 1 or 2 in the
EG structures. When the CD8 loops (residues 216-230) are
excluded from pairwise superpositions, the root mean square deviation
values fall to between 0.50 and 0.66 Å. There are less dramatic
differences in the loops formed by residues 133-139 and residues
193-199. However, the CD8 binding loop and the 133-139 loop are
involved in crystal contacts; therefore, these loops may be best
described as conformationally ill defined, or flexible, loops that have the particular conformations observed in the crystal structures selected by packing interactions and/or the particular
crystallization/cryopreservation conditions. Our analysis therefore
suggests that the failure of HLA-E to bind CD8 is not strictly due to
constraints holding this loop in a nonbinding conformation imposed in
the context of the HLA-E heavy chain.
Structural Affect of the Gly/Arg Allelic
Substitution--
The arginine-to-glycine substitution has a very
limited effect on the structure of HLA-E; the C positions of
residues 104-109 are within 0.8 Å of each other among the six
different structures, and the side chains adopt comparable rotamers and
conformations. This substitution does result in the elimination of a
hydrogen bond between the side chains of Arg107 and
His3 and in the apparent, slight rearrangement of the
hydrogen bond network around the residues surrounding position 107 in
the ER versus EG structures (Fig.
5B). However, structural changes in this neighborhood are
more dramatic between the molecules at positions 1 and 2 in the
EG structures than between corresponding EG and
ER structures, suggesting that these residues are more
strongly affected by the crystal environment (residue 107 lies in a
loop contacting the 3 domain of a neighboring molecule) than by the arginine-to-glycine substitution.
The residue at position 107 in HLA-E is not expected to directly or
indirectly affect the interaction with NKG2-CD94 heterodimeric receptors on the basis of a model of the NKG2A-CD94-HLA-E complex derived from the structure of the NKG2D-MICA NK cell receptor-ligand complex (41). In this model (see Fig. 5B), CD94 overlies the 1 domain of HLA-E, with a small hydrophobic patch on CD94
(Phe114 and Leu162) matching a similar patch on
HLA-E (Ile73, Val76, and the side chain of the
P8 residue in the peptide, leucine in the crystal structure). There is
no comparable hydrophobic patch on the 2 domain of HLA-E underlying
the presumed position of the NKG2 moiety, but Phe114 and
Leu162 are replaced with serine and lysine, respectively,
in the sequences of both NKG2A and NKG2C, thus accommodating this
change. The 6 strand and the 6/ 7 loop in CD94 are dominated by
four acidic residues (Asp163, Asp168,
Glu164, and Glu167) that match a cluster of
charged residues on HLA-E (Asp69, Arg75,
Lys146, and ArgP5). The binding site on NKG2A
is dominated by charged and polar residues (Glu58,
Arg62, Arg65, His155,
Asp162, Glu166, and Lys170), which
would overlie a similarly charged surface on HLA-E (Arg75,
Arg79, Arg82, and Gln72). The side
chain of the arginine at the P5 position in the peptide would be able
to exchange hydrogen bonds with residues from either NKG2 or CD94 at
the homodimer interface. Gln112 in the 2/ 1 loop of
CD94 is in position to reach into the peptide binding groove,
hydrogen-bonding to the peptide backbone at either P4 or P5. In this
model, no atom in any allowed conformation of the side chain of an
arginine at position 107 approaches closer than 9 Å to any atom in NKG2A.
Effect of Different Peptides on Structure--
The HLA-E structure
is even less affected by the methionine-to-threonine substitution
between the HLA-B7- and HLA-B27-derived peptides at the P2 position
(see Fig. 5C) or the leucine-to-valine substitution at the
P7 position. There are no significant conformational differences among
HLA-E residues lining the corresponding pockets for these peptide
residues. There are minor differences in the side chain of
Ser24 in the P2 pocket, which adopts different rotamers in
the HLA-ER versus the HLA-EG
structures, although these differences may be the result of different interpretations of moderate resolution electron density maps. The
methionine-to-threonine substitution at P2 does increase the volume of
a cavity, located adjacent to the P2 side chain, from ~31 to 53 Å3, a direct consequence of the smaller size of the
threonine side chain and the lack of compensating rearrangements of
pocket residues. Such cavities have been directly linked to protein
stability in other studies (42), and this is the likeliest explanation
for the effect different peptides have on HLA-E stability (see below).
 |
DISCUSSION |
In the present study, we opened a thorough investigation of the
biochemical differences between the two nonsynonymous HLA-E alleles.
This study was motivated primarily by our initial observation that, in
most cases, the HLA-EG allele was expressed at higher
levels than the HLA-ER allele in human transfected cells
regardless of which peptide was bound. This observation was confirmed
by a similar comparative analysis of HLA-E expression on normal cells,
where, to a degree depending on the available classical class I signal
sequences, the HLA-EG allele was expressed at significantly
higher levels. Since studies have suggested that cell surface levels of
HLA-E can affect the signaling through CD94-NKG2 (3, 14, 43), such a
physical difference in cell surface expression levels might be
translated into functional differences between these molecules. An
additional dimension of complexity is introduced by the identity of the
bound peptide and the particular allele, since such functional
differences have been demonstrated to depend on these factors for HLA-E
(14).
We first considered the possibility that the substitution of glycine
for arginine at position 107 would result in structural differences
between the two alleles, and since the crystal structure of
HLA-ER had been solved (38), we undertook the
crystallographic analysis of HLA-EG complexed with two
different peptides. However, the structures of the peptide-binding,
1 2 platform domains of HLA-E with either peptide bound to
either of the two alleles are essentially identical within the accuracy
of the analysis. Therefore, the structures do not immediately provide
an explanation for the significant difference in the stability of the
two alleles. The one structural difference that is observed between
HLA-EG and HLA-ER is the presence of an
additional hydrogen bond in the HLA-ER molecule involving
the side chain of arginine 107, although this might naively imply that
the HLA-EG allele would be less stable than the
HLA-ER allele, the opposite of what is observed. Likewise,
the presence of an additional glycine in the HLA-E sequence would be
predicted to result in a larger loss of entropy during folding,
destabilizing the HLA-EG structure relative to
HLA-ER, again the opposite of what is observed.
Direct affects on stability, and thus indirect affects on cell-surface
half-life and peptide or receptor affinity, can be explained by the
gain or loss of stabilizing interactions between HLA-E alleles and the
various bound peptides. Differences in the identity of the P2 residue
of the peptide result in cavities within the peptide-platform domain
complex structure by varying the quality of fit of the different
peptides into an apparently rigid protein structure. The relative
quality of the fit of peptide into platform correlates well with the
differences in thermal stability and cell surface expression levels
measured for HLA-E complexes with different peptides. As a consequence,
each allele shows differing affinities with distinct peptides in a
manner that correlates with the differing stability. The
HLA-B27-derived nonamer provides a striking example of this difference.
The HLA-EG heavy chain does form complexes with the B27
nonamer, albeit at relatively high concentrations, whereas the
HLA-ER molecule does not bind the nonamer under the
conditions tested. This is reflected precisely in surface expression
using the hybrid constructs with the B27 signal sequence fused to
either HLA-E allele, where no detectable HLA-ER was
observed on the surface of 221 transfectants, whereas significant levels of surface HLA-EG were observed under the same
conditions, and in Tm measurements, where the
stability of HLA-ER refolded in the presence of the B27
peptide is comparable with peptideless MHC class I proteins.
The stability of the complexes was also consistent with a melting
temperature of some 5 °C higher for the HLA-EG/B27
nonamer complex. Indeed, with all peptides tested, completely consistent differences were observed between the alleles among all
three measures of cell surface expression level, peptide affinity, and
complex stability. Thus, the differences in expression levels are not
due exclusively to the affinities for available peptide or to any other
single factor, but instead are due to the interrelated combination of
relative affinity and stability of the refolded complex. The
measurements of stability show clearly that the EG complex
has a significantly higher melting temperature over ER
regardless of the peptide bound. Further, it is unlikely that peptide
is limiting, since classical class I molecules, the source of peptide,
are over 20-fold more abundant than the HLA-E complex (13). Further,
previous peptide feeding experiments had indicated that steady state
HLA-E levels were controlled by the half-life of the complex and
not by limiting peptide (3, 14).
Although these studies implicate differing surface levels of HLA-E as a
possible modulator of ligand interaction, we have not ruled out an
effect of the substitution at residue 107 as altering an interaction
between HLA-E and CD94-NKG2. In experiments carried out with
transfectants in vitro, essentially similar results were
observed regardless of the HLA-E allele used (3). Nevertheless, subtle
effects that may have significance in vivo would probably not be detected in these experiments. However, no differences were
observed in comparisons of HLA-EG and HLA-ER
structures that would directly or indirectly affect the interaction with NKG2-CD94 heterodimers. The possibility that TCRs recognize HLA-E
directly (44) adds the possibility that this position affects
interactions with receptors other than NKG2-CD94. Therefore, it is at
least conceivable that the allelic variation has two effects on ligand
interaction, one determining quantitative differences in the amount of
HLA-E complexes on the cell surface at any given time and the second
distinguishing the molecules qualitatively through alterations in the
effective affinity for interacting receptors.
The level of selection acting on the HLA-E locus to balance these
alleles in the population is not entirely clear, although at least two
possibilities can be envisioned. Whereas the present study was limited
to an examination of HLA class I signal sequence-derived peptides,
TCR-derived peptides have been reported to bind and be presented by
HLA-E (45). If, as these studies suggest, HLA-E does prove to be
involved in TCR V peptide presentation, the likelihood that these
peptides show differential binding between the two alleles seems
plausible. Indeed, of the seven peptides tested, in every case the
relative affinity of peptide was higher for HLA-EG (Fig.
3). Evidence for pathogen-derived peptides binding and being presented
by HLA-E has also been suggested (46), and evidence for recognition of
HLA-E by TCR / seems to support such a possibility (44). It
therefore is conceivable that selection for maintenance of two HLA-E
alleles could be acting at the level of regulation of peripheral T cell
function, of pathogen-mediated immune recognition, or both.
Alternatively, an additional and significant level of balancing
selection might operate via HLA-E expression in the placenta. Several
facts go together to implicate this as a mechanism for a relatively
rapid stabilization of a new allele in a population. First, placental
trophoblasts expressing HLA-G also express HLA-E complexed with the
HLA-G nonamer (47). A relatively large difference in
binding affinity, derived from the differential ability of peptide to
foster protein folding, between HLA-EG and
HLA-ER for the HLA-G nonamer was observed (Fig. 3),
suggesting a relative difference in surface expression levels between
these alleles in the placenta. Since the HLA-E/G nonamer complex can
evoke an inhibitory or stimulatory response from NK cells (14) and
since relative surface levels are likely to directly influence the
efficiency of either inhibition or stimulation via CD94-NKG2, it is
plausible that there is significant room for modulation of function in
the arena of the maternal-placental immune interaction. Indeed, a unique NK response is associated with pregnancy (48), and rather than
acting to inhibit NK activity in the maternal decidua, HLA-E may indeed
act to stimulate NK to secrete cytokines appropriate for a stable
immunological environment. The proper balance of inhibition and
stimulation to yield a stable pregnancy may require higher or lower
levels of HLA-E, depending upon other immunological and genetic factors
present, thus conceivably providing strong selection on a newly
introduced HLA-E allele.
 |
ACKNOWLEDGEMENTS |
We thank Robert Fleming-Jones for assistance
with crystallization and L. Hung, G. McDermott and T. Earnest (Advanced
Light Source, Lawrence Berkeley National Laboratory) for assistance with data collection. The outstanding technical assistance of Mark
Morris is gratefully acknowledged.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
(NIH) Grant R01 AI48675 and the Pendleton Fund (to R. K. S.) and by
NIH Grants R01 AI38508 and AI49213 (to D. E. G.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The atomic coordinates and the structure factors (code 1KPR and 1KTL) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).
§
To whom correspondence may be addressed: Fred
Hutchinson Cancer Research Center, 1100 Fairview Ave. N., A3-023,
Seattle, WA 98109. Tel.: 206-667-5587; Fax: 206-667-6877; E-mail:
rstrong@fhcrc.org.
To whom correspondence may be addressed: Fred
Hutchinson Cancer Research Center, 1100 Fairview Ave. N., D4-100,
Seattle, WA 98109. Tel.: 206-667-4668; Fax: 206-667-6948; E-mail:
geraghty@fhcrc.org.
Published, JBC Papers in Press, October 30, 2002, DOI 10.1074/jbc.M208268200
2
N. Lee, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
MHC, major
histocompatibility complex;
2m, 2-microglobulin;
MES, 4-morpholineethanesulfonic acid;
Pipes, 1,4-piperazinediethanesulfonic acid;
NK, natural killer;
FACS, fluorescence-activated cell sorting;
LCL, lymphoblastoid cell
line.
 |
REFERENCES |
| 1.
|
Townsend, A.,
and Bodmer, H.
(1989)
Ann. Rev. Immunol.
7,
601-624[Medline]
[Order article via Infotrieve]
|
| 2.
|
Geraghty, D. E.,
Koller, B. H.,
Hansen, J. A.,
and Orr, H. T.
(1992)
J. Immunol.
149,
1934-1946[Abstract]
|
| 3.
|
Lee, N.,
Llano, M.,
Carretero, M.,
Ishitani, A.,
Navarro, F.,
Lopez-Botet, M.,
and Geraghty, D. E.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
5199-5204[Abstract/Free Full Text]
|
| 4.
|
Kovats, S.,
Main, E. K.,
Librach, C.,
Stubblebine, M.,
Fisher, S. J.,
and DeMars, R.
(1990)
Science
248,
220-223[Abstract/Free Full Text]
|
| 5.
|
Geraghty, D. E.,
Wei, X. H.,
Orr, H. T.,
and Koller, B. H.
(1990)
J. Exp. Med.
171,
1-18[Abstract/Free Full Text]
|
| 6.
|
Lepin, E. J.,
Bastin, J. M.,
Allan, D. S.,
Roncador, G.,
Braud, V. M.,
Mason, D. Y.,
van der Merwe, P. A.,
McMichael, A. J.,
Bell, J. I.,
Powis, S. H.,
and O'Callaghan, C. A.
(2000)
Eur. J. Immunol.
30,
3552-3561[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Braud, V. M.,
Allan, D. S.,
O'Callaghan, C. A.,
Soderstrom, K.,
D'Andrea, A.,
Ogg, G. S.,
Lazetic, S.,
Young, N. T.,
Bell, J. I.,
Phillips, J. H.,
Lanier, L. L.,
and McMichael, A. J.
(1998)
Nature
391,
795-799[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Aramburu, J.,
Balboa, M. A.,
Izquierdo, M.,
and Lopez-Botet, M.
(1991)
J. Immunol.
147,
714-721[Abstract]
|
| 9.
|
Aramburu, J.,
Balboa, M. A.,
Ramirez, A.,
Silva, A.,
Acevedo, A.,
Sanchez-Madrid, F., De,
Landazuri, M. O.,
and Lopez-Botet, M.
(1990)
J. Immunol.
144,
3238-3247[Abstract]
|
| 10.
|
Bellon, T.,
Heredia, A. B.,
Llano, M.,
Minguela, A.,
Rodriguez, A.,
Lopez-Botet, M.,
and Aparicio, P.
(1999)
J. Immunol.
162,
3996-4002[Abstract/Free Full Text]
|
| 11.
|
Lazetic, S.,
Chang, C.,
Houchins, J. P.,
Lanier, L. L.,
and Phillips, J. H.
(1996)
J. Immunol.
157,
4741-4745[Abstract]
|
| 12.
|
Perez-Villar, J. J.,
Melero, I.,
Rodriguez, A.,
Carretero, M.,
Aramburu, J.,
Sivori, S.,
Orengo, A. M.,
Moretta, A.,
and Lopez-Botet, M.
(1995)
J. Immunol.
154,
5779-5788[Abstract]
|
| 13.
|
Lee, N.,
Goodlett, D. R.,
Ishitani, A.,
Marquardt, H.,
and Geraghty, D. E.
(1998)
J. Immunol.
160,
4951-4960[Abstract/Free Full Text]
|
| 14.
|
Llano, M.,
Lee, N.,
Navarro, F.,
Garcia, P.,
Albar, J. P.,
Geraghty, D. E.,
and Lopez-Botet, M.
(1998)
Eur. J. Immunol.
28,
2854-2863[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Little, A. M.,
and Parham, P.
(1999)
Rev. Immunogenet.
1,
105-123[Medline]
[Order article via Infotrieve]
|
| 16.
|
Hughes, A. L.,
and Nei, M.
(1988)
Nature
335,
167-170[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Geraghty, D. E.,
Stockschleader, M.,
Ishitani, A.,
and Hansen, J. A.
(1992)
Hum. Immunol.
33,
174-184[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Matte, C.,
Lacaille, J.,
Zijenah, L.,
Ward, B.,
and Roger, M.
(2000)
Hum. Immunol.
61,
1150-1156[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Grimsley, C.,
Kawasaki, A.,
Gassner, C.,
Sageshima, N.,
Nose, Y.,
Hatake, K.,
Geraghty, D. E.,
and Ishitani, A.
(2002)
Tissue Antigens
60,
206-212[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Grimsley, C.,
and Ober, C.
(1997)
Hum. Immunol.
52,
33-40[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Schatz, P. J.
(1993)
Bio/Technology
11,
1138-1143[Medline]
[Order article via Infotrieve]
|
| 22.
|
MacFerrin, K. D.,
Terranova, M. P.,
Schreiber, S. L.,
and Verdine, G. L.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
1937-1941[Abstract/Free Full Text]
|
| 23.
|
Griffin, T. A.,
Yuan, J.,
Friede, T.,
Stevanovic, S.,
Ariyoshi, K.,
Rowland-Jones, S. L.,
Rammensee, H. G.,
and Colbert, R. A.
(1997)
J. Immunol.
159,
4887-4897[Abstract]
|
| 24.
|
Garboczi, D. N.,
Hung, D. T.,
and Wiley, D. C.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
3429-3433[Abstract/Free Full Text]
|
| 25.
|
O'Callaghan, C. A.,
Tormo, J.,
Willcox, B. E.,
Blundell, C. D.,
Jakobsen, B. K.,
Stuart, D. I.,
McMichael, A. J.,
Bell, J. I.,
and Jones, E. Y.
(1998)
Protein Sci.
7,
1264-1266[Medline]
[Order article via Infotrieve]
|
| 26.
|
Fujii, T.,
Ishitani, A.,
and Geraghty, D. E.
(1994)
J. Immunol.
153,
5516-5524[Abstract]
|
| 27.
|
Mazda, O.,
Satoh, E.,
and Imanishi, J.
(1997)
Scand. J. Immunol.
46,
262-267[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Sylvester-Hvid, C.,
Kristensen, N.,
Blicher, T.,
Ferre, H.,
Lauemoller, S. L.,
Wolf, X. A.,
Lamberth, K.,
Nissen, M. H.,
Pedersen, L. O.,
and Buus, S.
(2002)
Tissue Antigens
59,
251-258[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Otwinowski, Z.,
and Minor, W.
(1997)
Methods Enzymol.
276,
307-326[CrossRef]
|
| 30.
|
Berman, H. M.,
Westbrook, J.,
Feng, Z.,
Gilliland, G.,
Bhat, T. N.,
Weissig, H.,
Shindyalov, I. N.,
and Bourne, P. E.
(2000)
Nucleic Acids Res.
28,
235-242[Abstract/Free Full Text]
|
| 31.
|
Brünger, A. T.,
Adams, P. D.,
Marius Clore, G.,
DeLano, W. L.,
Gros, P.,
Grosse-Kunstleve, R. W.,
Jiang, J.-S.,
Kuszewski, J.,
Nilges, M.,
Pannu, N. S.,
Read, R. J.,
Rice, L. M.,
Simonson, T.,
and Warren, G. L.
(1998)
Acta Crystallogr. Sec. D
54,
905-921[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
McRee, D. E.
(1992)
J. Mol. Graphics
10,
44-46[CrossRef]
|
| 33.
|
Brünger, A. T.
(1992)
Nature
355,
472-475[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Kleywegt, G. J.,
and Brunger, A. T.
(1996)
Structure
4,
897-904[Medline]
[Order article via Infotrieve]
|
| 35.
|
Ulbrecht, M.,
Couturier, A.,
Martinozzi, S.,
Pla, M.,
Srivastava, R.,
Peterson, P. A.,
and Weiss, E. H.
(1999)
Eur. J. Immunol.
29,
537-547[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Fahnestock, M. L.,
Tamir, I.,
Narhi, L.,
and Bjorkman, P. J.
(1992)
Science
258,
1658-1662[Abstract/Free Full Text]
|
| 37.
|
Morgan, C. S.,
Holton, J. M.,
Olafson, B. D.,
Bjorkman, P. J.,
and Mayo, S. L.
(1997)
Protein Sci.
6,
1771-1773[Medline]
[Order article via Infotrieve]
|
| 38.
|
O'Callaghan, C. A.,
Tormo, J.,
Willcox, B. E.,
Braud, V. M.,
Jakobsen, B. K.,
Stuart, D. I.,
McMichael, A. J.,
Bell, J. I.,
and Jones, E. Y.
(1998)
Mol. Cell
1,
531-541[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Bjorkman, P. J.,
and Parham, P.
(1990)
Annu. Rev. Biochem.
90,
253-288[CrossRef]
|
| 40.
|
Gao, G. F.,
Tormo, J.,
Gerth, U. C.,
Wyer, J. R.,
McMichael, A. J.,
Stuart, D. I.,
Bell, J. I.,
Jones, E. Y.,
and Jakobsen, B. K.
(1997)
Nature
387,
630-634[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Li, P.,
Morris, D. L.,
Willcox, B. E.,
Steinle, A.,
Spies, T.,
and Strong, R. K.
(2001)
Nat. Immunol.
2,
443-451[Medline]
[Order article via Infotrieve]
|
| 42.
|
Xu, J.,
Baase, W. A.,
Baldwin, E.,
and Matthews, B. W.
(1998)
Protein Sci.
7,
158-177[Medline]
[Order article via Infotrieve]
|
| 43.
|
Vales-Gomez, M.,
Reyburn, H. T.,
Erskine, R. A.,
Lopez-Botet, M.,
and Strominger, J. L.
(1999)
EMBO J.
18,
4250-4260[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Pietra, G.,
Romagnani, C.,
Falco, M.,
Vitale, M.,
Castriconi, R.,
Pende, D.,
Millo, E.,
Anfossi, S.,
Biassoni, R.,
Moretta, L.,
and Mingari, M. C.
(2001)
Eur. J. Immunol.
31,
3687-3693[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Li, J.,
Goldstein, I.,
Glickman-Nir, E.,
Jiang, H.,
and Chess, L.
(2001)
J. Immunol.
167,
3800-3808[Abstract/Free Full Text]
|
| 46.
|
Ulbrecht, M.,
Modrow, S.,
Srivastava, R.,
Peterson, P. A.,
and Weiss, E. H.
(1998)
J. Immunol.
160,
4375-4385[Abstract/Free Full Text]
|
| 47.
| Ishitani, A., Sageshima, N., Lee, N., Dorofeeva, N., Hatake, K., H.,
M., and Geraghty, D. E. (2003) J. Immunol.,
in press
|
| 48.
|
King, A.,
Burrows, T.,
Verma, S.,
Hiby, S.,
and Loke, Y. W.
(1998)
Hum. Reprod. Update
4,
480-485[Abstract/Free Full Text]
|
| 49.
|
Laskowski, R. A.,
MacArthur, M. W.,
Hutchinson, E. G.,
and Thornton, J. M.
(1992)
J. Appl. Crystallogr.
26,
283-291[CrossRef]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. K. Kaiser, J. C. Pizarro, J. Kerns, and R. K. Strong
Structural basis for NKG2A/CD94 recognition of HLA-E
PNAS,
May 6, 2008;
105(18):
6696 - 6701.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Derre, M. Corvaisier, B. Charreau, A. Moreau, E. Godefroy, A. Moreau-Aubry, F. Jotereau, and N. Gervois
Expression and Release of HLA-E by Melanoma Cells and Melanocytes: Potential Impact on the Response of Cytotoxic Effector Cells.
J. Immunol.,
September 1, 2006;
177(5):
3100 - 3107.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Clements, L. Kjer-Nielsen, L. Kostenko, H. L. Hoare, M. A. Dunstone, E. Moses, K. Freed, A. G. Brooks, J. Rossjohn, and J. McCluskey
Crystal structure of HLA-G: A nonclassical MHC class I molecule expressed at the fetal-maternal interface
PNAS,
March 1, 2005;
102(9):
3360 - 3365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. K. Kaiser, F. Barahmand-pour, W. Paulsene, S. Medley, D. E. Geraghty, and R. K. Strong
Interactions between NKG2x Immunoreceptors and HLA-E Ligands Display Overlapping Affinities and Thermodynamics
J. Immunol.,
March 1, 2005;
174(5):
2878 - 2884.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Guma, A. Angulo, C. Vilches, N. Gomez-Lozano, N. Malats, and M. Lopez-Botet
Imprint of human cytomegalovirus infection on the NK cell receptor repertoire
Blood,
December 1, 2004;
104(12):
3664 - 3671.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Hillig, M. Hulsmeyer, W. Saenger, K. Welfle, R. Misselwitz, H. Welfle, C. Kozerski, A. Volz, B. Uchanska-Ziegler, and A. Ziegler
Thermodynamic and Structural Analysis of Peptide- and Allele-dependent Properties of Two HLA-B27 Subtypes Exhibiting Differential Disease Association
J. Biol. Chem.,
January 2, 2004;
279(1):
652 - 663.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Lee and D. E. Geraghty
HLA-F Surface Expression on B Cell and Monocyte Cell Lines Is Partially Independent from Tapasin and Completely Independent from TAP
J. Immunol.,
November 15, 2003;
171(10):
5264 - 5271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ishitani, N. Sageshima, N. Lee, N. Dorofeeva, K. Hatake, H. Marquardt, and D. E. Geraghty
Protein Expression and Peptide Binding Suggest Unique and Interacting Functional Roles for HLA-E, F, and G in Maternal-Placental Immune Recognition
J. Immunol.,
August 1, 2003;
171(3):
1376 - 1384.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|