|
Originally published In Press as doi:10.1074/jbc.M209695200 on December 2, 2002
J. Biol. Chem., Vol. 278, Issue 7, 5388-5398, February 14, 2003
Synergy of Epidermal Growth Factor and
12(S)-Hydroxyeicosatetraenoate on Protein Kinase C
Activation in Lens Epithelial Cells*
Jianzheng
Zhou ,
Robert N.
Fariss§, and
Peggy S.
Zelenka ¶
From the Laboratory of Molecular and Developmental
Biology and the § Laboratory of Mechanisms of Ocular
Diseases, NEI, National Institutes of Health, Bethesda, Maryland
20892
Received for publication, September 20, 2002, and in revised form, November 22, 2002
 |
ABSTRACT |
12(S)-Hydroxyeicosatetraenoic acid
(12(S)HETE) is a bioactive metabolite of arachidonic acid
synthesized by 12-lipoxygenase. The 12-lipoxygenase blocker, baicalein,
prevents epidermal growth factor (EGF)-induced activation of protein
kinase C (PKC) and in lens epithelial cells, whereas
supplementation with 12(S)HETE reverses this effect,
suggesting that EGF and 12(S)HETE may work together to
activate PKC. This study investigates the mechanism of PKC
activation by EGF and 12(S)HETE. 12(S)HETE
alone directed translocation of PKC through the C1 rather than the
C2 domain, without activating phosphoinositide 3-kinase (PI3K)
or MAPK signaling or increasing intracellular calcium concentration. In
the presence of baicalein, EGF triggered an asymmetric phosphorylation
of the EGF receptor initiating signaling through PI3K and MAPK, but not PLC . Together, 12(S)HETE and EGF synergistically
increased phosphorylation of PKC in the activation loop and C
terminus as well as PKC -specific activity. PI3K inhibitors blocked
phosphorylation, but MEK1 inhibitors did not. Microvesicles containing
phosphatidylinositol 3,4,5-trisphosphate mimicked the
action of EGF on PKC activity in the presence of 12(S)HETE. Kinase-inactive PKC mutations in either
activation loop or C terminus were effectively translocated by
12(S)HETE, as was PKC in the presence of chelerythrine
or Gö-6983. These findings indicate that unphosphorylated PKC
is translocated to the membrane by 12(S)HETE and
phosphorylated by EGF-dependent PI3K signaling, to generate
catalytically competent PKC .
 |
INTRODUCTION |
12(S)-Hydroxyeicosatetraenoic acid
(12(S)HETE)1 is a
bioactive metabolite of arachidonic acid, which evokes a wide variety of cellular responses, ranging from survival and proliferation to
invasion and metastasis (1, 2). Although 12(S)HETE is synthesized primarily in platelets and leukocytes, a number of other
cell types have some capacity to make this hydroxylipid, including the
epithelial cells of the lens and cornea (3-5). Previous studies from
this laboratory found that inhibitors of endogenous
12(S)HETE synthesis prevent EGF-dependent DNA
synthesis and c-fos mRNA induction in cultured
lens epithelial cells. This effect was specifically reversed by
exogenous 12(S)HETE, but not by closely related HETEs,
suggesting that 12(S)HETE plays an essential role in
regulating lens cell proliferation (6, 7). Further investigation of the
role of 12(S)HETE showed that the selective lipoxygenase
inhibitor, baicalein, prevented EGF-induced activation of classic PKC
isoforms, PKC and PKC (8), raising the possibility that a
cooperative effect of EGF and 12(S)HETE is needed for full activation of PKC in these cells. In addition, because inhibition of
the classic PKC isoforms was sufficient to block both c-fos mRNA induction and DNA synthesis, these findings pinpointed PKC as
an important target of 12(S)HETE action in regulating lens epithelial cell proliferation (8).
Structural studies of the classic PKC isoforms (PKC , , and )
have identified several functional domains (9, 10). These include an
autoinhibitory pseudosubstrate domain at the N terminus, the C1 domain,
containing a diacylgycerol binding site (11), the C2 domain, containing
binding sites for both anionic lipids and calcium (12), an activation
loop adjacent to the active site, and the C-terminal domain. The
classic PKC isoforms require diacylglycerol and calcium as well as
PtdSer for full activity. In contrast, amino acid replacements at
certain key residues in the C2 domain of the novel PKC isoforms
(PKC , , , and ) has made these isoforms insensitive to
calcium signals, whereas changes in both the C1 and C2 domains of the
atypical isoforms (PKC and ) have rendered these isoforms
insensitive to both calcium and diacylglycerol (9, 10). However, all
isoforms require PtdSer or other acidic phospholipids for activity.
Activation of PKC involves both phosphorylation of the enzyme at the
activation loop and C terminus and translocation to the membrane, where
it interacts with its lipid cofactors, PtdSer and diacylglycerol. Phosphorylation at the activation loop seems to be catalyzed by the
phospholipid-dependent kinase, PDK1 (13-15), whereas the
two phosphorylations in the C terminus appear to be
autophosphorylations (16-18). Phosphorylation of PKC is thought to
introduce a conformational change, which allows it to respond to lipid
second messengers, such as diacylglycerol (18). Upon binding at the
membrane, an additional conformational change removes the
autoinhibitory substrate domain from the active site and the enzyme
becomes catalytically active (9, 10).
Because previous studies of lens epithelial cells had suggested that
EGF and 12(S)HETE may cooperate in some way to activate PKC and PKC , the present study was undertaken to investigate the
mechanism of this effect, using a GFP-tagged PKC fusion protein to
study the respective effects of 12(S)HETE and EGF on
translocation, phosphorylation, and activation. The results indicate
that the synergistic effect of EGF and 12(S)HETE on PKC
activation is due to 12(S)HETE-dependent
translocation of unphosphorylated PKC to the cytoplasmic membrane,
where it is phosphorylated by a PI3K-dependent mechanism
activated by EGF.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Wortmannin, LY294002, PD 98059, and the PepTag
nonradioactive PKC assay kit were purchased from Promega (Madison, WI).
12-O-Tetradecanoylphorbol 13-acetate (TPA), ionomycin, and
chelerythrine chloride were purchased from Sigma Chemical Co. (St.
Louis, MO). 12(S)HETE, baicalein, Gö-6983, and
phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P3) were from BIOMOL Research Laboratories, Inc. (Plymouth Meeting, PA). EGF was from Invitrogen (Rockville, MD). Polyclonal
anti-PKC antibody was from Santa Cruz Biotechnology Inc. (Santa
Cruz, CA). Antibodies against phosphorylated sites in PKC C
terminus, EGF receptor, and phosphorylated sites in EGF receptor as
well as PI3K and MAPK signaling sampler kits were all
purchased from Cell Signaling Technology Inc. (Beverly, MA). Monoclonal
and polyclonal anti-GFP antibodies were from
Clontech (Palo Alto, CA). Rabbit polyclonal (P500)
antibody directed against the phosphorylated activation loop of PKC
was a gift from Dr. Alexandra C. Newton (Department of Pharmacology,
University of California, San Diego, CA). Calcium indicator, Fluo-3
ester, was purchased from Molecular Probes, Inc. (Eugene, OR).
Cell Culture--
The rabbit lens epithelial cell line, N/N1003A
(a gift from Dr. John Reddan, Oakland University, Rochester, MI), was
cultured at 35 °C in 5% CO2 in Dulbecco's modified
Eagle's medium (DMEM) supplemented with 1 mM glutamine,
8% heat-inactivated rabbit serum, 100 units/ml penicillin, and 100 µg/ml streptomycin. For PKC activity assay, cells were plated in
75-mm flasks in an initial density of 2 × 106 cells.
At 90-95% confluence, the medium was replaced with serum-free DMEM
for 24 h, and the endogenous PKC or stably expressed PKC -GFP was precipitated with anti-PKC or anti-GFP antibodies. For confocal observation of GFP-tagged PKC translocation, cells were cultured in
a glass-bottomed chamber (LabTek-II Chamber Coverglass, VWR International, Bridgeport, NJ) and transfected with PKC -GFP
(Clontech, Palo Alto, CA) using FuGENE transfection
reagent (Roche Molecular Biochemicals, Indianapolis, IN). After 48 h, transfected cells were visualized with a Leica TCS SP2 confocal
microscope (Leica Microsystems, Wetzlar, Germany). For
immunoprecipitation and immunoblotting of PKC or PKC -GFP,
N/N1003A cells were cultured in six-well plates. In all experiments,
the cells were incubated with baicalein (30 µM) 8 h
before stimulation to block the endogenous synthesis of
12(S)HETE. To check whether PI3K or MAPKs participate in the EGF-induced PKC phosphorylation, cells were pretreated with either PI3K inhibitors, wortmannin, LY294002, or the MEK1 inhibitor PD98059 for 30 min.
Site-directed Mutagenesis and Cloning--
The preparation of
constructs with mutations in either activation loop or C terminus of
PKC -GFP was done with the QuikChange site-directed mutagenesis kit
from Stratagene Corp. (La Jolla, CA). The changed bases are underlined.
The oligonucleotides used for introducing the T500A, T641A, and S660A
mutations in pEGFP-PKC were as follows (5' 3'): for T500A,
GGTGACAACCAAGGCATTCTGTGGCACTCC (15 cycles, 95 °C,
30 s; 50 °C, 30 s; and 60 °C, 14 min); for T641A,
CCATCCACCAGTCCTAGCACCTCCTGACCAGGAAG (16 cycles,
95 °C, 30 s; 50 °C 1 min; and 65 °C, 14 min); for
S660A, CAGAATTCGAAGGATTTGCCTTTGTTAACTCTGAATTTTTAAAAC (16 cycles, 95 °C, 30 s; 50 °C 1 min; and 65 °C, 14 min).
For introducing the double mutation in the C terminus, mutant T641A was
used as a template for synthesis of the S660A mutation. The T500A,
T641A, and T641A/S660A mutation sites were confirmed by full sequencing
and then prepared in large quantity. For constructing truncated C1 and
C2 domains of PKC , the two fragments were amplified by PCR with
pfu DNA polymerase (Stratagene, La Jolla, CA) using primers
that introduced flanking restriction sites for EcoRI and BglII. The primers for amplification of C1 (residues
17-172) and C2 (residues 171-267) domains are as follows
(5' 3'): for C1, sense/ATGGGGGCCCGGTACCTTGGGGCGGGCCAC and
antisense/CGGAATTCCCCACGCCGCAAAGGGAGGGCACGCTGCGCAC; for C2,
sense/GAAGATCTATGGGGGCCCTAGAGCGCCGTGGACGTCTGC and
antisense/CGGAATTCTGGTACCTCTCGCCCTCCTCCTGGTTCAGTAACTTG. The two PCR products were purified and cut with EcoRI and
BglII, and the digested fragments were cloned into pEGFP-N3
vector (Clontech, Palo Alto, CA).
Expression of PKC -GFP and Its Mutants in N/N1003A
Cells--
Transient transfection into N/N1003A cells was performed by
FuGENE transfection reagent according to the manufacturer's standard protocol (Roche Molecular Biochemicals, Indianapolis, IN). Plasmids encoding wild-type or mutated PKC -GFP or GFP-tagged truncated C1 or
C2 domains were transfected into 6 × 106 cells. After
the transfection, cells were cultured at 35 °C to obtain the optimal
fluorescence of GFP, and experiments were performed 2 days after the transfection.
Establishment of Stable Transfectants of Wild Type and Mutated
PKC -GFP--
N/N1003A cells were transiently transfected with
PKC wild-type, T500A, T641A, and T641A/S660A, respectively, by
FuGENE transfection reagent (Roche Diagnostics Corp., Indianapolis,
IN). Clones were selected based on G418 (400 µg/ml) resistance, and
GFP fluorescence was checked under a fluorescence microscope
(Axioscope, Carl Zeiss, Jena, Germany) to confirm the stability
of expression.
Cell Lysis and Subcellular Fractionation--
Whole-cell lysates
were prepared by lysing cells in phosphate-buffered saline containing
1.0% Triton X-100 (v/v), 1% (w/v) sodium deoxycholic acid, and 1%
sodium dodecyl sulfate (w/v). Cells were scraped off the plate,
transferred to a microcentrifuge tube on ice, and sonicated in a
cold-water bath. Lysates were kept on ice for 15 min and centrifuged at
14,000 × g for 10 min at 4 °C. The resultant
supernatants were stored at 80 °C for immunoblot analysis.
Subcellular fractions for immunoblotting and PKC activity assays were
prepared as previously described (8). Immunoprecipitation was performed
as previously described (19).
Translocation of Wild-type and Mutated
PKC -GFP--
PKC -GFP-transfected cells were spread onto the
glass-bottomed chamber (LabTek-II, Ashland, MA) and cultured for at
least 36 h. Serum-containing medium was replaced with serum-free
DMEM 24 h before experiments. PKC -GFP fluorescence
was measured by confocal laser scanning microscopy (Leica TCS SP2,
Leica Microsystems) using 488-nm argon laser excitation, a 500-nm RSP
dichroic filter, and a 500- to 550-nm emission spectrum. Reagents were
diluted directly into the serum-free medium to obtain the appropriate final concentration, and real-time images were collected to monitor PKC -GFP movement. Images were collected at room temperature.
Immunoblot Analysis--
Protein concentration was measured by
the bicinchoninic acid method (BCA Protein Assay Reagent kit, Pierce,
Rockford, IL). Aliquots of fractions containing 20 µg of protein were
mixed with an equal volume of 2× loading buffer, electrophoresed on
4-20% SDS-polyacrylamide gels, and transferred to nitrocellulose
membranes (0.45-µm pore size, Novex, San Diego, CA) for 90 min at 400 mA as described previously (20). After transfer, membranes were blocked
for 1 h at room temperature in 5% skim milk (Difco, Detroit, MI)
in TBST (15 mM Tris-HCl and 150 mM NaCl, pH
7.5, with 0.05% Tween 20). After blocking, membranes were probed with
specific primary antibodies according to the manufacturer's
recommendations. Antibodies used were as follows: PKC (1:500) mouse
monoclonal (Transduction Laboratories, Lexington, KY), rabbit
polyclonal antibody to Erk1/2 and phospho-44/42 Erk1/2 (T202/Y204)
(1:1000), and rabbit polyclonal antibody to Akt or phospho-Akt (New
England BioLabs, Beverly, MA). The immunoblots were incubated with
primary antibodies for 1 h at room temperature on a shaking
platform, washed three times with TBST, and incubated with the
appropriate horseradish peroxidase-conjugated secondary antibody,
either anti-rabbit or anti-mouse IgG, (1:2500, New England BioLabs) for
30 min at room temperature. Specific immunoreactive bands were detected by enhanced chemiluminescence (ECL Plus, Amersham Biosciences, Buckinghamshire, UK). Chemiluminescence was quantified by densitometric scanning of x-ray films with image analysis software (ImageQuaNT Scientific Software, version 5.0, Amersham Biosciences, Piscataway, NJ).
PepTag Assay for Nonradioactive Detection of PKC
Activity--
The PepTag assay utilizes a brightly colored,
fluorescent peptide substrate that is highly specific to PKC (Promega).
Phosphorylation by PKC changes the net charge of the substrate from +1
to 1, thereby allowing the phosphorylated and nonphosphorylated
versions of the substrate to be separated on an agarose (0.8%) gel.
The phosphorylated species migrates toward the positive electrode, whereas the nonphosphorylated substrate migrates toward the negative electrode. The phosphorylated peptide in the band can then be visualized under UV light. Immunoprecipitated PKC was incubated with
PKC reaction mixture (25 µl) according to the manufacturer's protocol (Promega) at 30 °C for 30 min. The reactions were stopped by placing the tubes in a boiling water bath for 10 min. After adding
80% glycerol (1 µl), the samples were loaded onto an agarose gel
(0.8% agarose in 50 mM Tris-HCl, pH 8.0). The samples were separated on the agarose gel in the same buffer at 75 V for 25 min, and
the bands were visualized under UV light and quantified by ImageQuaNT
Scientific Software (version 5.0, Amersham Biosciences).
Confocal Ca2+ Imaging--
Intracellular
Ca2+ was monitored with Fluo-3 AM, a
membrane-permeable long wavelength fluorescence indicator. N/N1003
cells were plated in glass-bottomed chambers (LabTek-II Chamber
Coverglass, VWR International, Bridgeport, NJ) and cultured in the
standard medium for 24 h. The cells were loaded with acetoxymethyl
ester of Fluo-3 (5 µM) for 30 min; after loading, a
period of at least 30 min elapsed before experimentation to allow for
de-esterification of the intracellularly accumulated Fluo-3 AM. A Leica
TCS-SP2 laser scanning confocal microscope (Leica Microsystems,
Germany) was used to visualize Ca2+-mediated fluorescence
in the cells. Fluo-3 was excited with the 488-nm line of an argon
laser, and Fluo-3 fluorescence was collected between 524 and 540 nm.
Scanning was performed every 10 s for a total of 20 min after
treatment with 12(S)HETE (800 nM) or EGF (15 ng/ml). For quantitative measurements, scanning was performed every
30 s for 40 min, and the ratio of fluorescence intensity to
initial fluorescence intensity (F/F0)
was calculated at each point. Data were collected on 14 cells, and the
results were averaged.
 |
RESULTS |
12(S)HETE and EGF Act in Synergy to Increase PKC -specific
Enzymatic Activity--
To examine the effect of 12(S)HETE
and EGF on PKC activation, we immunoprecipitated both endogenous
PKC and exogenous GFP-tagged PKC from the membrane fraction of
N/N1003 cells and measured its activity using the PKC peptide
substrate, PepTag. We also calculated the specific enzymatic activity
of PKC by normalizing the relative level of phosphorylated PepTag to
the relative amount of PKC in the immunoprecipitate, as determined
by immunoblotting. The results showed that EGF (15 ng/ml) in the
presence of baicalein (30 µM) did not significantly
increase either the phosphorylation of the PepTag substrate (Fig.
1A, upper panel) or
the amount of PKC in the membrane fraction (Fig. 1A,
lower panel). Treatment with 12(S)HETE (300 nM) increased the amount of PKC in the membrane fraction
and increased the phosphorylation of the PepTag substrate somewhat but
produced no increase in the specific enzymatic activity of PKC (Fig.
1, A and B). However, combining
12(S)HETE (300 nM) with EGF (15 ng/ml)
significantly enhanced PepTag phosphorylation and produced an ~2-fold
increase in the specific enzymatic activity of PKC (Fig. 1,
A and B). These results confirm that
12(S)HETE and EGF have a synergistic effect on PKC
activation. For further studies of this effect, we established a cell
line that stably expresses GFP-tagged PKC . The GFP tag was fused
with the C terminus of PKC (Fig.
2A), because this fusion
protein has previously been shown to retain full catalytic competence
(21). Immunoprecipitation of PKC -GFP with monoclonal anti-GFP
antibody confirmed that its behavior was indistinguishable from that of
endogenous PKC with respect to activation in the presence and
absence of 12(S)HETE (Fig. 1B, lower
panel).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
12(S)HETE and EGF
synergistically enhance both endogenous and exogenous
PKC -specific activity in rabbit lens
epithelial N/N1003A cells. N/N1003A cells and a stably transfected
N/N1003A line expressing PKC -GFP were serum-deprived, pretreated
with baicalein (30 µM) for 8 h, then stimulated with
EGF (15 ng/ml), 12(S)HETE (300 nM), or both EGF
and 12(S)HETE together. Controls were mock stimulated with
DMEM. Endogenously expressed PKC and stably expressed PKC -GFP
were immunoprecipitated from isolated membrane fractions and incubated
with a specific substrate peptide tagged with a fluorescent probe
(PepTag). After phosphorylation by PKC, the phosphorylated and
unphosphorylated PepTag peptides were separated by agarose gel
electrophoresis. To determine the specific enzymatic activity, PKC
activity was quantitated by fluorescence intensity of the
phosphorylated PepTag and normalized to the amount of PKC in the
reaction mixture as determined by immunoblotting. A, a
representative agarose gel separation of phosphorylated PepTag showing
fluorescent phosphorylated Peptag (upper panel) and the
corresponding immunoblot indicating the amount of PKC present in each
kinase reaction (lower panel). B, specific
enzymatic activity of both endogenous PKC (upper panel)
and stably expressed PKC -GFP (lower panel) were
determined after treatment with either 12(S)HETE, or EGF, or
a combination of 12(S)HETE and EGF and expressed as
percentage of control. Five separate experiments were done (mean ± S.E.).
|
|

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 2.
Co-application of 12(S)HETE
(300 nM) with EGF (15 ng/ml) does not enhance
PKC translocation to the membrane.
A, diagram showing the structure of PKC -GFP
(left panel), truncated C1-GFP (middle), and
C2-GFP (right) fusion proteins in transiently transfected
N/N1003A cells. Note that GFP was fused C-terminal to PKC and its
truncated forms. B, time series images showing accumulation
of GFP fluorescence at the plasma membrane within 20 min after
serum-deprived cells were treated with 12(S)HETE
(upper panel), EGF (middle panel), or both
12(S)HETE and EGF in combination (lower panel).
Scale bar, 25 µm. C, to quantify the time
course of PKC -GFP redistribution, a translocation factor was
calculated by comparing changes in the fluorescence intensity in two
pre-assigned areas, one in the membrane and another in the cytosol
(upper panel). 12(S)HETE and EGF in combination
showed no synergistic effect on PKC -GFP membrane translocation
within 20 min (lower panel). D, time series
images showing C1-GFP (upper panel, scale bar, 25 µm) or C2-GFP (middle panel, scale bar, 50 µm) translocation and Fluo-3 fluorescence changes after treatment
with 12(S)HETE (800 nM). This concentration of
12(S)HETE had no effect on C2-GFP translocation or Fluo-3
fluorescence (lower panel, scale bar, 45 µm),
although both parameters responded rapidly to ionomycin (0.5 µM) after 12(S)HETE was washed out.
|
|
12(S)HETE Promotes Translocation of PKC -GFP--
Because
translocation of PKC to the membrane is often considered sufficient for
its activation, we next examined the effect of 12(S)HETE and
EGF on PKC translocation, using real-time imaging to follow the
movement of PKC -GFP in living cells. As in the above experiments,
the cells were incubated with the selective 12-lipoxygenase inhibitor,
baicalein (30 µM), to block the endogenous generation of
12(S)HETE (8). Under these conditions, exogenous application
of 12(S)HETE (300 nM) rapidly delivered
GFP-tagged PKC to the plasma membrane (Fig. 2B).
PKC -GFP fluorescence began to localize at the plasma membrane about
10 min after 12(S)HETE addition and reached a plateau after
about 15 min. In contrast, in the presence of baicalein, EGF (15 ng/ml)
had no effect on PKC -GFP translocation, whereas 12(S)HETE
plus EGF showed a time course of PKC translocation very similar to
that seen with 12(S)HETE alone (Fig. 2B).
To quantify the time course of PKC translocation induced by
12(S)HETE and EGF, we calculated a translocation factor
(R), defined as the difference between fluorescence
intensity in the plasma membrane (IM) and
cytoplasm (IC) divided by the intensity in the cytoplasm (IC). Thus,
|
(Eq. 1)
|
A time series of confocal images was taken, and the value of
R was calculated automatically by comparing the changes of
the fluorescence intensity in two pre-assigned areas: one in the
membrane (representing IM), another in the
cytosol (representing IC) (Fig. 2C).
The results demonstrated that the rate and extent of translocation produced by 12(S)HETE and EGF in combination was
indistinguishable from that produced by 12(S)HETE alone
(Fig. 2C).
To investigate the mechanism underlying the
12(S)HETE-dependent translocation of PKC , we
tested the effect of 12(S)HETE on GFP-tagged constructs of
the truncated C1 and C2 domains of PKC . Previous studies have
identified these domains as membrane targeting modules that mediate PKC
translocation by binding with diacylglycerol and calcium, respectively
(11, 12, 22, 23). In control experiments, TPA (1.5 µg/ml) induced a
translocation of the C1-GFP domain to the membrane, where it remained
for more than 20 min (not shown). Similarly, control experiments with
ionomycin (0.5 µM) induced translocation of GFP-C2 (Fig.
2D). In this case, however, the time course of translocation
was very rapid, with membrane-associated fluorescence reaching a peak
and returning to baseline within 60 s in most cells (Fig.
2D). Interestingly, ionomycin (0.5 µM) also
caused translocation of GFP-C1 to the membrane (data not shown).
Because previous studies of the isolated C1 domain indicate that it
binds to the membranes in a calcium-independent manner (12), the
response to ionomycin may reflect a calcium-dependent change in membrane lipids. Incubating cells in 300 nM
12(S)HETE, a concentration that promoted translocation of
full-length PKC -GFP (30/34 cells imaged) within about 14 min, had a
weak effect on C1-GFP membrane translocation (2/15 cells imaged) and no
effect on C2-GFP (data not shown). Increasing the concentration of
12(S)HETE to 800 nM strongly directed C1-GFP to
the membrane (14/16 cells imaged) but had no effect on C2-GFP
translocation (Fig. 2D). These findings suggest that
12(S)HETE promotes the translocation of PKC by affecting
either the lipid composition of the membrane or the lipid binding
capacity of PKC , rather than by mobilizing Ca2+. In
addition, the observation that higher concentrations of
12(S)HETE are needed for translocation of the isolated C1
domain than for the full-length protein suggests that interactions
between C1 and other regions of PKC , such as the recently reported
interaction between C1 and C2 (24), may facilitate membrane binding.
In view of the inability of 12(S)HETE to direct the
translocation of the calcium-responsive C2 domain, we next tested
whether 12(S)HETE has any effect on cytoplasmic
Ca2+ levels. To measure changes in cytoplasmic calcium, we
loaded N/N1003A cells with the membrane-permeable calcium indicator, Fluo-3 ester, and monitored the Ca2+-dependent
fluorescence by real-time imaging, sampling every 10 s for 20 min.
Application of 12(S)HETE (800 nM) had no effect on intracellular Ca2+ levels (Fig. 2D). Thus,
12(S)HETE seems to mediate translocation of PKC through a
preferential effect on the C1 domain, which is not accompanied by
changes in intracellular calcium.
EGF Induces PI3K and MAPK Signaling Cascades But Not the PLC-
Pathway--
The EGF receptor undergoes tyrosine autophosphorylation
in its intracellular domain after binding with EGF (25). The
phosphorylated tyrosine residues then serve as docking sites for
recruitment of different signaling molecules, leading to the activation
of signaling through PI3K, MAPK, and PLC- (25). Phosphorylation of
tyrosine 1068 leads to activation of PI3K and MAPK through the adaptor
proteins Grb2 or Gab1 (26, 27), whereas phosphorylation at tyrosine 992 or 1173 activates PLC- (28, 29) (Fig.
3A, upper panel).
In addition, EGF receptor phosphorylation by c-Src at tyrosine 845 increases the receptor kinase activity (30). To investigate the
signaling pathways activated by EGF in N/N1003A cells, we examined the
phosphorylation state of each of these tyrosines using phospho-specific
antibodies. The results confirmed that the EGF receptor is expressed
(Fig. 3A) and undergoes phosphorylation at tyrosine 845 and
1068 in response to EGF (15 ng/ml). However, no phosphorylation of
tyrosine 992 was observed (Fig. 3A). Consistent with these
findings, EGF treatment triggered strong phosphorylation of Akt, a
kinase downstream of PI3K, and of Erk1/2 (Fig. 3B), indicating that both the PI3K and MAPK signaling cascades are activated.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 3.
Asymmetric phosphorylation of EGFR initiates
PI3K and MAPK, but not PLC- , signaling
pathways. Phosphorylation of the EGFR intracellular domain at
different tyrosine residues was determined with site-specific
anti-phosphotyrosine antibodies. Activation of PI3K and MAPK signaling
pathways was assayed by monitoring Akt and Erk1/2 phosphorylation,
respectively, after treatment with EGF (15 ng/ml). Cytosolic
Ca2+ was monitored by confocal microscopy using
Fluo-3 AM fluorescence (excitation at 514 nm and emission between 524 and 560 nm) as an indicator for PLC- pathway activation.
A, Western blots demonstrating asymmetric phosphorylation of
tyrosine residues at 845, 1068, and 992. B, Western blots
indicating total and phosphorylated Akt at threonine 308 and serine
473, respectively (left panel), and total as well as
phosphorylated Erk1/2 (right panel) after EGF (15 ng/ml)
application. C, time series images showing that EGF (15 ng/ml) has no effect on translocation of C2-GFP (upper
panel, scale bar, 35 µm) or cytosolic calcium level
(lower panel, scale bar, 45 µm) within 20 min.
Note that ionomycin (0.5 µM) produced rapid calcium
mobilization after EGF was washed out (lower panel).
D, time course of the ratio of Fluo-3 fluorescence intensity
to initial Fluo-3 fluorescence intensity
(F/F0) after treatment with EGF (15 ng/ml) and ionomycin (0.5 µM), respectively. Each point
represents the average ± S.E. of measurements on 14 cells
(n = 14). In some cases the error bars are
contained within the symbol.
|
|
The lack of autophosphorylation at tyrosine 992 suggested that EGF may
fail to activate signaling through PLC- in N/N1003 cells under the
present conditions. In this case, EGF would also not produce the
increase in cytosolic calcium that is the expected consequence of
PLC- activation. To test this possibility, we examined the ability
of EGF (15 ng/ml) to deliver the calcium-responsive GFP-tagged C2
domain of PKC to the membrane. EGF failed to cause translocation of
the GFP-tagged C2 domain (Fig. 3C, upper panel), although ionomycin (0.5 µM) produced translocation within
40 s after EGF was washed out (not shown).
To further define the effect of EGF on the PLC signaling pathway, we
monitored changes in free cytosolic Ca2+ level using the
membrane-permeable calcium indicator, Fluo-3 ester. Cells were treated
with EGF (15 ng/ml), and fluorescence was monitored every 10 s for
20 min. We observed no increase in cytosolic Ca2+ level
within this time period (Fig. 3C, lower panel).
In contrast, when EGF was washed out and replaced by ionomycin (0.5 µM), Ca2+ levels were elevated within 20 s (Fig. 3C, lower panel). For a more quantitative
measure of Ca2+ levels, the ratio of fluorescence intensity
to initial fluorescence intensity
(F/F0) was measured every 30 s
for 40 min. Data were collected from fourteen individual cells, and the
results were averaged (Fig. 3D). We detected no increase in
F/F0, although this ratio increased
sharply when EGF was washed out and replaced by ionomycin. Thus, under
these experimental conditions, the PLC- pathway appears to be silent
after treatment with EGF (15 ng/ml). This may explain the unusual
finding that EGF (15 ng/ml) alone is unable to induce PKC
translocation (Fig. 2A).
12(S)HETE Does Not Activate PI3K and MAPK Signaling
Cascades--
To test the effect of 12(S)HETE and EGF on
the PI3K and MAPK signaling cascades, N/N1003 cells were treated with
baicalein, followed by exposure to 12(S)HETE, EGF, or both,
for 20 min, and specific antibodies were used to detect the activated
forms of Akt and Erk1/2. As expected, EGF treatment led to
phosphorylation of both Thr-308 and Ser-473 of Akt, as well as
phosphorylation of Erk1/2 (Fig. 4). In
contrast, treatment with 12(S)HETE did not lead to
phosphorylation of either Akt or Erk1/2. Adding both agents in
combination did not increase the extent of phosphorylation above the
levels produced by EGF alone. Phosphorylation of Akt and Erk were
blocked by the PI3K inhibitor, Ly294002, and the MEK1 inhibitor,
PD98059, respectively, confirming that the observed phosphorylations
resulted from signaling through PI3K and MEK1. These results imply that
EGF is able to initiate signaling through these pathways, whereas
12(S)HETE is not.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 4.
Co-application of 12(S)HETE
(300 nM) with EGF (15 ng/ml) has no synergistic effect on
PI3K or MAPK signaling. Akt and ErK1/2 phosphorylation were
determined as indicators for PI3K and MAPK signaling cascades
activation, respectively. LY294002 (10 µM) or wortmannin
(100 nM) was utilized to inhibit PI3K activity, whereas
PD98059 (10 µM) was used for MEK inhibition.
12(S)HETE, alone or in combination with EGF, had no effect
on Akt phosphorylation (left panel) or Erk1/2
phosphorylation (right panel). Phosphorylation of Akt was
abolished by Ly294002 (10 µM) or wortmannin (100 nM) and phosphorylation of Erk1/2 by PD98059 (10 µM) confirming the involvement of PI3K and MEK,
respectively.
|
|
Synergistic Effect of EGF and 12(S)HETE on PKC
Phosphorylation--
Because PKC phosphorylation is regarded as an
important factor in regulating PKC activity, we next tested the
respective roles of EGF and 12(S)HETE in phosphorylating the
activation loop and C terminus of PKC , using specific antibodies
against the phosphorylated motifs in the activation loop
DGVTTKpTFCGTPD and C terminus
NFDKFFTRGQPVLpTPPDQLVIANIDQSDFE. PKC was
immunoprecipitated from both membrane fraction and whole cell lysate
then analyzed by immunoblotting to determine its phosphorylation state.
Unstimulated N/N1003A cells contained very low levels of phosphorylation in the activation loop (T500) and C terminus (T641) in
either the membrane fraction or whole cell lysate as determined by
immunoblotting with phospho-specific antibodies (Fig.
5, A and B).
Incubating baicalein-treated cells with EGF (15 ng/ml) alone for 20 min
produced approximately a 70% increase in PKC phosphorylation at
both sites, whereas 12(S)HETE (300 nM) alone had
no significant effect on PKC phosphorylation under the same conditions (Fig. 5, A and B). In contrast, the
combination of EGF and 12(S)HETE had a strong synergistic
effect on PKC phosphorylation in both activation loop and C terminus
with approximately a 4- to 5-fold increase of PKC phosphorylation
(Fig. 5, A and B). To investigate the signaling
cascades required for this synergistic effect on PKC phosphorylation,
cells were pretreated with PI3K inhibitor LY294002 (10 µM) or MEK inhibitor PD98059 (10 µM) for 30 min. Pretreatment with LY294002 (10 µM) abolished the
phosphorylation of PKC produced by combined treatment with EGF and
12(S)HETE, whereas the MEK inhibitor, PD98059, had no effect
(Fig. 5, A and B), suggesting that signaling
through PI3K is required.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 5.
Co-application of 12(S)HETE
(300 nM) with EGF (15 ng/ml) synergistically affects
PI3K-dependent phosphorylation of endogenous
PKC in the activation loop and C
terminus. Endogenously expressed PKC from either
membrane-associated fraction (A) or whole cell lysate
(B) were immunoprecipitated with rabbit anti-PKC . Total
PKC was immunoblotted with mouse monoclonal anti-PKC . PKC
phosphorylation in the activation loop and C terminus was determined
with phosphospecific antibodies. Immunoblots were quantified by
densitometry and results were expressed as percentage of control. Five
separate experiments were performed (mean ± S.E.). A,
representative immunoblots showing total PKC and phosphorylation in
either activation loop or C terminus from the membrane-associated
fractions. Bar graphs of quantitative results show a
PI3K-dependent synergistic effect of 12(S)HETE
and EGF on PKC phosphorylation in activation loop and C terminus.
B, representative immunoblots showing total PKC and
phosphorylation in either activation loop or C terminus from whole cell
lysate. Bar graphs of quantitative results show a
PI3K-dependent synergistic effect of 12(S)HETE
and EGF on PKC phosphorylation in activation loop and C
terminus.
|
|
To confirm that EGF and 12(S)HETE have a synergistic effect
on phosphorylation of the PKC -GFP fusion protein, as well as the
endogenous enzyme, PKC -GFP was immunoprecipitated from stably transfected cells using anti-GFP antibody. The phosphorylation state of
its activation loop and C terminus were then examined by immunoblotting
with phospho-specific antibodies. Once again, the combination of
12(S)HETE and EGF had a synergistic effect on
phosphorylation of the activation loop and C terminus (Fig. 6, A and B), which
was prevented by pretreatment with PI3K blocker, LY294002 (10 µM), but not by the MEK inhibitor, PD98059 (Fig. 6,
A and B).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 6.
Synergy effect of 12(S)HETE
(300 nM) and EGF (15 ng/ml) on phosphorylation of stably
expressed exogenous PKC -GFP in both activation
loop and C terminus is PI3K-dependent. A stably
transfected line of N/N1003A cells expressing PKC -GFP was
established by resistance to G418 (400 µg/ml). The exogenously
expressed PKC -GFP fusion protein was immunoprecipitated with mouse
monoclonal anti-GFP antibody. Experiments were performed as described
in the legend to Fig. 5 and expressed as percentage of control. Results
represent mean of five separate experiments, ± S.E. A,
representative immunoblots and quantitative results for PKC -GFP from
the membrane-associated fractions. B, representative
immunoblots and quantitative results for PKC -GFP from whole
lysate.
|
|
Synergy of 12(S)HETE and EGF on PKC Activation Is
PI3K-dependent--
The above results imply that the
combined effect of EGF and 12(S)HETE on PKC activation
may be due to EGF-dependent phosphorylation of PKC
following its translocation to the membrane by 12(S)HETE. As
a direct test of this possibility, we measured the effect of PI3K
inhibitors on the specific enzymatic activity of PKC after stimulating with 12(S)HETE, EGF, or both agents combined. If
phosphorylation in either the activation loop or C terminus is
essential to the increase in specific enzymatic activity of PKC
produced by these agents in combination, co-treatment with these
inhibitors should block this effect. The results indicate that this is
the case (Fig. 7). The synergistic effect
of 12(S)HETE and EGF on the specific enzymatic
activity of PKC was prevented by pretreatment with PI3K blockers,
wortmannin (100 nM) or LY294002 (10 µM), but
not by the MEK inhibitor, PD98059 (10 µM) (Fig.
7A). The same result was obtained using PKC -GFP
immunoprecipitated from stably transfected N/N1003 cells with
monoclonal anti-GFP antibody (data not shown). Because
12(S)HETE had no effect on PI3K signaling (Fig. 4), these results imply that the synergistic effect of EGF and
12(S)HETE on PKC activation requires
EGF-dependent signaling through PI3K.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 7.
Synergistic effect of
12(S)HETE (300 nM) and EGF (15 ng/ml) on
endogenous PKC activity is
PI3K-dependent. N/N1003A cells were treated with EGF
and 12(S)HETE, either alone or in combination, as indicated.
PKC specific activity was quantified and plotted as in legend to
Fig. 1. Results represent mean ± S.E. of four separate
experiments. A, effect of PI3K inhibitors and MEK inhibitor
on PKC specific activity. Representative agarose gel separation of
phosphorylated PepTag and immunoblot indicating amount of PKC present
in corresponding kinase reaction. Synergistic effect of
12(S)HETE and EGF on PKC specific activity was blocked by
PI3K inhibitors. B, N/N1003A cells were loaded with
PtdIns(3,4,5)P3 microvesicles as indicated, then treated
with EGF and 12(S)HETE, either alone or in combination.
Representative agarose gel separation of phosphorylated PepTag and
immunoblot indicating amount of PKC in the corresponding kinase
reaction. Results indicate that PtdIns(3,4,5)P3 mimicked
the effect of EGF (lower panel).
|
|
One of the principal products of phosphoinositide phosphorylation by
PI3K is PtdIns(3,4,5)P3 (31). This lipid generates a
membrane docking site for a variety of pleckstrin homology domain proteins, including PDK1, the kinase implicated in PKC phosphorylation (13-15). To confirm that the EGF-dependent activation of
PI3K is responsible for the synergistic effect of EGF and
12(S)HETE on PKC activation, we loaded N/N1003A cells
with PtdIns(3,4,5)P3 microvesicles and measured the
specific enzymatic activity of PKC in the presence or absence of
12(S)HETE. PtdIns(3,4,5)P3 had no effect on the
specific enzymatic activity of PKC when added alone (Fig.
7B). However, in combination with 12(S)HETE, PtdIns(3,4,5)P3 increased the specific enzymatic activity
by about 2-fold (Fig. 7B). Thus, when combined with
12(S)HETE, PtdIns(3,4,5)P3 is able to enhance
the specific activity of PKC to about the same extent as EGF. These
findings strengthen the view that, when 12(S)HETE and EGF
act together to increase the specific enzymatic activity of PKC , the
role of EGF is to increase PKC phosphorylation via PI3K signaling.
12(S)HETE Delivers Unphosphorylated PKC to the
Membrane--
These findings implied that the contribution of
12(S)HETE to the synergistic effect with EGF lies in its
ability to deliver unphosphorylated PKC to the plasma membrane,
where it can be phosphorylated by EGF-dependent activation
of the PI3K cascade. To explore this idea in greater detail, we
generated stably transfected N/N1003A cell lines expressing PKC -GFP
containing specific mutations at phosphorylation sites in the
activation loop (T500A) and C terminus (T641A and T641A/S660A) (Fig.
8A). As expected, neither the
T500A mutation nor the T641A/S660A double mutation was phosphorylated in the combined presence of EGF and 12(S)HETE, although the
wild-type PKC construct was significantly phosphorylated under these
conditions (Fig. 8B). We also found no phosphorylation in
the C terminus when the phosphorylatable threonine residue in the
activation loop (T500) was replaced with alanine (data not shown), as
expected if these sites are autophosphorylated following
phosphorylation of the activation loop. In addition, immunoprecipitates
of the mutated proteins showed no kinase activity toward the PepTag
substrate. This confirms that phosphorylation at these sites is
required for activity, as suggested by previous studies (17, 32, 33). Using real-time fluorescence imaging, we next inquired whether 12(S)HETE directed translocation of the T500A and
T641A/S660A mutated proteins to the plasma membrane (Fig.
8D). Both mutated proteins were effectively translocated,
with a time course similar to that of the wild-type protein (compare
with Fig. 2). Thus, 12(S)HETE is able to direct membrane
translocation of inactive, unphosphorylated forms of PKC . Finally,
we tested whether abolishing PKC activity with the inhibitors
chelerythrine or Gö-6983 interfered with the ability of
12(S)HETE to direct PKC to the membrane (Fig. 8E). Although both inhibitors effectively blocked PKC
kinase activity toward the PepTag substrate (not shown), they had no effect on the ability of 12(S)HETE to direct translocation
to the plasma membrane (Fig. 8E). TPA was also able to
direct translocation of PKC in the presence of chelerythrine (Fig.
8E) or Gö-6983 (not shown). Together these findings
confirm that 12(S)HETE is able to direct membrane
translocation of unphosphorylated, inactive forms of PKC and
demonstrate that translocation and phosphorylation are separable
events.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 8.
Mutations in either activation loop or C
terminus of PKC -GFP prevent activation but not
translocation. Mutations in activation loop and C terminus were
introduced by site-directed mutagenesis and confirmed by complete
sequencing. Stable transfectants of the mutated PKC -GFP were made by
selection with resistance of G418 (400 µg/ml). The activity of
mutants was determined as described under "Experimental
Procedures." Membrane translocation of the mutants was visualized
with real-time confocal microscopy. A, schematics
showing the wild-type PKC -GFP and location of mutations in the
activation loop or C terminus. B, immunoblots confirming
that introduction of mutations in either activation loop (T500A) or C
terminus (T641A/S660A) eliminated phosphorylation in the corresponding
sites upon exposure to 12(S)HETE and EGF, although wild-type
(Wt) was still subject to phosphorylation. C,
separation of phosphorylated PepTag with agarose gel showing that
PKC -GFP bearing mutations in the activation loop (T500A) or C
terminus (T641A/S660A) were catalytically inactive. D,
representative time series of confocal images showing membrane delivery
of the mutated PKC -GFP fusion proteins, T500A and T641A/S660A, in
response to 12(S)HETE (300 nM). Scale
bar, 35 µm. E, representative time series of confocal
images showing PKC -GFP translocation after treatment with
12(S)HETE or TPA in the presence of two PKC inhibitors,
chelerythrine (10 µM), or Gö6983 (1 µM). Scale bar, 30 µm.
|
|
 |
DISCUSSION |
The present findings indicate that submicromolar
concentrations of 12(S)HETE are sufficient to cause
translocation of PKC to the plasma membrane. Moreover,
12(S)HETE also directs translocation of the kinase inactive
construct PKC (T500A), which can not be phosphorylated in either the
transactivation loop or C-terminal domain. Because this construct would
be expected to retain the conformation of the unphosphorylated enzyme,
as previously shown for PKC (T500V) (17, 34), conversion to the
mature, phosphorylated conformation of the enzyme is apparently not
required for 12(S)HETE-dependent translocation.
These findings contrast with previous findings indicating that PKC
must be fully phosphorylated to respond to lipid cofactors such as
diacylglycerol or TPA (18) and suggest that certain lipids can recruit
the unphosphorylated enzyme to the membrane for further processing by phosphorylation.
Although the mechanism responsible for
12(S)HETE-dependent translocation is unclear, it
does not seem to involve calcium mobilization, because
12(S)HETE had no effect on the calcium-responsive C2 domain of PKC and did not produce a detectable change in cytosolic calcium. Indeed, the preferential effect on the lipid-responsive C1 domain of
PKC , suggests that 12(S)HETE in some way modifies the
membrane lipid environment to facilitate PKC binding. Interestingly,
a recent report indicates that low concentrations of arachidonic acid
(10-30 nM) have a similar ability to translocate PKC in
human polymorphonuclear neutrophils (44). Translocation in
response to arachidonic acid, like translocation in response to
12(S)HETE, did not require calcium mobilization.
The present results confirm that EGF is unable to activate PKC in
lens epithelial cells if endogenous 12(S)HETE synthesis is
blocked and suggest that endogenously synthesized 12(S)HETE may participate in PKC activation in lens epithelial cells by promoting
translocation. Interestingly, this may provide a mechanism for
activating cPKC isoforms that does not require calcium mobilization. Exactly how endogenously synthesized 12(S)HETE might
participate in this process is not yet clear, however. One possibility
is that 12(S)HETE may be esterified to phospholipids, then
released in response to EGF by the action of cPLA2, which is activated by MAPK (35, 36). Alternatively, arachidonic acid might be released by
cPLA2 then converted to 12(S)HETE by 12-lipoxygenase. Because our results suggest that EGF does not activate PLC in this
cell type, it seems unlikely that formation of a
12(S)HETE-esterified diacylglycerol is involved.
Nevertheless, the related hydroxylipid, 15(S)HETE, has been shown to
form 15(S)HETE-esterified diacylglycerols that specifically activate
PKC in human tracheal epithelial cells (37).
Several reports in the literature indicate that there are specific cell
surface receptors for 12(S)HETE (38-40). In support of this
view, addition of 12(S)HETE has been shown to activate PKC,
PLC , MAPK, and PI3K in a variety of cell types (38, 40, 41). In
contrast, we found that 12(S)HETE had no effect on signaling via MAPK, PI3K, or intracellular calcium and was unable to activate PKC without the cooperative action of EGF. The difference between these findings and those reported for other cell types suggests that
12(S)HETE may have multiple modes of action. Indeed, binding curves for 12(S)HETE are complex and provide evidence for
both high affinity and low affinity receptors, further supporting the possibility that 12(S)HETE may have various modes of action
(39, 40). Moreover, the apparent lack of downstream signaling in response to 12(S)HETE in the present study raises the
possibility that some of its effects may be receptor-independent and
may result from its ability to modify the lipid environment of the membrane.
In most adherent cell types, PKC is highly phosphorylated in both the
activation loop and C terminus, even under unstimulated conditions (10,
15) or after serum starvation (15). Under these circumstances, cPKC
translocation is sufficient for its activation, because membrane
binding induces the conformational change needed to release the
catalytic core from the autoinhibitory pseudosubstrate (10, 12, 34). In
contrast, serum-deprived lens epithelial cells have very low levels of
PKC phosphorylation, making it possible to separate translocation
and activation. Our data suggest a model in which serum-deprived lens
epithelial cells contain both phosphorylated and unphosphorylated
PKC , which is distributed between the membrane and cytoplasm, with
the bulk of the enzyme in the cytoplasm. Upon addition of exogenous
12(S)HETE, both phosphorylated and unphosphorylated PKC
are translocated from the cytoplasm to the membrane (Fig.
9A). The phosphorylated PKC
present in this fraction produces an increase in membrane-associated kinase activity. However, because there is no new phosphorylation of
PKC , there is no increase in the specific enzymatic activity. On the
other hand, if endogenous 12(S)HETE synthesis is blocked and
EGF is added, activation of PI3K signaling may phosphorylate the small
amount of unphosphorylated PKC already associated with the membrane
fraction of the serum-deprived cells but is unable to promote
translocation (Fig. 9B). Phosphorylation of PKC in the
membrane increases both the activity of the membrane fraction and the
specific enzymatic activity, but the effect is small, because the
amount of enzyme associated with the membrane is small. Previous
results have shown that cell proliferation does not occur under these
conditions, although MAPK signaling is activated in response to EGF
(6-8). In contrast, when both 12(S)HETE and EGF are
present, a much larger amount of unphosphorylated PKC is associated
with the membrane, due to the ability of 12(S)HETE to direct
the translocation of unphosphorylated, as well as phosphorylated, enzyme (Fig. 9C). The newly translocated, unphosphorylated
enzyme is phosphorylated by EGF-dependent PI3K signaling,
producing a synergistic effect on membrane-associated activity and
specific enzymatic activity. Under these conditions, a large proportion of PKC is activated by phosphorylation and mitogenesis occurs (6-8). Importantly, unphosphorylated PKC is not phosphorylated in
response to EGF unless it is translocated to the membrane. Thus, our
data support the view that localization of PKC at the membrane
brings it into close proximity with PDK1, the kinase thought to be
responsible for its phosphorylation (13, 14, 42). In a similar manner,
membrane localization of Akt (also known as PKB) has been shown to
facilitate its phosphorylation by PDK-1 (43). Although some studies
have suggested that PDK1 may be constitutively active in cells, even
following serum starvation (15), in the present study its activity
appears to be regulated by PI3K in response to EGF. Thus, the results
of this study support the view that PI3K-dependent
activation of PDK1 and colocalization of PDK1 and PKC at the
membrane are both important for efficient phosphorylation of
PKC .

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 9.
Schematic of the synergistic effect of
12(S)HETE and EGF on PKC activation.
A, when endogenous 12(S)HETE synthesis is
blocked, most PKC is unphosphorylated and cytoplasmic. Application
of exogenous 12(S)HETE (300 nM) recruits PKC
to the cytoplasmic membrane without changing its phosphorylation state.
B, under the same experimental conditions, application of
EGF (15 ng/ml) triggers an asymmetric autophosphorylation of EGF
receptor (EGFR) leading to activation of PI3K and MAPK signaling
pathways but not the PLC pathway. This increases phosphorylation of
PKC that was already membrane-bound (presumably through the action
of PDK-1); however, because most PKC is cytoplasmic, there is little
increase in PKC activity. Previous results have shown that cell
proliferation does not occur under these conditions, although MAPK
signaling is activated (6-8). C, application of exogenous
12(S)HETE (300 nM) and EGF (15 ng/ml) together
leads to 12(S)HETE-dependent translocation of
PKC as well as EGF-dependent PI3K activation. The
resulting synthesis of PtdIns(3,4,5)P3 may recruit PDK-1 to
the membrane, increasing the probability of interaction between PDK-1
and PKC . Under these conditions, a large proportion PKC is
activated by phosphorylation and mitogenesis occurs (6-8).
|
|
 |
ACKNOWLEDGEMENTS |
We thank Dr. John Reddan for providing
N/N1003A lens epithelial cells, Dr. Alexandra Newton for providing the
antibody to the activation loop phosphorylation site, and Drs. Joram
Piatigorsky and Delores Takemoto for critically reading the text.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: NEI, National
Institutes of Health, Bldg. 6, Rm. 214, 6 Center Dr., MSC 2730, Bethesda, MD 20892-2730. Tel.: 301-496-7490; Fax: 301-435-7682; E-mail:
zelenkap@nei.nih.gov.
Published, JBC Papers in Press, December 2, 2002, DOI 10.1074/jbc.M209695200
 |
ABBREVIATIONS |
The abbreviations used are:
12(S)HETE, 12(S)-hydroxyeicosatetraenoic acid;
EGF, epidermal growth factor;
PKC, protein kinase C;
cPKC, classic
protein kinase C isoforms;
PI3K, phosphoinositide 3-kinase;
MAPK, mitogen-activated protein kinase;
PLC, phospholipase C;
MEK, MAPK
kinase;
PtdIns(3, 4,5)P3, phosphatidylinositol
3,4,5-trisphosphate;
TPA, 12-O-tetradecanoylphorbol
13-acetate;
GFP, green fluorescent protein;
DAG, diacylglycerol;
Erk, extracellular signal-regulated kinase;
PDK1, 3-phosphoinositide-dependent kinase-1;
cPLA2, cellular phospholipase A2;
Fluo-3 AM, glycine,
N-[4-[6-[(acetyloxy)methoxy]-2,7-dichloro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxyethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2- [(acetyloxy)methoxy]-2-oxyethyl],
(acetyloxy)methyl ester;
DMEM, Dulbecco's modified Eagle's
medium.
 |
REFERENCES |
| 1.
|
Lysz, T. W.,
Arora, J. K.,
Lin, C.,
and Zelenka, P. S.
(1994)
Cell Growth Differ.
5,
1069-1076[Abstract]
|
| 2.
|
Nie, D.,
Che, M.,
Grignon, D.,
Tang, K.,
and Honn, K. V.
(2001)
Cancer Metastasis Rev.
20,
195-206[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Lysz, T. W.,
Lin, C., Fu, S.-C. J.,
and Wu, Y.
(1992)
Exp. Eye Res.
54,
769-774[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Hurst, J. S.,
Balazy, M.,
Bazan, H. E. P.,
and Bazan, N. G.
(1991)
J. Biol. Chem.
266,
6726-6730[Abstract/Free Full Text]
|
| 5.
|
Oliw, E. H.
(1993)
Acta Physiol. Scand.
147,
117-121[Medline]
[Order article via Infotrieve]
|
| 6.
|
Arora, J. K.,
Lysz, T. W.,
and Zelenka, P. S.
(1996)
Invest. Ophthalmol. Vis. Res.
37,
1411-1418
|
| 7.
| Haque, M. S., Arora, J. K., Dikdan, G., Lysz, T. W., and
Zelenka, P. S. (1999) Mol Vis 5
|
| 8.
|
Seth, R. K.,
Haque, M. S.,
and Zelenka, P. S.
(2001)
Invest. Ophthalmol. Vis. Sci.
42,
3239-3246[Abstract/Free Full Text]
|
| 9.
|
Newton, A. C.
(1997)
Curr. Opin. Cell Biol.
9,
161-167[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Parekh, D. B.,
Ziegler, W.,
and Parker, P. J.
(2000)
EMBO J.
19,
496-503[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Oancea, E.,
and Meyer, T.
(1998)
Cell
95,
307-318[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Johnson, J. E.,
Giorgione, J.,
and Newton, A. C.
(2000)
Biochemistry
39,
1136-11369
|
| 13.
|
Dutil, E. M.,
Toker, A.,
and Newton, A. C.
(1998)
Curr. Biol.
8,
1366-1375[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Balendran, A.,
Hare, G. R.,
Kieloch, A.,
Williams, M. R.,
and Alessi, D. R.
(2000)
FEBS Lett.
484,
217-223[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Sonnenburg, E. D.,
Gao, T.,
and Newton, A. C.
(2001)
J. Biol. Chem.
276,
45289-45297[Abstract/Free Full Text]
|
| 16.
|
Dutil, E. M.,
Keranen, L. M.,
DePaoli-Roach, A. A.,
and Newton, A. C.
(1994)
J. Biol. Chem.
269,
29359-29362[Abstract/Free Full Text]
|
| 17.
|
Orr, J. W.,
and Newton, A. C.
(1994)
J. Biol. Chem.
269,
27715-27718[Abstract/Free Full Text]
|
| 18.
|
Edwards, A. S.,
Faux, M. C.,
Scott, J. D.,
and Newton, A. C.
(1999)
J. Biol. Chem.
274,
6461-6468[Abstract/Free Full Text]
|
| 19.
|
Negash, S.,
Wang, H. S.,
Gao, C.,
Ledee, D.,
and Zelenka, P.
(2002)
J. Cell Sci.
115,
2109-2117[Abstract/Free Full Text]
|
| 20.
|
Towbin, H.,
Staehelin, T.,
and Gordon, J.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
4350-4354[Abstract/Free Full Text]
|
| 21.
|
Sakai, N.,
Sasaki, K.,
Ikegaki, N.,
Shirai, Y.,
Ono, Y.,
and Saito, N.
(1997)
J. Cell Biol.
139,
1465-1476[Abstract/Free Full Text]
|
| 22.
| Ono, Y., Fujii, T., Igarashi, K., Kuno, T., Tanaka, C., Kikkawa, U.,
and Nishizuka, Y. (1989) Proc. Natl. Acad. Sci. U. S. A.
48684871
|
| 23.
|
Luo, J. H.,
and Weinstein, I. B.
(1993)
J. Biol. Chem.
268,
23580-23584[Abstract/Free Full Text]
|
| 24.
|
Slater, S. J.,
Seiz, J. L.,
Cook, A. C.,
Buzas, C. J.,
Malinowski, S. A.,
Kershner, J. L.,
Stagliano, B. A.,
and Stubbs, C. D.
(2002)
J. Biol. Chem.
277,
15277-15285[Abstract/Free Full Text]
|
| 25.
|
Grant, S.,
Qiao, L.,
and Dent, P.
(2002)
Front. Biosci.
7,
d376-d389[Medline]
[Order article via Infotrieve]
|
| 26.
|
Tari, A. M.,
and Lopez-Berestein, G.
(2001)
Semin. Oncol.
28,
142-147[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Okutani, T.,
Okabayashi, Y.,
Kido, Y.,
Sugimoto, Y.,
Sakaguchi, K.,
Matuoka, K.,
Takenawa, T.,
and Kasuga, M.
(1994)
J. Biol. Chem.
269,
31310-31314[Abstract/Free Full Text]
|
| 28.
|
Zwick, E.,
Hackel, P. O.,
Prenzel, N.,
and Ullrich, A.
(1999)
Trends Pharmacol. Sci.
20,
408-412[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Emlet, D. R.,
Moscatello, D. K.,
Ludlow, L. B.,
and Wong, A. J.
(1997)
J. Biol. Chem.
272,
4079-4086[Abstract/Free Full Text]
|
| 30.
|
Biscardi, J. S.,
Maa, M. C.,
Tice, D. A.,
Cox, M. E.,
Leu, T. H.,
and Parsons, S. J.
(1999)
J. Biol. Chem.
274,
8335-8343[Abstract/Free Full Text]
|
| 31.
|
Stephens, L.,
Jackson, T.,
and Hawkins, P. T.
(1993)
J. Biol. Chem.
268,
17162-17172[Abstract/Free Full Text]
|
| 32.
|
Cazaubon, S.,
Bornancin, F.,
and Parker, P.
(1994)
Biochem. J.
301,
443-448[Medline]
[Order article via Infotrieve]
|
| 33.
|
Keranen, L. M.,
Dutil, E. M.,
and Newton, A. C.
(1995)
Curr. Biol.
5,
1394-1403[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Dutil, E. M.,
and Newton, A. C.
(2000)
J. Biol. Chem.
275,
10697-10701[Abstract/Free Full Text]
|
| 35.
|
Nemenoff, R. A.,
Winitz, S.,
Qian, N. X.,
VanPutten, V.,
Johnson, G. L.,
and Heasley, L. E.
(1993)
J. Biol. Chem.
268,
1960-1964[Abstract/Free Full Text]
|
| 36.
|
Lin, L. L.,
Wartmann, M.,
Lin, A. Y.,
Knopf, J. L.,
Seth, A.,
and Davis, R. J.
(1993)
Cell
72,
269-278[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Alpert, S. E.,
Walenga, R. W.,
Mandal, A.,
Bourbon, N.,
and Kester, M.
(1999)
Am. J. Physiol.
277,
L457-L464[Medline]
[Order article via Infotrieve]
|
| 38.
|
Liu, B.,
Khan, W. A.,
Hannun, Y. A.,
Timar, J.,
Taylor, J. D.,
Lundy, S.,
Butovich, I.,
and Honn, K. V.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
9323-9327[Abstract/Free Full Text]
|
| 39.
|
Zakaroff-Girard, A.,
Dubois, M.,
Gilbert, M.,
Meskini, N.,
Nemoz, G.,
Lagarde, M.,
and Prigent, A. F.
(1999)
Life Sci.
64,
2135-2148[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Szekeres, C. K.,
Tang, K.,
Trikha, M.,
and Honn, K. V.
(2000)
J. Biol. Chem.
275,
38831-38841[Abstract/Free Full Text]
|
| 41.
|
Szekeres, C. K.,
Trikha, M.,
Nie, D.,
and Honn, K. V.
(2000)
Biochem. Biophys. Res. Commun.
275,
690-695[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
LeGood, J. A.,
Ziegler, W. H.,
Parekh, D. B.,
Alessi, D. R.,
Cohen, P.,
and Parker, P.
(1998)
Science
281,
2042-2045[Abstract/Free Full Text]
|
| 43.
|
Anderson, K. E.,
Coadwell, J.,
Stephens, L. R.,
and Hawkins, P. T.
(1998)
Curr. Biol.
8,
684-691[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
O'Flaherty, J. T.,
Chadwell, B. A.,
Kearns, M. W.,
Sergeant, S.,
and Daniel, L. W.
(2001)
J. Biol. Chem.
276,
24743-24750[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. A. Zampighi, A. M. Planells, D. Lin, and D. Takemoto
Regulation of Lens Cell-to-Cell Communication by Activation of PKC{gamma} and Disassembly of Cx50 Channels
Invest. Ophthalmol. Vis. Sci.,
September 1, 2005;
46(9):
3247 - 3255.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, H. Feng, X.-Q. Huang, H. Xiang, Y.-W. Mao, J.-P. Liu, Q. Yan, W.-B. Liu, Y. Liu, M. Deng, et al.
Human Telomerase Reverse Transcriptase Immortalizes Bovine Lens Epithelial Cells and Suppresses Differentiation through Regulation of the ERK Signaling Pathway
J. Biol. Chem.,
June 17, 2005;
280(24):
22776 - 22787.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Lin and D. J. Takemoto
Oxidative Activation of Protein Kinase C{gamma} through the C1 Domain: EFFECTS ON GAP JUNCTIONS
J. Biol. Chem.,
April 8, 2005;
280(14):
13682 - 13693.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. D. Sharma, P. Ottino, N. G. Bazan, and H. E. P. Bazan
Epidermal and Hepatocyte Growth Factors, but Not Keratinocyte Growth Factor, Modulate Protein Kinase C{alpha} Translocation to the Plasma Membrane through 15(S)-Hydroxyeicosatetraenoic Acid Synthesis
J. Biol. Chem.,
March 4, 2005;
280(9):
7917 - 7924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhou and M. L. Sutherland
Glutamate Transporter Cluster Formation in Astrocytic Processes Regulates Glutamate Uptake Activity
J. Neurosci.,
July 14, 2004;
24(28):
6301 - 6306.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Lin, J. Zhou, P. S. Zelenka, and D. J. Takemoto
Protein Kinase C{gamma} Regulation of Gap Junction Activity through Caveolin-1-Containing Lipid Rafts
Invest. Ophthalmol. Vis. Sci.,
December 1, 2003;
44(12):
5259 - 5268.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W.-C. Li, J.-P. Liu, J. Wang, Y.-W. Mao, and L.-H. Hou
Expression and Activity of the Signaling Molecules for Mitogen-Activated Protein Kinase Pathways in Human, Bovine, and Rat Lenses
Invest. Ophthalmol. Vis. Sci.,
December 1, 2003;
44(12):
5277 - 5286.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|