Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M209695200 on December 2, 2002

J. Biol. Chem., Vol. 278, Issue 7, 5388-5398, February 14, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/7/5388    most recent
M209695200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, J.
Right arrow Articles by Zelenka, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, J.
Right arrow Articles by Zelenka, P. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Synergy of Epidermal Growth Factor and 12(S)-Hydroxyeicosatetraenoate on Protein Kinase C Activation in Lens Epithelial Cells*

Jianzheng ZhouDagger , Robert N. Fariss§, and Peggy S. ZelenkaDagger

From the Dagger  Laboratory of Molecular and Developmental Biology and the § Laboratory of Mechanisms of Ocular Diseases, NEI, National Institutes of Health, Bethesda, Maryland 20892

Received for publication, September 20, 2002, and in revised form, November 22, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

12(S)-Hydroxyeicosatetraenoic acid (12(S)HETE) is a bioactive metabolite of arachidonic acid synthesized by 12-lipoxygenase. The 12-lipoxygenase blocker, baicalein, prevents epidermal growth factor (EGF)-induced activation of protein kinase C (PKC) alpha  and beta  in lens epithelial cells, whereas supplementation with 12(S)HETE reverses this effect, suggesting that EGF and 12(S)HETE may work together to activate PKC. This study investigates the mechanism of PKCbeta activation by EGF and 12(S)HETE. 12(S)HETE alone directed translocation of PKCbeta through the C1 rather than the C2 domain, without activating phosphoinositide 3-kinase (PI3K) or MAPK signaling or increasing intracellular calcium concentration. In the presence of baicalein, EGF triggered an asymmetric phosphorylation of the EGF receptor initiating signaling through PI3K and MAPK, but not PLCgamma . Together, 12(S)HETE and EGF synergistically increased phosphorylation of PKCbeta in the activation loop and C terminus as well as PKCbeta -specific activity. PI3K inhibitors blocked phosphorylation, but MEK1 inhibitors did not. Microvesicles containing phosphatidylinositol 3,4,5-trisphosphate mimicked the action of EGF on PKCbeta activity in the presence of 12(S)HETE. Kinase-inactive PKCbeta mutations in either activation loop or C terminus were effectively translocated by 12(S)HETE, as was PKCbeta in the presence of chelerythrine or Gö-6983. These findings indicate that unphosphorylated PKCbeta is translocated to the membrane by 12(S)HETE and phosphorylated by EGF-dependent PI3K signaling, to generate catalytically competent PKCbeta .

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

12(S)-Hydroxyeicosatetraenoic acid (12(S)HETE)1 is a bioactive metabolite of arachidonic acid, which evokes a wide variety of cellular responses, ranging from survival and proliferation to invasion and metastasis (1, 2). Although 12(S)HETE is synthesized primarily in platelets and leukocytes, a number of other cell types have some capacity to make this hydroxylipid, including the epithelial cells of the lens and cornea (3-5). Previous studies from this laboratory found that inhibitors of endogenous 12(S)HETE synthesis prevent EGF-dependent DNA synthesis and c-fos mRNA induction in cultured lens epithelial cells. This effect was specifically reversed by exogenous 12(S)HETE, but not by closely related HETEs, suggesting that 12(S)HETE plays an essential role in regulating lens cell proliferation (6, 7). Further investigation of the role of 12(S)HETE showed that the selective lipoxygenase inhibitor, baicalein, prevented EGF-induced activation of classic PKC isoforms, PKCalpha and PKCbeta (8), raising the possibility that a cooperative effect of EGF and 12(S)HETE is needed for full activation of PKC in these cells. In addition, because inhibition of the classic PKC isoforms was sufficient to block both c-fos mRNA induction and DNA synthesis, these findings pinpointed PKC as an important target of 12(S)HETE action in regulating lens epithelial cell proliferation (8).

Structural studies of the classic PKC isoforms (PKCalpha , beta , and gamma ) have identified several functional domains (9, 10). These include an autoinhibitory pseudosubstrate domain at the N terminus, the C1 domain, containing a diacylgycerol binding site (11), the C2 domain, containing binding sites for both anionic lipids and calcium (12), an activation loop adjacent to the active site, and the C-terminal domain. The classic PKC isoforms require diacylglycerol and calcium as well as PtdSer for full activity. In contrast, amino acid replacements at certain key residues in the C2 domain of the novel PKC isoforms (PKCdelta , epsilon , eta , and theta ) has made these isoforms insensitive to calcium signals, whereas changes in both the C1 and C2 domains of the atypical isoforms (PKCzeta and iota ) have rendered these isoforms insensitive to both calcium and diacylglycerol (9, 10). However, all isoforms require PtdSer or other acidic phospholipids for activity. Activation of PKC involves both phosphorylation of the enzyme at the activation loop and C terminus and translocation to the membrane, where it interacts with its lipid cofactors, PtdSer and diacylglycerol. Phosphorylation at the activation loop seems to be catalyzed by the phospholipid-dependent kinase, PDK1 (13-15), whereas the two phosphorylations in the C terminus appear to be autophosphorylations (16-18). Phosphorylation of PKC is thought to introduce a conformational change, which allows it to respond to lipid second messengers, such as diacylglycerol (18). Upon binding at the membrane, an additional conformational change removes the autoinhibitory substrate domain from the active site and the enzyme becomes catalytically active (9, 10).

Because previous studies of lens epithelial cells had suggested that EGF and 12(S)HETE may cooperate in some way to activate PKCalpha and PKCbeta , the present study was undertaken to investigate the mechanism of this effect, using a GFP-tagged PKCbeta fusion protein to study the respective effects of 12(S)HETE and EGF on translocation, phosphorylation, and activation. The results indicate that the synergistic effect of EGF and 12(S)HETE on PKCbeta activation is due to 12(S)HETE-dependent translocation of unphosphorylated PKCbeta to the cytoplasmic membrane, where it is phosphorylated by a PI3K-dependent mechanism activated by EGF.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- Wortmannin, LY294002, PD 98059, and the PepTag nonradioactive PKC assay kit were purchased from Promega (Madison, WI). 12-O-Tetradecanoylphorbol 13-acetate (TPA), ionomycin, and chelerythrine chloride were purchased from Sigma Chemical Co. (St. Louis, MO). 12(S)HETE, baicalein, Gö-6983, and phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P3) were from BIOMOL Research Laboratories, Inc. (Plymouth Meeting, PA). EGF was from Invitrogen (Rockville, MD). Polyclonal anti-PKCbeta antibody was from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Antibodies against phosphorylated sites in PKCbeta C terminus, EGF receptor, and phosphorylated sites in EGF receptor as well as PI3K and MAPK signaling sampler kits were all purchased from Cell Signaling Technology Inc. (Beverly, MA). Monoclonal and polyclonal anti-GFP antibodies were from Clontech (Palo Alto, CA). Rabbit polyclonal (P500) antibody directed against the phosphorylated activation loop of PKCbeta was a gift from Dr. Alexandra C. Newton (Department of Pharmacology, University of California, San Diego, CA). Calcium indicator, Fluo-3 ester, was purchased from Molecular Probes, Inc. (Eugene, OR).

Cell Culture-- The rabbit lens epithelial cell line, N/N1003A (a gift from Dr. John Reddan, Oakland University, Rochester, MI), was cultured at 35 °C in 5% CO2 in Dulbecco's modified Eagle's medium (DMEM) supplemented with 1 mM glutamine, 8% heat-inactivated rabbit serum, 100 units/ml penicillin, and 100 µg/ml streptomycin. For PKC activity assay, cells were plated in 75-mm flasks in an initial density of 2 × 106 cells. At 90-95% confluence, the medium was replaced with serum-free DMEM for 24 h, and the endogenous PKCbeta or stably expressed PKCbeta -GFP was precipitated with anti-PKCbeta or anti-GFP antibodies. For confocal observation of GFP-tagged PKCbeta translocation, cells were cultured in a glass-bottomed chamber (LabTek-II Chamber Coverglass, VWR International, Bridgeport, NJ) and transfected with PKCbeta -GFP (Clontech, Palo Alto, CA) using FuGENE transfection reagent (Roche Molecular Biochemicals, Indianapolis, IN). After 48 h, transfected cells were visualized with a Leica TCS SP2 confocal microscope (Leica Microsystems, Wetzlar, Germany). For immunoprecipitation and immunoblotting of PKCbeta or PKCbeta -GFP, N/N1003A cells were cultured in six-well plates. In all experiments, the cells were incubated with baicalein (30 µM) 8 h before stimulation to block the endogenous synthesis of 12(S)HETE. To check whether PI3K or MAPKs participate in the EGF-induced PKCbeta phosphorylation, cells were pretreated with either PI3K inhibitors, wortmannin, LY294002, or the MEK1 inhibitor PD98059 for 30 min.

Site-directed Mutagenesis and Cloning-- The preparation of constructs with mutations in either activation loop or C terminus of PKCbeta -GFP was done with the QuikChange site-directed mutagenesis kit from Stratagene Corp. (La Jolla, CA). The changed bases are underlined. The oligonucleotides used for introducing the T500A, T641A, and S660A mutations in pEGFP-PKCbeta were as follows (5' right-arrow 3'): for T500A, GGTGACAACCAAGGCATTCTGTGGCACTCC (15 cycles, 95 °C, 30 s; 50 °C, 30 s; and 60 °C, 14 min); for T641A, CCATCCACCAGTCCTAGCACCTCCTGACCAGGAAG (16 cycles, 95 °C, 30 s; 50 °C 1 min; and 65 °C, 14 min); for S660A, CAGAATTCGAAGGATTTGCCTTTGTTAACTCTGAATTTTTAAAAC (16 cycles, 95 °C, 30 s; 50 °C 1 min; and 65 °C, 14 min).

For introducing the double mutation in the C terminus, mutant T641A was used as a template for synthesis of the S660A mutation. The T500A, T641A, and T641A/S660A mutation sites were confirmed by full sequencing and then prepared in large quantity. For constructing truncated C1 and C2 domains of PKCbeta , the two fragments were amplified by PCR with pfu DNA polymerase (Stratagene, La Jolla, CA) using primers that introduced flanking restriction sites for EcoRI and BglII. The primers for amplification of C1 (residues 17-172) and C2 (residues 171-267) domains are as follows (5' right-arrow 3'): for C1, sense/ATGGGGGCCCGGTACCTTGGGGCGGGCCAC and antisense/CGGAATTCCCCACGCCGCAAAGGGAGGGCACGCTGCGCAC; for C2, sense/GAAGATCTATGGGGGCCCTAGAGCGCCGTGGACGTCTGC and antisense/CGGAATTCTGGTACCTCTCGCCCTCCTCCTGGTTCAGTAACTTG. The two PCR products were purified and cut with EcoRI and BglII, and the digested fragments were cloned into pEGFP-N3 vector (Clontech, Palo Alto, CA).

Expression of PKCbeta -GFP and Its Mutants in N/N1003A Cells-- Transient transfection into N/N1003A cells was performed by FuGENE transfection reagent according to the manufacturer's standard protocol (Roche Molecular Biochemicals, Indianapolis, IN). Plasmids encoding wild-type or mutated PKCbeta -GFP or GFP-tagged truncated C1 or C2 domains were transfected into 6 × 106 cells. After the transfection, cells were cultured at 35 °C to obtain the optimal fluorescence of GFP, and experiments were performed 2 days after the transfection.

Establishment of Stable Transfectants of Wild Type and Mutated PKCbeta -GFP-- N/N1003A cells were transiently transfected with PKCbeta wild-type, T500A, T641A, and T641A/S660A, respectively, by FuGENE transfection reagent (Roche Diagnostics Corp., Indianapolis, IN). Clones were selected based on G418 (400 µg/ml) resistance, and GFP fluorescence was checked under a fluorescence microscope (Axioscope, Carl Zeiss, Jena, Germany) to confirm the stability of expression.

Cell Lysis and Subcellular Fractionation-- Whole-cell lysates were prepared by lysing cells in phosphate-buffered saline containing 1.0% Triton X-100 (v/v), 1% (w/v) sodium deoxycholic acid, and 1% sodium dodecyl sulfate (w/v). Cells were scraped off the plate, transferred to a microcentrifuge tube on ice, and sonicated in a cold-water bath. Lysates were kept on ice for 15 min and centrifuged at 14,000 × g for 10 min at 4 °C. The resultant supernatants were stored at -80 °C for immunoblot analysis. Subcellular fractions for immunoblotting and PKC activity assays were prepared as previously described (8). Immunoprecipitation was performed as previously described (19).

Translocation of Wild-type and Mutated PKCbeta -GFP-- PKCbeta -GFP-transfected cells were spread onto the glass-bottomed chamber (LabTek-II, Ashland, MA) and cultured for at least 36 h. Serum-containing medium was replaced with serum-free DMEM 24 h before experiments. PKCbeta -GFP fluorescence was measured by confocal laser scanning microscopy (Leica TCS SP2, Leica Microsystems) using 488-nm argon laser excitation, a 500-nm RSP dichroic filter, and a 500- to 550-nm emission spectrum. Reagents were diluted directly into the serum-free medium to obtain the appropriate final concentration, and real-time images were collected to monitor PKCbeta -GFP movement. Images were collected at room temperature.

Immunoblot Analysis-- Protein concentration was measured by the bicinchoninic acid method (BCA Protein Assay Reagent kit, Pierce, Rockford, IL). Aliquots of fractions containing 20 µg of protein were mixed with an equal volume of 2× loading buffer, electrophoresed on 4-20% SDS-polyacrylamide gels, and transferred to nitrocellulose membranes (0.45-µm pore size, Novex, San Diego, CA) for 90 min at 400 mA as described previously (20). After transfer, membranes were blocked for 1 h at room temperature in 5% skim milk (Difco, Detroit, MI) in TBST (15 mM Tris-HCl and 150 mM NaCl, pH 7.5, with 0.05% Tween 20). After blocking, membranes were probed with specific primary antibodies according to the manufacturer's recommendations. Antibodies used were as follows: PKCbeta (1:500) mouse monoclonal (Transduction Laboratories, Lexington, KY), rabbit polyclonal antibody to Erk1/2 and phospho-44/42 Erk1/2 (T202/Y204) (1:1000), and rabbit polyclonal antibody to Akt or phospho-Akt (New England BioLabs, Beverly, MA). The immunoblots were incubated with primary antibodies for 1 h at room temperature on a shaking platform, washed three times with TBST, and incubated with the appropriate horseradish peroxidase-conjugated secondary antibody, either anti-rabbit or anti-mouse IgG, (1:2500, New England BioLabs) for 30 min at room temperature. Specific immunoreactive bands were detected by enhanced chemiluminescence (ECL Plus, Amersham Biosciences, Buckinghamshire, UK). Chemiluminescence was quantified by densitometric scanning of x-ray films with image analysis software (ImageQuaNT Scientific Software, version 5.0, Amersham Biosciences, Piscataway, NJ).

PepTag Assay for Nonradioactive Detection of PKC Activity-- The PepTag assay utilizes a brightly colored, fluorescent peptide substrate that is highly specific to PKC (Promega). Phosphorylation by PKC changes the net charge of the substrate from +1 to -1, thereby allowing the phosphorylated and nonphosphorylated versions of the substrate to be separated on an agarose (0.8%) gel. The phosphorylated species migrates toward the positive electrode, whereas the nonphosphorylated substrate migrates toward the negative electrode. The phosphorylated peptide in the band can then be visualized under UV light. Immunoprecipitated PKC was incubated with PKC reaction mixture (25 µl) according to the manufacturer's protocol (Promega) at 30 °C for 30 min. The reactions were stopped by placing the tubes in a boiling water bath for 10 min. After adding 80% glycerol (1 µl), the samples were loaded onto an agarose gel (0.8% agarose in 50 mM Tris-HCl, pH 8.0). The samples were separated on the agarose gel in the same buffer at 75 V for 25 min, and the bands were visualized under UV light and quantified by ImageQuaNT Scientific Software (version 5.0, Amersham Biosciences).

Confocal Ca2+ Imaging-- Intracellular Ca2+ was monitored with Fluo-3 AM, a membrane-permeable long wavelength fluorescence indicator. N/N1003 cells were plated in glass-bottomed chambers (LabTek-II Chamber Coverglass, VWR International, Bridgeport, NJ) and cultured in the standard medium for 24 h. The cells were loaded with acetoxymethyl ester of Fluo-3 (5 µM) for 30 min; after loading, a period of at least 30 min elapsed before experimentation to allow for de-esterification of the intracellularly accumulated Fluo-3 AM. A Leica TCS-SP2 laser scanning confocal microscope (Leica Microsystems, Germany) was used to visualize Ca2+-mediated fluorescence in the cells. Fluo-3 was excited with the 488-nm line of an argon laser, and Fluo-3 fluorescence was collected between 524 and 540 nm. Scanning was performed every 10 s for a total of 20 min after treatment with 12(S)HETE (800 nM) or EGF (15 ng/ml). For quantitative measurements, scanning was performed every 30 s for 40 min, and the ratio of fluorescence intensity to initial fluorescence intensity (F/F0) was calculated at each point. Data were collected on 14 cells, and the results were averaged.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

12(S)HETE and EGF Act in Synergy to Increase PKCbeta -specific Enzymatic Activity-- To examine the effect of 12(S)HETE and EGF on PKCbeta activation, we immunoprecipitated both endogenous PKCbeta and exogenous GFP-tagged PKCbeta from the membrane fraction of N/N1003 cells and measured its activity using the PKC peptide substrate, PepTag. We also calculated the specific enzymatic activity of PKCbeta by normalizing the relative level of phosphorylated PepTag to the relative amount of PKCbeta in the immunoprecipitate, as determined by immunoblotting. The results showed that EGF (15 ng/ml) in the presence of baicalein (30 µM) did not significantly increase either the phosphorylation of the PepTag substrate (Fig. 1A, upper panel) or the amount of PKCbeta in the membrane fraction (Fig. 1A, lower panel). Treatment with 12(S)HETE (300 nM) increased the amount of PKCbeta in the membrane fraction and increased the phosphorylation of the PepTag substrate somewhat but produced no increase in the specific enzymatic activity of PKCbeta (Fig. 1, A and B). However, combining 12(S)HETE (300 nM) with EGF (15 ng/ml) significantly enhanced PepTag phosphorylation and produced an ~2-fold increase in the specific enzymatic activity of PKCbeta (Fig. 1, A and B). These results confirm that 12(S)HETE and EGF have a synergistic effect on PKCbeta activation. For further studies of this effect, we established a cell line that stably expresses GFP-tagged PKCbeta . The GFP tag was fused with the C terminus of PKCbeta (Fig. 2A), because this fusion protein has previously been shown to retain full catalytic competence (21). Immunoprecipitation of PKCbeta -GFP with monoclonal anti-GFP antibody confirmed that its behavior was indistinguishable from that of endogenous PKCbeta with respect to activation in the presence and absence of 12(S)HETE (Fig. 1B, lower panel).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1.   12(S)HETE and EGF synergistically enhance both endogenous and exogenous PKCbeta -specific activity in rabbit lens epithelial N/N1003A cells. N/N1003A cells and a stably transfected N/N1003A line expressing PKCbeta -GFP were serum-deprived, pretreated with baicalein (30 µM) for 8 h, then stimulated with EGF (15 ng/ml), 12(S)HETE (300 nM), or both EGF and 12(S)HETE together. Controls were mock stimulated with DMEM. Endogenously expressed PKCbeta and stably expressed PKCbeta -GFP were immunoprecipitated from isolated membrane fractions and incubated with a specific substrate peptide tagged with a fluorescent probe (PepTag). After phosphorylation by PKC, the phosphorylated and unphosphorylated PepTag peptides were separated by agarose gel electrophoresis. To determine the specific enzymatic activity, PKC activity was quantitated by fluorescence intensity of the phosphorylated PepTag and normalized to the amount of PKC in the reaction mixture as determined by immunoblotting. A, a representative agarose gel separation of phosphorylated PepTag showing fluorescent phosphorylated Peptag (upper panel) and the corresponding immunoblot indicating the amount of PKC present in each kinase reaction (lower panel). B, specific enzymatic activity of both endogenous PKCbeta (upper panel) and stably expressed PKCbeta -GFP (lower panel) were determined after treatment with either 12(S)HETE, or EGF, or a combination of 12(S)HETE and EGF and expressed as percentage of control. Five separate experiments were done (mean ± S.E.).


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2.   Co-application of 12(S)HETE (300 nM) with EGF (15 ng/ml) does not enhance PKCbeta translocation to the membrane. A, diagram showing the structure of PKCbeta -GFP (left panel), truncated C1-GFP (middle), and C2-GFP (right) fusion proteins in transiently transfected N/N1003A cells. Note that GFP was fused C-terminal to PKCbeta and its truncated forms. B, time series images showing accumulation of GFP fluorescence at the plasma membrane within 20 min after serum-deprived cells were treated with 12(S)HETE (upper panel), EGF (middle panel), or both 12(S)HETE and EGF in combination (lower panel). Scale bar, 25 µm. C, to quantify the time course of PKCbeta -GFP redistribution, a translocation factor was calculated by comparing changes in the fluorescence intensity in two pre-assigned areas, one in the membrane and another in the cytosol (upper panel). 12(S)HETE and EGF in combination showed no synergistic effect on PKCbeta -GFP membrane translocation within 20 min (lower panel). D, time series images showing C1-GFP (upper panel, scale bar, 25 µm) or C2-GFP (middle panel, scale bar, 50 µm) translocation and Fluo-3 fluorescence changes after treatment with 12(S)HETE (800 nM). This concentration of 12(S)HETE had no effect on C2-GFP translocation or Fluo-3 fluorescence (lower panel, scale bar, 45 µm), although both parameters responded rapidly to ionomycin (0.5 µM) after 12(S)HETE was washed out.

12(S)HETE Promotes Translocation of PKCbeta -GFP-- Because translocation of PKC to the membrane is often considered sufficient for its activation, we next examined the effect of 12(S)HETE and EGF on PKCbeta translocation, using real-time imaging to follow the movement of PKCbeta -GFP in living cells. As in the above experiments, the cells were incubated with the selective 12-lipoxygenase inhibitor, baicalein (30 µM), to block the endogenous generation of 12(S)HETE (8). Under these conditions, exogenous application of 12(S)HETE (300 nM) rapidly delivered GFP-tagged PKCbeta to the plasma membrane (Fig. 2B). PKCbeta -GFP fluorescence began to localize at the plasma membrane about 10 min after 12(S)HETE addition and reached a plateau after about 15 min. In contrast, in the presence of baicalein, EGF (15 ng/ml) had no effect on PKCbeta -GFP translocation, whereas 12(S)HETE plus EGF showed a time course of PKCbeta translocation very similar to that seen with 12(S)HETE alone (Fig. 2B).

To quantify the time course of PKC translocation induced by 12(S)HETE and EGF, we calculated a translocation factor (R), defined as the difference between fluorescence intensity in the plasma membrane (IM) and cytoplasm (IC) divided by the intensity in the cytoplasm (IC). Thus,
R=(I<SUB><UP>M</UP></SUB>−I<SUB><UP>C</UP></SUB>)/I<SUB><UP>C</UP></SUB> (Eq. 1)
A time series of confocal images was taken, and the value of R was calculated automatically by comparing the changes of the fluorescence intensity in two pre-assigned areas: one in the membrane (representing IM), another in the cytosol (representing IC) (Fig. 2C). The results demonstrated that the rate and extent of translocation produced by 12(S)HETE and EGF in combination was indistinguishable from that produced by 12(S)HETE alone (Fig. 2C).

To investigate the mechanism underlying the 12(S)HETE-dependent translocation of PKCbeta , we tested the effect of 12(S)HETE on GFP-tagged constructs of the truncated C1 and C2 domains of PKCbeta . Previous studies have identified these domains as membrane targeting modules that mediate PKC translocation by binding with diacylglycerol and calcium, respectively (11, 12, 22, 23). In control experiments, TPA (1.5 µg/ml) induced a translocation of the C1-GFP domain to the membrane, where it remained for more than 20 min (not shown). Similarly, control experiments with ionomycin (0.5 µM) induced translocation of GFP-C2 (Fig. 2D). In this case, however, the time course of translocation was very rapid, with membrane-associated fluorescence reaching a peak and returning to baseline within 60 s in most cells (Fig. 2D). Interestingly, ionomycin (0.5 µM) also caused translocation of GFP-C1 to the membrane (data not shown). Because previous studies of the isolated C1 domain indicate that it binds to the membranes in a calcium-independent manner (12), the response to ionomycin may reflect a calcium-dependent change in membrane lipids. Incubating cells in 300 nM 12(S)HETE, a concentration that promoted translocation of full-length PKCbeta -GFP (30/34 cells imaged) within about 14 min, had a weak effect on C1-GFP membrane translocation (2/15 cells imaged) and no effect on C2-GFP (data not shown). Increasing the concentration of 12(S)HETE to 800 nM strongly directed C1-GFP to the membrane (14/16 cells imaged) but had no effect on C2-GFP translocation (Fig. 2D). These findings suggest that 12(S)HETE promotes the translocation of PKCbeta by affecting either the lipid composition of the membrane or the lipid binding capacity of PKCbeta , rather than by mobilizing Ca2+. In addition, the observation that higher concentrations of 12(S)HETE are needed for translocation of the isolated C1 domain than for the full-length protein suggests that interactions between C1 and other regions of PKCbeta , such as the recently reported interaction between C1 and C2 (24), may facilitate membrane binding.

In view of the inability of 12(S)HETE to direct the translocation of the calcium-responsive C2 domain, we next tested whether 12(S)HETE has any effect on cytoplasmic Ca2+ levels. To measure changes in cytoplasmic calcium, we loaded N/N1003A cells with the membrane-permeable calcium indicator, Fluo-3 ester, and monitored the Ca2+-dependent fluorescence by real-time imaging, sampling every 10 s for 20 min. Application of 12(S)HETE (800 nM) had no effect on intracellular Ca2+ levels (Fig. 2D). Thus, 12(S)HETE seems to mediate translocation of PKCbeta through a preferential effect on the C1 domain, which is not accompanied by changes in intracellular calcium.

EGF Induces PI3K and MAPK Signaling Cascades But Not the PLC-gamma Pathway-- The EGF receptor undergoes tyrosine autophosphorylation in its intracellular domain after binding with EGF (25). The phosphorylated tyrosine residues then serve as docking sites for recruitment of different signaling molecules, leading to the activation of signaling through PI3K, MAPK, and PLC-gamma (25). Phosphorylation of tyrosine 1068 leads to activation of PI3K and MAPK through the adaptor proteins Grb2 or Gab1 (26, 27), whereas phosphorylation at tyrosine 992 or 1173 activates PLC-gamma (28, 29) (Fig. 3A, upper panel). In addition, EGF receptor phosphorylation by c-Src at tyrosine 845 increases the receptor kinase activity (30). To investigate the signaling pathways activated by EGF in N/N1003A cells, we examined the phosphorylation state of each of these tyrosines using phospho-specific antibodies. The results confirmed that the EGF receptor is expressed (Fig. 3A) and undergoes phosphorylation at tyrosine 845 and 1068 in response to EGF (15 ng/ml). However, no phosphorylation of tyrosine 992 was observed (Fig. 3A). Consistent with these findings, EGF treatment triggered strong phosphorylation of Akt, a kinase downstream of PI3K, and of Erk1/2 (Fig. 3B), indicating that both the PI3K and MAPK signaling cascades are activated.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3.   Asymmetric phosphorylation of EGFR initiates PI3K and MAPK, but not PLC-gamma , signaling pathways. Phosphorylation of the EGFR intracellular domain at different tyrosine residues was determined with site-specific anti-phosphotyrosine antibodies. Activation of PI3K and MAPK signaling pathways was assayed by monitoring Akt and Erk1/2 phosphorylation, respectively, after treatment with EGF (15 ng/ml). Cytosolic Ca2+ was monitored by confocal microscopy using Fluo-3 AM fluorescence (excitation at 514 nm and emission between 524 and 560 nm) as an indicator for PLC-gamma pathway activation. A, Western blots demonstrating asymmetric phosphorylation of tyrosine residues at 845, 1068, and 992. B, Western blots indicating total and phosphorylated Akt at threonine 308 and serine 473, respectively (left panel), and total as well as phosphorylated Erk1/2 (right panel) after EGF (15 ng/ml) application. C, time series images showing that EGF (15 ng/ml) has no effect on translocation of C2-GFP (upper panel, scale bar, 35 µm) or cytosolic calcium level (lower panel, scale bar, 45 µm) within 20 min. Note that ionomycin (0.5 µM) produced rapid calcium mobilization after EGF was washed out (lower panel). D, time course of the ratio of Fluo-3 fluorescence intensity to initial Fluo-3 fluorescence intensity (F/F0) after treatment with EGF (15 ng/ml) and ionomycin (0.5 µM), respectively. Each point represents the average ± S.E. of measurements on 14 cells (n = 14). In some cases the error bars are contained within the symbol.

The lack of autophosphorylation at tyrosine 992 suggested that EGF may fail to activate signaling through PLC-gamma in N/N1003 cells under the present conditions. In this case, EGF would also not produce the increase in cytosolic calcium that is the expected consequence of PLC-gamma activation. To test this possibility, we examined the ability of EGF (15 ng/ml) to deliver the calcium-responsive GFP-tagged C2 domain of PKCbeta to the membrane. EGF failed to cause translocation of the GFP-tagged C2 domain (Fig. 3C, upper panel), although ionomycin (0.5 µM) produced translocation within 40 s after EGF was washed out (not shown).

To further define the effect of EGF on the PLCgamma signaling pathway, we monitored changes in free cytosolic Ca2+ level using the membrane-permeable calcium indicator, Fluo-3 ester. Cells were treated with EGF (15 ng/ml), and fluorescence was monitored every 10 s for 20 min. We observed no increase in cytosolic Ca2+ level within this time period (Fig. 3C, lower panel). In contrast, when EGF was washed out and replaced by ionomycin (0.5 µM), Ca2+ levels were elevated within 20 s (Fig. 3C, lower panel). For a more quantitative measure of Ca2+ levels, the ratio of fluorescence intensity to initial fluorescence intensity (F/F0) was measured every 30 s for 40 min. Data were collected from fourteen individual cells, and the results were averaged (Fig. 3D). We detected no increase in F/F0, although this ratio increased sharply when EGF was washed out and replaced by ionomycin. Thus, under these experimental conditions, the PLC-gamma pathway appears to be silent after treatment with EGF (15 ng/ml). This may explain the unusual finding that EGF (15 ng/ml) alone is unable to induce PKCbeta translocation (Fig. 2A).

12(S)HETE Does Not Activate PI3K and MAPK Signaling Cascades-- To test the effect of 12(S)HETE and EGF on the PI3K and MAPK signaling cascades, N/N1003 cells were treated with baicalein, followed by exposure to 12(S)HETE, EGF, or both, for 20 min, and specific antibodies were used to detect the activated forms of Akt and Erk1/2. As expected, EGF treatment led to phosphorylation of both Thr-308 and Ser-473 of Akt, as well as phosphorylation of Erk1/2 (Fig. 4). In contrast, treatment with 12(S)HETE did not lead to phosphorylation of either Akt or Erk1/2. Adding both agents in combination did not increase the extent of phosphorylation above the levels produced by EGF alone. Phosphorylation of Akt and Erk were blocked by the PI3K inhibitor, Ly294002, and the MEK1 inhibitor, PD98059, respectively, confirming that the observed phosphorylations resulted from signaling through PI3K and MEK1. These results imply that EGF is able to initiate signaling through these pathways, whereas 12(S)HETE is not.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4.   Co-application of 12(S)HETE (300 nM) with EGF (15 ng/ml) has no synergistic effect on PI3K or MAPK signaling. Akt and ErK1/2 phosphorylation were determined as indicators for PI3K and MAPK signaling cascades activation, respectively. LY294002 (10 µM) or wortmannin (100 nM) was utilized to inhibit PI3K activity, whereas PD98059 (10 µM) was used for MEK inhibition. 12(S)HETE, alone or in combination with EGF, had no effect on Akt phosphorylation (left panel) or Erk1/2 phosphorylation (right panel). Phosphorylation of Akt was abolished by Ly294002 (10 µM) or wortmannin (100 nM) and phosphorylation of Erk1/2 by PD98059 (10 µM) confirming the involvement of PI3K and MEK, respectively.

Synergistic Effect of EGF and 12(S)HETE on PKCbeta Phosphorylation-- Because PKC phosphorylation is regarded as an important factor in regulating PKC activity, we next tested the respective roles of EGF and 12(S)HETE in phosphorylating the activation loop and C terminus of PKCbeta , using specific antibodies against the phosphorylated motifs in the activation loop DGVTTKpTFCGTPD and C terminus NFDKFFTRGQPVLpTPPDQLVIANIDQSDFE. PKCbeta was immunoprecipitated from both membrane fraction and whole cell lysate then analyzed by immunoblotting to determine its phosphorylation state. Unstimulated N/N1003A cells contained very low levels of phosphorylation in the activation loop (T500) and C terminus (T641) in either the membrane fraction or whole cell lysate as determined by immunoblotting with phospho-specific antibodies (Fig. 5, A and B). Incubating baicalein-treated cells with EGF (15 ng/ml) alone for 20 min produced approximately a 70% increase in PKCbeta phosphorylation at both sites, whereas 12(S)HETE (300 nM) alone had no significant effect on PKCbeta phosphorylation under the same conditions (Fig. 5, A and B). In contrast, the combination of EGF and 12(S)HETE had a strong synergistic effect on PKCbeta phosphorylation in both activation loop and C terminus with approximately a 4- to 5-fold increase of PKCbeta phosphorylation (Fig. 5, A and B). To investigate the signaling cascades required for this synergistic effect on PKC phosphorylation, cells were pretreated with PI3K inhibitor LY294002 (10 µM) or MEK inhibitor PD98059 (10 µM) for 30 min. Pretreatment with LY294002 (10 µM) abolished the phosphorylation of PKC produced by combined treatment with EGF and 12(S)HETE, whereas the MEK inhibitor, PD98059, had no effect (Fig. 5, A and B), suggesting that signaling through PI3K is required.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5.   Co-application of 12(S)HETE (300 nM) with EGF (15 ng/ml) synergistically affects PI3K-dependent phosphorylation of endogenous PKCbeta in the activation loop and C terminus. Endogenously expressed PKCbeta from either membrane-associated fraction (A) or whole cell lysate (B) were immunoprecipitated with rabbit anti-PKCbeta . Total PKCbeta was immunoblotted with mouse monoclonal anti-PKCbeta . PKCbeta phosphorylation in the activation loop and C terminus was determined with phosphospecific antibodies. Immunoblots were quantified by densitometry and results were expressed as percentage of control. Five separate experiments were performed (mean ± S.E.). A, representative immunoblots showing total PKCbeta and phosphorylation in either activation loop or C terminus from the membrane-associated fractions. Bar graphs of quantitative results show a PI3K-dependent synergistic effect of 12(S)HETE and EGF on PKCbeta phosphorylation in activation loop and C terminus. B, representative immunoblots showing total PKCbeta and phosphorylation in either activation loop or C terminus from whole cell lysate. Bar graphs of quantitative results show a PI3K-dependent synergistic effect of 12(S)HETE and EGF on PKCbeta phosphorylation in activation loop and C terminus.

To confirm that EGF and 12(S)HETE have a synergistic effect on phosphorylation of the PKCbeta -GFP fusion protein, as well as the endogenous enzyme, PKCbeta -GFP was immunoprecipitated from stably transfected cells using anti-GFP antibody. The phosphorylation state of its activation loop and C terminus were then examined by immunoblotting with phospho-specific antibodies. Once again, the combination of 12(S)HETE and EGF had a synergistic effect on phosphorylation of the activation loop and C terminus (Fig. 6, A and B), which was prevented by pretreatment with PI3K blocker, LY294002 (10 µM), but not by the MEK inhibitor, PD98059 (Fig. 6, A and B).


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 6.   Synergy effect of 12(S)HETE (300 nM) and EGF (15 ng/ml) on phosphorylation of stably expressed exogenous PKCbeta -GFP in both activation loop and C terminus is PI3K-dependent. A stably transfected line of N/N1003A cells expressing PKCbeta -GFP was established by resistance to G418 (400 µg/ml). The exogenously expressed PKCbeta -GFP fusion protein was immunoprecipitated with mouse monoclonal anti-GFP antibody. Experiments were performed as described in the legend to Fig. 5 and expressed as percentage of control. Results represent mean of five separate experiments, ± S.E. A, representative immunoblots and quantitative results for PKCbeta -GFP from the membrane-associated fractions. B, representative immunoblots and quantitative results for PKCbeta -GFP from whole lysate.

Synergy of 12(S)HETE and EGF on PKCbeta Activation Is PI3K-dependent-- The above results imply that the combined effect of EGF and 12(S)HETE on PKCbeta activation may be due to EGF-dependent phosphorylation of PKCbeta following its translocation to the membrane by 12(S)HETE. As a direct test of this possibility, we measured the effect of PI3K inhibitors on the specific enzymatic activity of PKCbeta after stimulating with 12(S)HETE, EGF, or both agents combined. If phosphorylation in either the activation loop or C terminus is essential to the increase in specific enzymatic activity of PKCbeta produced by these agents in combination, co-treatment with these inhibitors should block this effect. The results indicate that this is the case (Fig. 7). The synergistic effect of 12(S)HETE and EGF on the specific enzymatic activity of PKCbeta was prevented by pretreatment with PI3K blockers, wortmannin (100 nM) or LY294002 (10 µM), but not by the MEK inhibitor, PD98059 (10 µM) (Fig. 7A). The same result was obtained using PKCbeta -GFP immunoprecipitated from stably transfected N/N1003 cells with monoclonal anti-GFP antibody (data not shown). Because 12(S)HETE had no effect on PI3K signaling (Fig. 4), these results imply that the synergistic effect of EGF and 12(S)HETE on PKCbeta activation requires EGF-dependent signaling through PI3K.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 7.   Synergistic effect of 12(S)HETE (300 nM) and EGF (15 ng/ml) on endogenous PKCbeta activity is PI3K-dependent. N/N1003A cells were treated with EGF and 12(S)HETE, either alone or in combination, as indicated. PKCbeta specific activity was quantified and plotted as in legend to Fig. 1. Results represent mean ± S.E. of four separate experiments. A, effect of PI3K inhibitors and MEK inhibitor on PKCbeta specific activity. Representative agarose gel separation of phosphorylated PepTag and immunoblot indicating amount of PKC present in corresponding kinase reaction. Synergistic effect of 12(S)HETE and EGF on PKCbeta specific activity was blocked by PI3K inhibitors. B, N/N1003A cells were loaded with PtdIns(3,4,5)P3 microvesicles as indicated, then treated with EGF and 12(S)HETE, either alone or in combination. Representative agarose gel separation of phosphorylated PepTag and immunoblot indicating amount of PKC in the corresponding kinase reaction. Results indicate that PtdIns(3,4,5)P3 mimicked the effect of EGF (lower panel).

One of the principal products of phosphoinositide phosphorylation by PI3K is PtdIns(3,4,5)P3 (31). This lipid generates a membrane docking site for a variety of pleckstrin homology domain proteins, including PDK1, the kinase implicated in PKC phosphorylation (13-15). To confirm that the EGF-dependent activation of PI3K is responsible for the synergistic effect of EGF and 12(S)HETE on PKCbeta activation, we loaded N/N1003A cells with PtdIns(3,4,5)P3 microvesicles and measured the specific enzymatic activity of PKCbeta in the presence or absence of 12(S)HETE. PtdIns(3,4,5)P3 had no effect on the specific enzymatic activity of PKCbeta when added alone (Fig. 7B). However, in combination with 12(S)HETE, PtdIns(3,4,5)P3 increased the specific enzymatic activity by about 2-fold (Fig. 7B). Thus, when combined with 12(S)HETE, PtdIns(3,4,5)P3 is able to enhance the specific activity of PKCbeta to about the same extent as EGF. These findings strengthen the view that, when 12(S)HETE and EGF act together to increase the specific enzymatic activity of PKCbeta , the role of EGF is to increase PKCbeta phosphorylation via PI3K signaling.

12(S)HETE Delivers Unphosphorylated PKCbeta to the Membrane-- These findings implied that the contribution of 12(S)HETE to the synergistic effect with EGF lies in its ability to deliver unphosphorylated PKCbeta to the plasma membrane, where it can be phosphorylated by EGF-dependent activation of the PI3K cascade. To explore this idea in greater detail, we generated stably transfected N/N1003A cell lines expressing PKCbeta -GFP containing specific mutations at phosphorylation sites in the activation loop (T500A) and C terminus (T641A and T641A/S660A) (Fig. 8A). As expected, neither the T500A mutation nor the T641A/S660A double mutation was phosphorylated in the combined presence of EGF and 12(S)HETE, although the wild-type PKCbeta construct was significantly phosphorylated under these conditions (Fig. 8B). We also found no phosphorylation in the C terminus when the phosphorylatable threonine residue in the activation loop (T500) was replaced with alanine (data not shown), as expected if these sites are autophosphorylated following phosphorylation of the activation loop. In addition, immunoprecipitates of the mutated proteins showed no kinase activity toward the PepTag substrate. This confirms that phosphorylation at these sites is required for activity, as suggested by previous studies (17, 32, 33). Using real-time fluorescence imaging, we next inquired whether 12(S)HETE directed translocation of the T500A and T641A/S660A mutated proteins to the plasma membrane (Fig. 8D). Both mutated proteins were effectively translocated, with a time course similar to that of the wild-type protein (compare with Fig. 2). Thus, 12(S)HETE is able to direct membrane translocation of inactive, unphosphorylated forms of PKCbeta . Finally, we tested whether abolishing PKCbeta activity with the inhibitors chelerythrine or Gö-6983 interfered with the ability of 12(S)HETE to direct PKCbeta to the membrane (Fig. 8E). Although both inhibitors effectively blocked PKCbeta kinase activity toward the PepTag substrate (not shown), they had no effect on the ability of 12(S)HETE to direct translocation to the plasma membrane (Fig. 8E). TPA was also able to direct translocation of PKCbeta in the presence of chelerythrine (Fig. 8E) or Gö-6983 (not shown). Together these findings confirm that 12(S)HETE is able to direct membrane translocation of unphosphorylated, inactive forms of PKCbeta and demonstrate that translocation and phosphorylation are separable events.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 8.   Mutations in either activation loop or C terminus of PKCbeta -GFP prevent activation but not translocation. Mutations in activation loop and C terminus were introduced by site-directed mutagenesis and confirmed by complete sequencing. Stable transfectants of the mutated PKCbeta -GFP were made by selection with resistance of G418 (400 µg/ml). The activity of mutants was determined as described under "Experimental Procedures." Membrane translocation of the mutants was visualized with real-time confocal microscopy. A, schematics showing the wild-type PKCbeta -GFP and location of mutations in the activation loop or C terminus. B, immunoblots confirming that introduction of mutations in either activation loop (T500A) or C terminus (T641A/S660A) eliminated phosphorylation in the corresponding sites upon exposure to 12(S)HETE and EGF, although wild-type (Wt) was still subject to phosphorylation. C, separation of phosphorylated PepTag with agarose gel showing that PKCbeta -GFP bearing mutations in the activation loop (T500A) or C terminus (T641A/S660A) were catalytically inactive. D, representative time series of confocal images showing membrane delivery of the mutated PKCbeta -GFP fusion proteins, T500A and T641A/S660A, in response to 12(S)HETE (300 nM). Scale bar, 35 µm. E, representative time series of confocal images showing PKCbeta -GFP translocation after treatment with 12(S)HETE or TPA in the presence of two PKC inhibitors, chelerythrine (10 µM), or Gö6983 (1 µM). Scale bar, 30 µm.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The present findings indicate that submicromolar concentrations of 12(S)HETE are sufficient to cause translocation of PKCbeta to the plasma membrane. Moreover, 12(S)HETE also directs translocation of the kinase inactive construct PKCbeta (T500A), which can not be phosphorylated in either the transactivation loop or C-terminal domain. Because this construct would be expected to retain the conformation of the unphosphorylated enzyme, as previously shown for PKCbeta (T500V) (17, 34), conversion to the mature, phosphorylated conformation of the enzyme is apparently not required for 12(S)HETE-dependent translocation. These findings contrast with previous findings indicating that PKCbeta must be fully phosphorylated to respond to lipid cofactors such as diacylglycerol or TPA (18) and suggest that certain lipids can recruit the unphosphorylated enzyme to the membrane for further processing by phosphorylation.

Although the mechanism responsible for 12(S)HETE-dependent translocation is unclear, it does not seem to involve calcium mobilization, because 12(S)HETE had no effect on the calcium-responsive C2 domain of PKCbeta and did not produce a detectable change in cytosolic calcium. Indeed, the preferential effect on the lipid-responsive C1 domain of PKCbeta , suggests that 12(S)HETE in some way modifies the membrane lipid environment to facilitate PKCbeta binding. Interestingly, a recent report indicates that low concentrations of arachidonic acid (10-30 nM) have a similar ability to translocate PKC in human polymorphonuclear neutrophils (44). Translocation in response to arachidonic acid, like translocation in response to 12(S)HETE, did not require calcium mobilization.

The present results confirm that EGF is unable to activate PKCbeta in lens epithelial cells if endogenous 12(S)HETE synthesis is blocked and suggest that endogenously synthesized 12(S)HETE may participate in PKC activation in lens epithelial cells by promoting translocation. Interestingly, this may provide a mechanism for activating cPKC isoforms that does not require calcium mobilization. Exactly how endogenously synthesized 12(S)HETE might participate in this process is not yet clear, however. One possibility is that 12(S)HETE may be esterified to phospholipids, then released in response to EGF by the action of cPLA2, which is activated by MAPK (35, 36). Alternatively, arachidonic acid might be released by cPLA2 then converted to 12(S)HETE by 12-lipoxygenase. Because our results suggest that EGF does not activate PLCgamma in this cell type, it seems unlikely that formation of a 12(S)HETE-esterified diacylglycerol is involved. Nevertheless, the related hydroxylipid, 15(S)HETE, has been shown to form 15(S)HETE-esterified diacylglycerols that specifically activate PKCalpha in human tracheal epithelial cells (37).

Several reports in the literature indicate that there are specific cell surface receptors for 12(S)HETE (38-40). In support of this view, addition of 12(S)HETE has been shown to activate PKC, PLCgamma , MAPK, and PI3K in a variety of cell types (38, 40, 41). In contrast, we found that 12(S)HETE had no effect on signaling via MAPK, PI3K, or intracellular calcium and was unable to activate PKCbeta without the cooperative action of EGF. The difference between these findings and those reported for other cell types suggests that 12(S)HETE may have multiple modes of action. Indeed, binding curves for 12(S)HETE are complex and provide evidence for both high affinity and low affinity receptors, further supporting the possibility that 12(S)HETE may have various modes of action (39, 40). Moreover, the apparent lack of downstream signaling in response to 12(S)HETE in the present study raises the possibility that some of its effects may be receptor-independent and may result from its ability to modify the lipid environment of the membrane.

In most adherent cell types, PKC is highly phosphorylated in both the activation loop and C terminus, even under unstimulated conditions (10, 15) or after serum starvation (15). Under these circumstances, cPKC translocation is sufficient for its activation, because membrane binding induces the conformational change needed to release the catalytic core from the autoinhibitory pseudosubstrate (10, 12, 34). In contrast, serum-deprived lens epithelial cells have very low levels of PKCbeta phosphorylation, making it possible to separate translocation and activation. Our data suggest a model in which serum-deprived lens epithelial cells contain both phosphorylated and unphosphorylated PKCbeta , which is distributed between the membrane and cytoplasm, with the bulk of the enzyme in the cytoplasm. Upon addition of exogenous 12(S)HETE, both phosphorylated and unphosphorylated PKCbeta are translocated from the cytoplasm to the membrane (Fig. 9A). The phosphorylated PKCbeta present in this fraction produces an increase in membrane-associated kinase activity. However, because there is no new phosphorylation of PKCbeta , there is no increase in the specific enzymatic activity. On the other hand, if endogenous 12(S)HETE synthesis is blocked and EGF is added, activation of PI3K signaling may phosphorylate the small amount of unphosphorylated PKCbeta already associated with the membrane fraction of the serum-deprived cells but is unable to promote translocation (Fig. 9B). Phosphorylation of PKCbeta in the membrane increases both the activity of the membrane fraction and the specific enzymatic activity, but the effect is small, because the amount of enzyme associated with the membrane is small. Previous results have shown that cell proliferation does not occur under these conditions, although MAPK signaling is activated in response to EGF (6-8). In contrast, when both 12(S)HETE and EGF are present, a much larger amount of unphosphorylated PKCbeta is associated with the membrane, due to the ability of 12(S)HETE to direct the translocation of unphosphorylated, as well as phosphorylated, enzyme (Fig. 9C). The newly translocated, unphosphorylated enzyme is phosphorylated by EGF-dependent PI3K signaling, producing a synergistic effect on membrane-associated activity and specific enzymatic activity. Under these conditions, a large proportion of PKCbeta is activated by phosphorylation and mitogenesis occurs (6-8). Importantly, unphosphorylated PKCbeta is not phosphorylated in response to EGF unless it is translocated to the membrane. Thus, our data support the view that localization of PKCbeta at the membrane brings it into close proximity with PDK1, the kinase thought to be responsible for its phosphorylation (13, 14, 42). In a similar manner, membrane localization of Akt (also known as PKB) has been shown to facilitate its phosphorylation by PDK-1 (43). Although some studies have suggested that PDK1 may be constitutively active in cells, even following serum starvation (15), in the present study its activity appears to be regulated by PI3K in response to EGF. Thus, the results of this study support the view that PI3K-dependent activation of PDK1 and colocalization of PDK1 and PKCbeta at the membrane are both important for efficient phosphorylation of PKCbeta .


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 9.   Schematic of the synergistic effect of 12(S)HETE and EGF on PKC activation. A, when endogenous 12(S)HETE synthesis is blocked, most PKCbeta is unphosphorylated and cytoplasmic. Application of exogenous 12(S)HETE (300 nM) recruits PKCbeta to the cytoplasmic membrane without changing its phosphorylation state. B, under the same experimental conditions, application of EGF (15 ng/ml) triggers an asymmetric autophosphorylation of EGF receptor (EGFR) leading to activation of PI3K and MAPK signaling pathways but not the PLCgamma pathway. This increases phosphorylation of PKCbeta that was already membrane-bound (presumably through the action of PDK-1); however, because most PKCbeta is cytoplasmic, there is little increase in PKCbeta activity. Previous results have shown that cell proliferation does not occur under these conditions, although MAPK signaling is activated (6-8). C, application of exogenous 12(S)HETE (300 nM) and EGF (15 ng/ml) together leads to 12(S)HETE-dependent translocation of PKCbeta as well as EGF-dependent PI3K activation. The resulting synthesis of PtdIns(3,4,5)P3 may recruit PDK-1 to the membrane, increasing the probability of interaction between PDK-1 and PKCbeta . Under these conditions, a large proportion PKCbeta is activated by phosphorylation and mitogenesis occurs (6-8).


    ACKNOWLEDGEMENTS

We thank Dr. John Reddan for providing N/N1003A lens epithelial cells, Dr. Alexandra Newton for providing the antibody to the activation loop phosphorylation site, and Drs. Joram Piatigorsky and Delores Takemoto for critically reading the text.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: NEI, National Institutes of Health, Bldg. 6, Rm. 214, 6 Center Dr., MSC 2730, Bethesda, MD 20892-2730. Tel.: 301-496-7490; Fax: 301-435-7682; E-mail: zelenkap@nei.nih.gov.

Published, JBC Papers in Press, December 2, 2002, DOI 10.1074/jbc.M209695200

    ABBREVIATIONS

The abbreviations used are: 12(S)HETE, 12(S)-hydroxyeicosatetraenoic acid; EGF, epidermal growth factor; PKC, protein kinase C; cPKC, classic protein kinase C isoforms; PI3K, phosphoinositide 3-kinase; MAPK, mitogen-activated protein kinase; PLC, phospholipase C; MEK, MAPK kinase; PtdIns(3, 4,5)P3, phosphatidylinositol 3,4,5-trisphosphate; TPA, 12-O-tetradecanoylphorbol 13-acetate; GFP, green fluorescent protein; DAG, diacylglycerol; Erk, extracellular signal-regulated kinase; PDK1, 3-phosphoinositide-dependent kinase-1; cPLA2, cellular phospholipase A2; Fluo-3 AM, glycine, N-[4-[6-[(acetyloxy)methoxy]-2,7-dichloro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxyethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2- [(acetyloxy)methoxy]-2-oxyethyl], (acetyloxy)methyl ester; DMEM, Dulbecco's modified Eagle's medium.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Lysz, T. W., Arora, J. K., Lin, C., and Zelenka, P. S. (1994) Cell Growth Differ. 5, 1069-1076[Abstract]
2. Nie, D., Che, M., Grignon, D., Tang, K., and Honn, K. V. (2001) Cancer Metastasis Rev. 20, 195-206[CrossRef][Medline] [Order article via Infotrieve]
3. Lysz, T. W., Lin, C., Fu, S.-C. J., and Wu, Y. (1992) Exp. Eye Res. 54, 769-774[CrossRef][Medline] [Order article via Infotrieve]
4. Hurst, J. S., Balazy, M., Bazan, H. E. P., and Bazan, N. G. (1991) J. Biol. Chem. 266, 6726-6730[Abstract/Free Full Text]
5. Oliw, E. H. (1993) Acta Physiol. Scand. 147, 117-121[Medline] [Order article via Infotrieve]
6. Arora, J. K., Lysz, T. W., and Zelenka, P. S. (1996) Invest. Ophthalmol. Vis. Res. 37, 1411-1418
7. Haque, M. S., Arora, J. K., Dikdan, G., Lysz, T. W., and Zelenka, P. S. (1999) Mol Vis 5
8. Seth, R. K., Haque, M. S., and Zelenka, P. S. (2001) Invest. Ophthalmol. Vis. Sci. 42, 3239-3246[Abstract/Free Full Text]
9. Newton, A. C. (1997) Curr. Opin. Cell Biol. 9, 161-167[CrossRef][Medline] [Order article via Infotrieve]
10. Parekh, D. B., Ziegler, W., and Parker, P. J. (2000) EMBO J. 19, 496-503[CrossRef][Medline] [Order article via Infotrieve]
11. Oancea, E., and Meyer, T. (1998) Cell 95, 307-318[CrossRef][Medline] [Order article via Infotrieve]
12. Johnson, J. E., Giorgione, J., and Newton, A. C. (2000) Biochemistry 39, 1136-11369
13. Dutil, E. M., Toker, A., and Newton, A. C. (1998) Curr. Biol. 8, 1366-1375[CrossRef][Medline] [Order article via Infotrieve]
14. Balendran, A., Hare, G. R., Kieloch, A., Williams, M. R., and Alessi, D. R. (2000) FEBS Lett. 484, 217-223[CrossRef][Medline] [Order article via Infotrieve]
15. Sonnenburg, E. D., Gao, T., and Newton, A. C. (2001) J. Biol. Chem. 276, 45289-45297[Abstract/Free Full Text]
16. Dutil, E. M., Keranen, L. M., DePaoli-Roach, A. A., and Newton, A. C. (1994) J. Biol. Chem. 269, 29359-29362[Abstract/Free Full Text]
17. Orr, J. W., and Newton, A. C. (1994) J. Biol. Chem. 269, 27715-27718[Abstract/Free Full Text]
18. Edwards, A. S., Faux, M. C., Scott, J. D., and Newton, A. C. (1999) J. Biol. Chem. 274, 6461-6468[Abstract/Free Full Text]
19. Negash, S., Wang, H. S., Gao, C., Ledee, D., and Zelenka, P. (2002) J. Cell Sci. 115, 2109-2117[Abstract/Free Full Text]
20. Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 4350-4354[Abstract/Free Full Text]
21. Sakai, N., Sasaki, K., Ikegaki, N., Shirai, Y., Ono, Y., and Saito, N. (1997) J. Cell Biol. 139, 1465-1476[Abstract/Free Full Text]
22. Ono, Y., Fujii, T., Igarashi, K., Kuno, T., Tanaka, C., Kikkawa, U., and Nishizuka, Y. (1989) Proc. Natl. Acad. Sci. U. S. A. 48684871
23. Luo, J. H., and Weinstein, I. B. (1993) J. Biol. Chem. 268, 23580-23584[Abstract/Free Full Text]
24. Slater, S. J., Seiz, J. L., Cook, A. C., Buzas, C. J., Malinowski, S. A., Kershner, J. L., Stagliano, B. A., and Stubbs, C. D. (2002) J. Biol. Chem. 277, 15277-15285[Abstract/Free Full Text]
25. Grant, S., Qiao, L., and Dent, P. (2002) Front. Biosci. 7, d376-d389[Medline] [Order article via Infotrieve]
26. Tari, A. M., and Lopez-Berestein, G. (2001) Semin. Oncol. 28, 142-147[CrossRef][Medline] [Order article via Infotrieve]
27. Okutani, T., Okabayashi, Y., Kido, Y., Sugimoto, Y., Sakaguchi, K., Matuoka, K., Takenawa, T., and Kasuga, M. (1994) J. Biol. Chem. 269, 31310-31314[Abstract/Free Full Text]
28. Zwick, E., Hackel, P. O., Prenzel, N., and Ullrich, A. (1999) Trends Pharmacol. Sci. 20, 408-412[CrossRef][Medline] [Order article via Infotrieve]
29. Emlet, D. R., Moscatello, D. K., Ludlow, L. B., and Wong, A. J. (1997) J. Biol. Chem. 272, 4079-4086[Abstract/Free Full Text]
30. Biscardi, J. S., Maa, M. C., Tice, D. A., Cox, M. E., Leu, T. H., and Parsons, S. J. (1999) J. Biol. Chem. 274, 8335-8343[Abstract/Free Full Text]
31. Stephens, L., Jackson, T., and Hawkins, P. T. (1993) J. Biol. Chem. 268, 17162-17172[Abstract/Free Full Text]
32. Cazaubon, S., Bornancin, F., and Parker, P. (1994) Biochem. J. 301, 443-448[Medline] [Order article via Infotrieve]
33. Keranen, L. M., Dutil, E. M., and Newton, A. C. (1995) Curr. Biol. 5, 1394-1403[CrossRef][Medline] [Order article via Infotrieve]
34. Dutil, E. M., and Newton, A. C. (2000) J. Biol. Chem. 275, 10697-10701[Abstract/Free Full Text]
35. Nemenoff, R. A., Winitz, S., Qian, N. X., VanPutten, V., Johnson, G. L., and Heasley, L. E. (1993) J. Biol. Chem. 268, 1960-1964[Abstract/Free Full Text]
36. Lin, L. L., Wartmann, M., Lin, A. Y., Knopf, J. L., Seth, A., and Davis, R. J. (1993) Cell 72, 269-278[CrossRef][Medline] [Order article via Infotrieve]
37. Alpert, S. E., Walenga, R. W., Mandal, A., Bourbon, N., and Kester, M. (1999) Am. J. Physiol. 277, L457-L464[Medline] [Order article via Infotrieve]
38. Liu, B., Khan, W. A., Hannun, Y. A., Timar, J., Taylor, J. D., Lundy, S., Butovich, I., and Honn, K. V. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 9323-9327[Abstract/Free Full Text]
39. Zakaroff-Girard, A., Dubois, M., Gilbert, M., Meskini, N., Nemoz, G., Lagarde, M., and Prigent, A. F. (1999) Life Sci. 64, 2135-2148[CrossRef][Medline] [Order article via Infotrieve]
40. Szekeres, C. K., Tang, K., Trikha, M., and Honn, K. V. (2000) J. Biol. Chem. 275, 38831-38841[Abstract/Free Full Text]
41. Szekeres, C. K., Trikha, M., Nie, D., and Honn, K. V. (2000) Biochem. Biophys. Res. Commun. 275, 690-695[CrossRef][Medline] [Order article via Infotrieve]
42. LeGood, J. A., Ziegler, W. H., Parekh, D. B., Alessi, D. R., Cohen, P., and Parker, P. (1998) Science 281, 2042-2045[Abstract/Free Full Text]
43. Anderson, K. E., Coadwell, J., Stephens, L. R., and Hawkins, P. T. (1998) Curr. Biol. 8, 684-691[CrossRef][Medline] [Order article via Infotrieve]
44. O'Flaherty, J. T., Chadwell, B. A., Kearns, M. W., Sergeant, S., and Daniel, L. W. (2001) J. Biol. Chem. 276, 24743-24750[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
IOVSHome page
G. A. Zampighi, A. M. Planells, D. Lin, and D. Takemoto
Regulation of Lens Cell-to-Cell Communication by Activation of PKC{gamma} and Disassembly of Cx50 Channels
Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3247 - 3255.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang, H. Feng, X.-Q. Huang, H. Xiang, Y.-W. Mao, J.-P. Liu, Q. Yan, W.-B. Liu, Y. Liu, M. Deng, et al.
Human Telomerase Reverse Transcriptase Immortalizes Bovine Lens Epithelial Cells and Suppresses Differentiation through Regulation of the ERK Signaling Pathway
J. Biol. Chem., June 17, 2005; 280(24): 22776 - 22787.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Lin and D. J. Takemoto
Oxidative Activation of Protein Kinase C{gamma} through the C1 Domain: EFFECTS ON GAP JUNCTIONS
J. Biol. Chem., April 8, 2005; 280(14): 13682 - 13693.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. D. Sharma, P. Ottino, N. G. Bazan, and H. E. P. Bazan
Epidermal and Hepatocyte Growth Factors, but Not Keratinocyte Growth Factor, Modulate Protein Kinase C{alpha} Translocation to the Plasma Membrane through 15(S)-Hydroxyeicosatetraenoic Acid Synthesis
J. Biol. Chem., March 4, 2005; 280(9): 7917 - 7924.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Zhou and M. L. Sutherland
Glutamate Transporter Cluster Formation in Astrocytic Processes Regulates Glutamate Uptake Activity
J. Neurosci., July 14, 2004; 24(28): 6301 - 6306.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
D. Lin, J. Zhou, P. S. Zelenka, and D. J. Takemoto
Protein Kinase C{gamma} Regulation of Gap Junction Activity through Caveolin-1-Containing Lipid Rafts
Invest. Ophthalmol. Vis. Sci., December 1, 2003; 44(12): 5259 - 5268.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
D. W.-C. Li, J.-P. Liu, J. Wang, Y.-W. Mao, and L.-H. Hou
Expression and Activity of the Signaling Molecules for Mitogen-Activated Protein Kinase Pathways in Human, Bovine, and Rat Lenses
Invest. Ophthalmol. Vis. Sci., December 1, 2003; 44(12): 5277 - 5286.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/7/5388    most recent
M209695200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, J.
Right arrow Articles by Zelenka, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, J.
Right arrow Articles by Zelenka, P. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement