Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M208381200 on November 25, 2002

J. Biol. Chem., Vol. 278, Issue 8, 5630-5638, February 21, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/8/5630    most recent
M208381200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hill, D. M.
Right arrow Articles by Kozlowski, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hill, D. M.
Right arrow Articles by Kozlowski, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Dominant Negative Mutant beta 2-Microglobulin Blocks the Extracellular Folding of a Major Histocompatibility Complex Class I Heavy Chain*

Dawn M. HillDagger, Tina KasliwalDagger, Elie Schwarz, Andrea M. Hebert, Trina Chen, Elena Gubina, Lei Zhang, and Steven Kozlowski§

From the Division of Monoclonal Antibodies, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland 20892

Received for publication, August 16, 2002, and in revised form, November 25, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The major histocompatibility complex class I (MHC1) molecule plays a crucial role in cytotoxic lymphocyte function. beta 2-Microglobulin (beta 2m) has been demonstrated to be both a structural component of the MHC1 complex and a chaperone-like molecule for MHC1 folding. beta 2m binding to an isolated alpha 3 domain of MHC1 heavy chain at micromolar concentrations has been shown to accurately model the biochemistry and thermodynamics of beta 2m-driven MHC1 folding. These results suggested a model in which the chaperone-like role of beta 2m is dependent on initial binding to the alpha 3 domain interface of MHC1 with beta 2m. Such a model predicts that a mutant beta 2m molecule with an intact MHC1 alpha 3 domain interaction but a defective MHC1 alpha 1alpha 2 domain interaction would block beta 2m-driven folding of MHC1. In this study we generated such a beta 2m mutant and demonstrated that it blocks MHC1 folding by normal beta 2m at the expected micromolar concentrations. Our data support an initial interaction of beta 2m with the MHC1 alpha 3 domain in MHC1 folding. In addition, the dominant negative mutant beta 2m can block T-cell functional responses to antigenic peptide and MHC1.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The major histocompatibility complex class I (MHC1)1 molecule and antigenic peptide are recognized by CD8+ cytotoxic T-lymphocytes (CTL) in CTL activation and lysis of targets (1). The heavy chain of the MHC1 molecule can interact noncovalently with a number of other molecules in the formation of a CTL activating complex. These include the MHC1 light chain or beta 2m, the antigenic peptide fragment, the T-cell receptor (TCR), and the CD8 molecule (2). The specificity of the CTL response resides in the selective MHC1 binding of specific antigenic peptide fragments and in the TCR recognition of these antigenic peptides and MHC1 (3, 4). The MHC1 contact surface for TCR and peptide binding is formed by the alpha 1 and alpha 2 domains of the three-domain MHC1 heavy chain (2, 5-7).

The MHC1 heavy chain alpha 1 and alpha 2 domains, as well as the immunoglobulin-like alpha 3 domain, have been shown by x-ray crystallography (8) to interact with beta 2m, the nonpolymorphic component of the MHC1 complex. Mutations in the alpha 1 (9, 10) or alpha 3 (11) domains of the MHC1 heavy chain lead to changes in beta 2m binding. These studies demonstrate that the functional interaction of the MHC1 heavy chain with beta 2m occurs at multiple surfaces on different domains.

In the absence of beta 2m, most MHC1 molecules are not expressed efficiently on the surface of cells (12, 13). Although some MHC1 molecules, such as murine H-2Ld and H-2Db, are transported to the cell surface without beta 2m, they have diminished levels of expression (14, 15). This decreased MHC1 expression is not simply because of an export requirement for fully assembled MHC1 complexes. Transfection of beta 2m-negative cells with ER-retained beta 2m was able to salvage MHC1 cell surface expression (16). MHC1 folded in the presence of this ER-retained beta 2m was exported to the cell surface without bound beta 2m. Thus beta 2m, which promotes protein folding through a transient interaction, fits the definition of a chaperone (17). Therefore, beta 2m plays two roles in MHC1, first, as a structural subunit of the assembled complex and second, as a chaperone for the folding of the MHC1 heavy chain. A possible mechanism for beta 2m as a chaperone is facilitation of the interaction of MHC1 heavy chain with other chaperones, such as calreticulin, tapasin, transporter associated with antigen processing, and Erp57 (18, 19). However, because beta 2m has been shown to promote stabilization or folding of MHC1 on the cell surface in the absence of ER chaperones (20, 21), it is likely that beta 2m also has a direct effect on MHC1 folding.

Although high concentrations of high affinity peptides can promote the folding of MHC1 in the absence of beta 2m (15), these same peptides can stabilize MHC1 folded with beta 2m at significantly lower concentrations (22, 23). Therefore, with physiologic concentrations of high affinity peptides or any concentration of lower affinity peptides, beta 2m levels are limiting for the folding of MHC1 molecules.

The two roles of beta 2m, as structural subunit and chaperone, do not depend equally on beta 2m concentration. beta 2m binds to MHC1 heavy chain with an equilibrium dissociation constant (Kd) in the nanomolar range (24-27) while it folds or stabilizes cell surface MHC1 at micromolar concentrations (20, 21, 28). We have demonstrated previously (29) that human beta 2m (hbeta 2m) binds the isolated alpha 3 domain of the MHC1 heavy chain with a Kd in that same micromolar range and this binding has the same species dependence and thermodynamics as the beta 2m-driven refolding of the MHC1 heavy chain (30). This suggested that beta 2m folding of the complete MHC1 heavy chain may be nucleated by a beta 2m-alpha 3 interaction. Although the biochemical characteristics of folding match those of the predicted limiting initial beta 2m-alpha 3 interaction (30), it is formally possible that the similar binding characteristics of beta 2m-alpha 3 binding and beta 2m folding of MHC1 are coincidental.

To resolve this issue, we have generated beta 2m mutants with predicted defects in interactions with MHC1 alpha 1/alpha 2 domains and evaluated the mutant beta 2m effects on native beta 2m-driven folding of MHC1. Because the beta 2m-driven folding of the alpha 1 and alpha 2 domains is likely to be dependent on the beta 2m-alpha 1/alpha 2 interaction, many possible models would predict poor folding of MHC1 by these mutants. However, if the initial limiting interaction of beta 2m were with the alpha 3 domain, these beta 2m mutants would still have an intact initial interaction and be able to compete with native beta 2m for this initial interaction. Thus beta 2m mutants with diminished alpha 1/alpha 2 interactions would be competitive inhibitors of native beta 2m-driven MHC1 folding. Although such a mutant beta 2m protein would be predicted to inhibit extracellular MHC1 folding, its design and mode of inhibition are similar to dominant negative mutations used in the study of intracellular signaling and cytoskeletal structures (31, 32). It would be expected that this dominant negative effect on MHC1 folding would have a concentration dependence similar to that of the beta 2m-alpha 3 interaction.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

alpha 3 Domain Protein Expression and Purification-- The H-2Dd alpha 3 domain sequence was generated by PCR amplification of an H-Dd cDNA as described previously (29) with the upper primer ACTCCATGGCAACAGATCCCCCAAAGGCCC and the lower primer GATGAATTCGACCCGGAAGGAGGAGGTTC. The alpha 3 domain sequence was inserted between the NcoI and EcoR1 sites of a modified pET21d vector (Novagen, Madison, WI). The vector was modified by ligating a synthetic oligonucleotide (GAGGAATTCTGGAATTTCGCAAGCTGTACATGCTGCACACGCTGAAATTAACGAAGCAGGAAGAGCACTCGAGCAC) between the EcoR1 and XhoI sites of the pET21d bacterial expression vector. The completed construct had the correct sequence and when transfected and induced, generated a 15-kDa fusion protein consisting of the H-Dd alpha 3 domain fused to vector expressed sequence, a 17-amino acid peptide sequence from ovalbumin, and a polyhistidine tag.

The expression construct was transfected into BL21(DE3) bacteria (Novagen, Madison, WI). 400-ml cultures of transfected bacteria in LB broth with 200 µg/ml carbenicillin (Sigma) were grown to an absorbance of 0.6 at 600 nm. The cultures were then induced with 1 mM isopropyl-1-thio-beta -D-galactopyranoside (Sigma), and the cells were harvested by centrifugation after overnight induction at 28 °C. The bacteria were washed with PBS, and the pellet was frozen at -70 °C. The frozen pellet was thawed in 0.5 M NaCl, 10 mM Tris, pH 8.0, with 1 mg/ml lysozyme (Sigma). After addition of imidazole (Sigma) to a concentration of 5 mM and Triton X-100 (Roche Molecular Biochemicals) to a concentration of 1%, the bacteria were sonicated in a Brinkmann homogenizer (Brinkmann, Westbury, CT) for 3 × 30 s at a setting of 4. The homogenate was treated with ~500 units of Benzonase (Sigma) in the presence of 5 mM MgCl. Inclusion bodies were pelleted by spinning at 15,000 × g, and the soluble fraction was loaded on to buffer-equilibrated nickel-nitrilotriacetic acid resin (Qiagen) for 1 h at 4 °C. The loaded nickel-nitrilotriacetic acid resin was washed three times with 0.5 M NaCl, 10 mM Tris, pH 8.0, 1% Triton X 100, 5 mM imidazole buffer and then three times with 0.5 M NaCl, 10 mM Tris, pH 8.0, buffer. The fusion protein was eluted with high concentration imidazole (150 to 500 mM). The imidazole was removed by dialysis, and the protein was further purified by size exclusion chromatography. The protein concentration was measured by 280-nm absorbance. The extinction coefficient at 280 nm was calculated from the primary amino acid sequence (33).

beta 2m Mutagenesis, Expression, and Purification-- The recombinant native hbeta 2m was expressed using a construct in a PET21d vector generously supplied by Randall K. Ribaudo (34, 35). Mutant hbeta 2m genes were generated by PCR with the Pfu-1 polymerase (Stratagene) using splice overlap extension (36) with mutant oligonucleotides. The D53K mutation was generated with the upper GGAGCATTCAAAATTGTCTTTCA oligonucleotide primer (the base pairs in mutated codons are underlined) and a complementary lower primer. The D53R mutation was generated with the upper GGAGCATTCAAGATTGTCTTTCA oligonucleotide primer and a complementary lower primer. The W60A mutation was generated with the upper ATAGAAAGACGCGTCCTTGCT oligonucleotide primer and a complementary lower primer. The hbeta 2m upper GACGGAGCTCGAATTCGGATC primer and hbeta 2m lower AGGAGATATATCATGATCCAGCGT primer were used with the corresponding mutant oligos to amplify the mutated gene fragments in the first amplification step and for generating an intact gene the second amplification step. The intact gene fragments were digested with BspHI and BamHI and ligated into PET21d vector that was digested with NcoI and BamHI. Double mutants such as W60A/D53K were sequentially generated using the same process. The mutant genes were verified by sequencing. The constructs were transfected into BL21(DE3) bacteria (Novagen). 100-ml cultures of transfected bacteria in LB broth with 250 µg/ml carbenicillin with were grown at 37 °C to an absorbance of 0.8 at 600 nm and then induced with 1 mM isopropyl-1-thio-beta -D-galactopyranoside for 2 h. The bacteria were harvested by centrifugation and washed and resuspended with 0.1 M Tris, pH 8.0, with 2 mM EDTA. Lysozyme (Sigma) was added at 0.5 mg/ml, and the bacteria were incubated overnight at 4 °C. Deoxycholate was added to a final concentration of 0.1%, and the mixture was sonicated on a Brinkmann homogenizer for 4 × 30 s. The inclusion bodies were pelleted by centrifugation at 15,000 × g, and the soluble fraction was discarded. Inclusion bodies were washed three times with 0.1 M Tris, pH 8.0, with 2 mM EDTA and 0.1% deoxycholate followed by a wash with 0.1 M Tris, pH 8.0, 2 mM EDTA. The pellet was resuspended with 2 ml of 6 M guanidine HCl, 0.1 mM dithiothreitol, 0.1 M Tris, pH 8.0, 2 mM EDTA. The dissolved protein was added to 50 ml of pre-chilled 0.4 M arginine, 0.1 M Tris, 2 mM EDTA, 5 mM oxidized glutathione, 0.5 mM reduced glutathione and left to refold in the cold room with gentle agitation for a minimum of 3 days. The protein was then dialyzed against 1 liter of HEPES-buffered saline, 3 mM EDTA three times and then concentrated using an Amicon ultrafiltration cell and MicroSep 3K omega filters (Pall Corporation, Ann Arbor, MI). The concentrated beta 2m was then purified by size exclusion chromatography. Both native and mutant beta 2m were purified in the same manner. The protein concentrations were measured by 280-nm absorbance. The extinction coefficient at 280 nm was calculated from the primary amino acid sequence (33).

Size Exclusion Chromatography-- For beta 2m and for H-2Dd alpha 3 domain purification, 500-1000 µl of protein was loaded onto a Superdex 75 column (Pharmacia LKB, Amersham Biosciences, Uppsala, Sweden) using the P-500 pump (Pharmacia LKB) at 0.5 ml/min buffer. Half-ml fractions were collected, and the protein concentration was determined by 280-nm absorbance. Protein used for surface plasmon resonance experiments was purified in HBS-EP buffer (HEPES-buffered saline with 3 mM EDTA and 0.005% polysorbate 20) or PBS. Proteins used in flow cytometry and functional experiments were purified in PBS.

Antibodies, Cell Lines, and Peptide-- Anti-tetra His antibody was purchased from Qiagen. An anti-H-2Dd antibody (34.5.8S), an anti-H-2Kd antibody (SF1-1.1), and an IgG2akappa control antibody were purchased from Pharmingen. The LKD8 cell line, a peptide transport-deficient EE2H3 embryonic cell line transfected with H-2Dd (37), was the generous gift of David H. Margulies (NIH, Bethesda, MD). RMAs-Kd, a peptide transport-deficient cell line transfected with H-2Kd (38), was generously provided by Jonathan Yewdell (NIH, Bethesda, MD). The B4.2.3 T-cell hybridoma (reactive with gp160 p18-I10 in the context of H-2Dd) and H-2Dd L-cell transfectant cell lines were also used (39). The H-2Dd-expressing gp160 transfectant 3T3 cell line (40), 15-12, and its control cell line, 18neo, were generously provided by Jay A. Berzofsky (NIH, Bethesda, MD). The p18-I10 peptide (RGPGRAFVTI) (41, 42) was obtained from the Center for Biologics Evaluation and Research Facility for Biotechnology Resources (Bethesda, MD). The peptide was synthesized on an ABI 433 peptide synthesizer (Applied Biosystems, Foster City, CA) and characterized by matrix-assisted laser desorption ionization time-of-flight mass spectrometry analysis (Voyager; Applied Biosystems).

Surface Plasmon Resonance (SPR) Experiments and Data Analysis-- All SPR experiments were performed on the BIAcore 3000 biosensor (BIAcore AB, Uppsala, Sweden). Anti-His antibody, diluted in 10 mM acetate buffer, pH 4.5, was covalently coupled to the carboxymethylated dextran matrix on a CM5 sensor chip (Biacore AB) by using the amine coupling kit as described previously (43). Experiments were performed in HBS-EP buffer, and regeneration of the anti-His surface was achieved with 20 mM HCl.

Equilibrium binding data for beta 2m were obtained by averaging a 5-10-s interval of normalized signal after reaching equilibrium. The normalized signal was obtained by subtracting the control surface signal from alpha 3 surface signal. The equilibrium binding data was analyzed by nonlinear curve fitting of the Langmuir isotherm to the data. The curve fitting was performed using the BIAevaluation 3.0 software (BIAcore AB).

Flow Cytometry beta 2m MHC1 Folding Assay-- beta 2m and beta 2m mutants were titrated at the indicated concentrations in 24- or 12-well tissue culture plates containing 1 or 2 ml of OPTI-MEM medium (Invitrogen) with 0.5% BSA (Sigma) and 0.5 × 106 LKD8 cells (for H-2Dd folding) or 0.5 × 106 RMAs-Kd cells (for H-2Kd folding) per well. The assay was carried out in a 7.5% CO2 incubator at 26-28 °C for low temperature-induced folding or at 37 °C, with the indicated concentration of peptide, for peptide-induced folding. After an overnight incubation, the cells were spun down at 4 °C. One-half µg of the biotinylated anti-H-2Dd antibody, 34.5.8S (Pharmingen), or biotinylated anti-H-2Kd antibody, SF1-1.1 (Pharmingen), was added to the cells. Cells receiving no primary antibody or a biotinylated isotype-matched antibody (Pharmingen) were used as controls. After an hour of incubation on ice, the cells were washed with 0.5% BSA/OPTI-MEM medium and then 50 µl of streptavidin-fluorescein isothiocyanate (Pharmingen), diluted 1:50 in 0.5% BSA/OPTI-MEM, was added to the cells for an additional 30-min incubation on ice. The cells were then washed with 0.5% BSA/OPTI-MEM and analyzed on a FACScalibur (BD Biosciences) flow cytometer. The cells were size-gated, and generally 2,500 to 10,000 cells were counted for each data point. Data analysis was performed using Cell Quest Software (BD Biosciences).

Mutant beta 2m Effects on Antigen-induced T-cell Activation-- beta 2m and beta 2m mutants were added at the indicated concentrations to wells in 96-well round bottom tissue culture plates with 3.6 × 105 of the APC. The p18-I10 peptide was added as indicated to wells. The final volume was 200 µl/well of three parts 5% BSA/OPTI-MEM and one part PBS. After an overnight incubation at 37 °C in 7.5% CO2, the cells were washed two times with 5% BSA/OPTI-MEM and resuspended in 150 µl of Dulbecco's modified Eagle's medium with 10% fetal calf serum, 2 mM L-glutamine, nonessential amino acids, penicillin/streptomycin (100 units/ml penicillin), and 5 × 10-5 M beta -mercaptoethanol (complete medium). Fifty µl of washed APC were titrated by threes into 100 µl of complete medium in 96-well flat bottom tissue culture plates as indicated. B4.2.3 T-cells were added at the indicated concentrations in 50 µl of complete medium, and the plates were incubated overnight at 37 °C in 7.5% CO2. For IL2 cytokine determinations, 25 µl of culture supernatants were assayed with commercially available kits (Endogen, Boston, MA) according to the manufacturer's specifications. Horseradish peroxidase-conjugated streptavidin (Zymed Laboratories Inc., San Francisco, CA) and tetramethylbenzidine (Dako, Carpinteria, CA) were used as developers. The absorbance was read on a Bio-Rad model 3550 microplate reader (Hercules, CA) at 655 nm with background subtraction. Cytokine standards were run with each experiment. A linear fit of these IL2 standard values was used to extrapolate the scales for IL2 levels. In some experiments the cells were pulsed with 1 µCi/well of [3H]thymidine (PerkinElmer Life Sciences) for 3-6 h and harvested and counted to assess growth inhibition (44).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

beta 2m Mutations and beta 2m Mutant Binding to an MHC1 alpha 3 Domain-- Human and murine beta 2m are ~70% homologous (34), and critical beta 2m contact residues with MHC1 heavy chain are conserved (8). Human beta 2m is more effective than murine beta 2m at folding murine MHC1 heavy chain and at binding an MHC1 alpha 3 domain (30). Because hbeta 2m has a higher affinity for an MHC1 alpha 3 domain than murine beta 2m, we chose to mutate hbeta 2m. This higher affinity for MHC1 alpha 3 would predictably lower the concentration necessary to observe a mutant dominant negative effect. We limited our mutation of beta 2m residues to those that interact with the alpha 1 and alpha 2 interface of the MHC1 heavy chain in MHC1 crystal structures. HLA-A2 and H-2Dd MHC1 crystal structures (8, 45) implicate the tryptophan at position 60 of beta 2m as a critical residue for multiple contacts between beta 2m and the alpha 2 domain of the MHC1 heavy chain. Mutations of beta 2m at position 60 have also been shown to interfere with beta 2m exchange onto MHC1 (46). To create a defect in beta 2m folding of MHC1, we mutated the tryptophan at beta 2m position 60 to an alanine residue, a non-conservative change. The HLA-A2 MHC1 crystal structure also predicts a number of interactions between the aspartate at position 53 of beta 2m and residues of the alpha 1 domain of the MHC1 heavy chain. However, crystal structures of H-2Dd (45, 47-49) suggest weaker interactions between the aspartate at position 53 of beta 2m and the alpha 1 domain. Despite this, a previous study (34) has demonstrated that changing the negatively charged aspartate residue at position 53 to a neutral valine decreased the ability of hbeta 2m to fold murine MHC1 molecules, including H-2Dd. Based on this study, we generated charge reversal mutants, changing position 53 of beta 2m to positively charged lysine or arginine, predicting that these mutants would have greater defects in MHC1 folding than the neutral D53V mutation. In addition, we generated a beta 2m mutant with non-conservative changes at both positions, 60 and 53. Based on amino acid sequence data, these residues are conserved across murine and human beta 2m molecules (8). The locations of the two sites we mutated in beta 2m, as related to an example MHC1 crystal structure (50), are illustrated in Fig. 1.


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 1.   Location of mutated beta 2m residues and their relationship to the MHC1 heavy chain. Residues Asp-53 (D53) and Trp-60 (W60) are shown in space-fill on a gray backbone frame of human beta 2m. The MHC1 heavy chain is illustrated as a black backbone frame, and the antigenic peptide is illustrated as a gray backbone frame. This figure was generated using RasMol from the Protein Data Bank structure 1HHJ (HLA A201 with a nonamer human immunodeficiency virus reverse transcriptase peptide).

Based on structural data, our beta 2m mutants at positions 60 and 53 are likely to be defective in their interactions with MHC1 alpha 1/alpha 2 and not MHC1 alpha 3. However, to rule out an unexpected global effect of the mutations, we verified that the mutant beta 2m-alpha 3 interactions were not compromised. We expressed the beta 2m proteins using constructs in bacterial expression vectors (34, 35). Purified mutant beta 2m molecules were evaluated for binding to isolated MHC1 H-2Dd alpha 3 domain molecules using a biosensor for SPR (30). Antibody to the polyhistidine tail of the alpha 3 protein was directly coupled to the carboxymethylated dextran surface of a biosensor chip, allowing for the capture of alpha 3 protein on this surface. beta 2m molecules were injected across the surface of the immobilized alpha 3 protein, and the binding was assessed by mass-related changes in the sensor chip matrix refractive index and quantified as response units (RU). beta 2m was also injected across a control surface consisting of the directly coupled capture antibody without alpha 3 protein. We injected a control protein, ovalbumin, and there was no detectable alpha 3 domain binding (data not shown). This experimental system was sensitive to a 2-fold difference in affinity between human and mouse beta 2m (30). This allowed protein concentration effects on the refractive index response to be subtracted out. An example of such an SPR experiment with the W60A/D53K double mutant beta 2m is shown in Fig. 2A. The responses of the alpha 3 domain and control surfaces were normalized to each other immediately prior to the injection of the beta 2m to allow comparison of the active and control surfaces in this figure. Increasing concentrations of beta 2m were then evaluated for binding to purified monomeric alpha 3 domains. The binding curves after subtraction of the control surface are shown in Fig. 2B. Equilibrium values taken from the subtracted data were used to generate the plot in Fig. 2C. This plot was fit with the nonlinear Langmuir isotherm for calculation of the equilibrium binding constant. The equilibrium constants for alpha 3 binding were generated in this manner from three experiments with each of the beta 2m proteins and are shown in Table I. The dissociation equilibrium constants vary from ~0.2-0.4 micromolar for native hbeta 2m, and all the beta 2m mutants we generated. This suggests that these mutations do not have global effects on beta 2m structure and do not significantly modify the interaction of beta 2m with the MHC1 alpha 3 domain. Thus these mutant beta 2m molecules are useful for testing our predictions regarding MHC1 folding.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   Measurement of mutant beta 2m binding to the H-2Dd alpha 3 domain. A, anti-polyhistidine antibody was immobilized on two surfaces of an SPR sensor chip at 2850 and 3550 RU by amide coupling. 1 µM alpha 3 domain (dashed line) was injected over the 2850 RU anti-polyhistidine surface, and buffer (solid line) was injected over the 3550 RU anti-polyhistidine surface for 3 min at a flow rate of 10 µl/min. After a 4.5-min wait, 1 µM W60A/D53K mutant beta 2m was injected over both surfaces for 90 s at a flow rate of 10 µl/min. The responses of the two surfaces were normalized prior to the beta 2m injection to allow comparison of the beta 2m binding of the alpha 3 domain and the control surface. B, the response of the control surface to beta 2m was subtracted from the response of the alpha 3 surface to beta 2m as a measure of beta 2m-alpha 3 binding. The binding curves shown are at the indicated concentrations of W60A/D53K mutant beta 2m. C, averages of the equilibrium W60A/D53K mutant beta 2m-alpha 3 binding responses during beta 2m injection were plotted versus beta 2m concentration. These points were fit with the Langmuir isotherm to determine the Kd. The chi 2 (average of the squared residuals) value of 0.072 suggests a good fit.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Equilibrium binding of beta 2m to the MHC1 H-2Dd alpha 3 domain
The equilibrium fit was determined from a nonlinear Langmuir isotherm fit of equilibrium data similar to that of Fig. 2C. The fitting was done using the BIAevaluation 3.0 software as described under "Experimental Procedures." The Kd results are the average of three experiments ± S.D. The chi 2 average ± the S.D. is shown as a measure of the curve fit.

Asp-53 Mutant beta 2m-driven Folding of Cell Surface MHC1 Heavy Chain-- Because our alpha 3 binding data were generated with a murine alpha 3 MHC1 domain, we evaluated the mutant hbeta 2m molecules with murine MHC1. Previous studies have demonstrated that the folding of MHC1 by beta 2m, in the absence of added MHC1 binding peptide, is much more efficient at room temperature than at 37 °C (20, 21, 51). This low temperature-induced expression of folded MHC1 in peptide transport-deficient cells is dependent on the presence of beta 2m. To study the effects of the beta 2m mutations on MHC1 alpha 1/alpha 2 domain folding, we added bacterially expressed beta 2m molecules to a peptide transport-deficient cell line, LKD8 (37), at room temperature. This cell line lacks stable folded H-2Dd heavy chain, as demonstrated by poor binding of the alpha 1/alpha 2 conformational epitope-dependent anti-H-2Dd antibody, 34.5.8S (21). Addition of increasing amounts of native hbeta 2m to these cells, with an overnight incubation at 26-28 °C, leads to increasing amounts of folded cell surface H-2Dd MHC1 (Fig. 3A). The increase in folded MHC1, shown by the increased binding of 34.5.8S, is greater with the addition of native hbeta 2m than with the addition of the Asp-53 beta 2m mutants (Fig. 3B). However, addition of Asp-53 mutants can still facilitate folding of H-2Dd. We also evaluated the effects of Asp-53 mutant beta 2m on the H-2Kd haplotype of MHC1 using the peptide transport-deficient cell line, RMAs-Kd (Fig. 3, A and C). We stained the cells with the anti-H-2Kd antibody, SF1-1.1, as a readout for folded H-2Kd MHC1. Although the antibody recognizes an alpha 3 domain epitope (52, 53), it can detect differences in H-2Kd stable expression secondary to folding by peptide and beta 2m (38). We observed a greater defect in expression of H-2Kd than H-2Dd with all the Asp-53 mutants. This defect was most striking with the charge reversal mutants D53K and D53R (Fig. 3C).


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3.   Asp-53 mutants of beta 2m have decreased ability to fold MHC1 at room temperature. A, human native or mutant beta 2m was added at the indicated concentrations to the peptide transport-deficient cell lines (LKD8 for H-2Dd and RMAs-Kd for H-2Kd) and incubated overnight at 26-28 °C. The folding of MHC1 was assessed by staining LKD8 with a biotinylated antibody to H-2Dd MHC1, 34.5.8S, and staining RMAs-Kd with a biotinylated antibody to H-2Kd MHC1, SF1-1.1, as described under "Experimental Procedures." After secondary staining with streptavidin-fluorescein isothiocyanate, cells were size-gated, and 10,000 cells were counted. Histograms with addition of 0 (shaded), 0.1 (dashed line), 1 (thin solid line), and 10 (thick solid line) µg/ml of human and D53V beta 2m are shown for H-2Dd and Kd cells. Histograms of 0 (shaded), 0.14 (dashed line), 1.4 (thin solid line), and 14 (thick solid line) µg/ml of D53K beta 2m are shown for H-2Dd and Kd cells. Similar results were obtained in three experiments with H-2Dd and Kd cells, and the histograms are representative of histograms used in generation of summary flow cytometry data throughout the paper. B, the median fluorescence of 34.5.8S staining LKD8 cells is increased to a greater extent by human beta 2m (-open circle -) than by D53V beta 2m (-triangle -). D53K (--) and D53R (-black-triangle-) are even weaker than D53V beta 2m at inducing 34.5.8S epitopes. LKD8 cells in the absence of beta 2m had a median fluorescence of 18 units. Controls stained with IgG2akappa had a median fluorescence of ~13 units. C, the median fluorescence of SF1-1.1 staining RMAs-Kd cells is increased to a much greater extent by human beta 2m (-open circle -) than by D53V beta 2m (-triangle -). D53K (--) and D53R (-black-triangle-) have almost no effect on induction of the SF1-1.1 epitope at the indicated concentrations. RMAs-Kd cells in the absence of beta 2m had a median fluorescence of 18.4 units. Controls stained with IgG2akappa had a median fluorescence of ~8.5 units.

W60A Mutant beta 2m Molecules Have Severe Defects in MHC1 Folding and Can Act as Dominant Negatives for H-2Dd Folding-- Despite the profound defect of the Asp-53 charge reversal mutants in enhancing H-2Kd expression, D53K can still enhance expression of H-2Kd molecules when added at concentrations above 10 µM (Fig. 4A). In experiments where Asp-53 charge reversal mutants are added together with native hbeta 2m, no inhibition of the hbeta 2m-induced H-2Kd expression was observed (data not shown). We then evaluated the W60A and the W60A/D53K mutant beta 2m molecules in folding MHC1. Fig. 4A shows that beta 2m molecules with the W60A mutation are less efficient at enhancing expression of H-2Kd than beta 2m molecules that only have the D53K mutation. However, some increased expression of H-2Kd is still observed with the W60A mutants (Fig. 4A), and high concentrations of the W60A mutants are unable to interfere with native beta 2m-enhanced expression of H-2Kd (Fig. 4B). We then assessed the effect of the W60A mutants on H-2Dd folding. Both the W60A and W60A/D53K mutants were unable to facilitate H-2Dd folding even at 20 µM concentrations (Fig. 4C). In addition to the lack of H-2Dd MHC1 folding, the W60A and W60A/D53K mutants were able to inhibit H-2Dd folding by native beta 2m (Fig. 4D). The inhibitory effect of W60A mutant beta 2m molecules is not a general effect on cell viability or protein expression, because the H-2Kd expression induced by native beta 2m is unaffected. Thus beta 2m molecules containing the W60A mutation can function as dominant negatives for native beta 2m folding of H-2Dd MHC1.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4.   W60A beta 2m mutants have severe defects in MHC1 folding and are dominant negatives for H-2Dd folding. Human native and/or mutant beta 2m were added at the indicated concentrations to the peptide transport-deficient cell lines (LKD8 for H-2Dd and RMAs-Kd for H-2Kd), incubated overnight at 26-28 °C, and stained as described in the legend for Fig. 3 and under "Experimental Procedures." Similar results were obtained in two to four experiments. A, the median fluorescence of SF1-1.1 staining RMAs-Kd cells is increased as expected by native beta 2m (--). D53K beta 2m (-open circle -) only increases SF1-1.1 staining at high concentrations, and W60A (-triangle -) and W60A/D53K (--) are even less effective. Controls stained with IgG2akappa had a median fluorescence of ~5 units. B, addition of 20 µM W60A/D53K, together with 0.2 µM native beta 2m (shaded), or 20 µM W60A, together with 0.2 µM native beta 2m (white), does not decrease SF1-1.1 staining of RMAs-Kd cells below that of 0.2 µM native beta 2m alone (black). C, the median fluorescence of 34.5.8S staining LKD8 cells is increased as expected by native beta 2m (--). D53K beta 2m (-open circle -) is only somewhat less effective, and W60A (-triangle -) and W60A/D53K (--) beta 2m do not increase 34.5.8S staining even at high concentrations. Controls stained with IgG2akappa had a median fluorescence of ~23 units. D, addition of 20 µM W60A/D53K, together with 0.2 µM native beta 2m (shaded), or 20 µM W60A, together with 0.2 µM native beta 2m (white), do decrease 34.5.8S staining of LKD8 cells below that of 0.2 µM native beta 2m alone (black).

W60A Mutant beta 2m Molecules Require Micromolar Concentrations to Inhibit Native beta 2m-driven Folding of H-2Dd-- The dominant negative effect of W60A mutant beta 2m molecules on H-2Dd MHC1 folding supports the hypothesis of an initial rate-limiting beta 2m-MHC1 alpha 3 interaction in MHC1 folding. Because the MHC1 molecule in which we observe the dominant negative effect of mutant beta 2m is the same H-2Dd haplotype as our isolated alpha 3 domain, we can compare the concentrations of mutant beta 2m that inhibit H-2Dd folding with those that allow binding to the H-2Dd alpha 3 domain. The effects on H-2Dd folding of titrations of W60A and W60A/D53K beta 2m molecules are illustrated in Fig. 5A. Both mutants are inhibitory in the low micromolar range. Although there is some variability in the relative inhibition by the two mutants, in general the double mutant W60A/D53K is a slightly more potent inhibitor. Fig. 5B demonstrates that with the W60A/D53K mutant, the half-maximal inhibition of MHC1 folding occurs at an approximately micromolar concentration. As described previously (30), the binding of the W60A mutants to the H-2Dd alpha 3 domain by SPR has an equilibrium dissociation constant of ~0.3 µM. This SPR-derived binding is similar to that of native hbeta 2m. Using analytical ultracentrifugation, native hbeta 2m binds alpha 3 with a somewhat higher equilibrium dissociation constant of ~4 µM (30). One possible reason for this difference is a restriction of the alpha 3 His-tag tether mobility when captured by the anti-His surface in SPR experiments. Independent of the reason for this difference, the inhibitory concentrations for the dominant negative beta 2m effect are very similar to the range of beta 2m-alpha 3 binding suggested by biophysical methods. This provides further support for a beta 2m-alpha 3 rate-limiting step in MHC1 folding.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   The concentration dependence of mutant beta 2m inhibition of H-2Dd folding. A, W60A beta 2m (--) and W60A/D53K beta 2m (-open circle -) were added at the indicated concentrations with 0.1 µM native beta 2m to LKD8 cells, incubated overnight at 26-28 °C, and stained as described in the legend for Fig. 3 and under "Experimental Procedures." LKD8 cells in the absence of native beta 2m had a median fluorescence of ~13 units. This was subtracted from the median fluorescence at each point to give the relative median fluorescence. Controls stained with IgG2akappa had a median fluorescence of ~9 units. B, W60A/D53K beta 2m (-open circle -) were added at the indicated concentrations with 0.1 µM native beta 2m to LKD8 cells, incubated overnight at 26-28 °C, and stained as described under "Experimental Procedures." LKD8 cells in the absence of native beta 2m had a median fluorescence of ~17 units. This was subtracted from the median fluorescence at each point to give the relative median fluorescence. Controls stained with IgG2akappa had a median fluorescence of ~11.5 units. The relative median fluorescence of 0.1 µM native beta 2m in the absence of mutant beta 2m is shown (dashed line). Inhibition by W60A/D53K was seen in four similar experiments. Because inhibition was not complete in all experiments, we evaluated the concentration of W60A/D53K that led to 25% inhibition. The average value + the S.D. for this was 3.5 ± 2.3 µM.

Dominant Negative beta 2m Molecules Inhibit Peptide-induced Folding of H-2Dd MHC1-- So far all our studies have evaluated MHC1 folding driven by beta 2m at low temperature, in the absence of added antigenic peptide. MHC1 molecules expressed in this manner contain very few detectable peptides, as determined by peptide elution and high pressure liquid chromatography analysis (54). Because an important physiologic role for MHC1 is presentation of antigenic peptides, we also evaluated the effect of the dominant negative beta 2m mutants on peptide-induced MHC1 folding. Induction of folded H-2Dd by the human immunodeficiency virus gp160 peptide p18-I10, and native beta 2m was evaluated in the absence or presence of dominant negative beta 2m molecules (Fig. 6). The folding was done at 37 °C to minimize native beta 2m-induced folding in the absence of peptide (51). Although some MHC1 folding was induced by peptide in the absence of added beta 2m (82 median fluorescent units, Fig. 6), the combination of beta 2m and peptide led to a striking increase in folded MHC1 (348 median fluorescent units, Fig. 8). Both mutant beta 2m molecules inhibit the antigenic peptide-induced folding of H-2Dd, and in this experiment the W60A/D53K mutant is more effective than the W60A mutant. Thus the dominant negative effect of these mutant beta 2m molecules applies to both low temperature and antigenic peptide-induced folding of H-2Dd.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6.   W60A beta 2m mutants are dominant negatives for antigenic peptide-driven H-2Dd folding. Human native beta 2m at 0.1 µM in the presence or absence of mutant beta 2m at 20 µM, as indicated, with 1 µM p18-I10 antigenic peptide (white) or without peptide (black) were added to LKD8 for an overnight incubation at 37 °C. The cells were stained as described in the legend for Fig. 3 and under "Experimental Procedures." Controls stained with IgG2akappa had a median fluorescence of ~9.5 units. Staining in the absence of native beta 2m is shown, and a dotted line was added to the graph to highlight for comparison the 34.5.8S staining of LKD8 with peptide in the absence of beta 2m. Similar results were obtained in two experiments.

Functional Effects of Dominant Negative beta 2m on T-cell Activation-- Because dominant negative beta 2m molecules were able to inhibit H-2Dd folding by the antigenic peptide p18-I10, we evaluated the ability of the W60A/D53K beta 2m mutant to inhibit T-cell activation by p18-I10 in the context of H-2Dd. We utilized the B4.2.3 T-cell hybridoma (39) that is reactive with the p18-I10 peptide in the presence of H-2Dd-expressing APC. The H-2Dd-expressing LKD8 cells were incubated overnight with peptide and native beta 2m in the presence or absence of mutant beta 2m. After washing the LKD8 APC, the cells were titrated and evaluated for stimulation of the B4.2.3 T-cell hybridoma. Although we observed some IL2 production by the B4.2.3 cells with native beta 2m in the absence of antigenic peptide, this was increased in the presence of antigenic peptide. At low antigenic peptide concentrations, native beta 2m significantly enhanced the B4.2.3 IL2 production (0.3-2.7 ng/ml IL2, data not shown). This enhancement also occurred with higher concentrations of native hbeta 2m (data not shown). However the native hbeta 2m and 0.001 µM peptide-driven IL2 production was almost completely reversed by addition of 50 µM of the dominant negative W60A/D53K beta 2m (Fig. 7A). At higher concentrations of the p18-I10 peptide, the mutant beta 2m was unable to inhibit B4.2.3 T-cell activation (Fig. 7B). This is not unexpected, because high concentrations of MHC1 binding peptide have been shown to form complexes with MHC1 in the absence of beta 2m (15). Evaluation of this experiment by activation-induced growth inhibition (44) gave similar results, demonstrating mutant beta 2m reversal of growth inhibition (data not shown). This rules out a cytotoxic effect of the mutant beta 2m molecules, because they lead to increased rather than decreased proliferation. Thus, the beta 2m dominant negative inhibition of MHC1 folding can lead to inhibition of a T-cell response to antigenic peptide. This inhibition was seen with a peptide transport-deficient APC, LKD8, that primarily expresses misfolded MHC1 in the absence of exogenous beta 2m and peptide. Because APC that do not have a peptide transport defect also have misfolded MHC1 (55), this inhibitory effect should apply more generally. In the presence of native beta 2m, H-2Dd L-cell transfectants can activate B4.2.3 at low cell density with peptide or high cell density in the absence of peptide, and this activation can also be inhibited by dominant negative beta 2m (data not shown).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   Functional effects of dominant negative W60A/D53K beta 2m on T-cell hybridoma activation. A, LKD8 cells were incubated with p18-I10 peptide (-open circle -), p18-I10 and 50 µM W60A/D53K beta 2m (--), no peptide and no W60A/D53K (dashed line with triangle ), and no peptide and 50 µM W60A/D53K beta 2m (dashed line with black-triangle). After an overnight incubation in serum-free media with 0.1 µM native beta 2m, the cells were washed and titrated as indicated with 2 × 104 B4.2.3 T-hybridoma cells per well. Following an additional overnight incubation, an enzyme-linked immunosorbent assay was used to assay the supernatants for IL2 production. The averages of duplicates are shown, and the error bars represent the range. IL2 standard results are shown on the right y axis. Using the Student's t test, the values for peptide and peptide with W60A/D53K beta 2m are significantly different at p < 0.02 for all points shown with APC. In this experiment 0.001 µM p18-I10 peptide was added to peptide-positive wells. Similar results were obtained in three experiments with 0.001 or 0.01 µM p18-I10 peptide and 1 or 2 × 104 B4.2.3 cells. B, the same experiment was also performed with 0.1 µM p18-I10 peptide added to peptide-positive wells. Similar results were obtained in three experiments with 0.1 µM p18-I10 peptide and 1 or 2 × 104 B4.2.3 cells. C, 3T3 cells transfected with the gp160 gene (15-12) were incubated with no beta 2m (dashed line with open circle ), 0.1 µM native beta 2m (--), or 0.1 µM native beta 2m and 50 µM W60A/D53K beta 2m (-triangle -). After an overnight incubation in serum-free media, the cells were washed and titrated as indicated with 1 × 104 B4.2.3 T-hybridoma cells per well. Following an additional overnight incubation, an enzyme-linked immunosorbent assay was used to assay the supernatants for IL2 production. The averages of duplicates are shown, and the error bars represent the range. IL2 standard results are shown on the right y axis. Similar results were obtained in two experiments.

Because endogenous antigens are loaded onto MHC1 in the ER, it is unlikely that exogenously delivered dominant negative beta 2m would interfere with ER-based MHC1 folding and peptide loading. We attempted to evaluate this by using the cell line 15-12, an H-2Dd-expressing 3T3 cell line transfected with gp160 (40), containing the p18-I10 peptide sequence. In the presence of native beta 2m, there was a large increase in IL2 production (Fig. 7C) as observed with the exogenously loaded peptide. However the addition of W60A/D53K beta 2m did not lead to consistent inhibition of T-cell activation by 15-12 cells (Fig. 7C). A differing role of beta 2m for endogenous and exogenous antigen is suggested by these data. Endogenous peptide-loaded MHC1 may be dependent on beta 2m for stabilization whereas exogenous peptide loading is dependent on beta 2m for MHC1 refolding. Therefore the loading of exogenous antigen is more sensitive to a dominant negative beta 2m for MHC1 folding.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

beta 2m is both a structural component of MHC1 and a chaperone for correct folding of the MHC1 heavy chain. beta 2m binds folded MHC1 heavy chain at a thousand-fold lower concentration than that required for beta 2m-driven folding of cell surface MHC1. The alpha 3 domain of the MHC1 heavy chain is folded before the other MHC1 domains, prior to associating with beta 2m (56, 57), and remains folded longest on the cell surface (21). This makes a beta 2m interaction with the alpha 3 domain an attractive model for the beta 2m-driven folding of the MHC1 heavy chain. We have demonstrated previously (29) that human beta 2m binding to an isolated alpha 3 domain has a dissociation affinity constant in the micromolar range similar to the concentration range in which beta 2m folds MHC1. In addition, we demonstrated that the binding of the alpha 3 domain by beta 2m has a species hierarchy and a temperature dependence similar to that of the folding of MHC1 heavy chain by beta 2m (30). These data support a model in which a beta 2m-alpha 3 interaction is a required intermediate in the folding of MHC1 heavy chain. Such a model would predict that a beta 2m molecule that retains the ability to interact with the alpha 3 domain but is defective in its ability to interact with the alpha 1/alpha 2 domains of MHC1 would function as a competitive inhibitor of native beta 2m with a dominant negative effect on MHC1 folding. Furthermore, the concentration dependence of the dominant negative effect would relate to the affinity of beta 2m for the alpha 3 domain. In this study we demonstrate that beta 2m molecules with mutations of critical residues in the beta 2m-alpha 1/alpha 2 interface can block native beta 2m folding of H-2Dd MHC1 at concentrations similar to those allowing beta 2m interaction with the H-2Dd alpha 3 domain. This provides very strong evidence for a beta 2m-alpha 3-limiting intermediate in extracellular H-2Dd MHC1 folding.

In our studies, we have observed only the dominant negative effect of beta 2m mutants on the H-2Dd haplotype. Although it is possible that the limiting beta 2m-alpha 3 step is haplotype-specific, the lack of a dominant negative effect on H-2Kd MHC1 may be due to our choice of beta 2m mutants. Differential effects of beta 2m mutants on MHC1 haplotypes have been described previously (49). Experiments using additional MHC1 haplotypes and beta 2m mutations are planned to define the generality of our observations. It is likely that dominant negative beta 2m molecules can be generated that block folding of MHC1 haplotypes other than murine H-2Dd.

Although the data we present are limited to extracellular MHC1 folding, the binding parameters and kinetic intermediates of beta 2m interactions are likely to play an important role in MHC1 assembly in the ER. The beta 2m interaction with the alpha 3 domain can be further evaluated with other fragments of MHC1 heavy chain and whole MHC1 using SPR. The addition of MHC binding peptides and chaperone molecules such as calreticulin, tapasin, transporter associated with antigen processing, and Erp57 may allow for the understanding of the biochemistry of physiologic MHC1 folding in the ER. The use of mutant beta 2m molecules in these studies could help define the roles of various chaperones in transitional steps between beta 2m binding and complete MHC1 folding. The transfection of beta 2m mutant genes into mammalian cells could supply information on the relevance of the beta 2m-alpha 3 interaction to the complete MHC1 assembly process in the ER. However, even if the mutant beta 2m effects on folding are limited to extracellular MHC1, these mutant effects could alter the exogenous peptide generation of antigen-MHC1 complexes for T-cell stimulation.

To assess the effect of the beta 2m mutant molecules on formation of stimulatory MHC1-antigenic peptide complexes, we tested their ability to block antigenic peptide and native beta 2m- mediated MHC1 folding at 37 °C. The W60A mutant beta 2m molecules were able to block this folding. Because the mutants were also dominant negative for this antigenic peptide-mediated folding, we tested whether mutant beta 2m could block the functional response of a T-cell hybridoma specific for peptide-H-2Dd complexes. At low peptide concentrations, W60A/D53K beta 2m was able to block the T-cell response. It was also of interest to assess the effects of these mutants on endogenously loaded antigenic peptides. Activation of a T-cell hybridoma by a transfectant cell line with endogenous peptide was more resistant to inhibition than cell lines loaded exogenously with peptide. If additional work supports a selective effect of mutant beta 2m on exogenous versus endogenous peptide loading, these mutants may be useful in defining whether there is a role for exogenous peptide loading in in vivo CTL-mediated responses and pathology. Mutants of beta 2m have also been generated that interfere with the binding of the non-TCR MHC1 ligands, Ly49A (58, 59) and CD8 (60), to MHC1. Although the effects on CD8 binding were demonstrated with mutation of position 58 of beta 2m, mutation of position 60 also diminished CD8 binding to MHC1 (60). However, the effects on MHC1 folding we observed with the W60A mutants are independent of CD8. In addition, the functional inhibition we observed of the B4.2.3 T-cell hybridoma cannot be explained by an effect on CD8 binding, because B4.2.3 does not express CD8. Different mutations of beta 2m between positions 52 and 63 have been generated (46). Although the ability of these mutants to fold MHC1 expressed by peptide transport-deficient cells was not evaluated, some of these mutants interfered with the generation of a peptide-specific epitope in HLA-B27. There was only minimal blockade of CTL lysis by two of these mutants, and the blockade did not correlate with effects on the peptide-specific epitope. This suggests possible alternative effects of these mutant beta 2m molecules, such as antagonism of CD8 binding.

The folding of free MHC1 heavy chain on the surface of cells by beta 2m plays an important role in normal cells (55, 61, 62), as well as in peptide transport-deficient cells. This folding can have immunologic consequences due to the enhanced presentation of exogenous peptide fragments to CTL (39, 63-65). Such presentation of extracellularly processed (41, 66-68) class I restricted peptides could cause lysis of uninfected bystander cells in a CTL response to virus. Understanding the mechanism of MHC1 folding and developing reagents that can interfere with this folding may suggest clinically relevant strategies to prevent such aberrant responses.

    ACKNOWLEDGEMENTS

We thank Drs. Jorge Laborda and David H. Margulies for valuable discussion and review of this work.

    FOOTNOTES

* This work was supported by the Howard Hughes Medical Institute and Montgomery County Public Schools student intern program.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Contributed equally to this work.

§ To whom correspondence should be addressed: DMA, CBER, FDA, 29 Lincoln Dr., Bldg. 29B-3NN08, HFM-561, Bethesda, MD 20892. Tel.: 301-827-0719; Fax: 301-827-0852; E-mail: kozlowski@cber.fda.gov.

Published, JBC Papers in Press, November 25, 2002, DOI 10.1074/jbc.M208381200

    ABBREVIATIONS

The abbreviations used are: MHC1, major histocompatibility class I molecules; beta 2m, beta 2-microglobulin; CTL, cytotoxic T-lymphocyte; TCR, T-cell receptor; hbeta 2m, human beta 2-microglobulin; APC, antigen-presenting cells; SPR, surface plasmon resonance; RU, response units; ER, endoplasmic reticulum; PBS, phosphate-buffered saline; BSA, bovine serum albumin; IL, interleukin.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Townsend, A., and Bodmer, H. (1989) Annu. Rev. Immunol. 7, 601-624[Medline] [Order article via Infotrieve]
2. Jones, E. Y., Tormo, J., Reid, S. W., and Stuart, D. I. (1998) Immunol. Rev. 163, 121-128[CrossRef][Medline] [Order article via Infotrieve]
3. Germain, R. N., and Margulies, D. H. (1993) Annu. Rev. Immunol. 11, 403-450[CrossRef][Medline] [Order article via Infotrieve]
4. Ljunggren, H. G., and Thorpe, C. J. (1996) Histol. Histopathol. 11, 267-274[Medline] [Order article via Infotrieve]
5. Ozato, K., Evans, G. A., Shykind, B., Margulies, D. H., and Seidman, J. G. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 2040-2043[Abstract/Free Full Text]
6. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Strominger, J. L., and Wiley, D. C. (1987) Nature 329, 512-518[CrossRef][Medline] [Order article via Infotrieve]
7. Davis, M. M., Boniface, J. J., Reich, Z., Lyons, D., Hampl, J., Arden, B., and Chien, Y. (1998) Annu. Rev. Immunol. 16, 523-544[CrossRef][Medline] [Order article via Infotrieve]
8. Saper, M. A., Bjorkman, P. J., and Wiley, D. C. (1991) J. Mol. Biol. 219, 277-319[CrossRef][Medline] [Order article via Infotrieve]
9. Santos-Aguado, J., Biro, P. A., Fuhrmann, U., Strominger, J. L., and Barbosa, J. A. (1987) Mol. Cell. Biol. 7, 982-990[Abstract/Free Full Text]
10. Ribaudo, R. K., and Margulies, D. H. (1995) J. Immunol. 155, 3481-3493[Abstract]
11. Salter, R. D. (1992) Hum. Immunol. 35, 40-49[CrossRef][Medline] [Order article via Infotrieve]
12. Seong, R. H., Clayberger, C. A., Krensky, A. M., and Parnes, J. R. (1988) J. Exp. Med. 167, 288-299[Abstract/Free Full Text]
13. Zijlstra, M., Bix, M., Simister, N. E., Loring, J. M., Raulet, D. H., and Jaenisch, R. (1990) Nature 344, 742-746[CrossRef][Medline] [Order article via Infotrieve]
14. Allen, H., Fraser, J., Flyer, D., Calvin, S., and Flavell, R. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 7447-7451[Abstract/Free Full Text]
15. Bix, M., and Raulet, D. (1992) J. Exp. Med. 176, 829-834[Abstract/Free Full Text]
16. Solheim, J. C., Johnson, N. A., Carreno, B. M., Lie, W. R., and Hansen, T. H. (1995) Eur. J. Immunol. 25, 3011-3016[Medline] [Order article via Infotrieve]
17. Fink, A. L. (1999) Physiol. Rev. 79, 425-449[Abstract/Free Full Text]
18. Solheim, J. C. (1999) Immunol. Rev. 172, 11-19[CrossRef][Medline] [Order article via Infotrieve]
19. Cresswell, P., Bangia, N., Dick, T., and Diedrich, G. (1999) Immunol. Rev. 172, 21-28[CrossRef][Medline] [Order article via Infotrieve]
20. Rock, K. L., Gramm, C., and Benacerraf, B. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4200-4204[Abstract/Free Full Text]
21. Otten, G. R., Bikoff, E., Ribaudo, R. K., Kozlowski, S., Margulies, D. H., and Germain, R. N. (1992) J. Immunol. 148, 3723-3732[Abstract]
22. Elliott, T., Cerundolo, V., Elvin, J., and Townsend, A. (1991) Nature 351, 402-406[CrossRef][Medline] [Order article via Infotrieve]
23. Elliott, T., Elvin, J., Cerundolo, V., Allen, H., and Townsend, A. (1992) Eur. J. Immunol. 22, 2085-2091[Medline] [Order article via Infotrieve]
24. Hyafil, F., and Strominger, J. L. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 5834-5838[Abstract/Free Full Text]
25. Parker, K. C., and Strominger, J. L. (1985) Biochemistry 24, 5543-5550[CrossRef][Medline] [Order article via Infotrieve]
26. Hochman, J. H., Shimizu, Y., DeMars, R., and Edidin, M. (1988) J. Immunol. 140, 2322-2329[Abstract]
27. Pedersen, L. O., Hansen, A. S., Olsen, A. C., Gerwien, J., Nissen, M. H., and Buus, S. (1994) Scand. J. Immunol. 39, 64-72[CrossRef][Medline] [Order article via Infotrieve]
28. Shields, M. J., Moffat, L. E., and Ribaudo, R. K. (1998) Mol. Immunol. 35, 919-928[CrossRef][Medline] [Order article via Infotrieve]
29. Whitman, M. C., Strohmaier, J., O'Boyle, K., Tingem, J. M., Wilkinson, Y., Goldstein, J., Chen, T., Brorson, K., Brunswick, M., and Kozlowski, S. (2000) Mol. Immunol. 37, 141-149[CrossRef][Medline] [Order article via Infotrieve]
30. Hebert, A. M., Strohmaier, J., Whitman, M. C., Chen, T., Gubina, E., Hill, D. M., Lewis, M. S., and Kozlowski, S. (2001) Biochemistry 40, 5233-5242[Medline] [Order article via Infotrieve]
31. Herskowitz, I. (1987) Nature 329, 219-222[CrossRef][Medline] [Order article via Infotrieve]
32. Perlmutter, R. M., and Alberola-Ila, J. (1996) Curr. Opin. Immunol. 8, 285-290[CrossRef][Medline] [Order article via Infotrieve]
33. Gill, S. C., and von Hippel, P. H. (1989) Anal. Biochem. 182, 319-326[CrossRef][Medline] [Order article via Infotrieve]
34. Shields, M. J., Assefi, N., Hodgson, W., Kim, E. J., and Ribaudo, R. K. (1998) J. Immunol. 160, 2297-2307[Abstract/Free Full Text]
35. Shields, M. J., Kubota, R., Hodgson, W., Jacobson, S., Biddison, W. E., and Ribaudo, R. K. (1998) J. Biol. Chem. 273, 28010-28018[Abstract/Free Full Text]
36. Horton, R. M., Cai, Z. L., Ho, S. N., and Pease, L. R. (1990) Biotechniques 8, 528-535[Medline] [Order article via Infotrieve]
37. Bikoff, E. K., Otten, G. R., and Robertson, E. J. (1991) Eur. J. Immunol. 21, 1997-2004[Medline] [Order article via Infotrieve]
38. Chen, W., Yewdell, J. W., Levine, R. L., and Bennink, J. R. (1999) J. Exp. Med. 189, 1757-1764[Abstract/Free Full Text]
39. Kozlowski, S., Takeshita, T., Boehncke, W. H., Takahashi, H., Boyd, L. F., Germain, R. N., Berzofsky, J. A., and Margulies, D. H. (1991) Nature 349, 74-77[CrossRef][Medline] [Order article via Infotrieve]
40. Takahashi, H., Cohen, J., Hosmalin, A., Cease, K. B., Houghten, R., Cornette, J. L., DeLisi, C., Moss, B., Germain, R. N., and Berzofsky, J. A. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 3105-3109[Abstract/Free Full Text]
41. Kozlowski, S., Corr, M., Takeshita, T., Boyd, L. F., Pendleton, C. D., Germain, R. N., Berzofsky, J. A., and Margulies, D. H. (1992) J. Exp. Med. 175, 1417-1422[Abstract/Free Full Text]
42. Takeshita, T., Takahashi, H., Kozlowski, S., Ahlers, J. D., Pendleton, C. D., Moore, R. L., Nakagawa, Y., Yokomuro, K., Fox, B. S., Margulies, D. H., et al.. (1995) J. Immunol. 154, 1973-1986[Abstract]
43. Johnsson, B., Lofas, S., and Lindquist, G. (1991) Anal. Biochem. 198, 268-277[CrossRef][Medline] [Order article via Infotrieve]
44. Ashwell, J. D., Cunningham, R. E., Noguchi, P. D., and Hernandez, D. (1987) J. Exp. Med. 165, 173-194[Abstract/Free Full Text]
45. Li, H., Natarajan, K., Malchiodi, E. L., Margulies, D. H., and Mariuzza, R. A. (1998) J. Mol. Biol. 283, 179-191[CrossRef][Medline] [Order article via Infotrieve]
46. Fukazawa, T., Hermann, E., Edidin, M., Wen, J., Huang, F., Kellner, H., Floege, J., Farahmandian, D., Williams, K. M., and Yu, D. T. (1994) J. Immunol. 153, 3543-3550[Abstract]
47. Achour, A., Persson, K., Harris, R. A., Sundback, J., Sentman, C. L., Lindqvist, Y., Schneider, G., and Karre, K. (1998) Immunity 9, 199-208[CrossRef][Medline] [Order article via Infotrieve]
48. Tormo, J., Natarajan, K., Margulies, D. H., and Mariuzza, R. A. (1999) Nature 402, 623-631[CrossRef][Medline] [Order article via Infotrieve]
49. Shields, M. J., Hodgson, W., and Ribaudo, R. K. (1999) Mol. Immunol. 36, 561-573[CrossRef][Medline] [Order article via Infotrieve]
50. Garboczi, D. N., Madden, D. R., and Wiley, D. C. (1994) J. Mol. Biol. 239, 581-587[CrossRef][Medline] [Order article via Infotrieve]
51. Ljunggren, H. G., Stam, N. J., Ohlen, C., Neefjes, J. J., Hoglund, P., Heemels, M. T., Bastin, J., Schumacher, T. N., Townsend, A., Karre, K., et al.. (1990) Nature 346, 476-480[CrossRef][Medline] [Order article via Infotrieve]
52. Abastado, J. P., Casrouge, A., and Kourilsky, P. (1993) J. Immunol. 151, 3569-3575[Abstract]
53. Noun, G., Reboul, M., Abastado, J. P., Jaulin, C., Kourilsky, P., and Pla, M. (1996) J. Immunol. 157, 2455-2461[Abstract]
54. Anderson, K. S., Alexander, J., Wei, M., and Cresswell, P. (1993) J. Immunol. 151, 3407-3419[Abstract]
55. Smith, M. H., and Barber, B. H. (1990) Mol. Immunol. 27, 169-180[CrossRef][Medline] [Order article via Infotrieve]
56. Elliott, T. (1991) Immunol. Today 12, 386-388[CrossRef][Medline] [Order article via Infotrieve]
57. Ribaudo, R. K., and Margulies, D. H. (1992) J. Immunol. 149, 2935-2944[Abstract]
58. Wang, J., Whitman, M. C., Natarajan, K., Tormo, J., Mariuzza, R. A., and Margulies, D. H. (2002) J. Biol. Chem. 277, 1433-1442[Abstract/Free Full Text]
59. Michaelsson, J., Achour, A., Rolle, A., and Karre, K. (2001) J. Immunol. 166, 7327-7334[Abstract/Free Full Text]
60. Glick, M., Price, D. A., Vuidepot, A. L., Andersen, T. B., Hutchinson, S. L., Laugel, B., Sewell, A. K., Boulter, J. M., Dunbar, P. R., Cerundolo, V., Oxenius, A., Bell, J. I., Richards, W. G., and Jakobsen, B. K. (2002) J. Biol. Chem. 277, 20840-20846[Abstract/Free Full Text]
61. Rock, K. L., Gamble, S., Rothstein, L., Gramm, C., and Benacerraf, B. (1991) Cell 65, 611-620[CrossRef][Medline] [Order article via Infotrieve]
62. Smith, J. D., Lie, W. R., Gorka, J., Myers, N. B., and Hansen, T. H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7767-7771[Abstract/Free Full Text]
63. Vitiello, A., Potter, T. A., and Sherman, L. A. (1990) Science 250, 1423-1426[Abstract/Free Full Text]
64. Rock, K. L., Rothstein, L. E., Gamble, S. R., and Benacerraf, B. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 7517-7521[Abstract/Free Full Text]
65. Kane, K. P., Sherman, L. A., and Mescher, M. F. (1991) Eur. J. Immunol. 21, 2289-2292[Medline] [Order article via Infotrieve]
66. Sherman, L. A., Burke, T. A., and Biggs, J. A. (1992) J. Exp. Med. 175, 1221-1226[Abstract/Free Full Text]
67. Falo, L. D., Jr., Colarusso, L. J., Benacerraf, B., and Rock, K. L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8347-8350[Abstract/Free Full Text]
68. Kozlowski, S., Corr, M., Shirai, M., Boyd, L. F., Pendleton, C. D., Berzofsky, J. A., and Margulies, D. H. (1993) J. Immunol. 151, 4033-4044[Abstract]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol Cancer ResHome page
Md. I. Hassan, A. Waheed, S. Yadav, T. P. Singh, and F. Ahmad
Zinc {alpha}2-Glycoprotein: A Multidisciplinary Protein
Mol. Cancer Res., June 1, 2008; 6(6): 892 - 906.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A.-M. Tsimberidou, H. M. Kantarjian, S. Wen, S. O'Brien, J. Cortes, W. G. Wierda, C. Koller, S. Pierce, M. Brandt, E. J. Freireich, et al.
The Prognostic Significance of Serum {beta}2 Microglobulin Levels in Acute Myeloid Leukemia and Prognostic Scores Predicting Survival: Analysis of 1,180 Patients
Clin. Cancer Res., February 1, 2008; 14(3): 721 - 730.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-C. Chang, T. Ogino, D. W. Mullins, J. L. Oliver, G. V. Yamshchikov, N. Bandoh, C. L. Slingluff Jr., and S. Ferrone
Defective Human Leukocyte Antigen Class I-associated Antigen Presentation Caused by a Novel beta2-Microglobulin Loss-of-function in Melanoma Cells
J. Biol. Chem., July 7, 2006; 281(27): 18763 - 18773.
[Abstract] [Full Text] [PDF]


Home page
BioinformaticsHome page
E. Duprat, M.-P. Lefranc, and O. Gascuel
A simple method to predict protein-binding from aligned sequences--application to MHC superfamily and {beta}2-microglobulin
Bioinformatics, February 15, 2006; 22(4): 453 - 459.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. A. York, E. P. Grant, A. M. Dahl, and K. L. Rock
A Mutant Cell with a Novel Defect in MHC Class I Quality Control
J. Immunol., June 1, 2005; 174(11): 6839 - 6846.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. J. H. Borysik, S. E. Radford, and A. E. Ashcroft
Co-populated Conformational Ensembles of {beta}2-Microglobulin Uncovered Quantitatively by Electrospray Ionization Mass Spectrometry
J. Biol. Chem., June 25, 2004; 279(26): 27069 - 27077.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/8/5630    most recent
M208381200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hill, D. M.
Right arrow Articles by Kozlowski, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hill, D. M.
Right arrow Articles by Kozlowski, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement