|
Originally published In Press as doi:10.1074/jbc.M208381200 on November 25, 2002
J. Biol. Chem., Vol. 278, Issue 8, 5630-5638, February 21, 2003
A Dominant Negative Mutant 2-Microglobulin Blocks the
Extracellular Folding of a Major Histocompatibility Complex Class I
Heavy Chain*
Dawn M.
Hill ,
Tina
Kasliwal ,
Elie
Schwarz,
Andrea M.
Hebert,
Trina
Chen,
Elena
Gubina,
Lei
Zhang, and
Steven
Kozlowski§
From the Division of Monoclonal Antibodies, Center for Biologics
Evaluation and Research, Food and Drug Administration, Bethesda,
Maryland 20892
Received for publication, August 16, 2002, and in revised form, November 25, 2002
 |
ABSTRACT |
The major histocompatibility complex class
I (MHC1) molecule plays a crucial role in cytotoxic lymphocyte
function. 2-Microglobulin ( 2m) has been demonstrated to be both a
structural component of the MHC1 complex and a chaperone-like molecule
for MHC1 folding. 2m binding to an isolated 3 domain of MHC1
heavy chain at micromolar concentrations has been shown to accurately
model the biochemistry and thermodynamics of 2m-driven MHC1 folding.
These results suggested a model in which the chaperone-like role of
2m is dependent on initial binding to the 3 domain interface of
MHC1 with 2m. Such a model predicts that a mutant 2m molecule
with an intact MHC1 3 domain interaction but a defective MHC1
1 2 domain interaction would block 2m-driven folding of MHC1.
In this study we generated such a 2m mutant and demonstrated that it
blocks MHC1 folding by normal 2m at the expected micromolar
concentrations. Our data support an initial interaction of 2m with
the MHC1 3 domain in MHC1 folding. In addition, the dominant
negative mutant 2m can block T-cell functional responses to
antigenic peptide and MHC1.
 |
INTRODUCTION |
The major histocompatibility complex class I
(MHC1)1 molecule and
antigenic peptide are recognized by CD8+ cytotoxic T-lymphocytes (CTL)
in CTL activation and lysis of targets (1). The heavy chain of the MHC1
molecule can interact noncovalently with a number of other molecules in
the formation of a CTL activating complex. These include the MHC1 light
chain or 2m, the antigenic peptide fragment, the T-cell receptor
(TCR), and the CD8 molecule (2). The specificity of the CTL response
resides in the selective MHC1 binding of specific antigenic peptide
fragments and in the TCR recognition of these antigenic peptides and
MHC1 (3, 4). The MHC1 contact surface for TCR and peptide binding is
formed by the 1 and 2 domains of the three-domain MHC1 heavy
chain (2, 5-7).
The MHC1 heavy chain 1 and 2 domains, as well as the
immunoglobulin-like 3 domain, have been shown by x-ray
crystallography (8) to interact with 2m, the nonpolymorphic
component of the MHC1 complex. Mutations in the 1 (9, 10) or 3
(11) domains of the MHC1 heavy chain lead to changes in 2m binding.
These studies demonstrate that the functional interaction of the MHC1 heavy chain with 2m occurs at multiple surfaces on different domains.
In the absence of 2m, most MHC1 molecules are not expressed
efficiently on the surface of cells (12, 13). Although some MHC1
molecules, such as murine H-2Ld and H-2Db, are
transported to the cell surface without 2m, they have diminished levels of expression (14, 15). This decreased MHC1 expression is not
simply because of an export requirement for fully assembled MHC1
complexes. Transfection of 2m-negative cells with ER-retained 2m
was able to salvage MHC1 cell surface expression (16). MHC1 folded in
the presence of this ER-retained 2m was exported to the cell surface
without bound 2m. Thus 2m, which promotes protein folding through
a transient interaction, fits the definition of a chaperone (17).
Therefore, 2m plays two roles in MHC1, first, as a structural
subunit of the assembled complex and second, as a chaperone for the
folding of the MHC1 heavy chain. A possible mechanism for 2m as a
chaperone is facilitation of the interaction of MHC1 heavy chain with
other chaperones, such as calreticulin, tapasin, transporter associated
with antigen processing, and Erp57 (18, 19). However, because
2m has been shown to promote stabilization or folding of MHC1 on the
cell surface in the absence of ER chaperones (20, 21), it is likely
that 2m also has a direct effect on MHC1 folding.
Although high concentrations of high affinity peptides can promote the
folding of MHC1 in the absence of 2m (15), these same peptides can
stabilize MHC1 folded with 2m at significantly lower concentrations
(22, 23). Therefore, with physiologic concentrations of high affinity
peptides or any concentration of lower affinity peptides, 2m levels
are limiting for the folding of MHC1 molecules.
The two roles of 2m, as structural subunit and chaperone, do not
depend equally on 2m concentration. 2m binds to MHC1 heavy chain
with an equilibrium dissociation constant (Kd) in
the nanomolar range (24-27) while it folds or stabilizes cell surface
MHC1 at micromolar concentrations (20, 21, 28). We have demonstrated
previously (29) that human 2m (h 2m) binds the isolated 3
domain of the MHC1 heavy chain with a Kd in that
same micromolar range and this binding has the same species dependence
and thermodynamics as the 2m-driven refolding of the MHC1 heavy
chain (30). This suggested that 2m folding of the complete MHC1
heavy chain may be nucleated by a 2m- 3 interaction. Although the
biochemical characteristics of folding match those of the predicted
limiting initial 2m- 3 interaction (30), it is formally possible
that the similar binding characteristics of 2m- 3 binding and
2m folding of MHC1 are coincidental.
To resolve this issue, we have generated 2m mutants with predicted
defects in interactions with MHC1 1/ 2 domains and evaluated the
mutant 2m effects on native 2m-driven folding of MHC1. Because the 2m-driven folding of the 1 and 2 domains is likely to be dependent on the 2m- 1/ 2 interaction, many possible models
would predict poor folding of MHC1 by these mutants. However, if the initial limiting interaction of 2m were with the 3 domain, these 2m mutants would still have an intact initial interaction and be
able to compete with native 2m for this initial interaction. Thus
2m mutants with diminished 1/ 2 interactions would be
competitive inhibitors of native 2m-driven MHC1 folding. Although
such a mutant 2m protein would be predicted to inhibit extracellular MHC1 folding, its design and mode of inhibition are similar to dominant
negative mutations used in the study of intracellular signaling and
cytoskeletal structures (31, 32). It would be expected that this
dominant negative effect on MHC1 folding would have a concentration
dependence similar to that of the 2m- 3 interaction.
 |
EXPERIMENTAL PROCEDURES |
3 Domain Protein Expression and Purification--
The
H-2Dd 3 domain sequence was generated by PCR
amplification of an H-Dd cDNA as described
previously (29) with the upper primer ACTCCATGGCAACAGATCCCCCAAAGGCCC and the lower primer GATGAATTCGACCCGGAAGGAGGAGGTTC. The 3
domain sequence was inserted between the NcoI and
EcoR1 sites of a modified pET21d vector (Novagen, Madison,
WI). The vector was modified by ligating a synthetic
oligonucleotide
(GAGGAATTCTGGAATTTCGCAAGCTGTACATGCTGCACACGCTGAAATTAACGAAGCAGGAAGAGCACTCGAGCAC) between the EcoR1 and XhoI sites of the
pET21d bacterial expression vector. The completed construct had the
correct sequence and when transfected and induced, generated a 15-kDa
fusion protein consisting of the H-Dd 3 domain fused to
vector expressed sequence, a 17-amino acid peptide sequence from
ovalbumin, and a polyhistidine tag.
The expression construct was transfected into BL21(DE3) bacteria
(Novagen, Madison, WI). 400-ml cultures of transfected bacteria in LB
broth with 200 µg/ml carbenicillin (Sigma) were grown to an
absorbance of 0.6 at 600 nm. The cultures were then induced with 1 mM isopropyl-1-thio- -D-galactopyranoside
(Sigma), and the cells were harvested by centrifugation after overnight
induction at 28 °C. The bacteria were washed with PBS, and the
pellet was frozen at 70 °C. The frozen pellet was thawed in 0.5 M NaCl, 10 mM Tris, pH 8.0, with 1 mg/ml
lysozyme (Sigma). After addition of imidazole (Sigma) to a
concentration of 5 mM and Triton X-100 (Roche Molecular
Biochemicals) to a concentration of 1%, the bacteria were sonicated in
a Brinkmann homogenizer (Brinkmann, Westbury, CT) for 3 × 30 s at a setting of 4. The homogenate was treated with ~500 units of
Benzonase (Sigma) in the presence of 5 mM MgCl. Inclusion
bodies were pelleted by spinning at 15,000 × g, and the soluble fraction was loaded on to buffer-equilibrated
nickel-nitrilotriacetic acid resin (Qiagen) for 1 h at 4 °C.
The loaded nickel-nitrilotriacetic acid resin was washed three times
with 0.5 M NaCl, 10 mM Tris, pH 8.0, 1% Triton
X 100, 5 mM imidazole buffer and then three times with 0.5 M NaCl, 10 mM Tris, pH 8.0, buffer. The fusion protein was eluted with high concentration imidazole (150 to 500 mM). The imidazole was removed by dialysis, and the protein
was further purified by size exclusion chromatography. The protein concentration was measured by 280-nm absorbance. The extinction coefficient at 280 nm was calculated from the primary amino acid sequence (33).
2m Mutagenesis, Expression, and Purification--
The
recombinant native h 2m was expressed using a construct in a PET21d
vector generously supplied by Randall K. Ribaudo (34, 35). Mutant
h 2m genes were generated by PCR with the Pfu-1 polymerase
(Stratagene) using splice overlap extension (36) with mutant
oligonucleotides. The D53K mutation was generated with the upper
GGAGCATTCAAAATTGTCTTTCA oligonucleotide primer (the base
pairs in mutated codons are underlined) and a complementary lower
primer. The D53R mutation was generated with the upper
GGAGCATTCAAGATTGTCTTTCA oligonucleotide primer and a
complementary lower primer. The W60A mutation was generated with the
upper ATAGAAAGACGCGTCCTTGCT oligonucleotide primer and a
complementary lower primer. The h 2m upper GACGGAGCTCGAATTCGGATC primer and h 2m lower AGGAGATATATCATGATCCAGCGT primer were used with
the corresponding mutant oligos to amplify the mutated gene fragments
in the first amplification step and for generating an intact gene the
second amplification step. The intact gene fragments were digested with
BspHI and BamHI and ligated into PET21d vector that was digested with NcoI and BamHI. Double
mutants such as W60A/D53K were sequentially generated using the
same process. The mutant genes were verified by sequencing. The
constructs were transfected into BL21(DE3) bacteria (Novagen). 100-ml
cultures of transfected bacteria in LB broth with 250 µg/ml
carbenicillin with were grown at 37 °C to an absorbance of 0.8 at
600 nm and then induced with 1 mM
isopropyl-1-thio- -D-galactopyranoside for 2 h.
The bacteria were harvested by centrifugation and washed and
resuspended with 0.1 M Tris, pH 8.0, with 2 mM
EDTA. Lysozyme (Sigma) was added at 0.5 mg/ml, and the bacteria were
incubated overnight at 4 °C. Deoxycholate was added to a final
concentration of 0.1%, and the mixture was sonicated on a Brinkmann
homogenizer for 4 × 30 s. The inclusion bodies were pelleted
by centrifugation at 15,000 × g, and the soluble
fraction was discarded. Inclusion bodies were washed three times with
0.1 M Tris, pH 8.0, with 2 mM EDTA and 0.1%
deoxycholate followed by a wash with 0.1 M Tris, pH 8.0, 2 mM EDTA. The pellet was resuspended with 2 ml of 6 M guanidine HCl, 0.1 mM dithiothreitol,
0.1 M Tris, pH 8.0, 2 mM EDTA. The dissolved
protein was added to 50 ml of pre-chilled 0.4 M arginine,
0.1 M Tris, 2 mM EDTA, 5 mM
oxidized glutathione, 0.5 mM reduced glutathione and left
to refold in the cold room with gentle agitation for a minimum of 3 days. The protein was then dialyzed against 1 liter of HEPES-buffered
saline, 3 mM EDTA three times and then concentrated using
an Amicon ultrafiltration cell and MicroSep 3K omega filters (Pall
Corporation, Ann Arbor, MI). The concentrated 2m was then purified
by size exclusion chromatography. Both native and mutant 2m were
purified in the same manner. The protein concentrations were measured
by 280-nm absorbance. The extinction coefficient at 280 nm was
calculated from the primary amino acid sequence (33).
Size Exclusion Chromatography--
For 2m and for
H-2Dd 3 domain purification, 500-1000 µl of protein
was loaded onto a Superdex 75 column (Pharmacia LKB, Amersham Biosciences, Uppsala, Sweden) using the P-500 pump (Pharmacia LKB) at
0.5 ml/min buffer. Half-ml fractions were collected, and the protein
concentration was determined by 280-nm absorbance. Protein used for
surface plasmon resonance experiments was purified in HBS-EP buffer
(HEPES-buffered saline with 3 mM EDTA and 0.005% polysorbate 20) or PBS. Proteins used in flow cytometry and functional experiments were purified in PBS.
Antibodies, Cell Lines, and Peptide--
Anti-tetra His antibody
was purchased from Qiagen. An anti-H-2Dd antibody
(34.5.8S), an anti-H-2Kd antibody (SF1-1.1), and an
IgG2a control antibody were purchased from Pharmingen. The LKD8 cell
line, a peptide transport-deficient EE2H3 embryonic cell line
transfected with H-2Dd (37), was the generous gift of David
H. Margulies (NIH, Bethesda, MD). RMAs-Kd, a peptide
transport-deficient cell line transfected with H-2Kd (38),
was generously provided by Jonathan Yewdell (NIH, Bethesda, MD). The
B4.2.3 T-cell hybridoma (reactive with gp160 p18-I10 in the context
of H-2Dd) and H-2Dd L-cell transfectant
cell lines were also used (39). The H-2Dd-expressing gp160
transfectant 3T3 cell line (40), 15-12, and its control cell line,
18neo, were generously provided by Jay A. Berzofsky (NIH,
Bethesda, MD). The p18-I10 peptide (RGPGRAFVTI) (41, 42) was obtained
from the Center for Biologics Evaluation and Research Facility
for Biotechnology Resources (Bethesda, MD). The peptide was synthesized
on an ABI 433 peptide synthesizer (Applied Biosystems, Foster City, CA)
and characterized by matrix-assisted laser desorption ionization
time-of-flight mass spectrometry analysis (Voyager; Applied Biosystems).
Surface Plasmon Resonance (SPR) Experiments and Data
Analysis--
All SPR experiments were performed on the BIAcore 3000 biosensor (BIAcore AB, Uppsala, Sweden). Anti-His antibody,
diluted in 10 mM acetate buffer, pH 4.5, was covalently
coupled to the carboxymethylated dextran matrix on a CM5 sensor chip
(Biacore AB) by using the amine coupling kit as described previously
(43). Experiments were performed in HBS-EP buffer, and regeneration of
the anti-His surface was achieved with 20 mM HCl.
Equilibrium binding data for 2m were obtained by averaging a 5-10-s
interval of normalized signal after reaching equilibrium. The
normalized signal was obtained by subtracting the control surface
signal from 3 surface signal. The equilibrium binding data was
analyzed by nonlinear curve fitting of the Langmuir isotherm to the
data. The curve fitting was performed using the BIAevaluation 3.0 software (BIAcore AB).
Flow Cytometry 2m MHC1 Folding Assay--
2m and 2m
mutants were titrated at the indicated concentrations in 24- or 12-well
tissue culture plates containing 1 or 2 ml of OPTI-MEM medium
(Invitrogen) with 0.5% BSA (Sigma) and 0.5 × 106
LKD8 cells (for H-2Dd folding) or 0.5 × 106 RMAs-Kd cells (for H-2Kd
folding) per well. The assay was carried out in a 7.5% CO2
incubator at 26-28 °C for low temperature-induced folding or at
37 °C, with the indicated concentration of peptide, for
peptide-induced folding. After an overnight incubation, the cells were
spun down at 4 °C. One-half µg of the biotinylated
anti-H-2Dd antibody, 34.5.8S (Pharmingen), or biotinylated
anti-H-2Kd antibody, SF1-1.1 (Pharmingen), was added to
the cells. Cells receiving no primary antibody or a biotinylated
isotype-matched antibody (Pharmingen) were used as controls. After an
hour of incubation on ice, the cells were washed with 0.5%
BSA/OPTI-MEM medium and then 50 µl of streptavidin-fluorescein
isothiocyanate (Pharmingen), diluted 1:50 in 0.5% BSA/OPTI-MEM, was
added to the cells for an additional 30-min incubation on ice. The
cells were then washed with 0.5% BSA/OPTI-MEM and analyzed on a
FACScalibur (BD Biosciences) flow cytometer. The cells were
size-gated, and generally 2,500 to 10,000 cells were counted for each
data point. Data analysis was performed using Cell Quest Software (BD Biosciences).
Mutant 2m Effects on Antigen-induced T-cell
Activation--
2m and 2m mutants were added at the indicated
concentrations to wells in 96-well round bottom tissue culture plates
with 3.6 × 105 of the APC. The p18-I10 peptide
was added as indicated to wells. The final volume was 200 µl/well of
three parts 5% BSA/OPTI-MEM and one part PBS. After an overnight
incubation at 37 °C in 7.5% CO2, the cells were washed
two times with 5% BSA/OPTI-MEM and resuspended in 150 µl of
Dulbecco's modified Eagle's medium with 10% fetal calf serum, 2 mM L-glutamine, nonessential amino acids, penicillin/streptomycin (100 units/ml penicillin), and 5 × 10 5 M -mercaptoethanol (complete
medium). Fifty µl of washed APC were titrated by threes into 100 µl
of complete medium in 96-well flat bottom tissue culture plates
as indicated. B4.2.3 T-cells were added at the indicated concentrations
in 50 µl of complete medium, and the plates were incubated overnight
at 37 °C in 7.5% CO2. For IL2 cytokine determinations,
25 µl of culture supernatants were assayed with commercially
available kits (Endogen, Boston, MA) according to the manufacturer's
specifications. Horseradish peroxidase-conjugated streptavidin
(Zymed Laboratories Inc., San Francisco, CA) and
tetramethylbenzidine (Dako, Carpinteria, CA) were used as developers.
The absorbance was read on a Bio-Rad model 3550 microplate reader
(Hercules, CA) at 655 nm with background subtraction. Cytokine
standards were run with each experiment. A linear fit of these IL2
standard values was used to extrapolate the scales for IL2 levels. In
some experiments the cells were pulsed with 1 µCi/well of
[3H]thymidine (PerkinElmer Life Sciences) for 3-6
h and harvested and counted to assess growth inhibition (44).
 |
RESULTS |
2m Mutations and 2m Mutant Binding to an MHC1 3
Domain--
Human and murine 2m are ~70% homologous (34), and
critical 2m contact residues with MHC1 heavy chain are conserved
(8). Human 2m is more effective than murine 2m at folding murine MHC1 heavy chain and at binding an MHC1 3 domain (30). Because h 2m has a higher affinity for an MHC1 3 domain than murine 2m, we chose to mutate h 2m. This higher affinity for MHC1 3 would predictably lower the concentration necessary to observe a mutant dominant negative effect. We limited our mutation of 2m residues to
those that interact with the 1 and 2 interface of the MHC1 heavy
chain in MHC1 crystal structures. HLA-A2 and H-2Dd MHC1
crystal structures (8, 45) implicate the tryptophan at position 60 of
2m as a critical residue for multiple contacts between 2m and the
2 domain of the MHC1 heavy chain. Mutations of 2m at position 60 have also been shown to interfere with 2m exchange onto MHC1 (46).
To create a defect in 2m folding of MHC1, we mutated the tryptophan
at 2m position 60 to an alanine residue, a non-conservative change.
The HLA-A2 MHC1 crystal structure also predicts a number of
interactions between the aspartate at position 53 of 2m and residues
of the 1 domain of the MHC1 heavy chain. However, crystal structures
of H-2Dd (45, 47-49) suggest weaker interactions between
the aspartate at position 53 of 2m and the 1 domain. Despite
this, a previous study (34) has demonstrated that changing the
negatively charged aspartate residue at position 53 to a neutral valine
decreased the ability of h 2m to fold murine MHC1 molecules,
including H-2Dd. Based on this study, we generated charge
reversal mutants, changing position 53 of 2m to positively charged
lysine or arginine, predicting that these mutants would have greater
defects in MHC1 folding than the neutral D53V mutation. In addition, we
generated a 2m mutant with non-conservative changes at both
positions, 60 and 53. Based on amino acid sequence data, these residues
are conserved across murine and human 2m molecules (8). The
locations of the two sites we mutated in 2m, as related to an
example MHC1 crystal structure (50), are illustrated in Fig.
1.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 1.
Location of mutated
2m residues and their relationship to the MHC1
heavy chain. Residues Asp-53 (D53) and Trp-60
(W60) are shown in space-fill on a gray backbone
frame of human 2m. The MHC1 heavy chain is illustrated as a
black backbone frame, and the antigenic peptide is
illustrated as a gray backbone frame. This figure was
generated using RasMol from the Protein Data Bank structure 1HHJ (HLA
A201 with a nonamer human immunodeficiency virus reverse
transcriptase peptide).
|
|
Based on structural data, our 2m mutants at positions 60 and 53 are
likely to be defective in their interactions with MHC1 1/ 2 and
not MHC1 3. However, to rule out an unexpected global effect of the
mutations, we verified that the mutant 2m- 3 interactions were not
compromised. We expressed the 2m proteins using constructs in
bacterial expression vectors (34, 35). Purified mutant 2m molecules
were evaluated for binding to isolated MHC1 H-2Dd 3
domain molecules using a biosensor for SPR (30). Antibody to the
polyhistidine tail of the 3 protein was directly coupled to the
carboxymethylated dextran surface of a biosensor chip, allowing for
the capture of 3 protein on this surface. 2m molecules were
injected across the surface of the immobilized 3 protein, and the
binding was assessed by mass-related changes in the sensor chip matrix
refractive index and quantified as response units (RU). 2m was also
injected across a control surface consisting of the directly coupled
capture antibody without 3 protein. We injected a control protein,
ovalbumin, and there was no detectable 3 domain binding (data not
shown). This experimental system was sensitive to a 2-fold difference
in affinity between human and mouse 2m (30). This allowed protein
concentration effects on the refractive index response to be subtracted
out. An example of such an SPR experiment with the W60A/D53K double
mutant 2m is shown in Fig.
2A. The responses of the 3
domain and control surfaces were normalized to each other immediately
prior to the injection of the 2m to allow comparison of the active
and control surfaces in this figure. Increasing concentrations of 2m
were then evaluated for binding to purified monomeric 3 domains. The binding curves after subtraction of the control surface are shown in
Fig. 2B. Equilibrium values taken from the subtracted data were used to generate the plot in Fig. 2C. This plot was fit
with the nonlinear Langmuir isotherm for calculation of the equilibrium binding constant. The equilibrium constants for 3 binding were generated in this manner from three experiments with each of the 2m
proteins and are shown in Table
I. The dissociation equilibrium constants
vary from ~0.2-0.4 micromolar for native h 2m, and all the 2m
mutants we generated. This suggests that these mutations do not have
global effects on 2m structure and do not significantly modify the
interaction of 2m with the MHC1 3 domain. Thus these mutant 2m
molecules are useful for testing our predictions regarding MHC1
folding.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Measurement of mutant
2m binding to the H-2Dd 3
domain. A, anti-polyhistidine antibody was immobilized
on two surfaces of an SPR sensor chip at 2850 and 3550 RU by amide
coupling. 1 µM 3 domain (dashed line) was
injected over the 2850 RU anti-polyhistidine surface, and buffer
(solid line) was injected over the 3550 RU
anti-polyhistidine surface for 3 min at a flow rate of 10 µl/min.
After a 4.5-min wait, 1 µM W60A/D53K mutant 2m was
injected over both surfaces for 90 s at a flow rate of 10 µl/min. The responses of the two surfaces were normalized prior to
the 2m injection to allow comparison of the 2m binding of the
3 domain and the control surface. B, the response of the
control surface to 2m was subtracted from the response of the 3
surface to 2m as a measure of 2m- 3 binding. The binding curves
shown are at the indicated concentrations of W60A/D53K mutant 2m.
C, averages of the equilibrium W60A/D53K mutant 2m- 3
binding responses during 2m injection were plotted versus
2m concentration. These points were fit with the Langmuir isotherm
to determine the Kd. The 2 (average
of the squared residuals) value of 0.072 suggests a good fit.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Equilibrium binding of 2m to the MHC1 H-2Dd 3 domain
The equilibrium fit was determined from a nonlinear Langmuir isotherm
fit of equilibrium data similar to that of Fig. 2C. The
fitting was done using the BIAevaluation 3.0 software as described
under "Experimental Procedures." The Kd results
are the average of three experiments ± S.D. The 2
average ± the S.D. is shown as a measure of the curve fit.
|
|
Asp-53 Mutant 2m-driven Folding of Cell Surface MHC1
Heavy Chain--
Because our 3 binding data were generated with a
murine 3 MHC1 domain, we evaluated the mutant h 2m molecules with
murine MHC1. Previous studies have demonstrated that the folding of
MHC1 by 2m, in the absence of added MHC1 binding peptide, is much more efficient at room temperature than at 37 °C (20, 21, 51). This
low temperature-induced expression of folded MHC1 in peptide
transport-deficient cells is dependent on the presence of 2m. To
study the effects of the 2m mutations on MHC1 1/ 2 domain
folding, we added bacterially expressed 2m molecules to a peptide
transport-deficient cell line, LKD8 (37), at room temperature. This
cell line lacks stable folded H-2Dd heavy chain, as
demonstrated by poor binding of the 1/ 2 conformational epitope-dependent anti-H-2Dd antibody, 34.5.8S
(21). Addition of increasing amounts of native h 2m to these cells,
with an overnight incubation at 26-28 °C, leads to increasing
amounts of folded cell surface H-2Dd MHC1 (Fig.
3A). The increase in folded
MHC1, shown by the increased binding of 34.5.8S, is greater with the
addition of native h 2m than with the addition of the Asp-53 2m
mutants (Fig. 3B). However, addition of Asp-53 mutants can
still facilitate folding of H-2Dd. We also evaluated the
effects of Asp-53 mutant 2m on the H-2Kd haplotype of
MHC1 using the peptide transport-deficient cell line,
RMAs-Kd (Fig. 3, A and C). We stained
the cells with the anti-H-2Kd antibody, SF1-1.1, as a
readout for folded H-2Kd MHC1. Although the antibody
recognizes an 3 domain epitope (52, 53), it can detect differences
in H-2Kd stable expression secondary to folding by peptide
and 2m (38). We observed a greater defect in expression of
H-2Kd than H-2Dd with all the Asp-53 mutants.
This defect was most striking with the charge reversal mutants D53K and
D53R (Fig. 3C).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 3.
Asp-53 mutants of 2m
have decreased ability to fold MHC1 at room temperature. A,
human native or mutant 2m was added at the indicated concentrations
to the peptide transport-deficient cell lines (LKD8 for
H-2Dd and RMAs-Kd for H-2Kd) and
incubated overnight at 26-28 °C. The folding of MHC1 was assessed
by staining LKD8 with a biotinylated antibody to H-2Dd
MHC1, 34.5.8S, and staining RMAs-Kd with a biotinylated
antibody to H-2Kd MHC1, SF1-1.1, as described under
"Experimental Procedures." After secondary staining with
streptavidin-fluorescein isothiocyanate, cells were size-gated, and
10,000 cells were counted. Histograms with addition of 0 (shaded), 0.1 (dashed line), 1 (thin solid
line), and 10 (thick solid line) µg/ml of human and
D53V 2m are shown for H-2Dd and Kd cells.
Histograms of 0 (shaded), 0.14 (dashed line), 1.4 (thin solid line), and 14 (thick solid line)
µg/ml of D53K 2m are shown for H-2Dd and
Kd cells. Similar results were obtained in three
experiments with H-2Dd and Kd cells, and the
histograms are representative of histograms used in generation of
summary flow cytometry data throughout the paper. B, the
median fluorescence of 34.5.8S staining LKD8 cells is increased to a
greater extent by human 2m (- -) than by D53V 2m (- -). D53K
(- -) and D53R (- -) are even weaker than D53V 2m at inducing
34.5.8S epitopes. LKD8 cells in the absence of 2m had a median
fluorescence of 18 units. Controls stained with IgG2a had a median
fluorescence of ~13 units. C, the median fluorescence of
SF1-1.1 staining RMAs-Kd cells is increased to a much
greater extent by human 2m (- -) than by D53V 2m (- -). D53K
(- -) and D53R (- -) have almost no effect on induction of the
SF1-1.1 epitope at the indicated concentrations. RMAs-Kd
cells in the absence of 2m had a median fluorescence of 18.4 units.
Controls stained with IgG2a had a median fluorescence of ~8.5
units.
|
|
W60A Mutant 2m Molecules Have Severe Defects in MHC1 Folding and
Can Act as Dominant Negatives for H-2Dd
Folding--
Despite the profound defect of the Asp-53 charge reversal
mutants in enhancing H-2Kd expression, D53K can still
enhance expression of H-2Kd molecules when added at
concentrations above 10 µM (Fig.
4A). In experiments where
Asp-53 charge reversal mutants are added together with native h 2m,
no inhibition of the h 2m-induced H-2Kd expression was
observed (data not shown). We then evaluated the W60A and the W60A/D53K
mutant 2m molecules in folding MHC1. Fig. 4A shows that
2m molecules with the W60A mutation are less efficient at enhancing
expression of H-2Kd than 2m molecules that only have the
D53K mutation. However, some increased expression of H-2Kd
is still observed with the W60A mutants (Fig. 4A), and high
concentrations of the W60A mutants are unable to interfere with native
2m-enhanced expression of H-2Kd (Fig. 4B). We
then assessed the effect of the W60A mutants on H-2Dd
folding. Both the W60A and W60A/D53K mutants were unable to facilitate H-2Dd folding even at 20 µM concentrations
(Fig. 4C). In addition to the lack of H-2Dd MHC1
folding, the W60A and W60A/D53K mutants were able to inhibit H-2Dd folding by native 2m (Fig. 4D). The
inhibitory effect of W60A mutant 2m molecules is not a general
effect on cell viability or protein expression, because the
H-2Kd expression induced by native 2m is unaffected.
Thus 2m molecules containing the W60A mutation can function as
dominant negatives for native 2m folding of H-2Dd
MHC1.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4.
W60A 2m mutants have
severe defects in MHC1 folding and are dominant negatives for
H-2Dd folding. Human native and/or mutant 2m were
added at the indicated concentrations to the peptide
transport-deficient cell lines (LKD8 for H-2Dd and
RMAs-Kd for H-2Kd), incubated overnight at
26-28 °C, and stained as described in the legend for Fig. 3 and
under "Experimental Procedures." Similar results were obtained in
two to four experiments. A, the median fluorescence of
SF1-1.1 staining RMAs-Kd cells is increased as expected by
native 2m (- -). D53K 2m (- -) only increases SF1-1.1
staining at high concentrations, and W60A (- -) and W60A/D53K (- -)
are even less effective. Controls stained with IgG2a had a median
fluorescence of ~5 units. B, addition of 20 µM W60A/D53K, together with 0.2 µM native
2m (shaded), or 20 µM W60A, together with
0.2 µM native 2m (white), does not decrease
SF1-1.1 staining of RMAs-Kd cells below that of 0.2 µM native 2m alone (black). C,
the median fluorescence of 34.5.8S staining LKD8 cells is increased as
expected by native 2m (- -). D53K 2m (- -) is only somewhat
less effective, and W60A (- -) and W60A/D53K (- -) 2m do not
increase 34.5.8S staining even at high concentrations. Controls stained
with IgG2a had a median fluorescence of ~23 units. D,
addition of 20 µM W60A/D53K, together with 0.2 µM native 2m (shaded), or 20 µM W60A, together with 0.2 µM native 2m
(white), do decrease 34.5.8S staining of LKD8 cells below
that of 0.2 µM native 2m alone
(black).
|
|
W60A Mutant 2m Molecules Require Micromolar Concentrations
to Inhibit Native 2m-driven Folding of H-2Dd--
The
dominant negative effect of W60A mutant 2m molecules on
H-2Dd MHC1 folding supports the hypothesis of an initial
rate-limiting 2m-MHC1 3 interaction in MHC1 folding. Because the
MHC1 molecule in which we observe the dominant negative effect of
mutant 2m is the same H-2Dd haplotype as our isolated
3 domain, we can compare the concentrations of mutant 2m that
inhibit H-2Dd folding with those that allow binding to the
H-2Dd 3 domain. The effects on H-2Dd folding
of titrations of W60A and W60A/D53K 2m molecules are illustrated in
Fig. 5A. Both mutants are
inhibitory in the low micromolar range. Although there is some
variability in the relative inhibition by the two mutants, in general
the double mutant W60A/D53K is a slightly more potent inhibitor. Fig.
5B demonstrates that with the W60A/D53K mutant, the
half-maximal inhibition of MHC1 folding occurs at an approximately
micromolar concentration. As described previously (30), the binding of
the W60A mutants to the H-2Dd 3 domain by SPR has an
equilibrium dissociation constant of ~0.3 µM. This
SPR-derived binding is similar to that of native h 2m. Using
analytical ultracentrifugation, native h 2m binds 3 with a
somewhat higher equilibrium dissociation constant of ~4
µM (30). One possible reason for this difference is a
restriction of the 3 His-tag tether mobility when captured by the
anti-His surface in SPR experiments. Independent of the reason for this difference, the inhibitory concentrations for the dominant negative 2m effect are very similar to the range of 2m- 3 binding
suggested by biophysical methods. This provides further support for a
2m- 3 rate-limiting step in MHC1 folding.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
The concentration dependence of mutant
2m inhibition of H-2Dd folding.
A, W60A 2m (- -) and W60A/D53K 2m (- -) were added
at the indicated concentrations with 0.1 µM native 2m
to LKD8 cells, incubated overnight at 26-28 °C, and stained as
described in the legend for Fig. 3 and under "Experimental
Procedures." LKD8 cells in the absence of native 2m had a median
fluorescence of ~13 units. This was subtracted from the median
fluorescence at each point to give the relative median fluorescence.
Controls stained with IgG2a had a median fluorescence of ~9 units.
B, W60A/D53K 2m (- -) were added at the indicated
concentrations with 0.1 µM native 2m to LKD8 cells,
incubated overnight at 26-28 °C, and stained as described under
"Experimental Procedures." LKD8 cells in the absence of native
2m had a median fluorescence of ~17 units. This was subtracted
from the median fluorescence at each point to give the relative median
fluorescence. Controls stained with IgG2a had a median fluorescence
of ~11.5 units. The relative median fluorescence of 0.1 µM native 2m in the absence of mutant 2m is shown
(dashed line). Inhibition by W60A/D53K was seen in four
similar experiments. Because inhibition was not complete in all
experiments, we evaluated the concentration of W60A/D53K that led to
25% inhibition. The average value + the S.D. for this was 3.5 ± 2.3 µM.
|
|
Dominant Negative 2m Molecules Inhibit Peptide-induced Folding
of H-2Dd MHC1--
So far all our studies have evaluated
MHC1 folding driven by 2m at low temperature, in the absence of
added antigenic peptide. MHC1 molecules expressed in this manner
contain very few detectable peptides, as determined by peptide elution
and high pressure liquid chromatography analysis (54). Because an
important physiologic role for MHC1 is presentation of antigenic
peptides, we also evaluated the effect of the dominant negative 2m
mutants on peptide-induced MHC1 folding. Induction of folded
H-2Dd by the human immunodeficiency virus gp160
peptide p18-I10, and native 2m was evaluated in the absence or
presence of dominant negative 2m molecules (Fig.
6). The folding was done at 37 °C to
minimize native 2m-induced folding in the absence of peptide (51).
Although some MHC1 folding was induced by peptide in the absence of
added 2m (82 median fluorescent units, Fig. 6), the combination of
2m and peptide led to a striking increase in folded MHC1 (348 median
fluorescent units, Fig. 8). Both mutant 2m molecules inhibit the
antigenic peptide-induced folding of H-2Dd, and in this
experiment the W60A/D53K mutant is more effective than the W60A mutant.
Thus the dominant negative effect of these mutant 2m molecules
applies to both low temperature and antigenic peptide-induced folding
of H-2Dd.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 6.
W60A 2m mutants are
dominant negatives for antigenic peptide-driven H-2Dd
folding. Human native 2m at 0.1 µM in the
presence or absence of mutant 2m at 20 µM, as
indicated, with 1 µM p18-I10 antigenic peptide
(white) or without peptide (black) were added to
LKD8 for an overnight incubation at 37 °C. The cells were stained as
described in the legend for Fig. 3 and under "Experimental
Procedures." Controls stained with IgG2a had a median fluorescence
of ~9.5 units. Staining in the absence of native 2m is shown, and
a dotted line was added to the graph to highlight
for comparison the 34.5.8S staining of LKD8 with peptide in the absence
of 2m. Similar results were obtained in two experiments.
|
|
Functional Effects of Dominant Negative 2m on T-cell
Activation--
Because dominant negative 2m molecules were able to
inhibit H-2Dd folding by the antigenic peptide p18-I10, we
evaluated the ability of the W60A/D53K 2m mutant to inhibit T-cell
activation by p18-I10 in the context of H-2Dd. We utilized
the B4.2.3 T-cell hybridoma (39) that is reactive with the p18-I10
peptide in the presence of H-2Dd-expressing APC. The
H-2Dd-expressing LKD8 cells were incubated overnight with
peptide and native 2m in the presence or absence of mutant 2m.
After washing the LKD8 APC, the cells were titrated and evaluated for
stimulation of the B4.2.3 T-cell hybridoma. Although we observed some
IL2 production by the B4.2.3 cells with native 2m in the absence of
antigenic peptide, this was increased in the presence of antigenic peptide. At low antigenic peptide concentrations, native 2m
significantly enhanced the B4.2.3 IL2 production
(0.3-2.7 ng/ml IL2, data not shown).
This enhancement also occurred with higher concentrations of native
h 2m (data not shown). However the native h 2m and 0.001 µM peptide-driven IL2 production was almost completely
reversed by addition of 50 µM of the dominant negative
W60A/D53K 2m (Fig. 7A). At higher concentrations of the
p18-I10 peptide, the mutant 2m was unable to inhibit B4.2.3 T-cell
activation (Fig. 7B). This is not unexpected, because high
concentrations of MHC1 binding peptide have been shown to form
complexes with MHC1 in the absence of 2m (15). Evaluation of this
experiment by activation-induced growth inhibition (44) gave similar
results, demonstrating mutant 2m reversal of growth inhibition (data
not shown). This rules out a cytotoxic effect of the mutant 2m
molecules, because they lead to increased rather than decreased
proliferation. Thus, the 2m dominant negative inhibition of MHC1
folding can lead to inhibition of a T-cell response to antigenic
peptide. This inhibition was seen with a peptide transport-deficient
APC, LKD8, that primarily expresses misfolded MHC1 in the absence of
exogenous 2m and peptide. Because APC that do not have a peptide
transport defect also have misfolded MHC1 (55), this inhibitory effect
should apply more generally. In the presence of native 2m,
H-2Dd L-cell transfectants can activate B4.2.3 at low cell
density with peptide or high cell density in the absence of peptide,
and this activation can also be inhibited by dominant negative
2m (data not shown).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7.
Functional effects of dominant negative
W60A/D53K 2m on T-cell hybridoma
activation. A, LKD8 cells were incubated with p18-I10
peptide (- -), p18-I10 and 50 µM W60A/D53K 2m
(- -), no peptide and no W60A/D53K (dashed line with ),
and no peptide and 50 µM W60A/D53K 2m (dashed
line with ). After an overnight incubation in serum-free media
with 0.1 µM native 2m, the cells were washed and
titrated as indicated with 2 × 104 B4.2.3 T-hybridoma
cells per well. Following an additional overnight incubation, an
enzyme-linked immunosorbent assay was used to assay the supernatants
for IL2 production. The averages of duplicates are shown, and the
error bars represent the range. IL2 standard results are
shown on the right y axis. Using the Student's t
test, the values for peptide and peptide with W60A/D53K 2m are
significantly different at p < 0.02 for all points
shown with APC. In this experiment 0.001 µM p18-I10
peptide was added to peptide-positive wells. Similar results were
obtained in three experiments with 0.001 or 0.01 µM
p18-I10 peptide and 1 or 2 × 104 B4.2.3 cells.
B, the same experiment was also performed with 0.1 µM p18-I10 peptide added to peptide-positive wells.
Similar results were obtained in three experiments with 0.1 µM p18-I10 peptide and 1 or 2 × 104
B4.2.3 cells. C, 3T3 cells transfected with the gp160 gene
(15-12) were incubated with no 2m (dashed line with
), 0.1 µM native 2m (- -), or 0.1 µM native 2m and 50 µM W60A/D53K 2m
(- -). After an overnight incubation in serum-free media, the cells
were washed and titrated as indicated with 1 × 104
B4.2.3 T-hybridoma cells per well. Following an additional overnight
incubation, an enzyme-linked immunosorbent assay was used to assay the
supernatants for IL2 production. The averages of duplicates are shown,
and the error bars represent the range. IL2 standard results
are shown on the right y axis. Similar results were obtained
in two experiments.
|
|
Because endogenous antigens are loaded onto MHC1 in the ER, it is
unlikely that exogenously delivered dominant negative 2m would
interfere with ER-based MHC1 folding and peptide loading. We attempted
to evaluate this by using the cell line 15-12, an H-2Dd-expressing 3T3 cell line transfected with gp160 (40),
containing the p18-I10 peptide sequence. In the presence of native
2m, there was a large increase in IL2 production (Fig.
7C) as observed with the exogenously loaded peptide. However
the addition of W60A/D53K 2m did not lead to consistent inhibition
of T-cell activation by 15-12 cells (Fig. 7C). A differing
role of 2m for endogenous and exogenous antigen is suggested by
these data. Endogenous peptide-loaded MHC1 may be dependent on 2m
for stabilization whereas exogenous peptide loading is dependent on
2m for MHC1 refolding. Therefore the loading of exogenous antigen is
more sensitive to a dominant negative 2m for MHC1 folding.
 |
DISCUSSION |
2m is both a structural component of MHC1 and a chaperone for
correct folding of the MHC1 heavy chain. 2m binds folded MHC1 heavy
chain at a thousand-fold lower concentration than that required for
2m-driven folding of cell surface MHC1. The 3 domain of the MHC1
heavy chain is folded before the other MHC1 domains, prior to
associating with 2m (56, 57), and remains folded longest on the cell
surface (21). This makes a 2m interaction with the 3 domain an
attractive model for the 2m-driven folding of the MHC1 heavy chain.
We have demonstrated previously (29) that human 2m binding to an
isolated 3 domain has a dissociation affinity constant in the
micromolar range similar to the concentration range in which 2m
folds MHC1. In addition, we demonstrated that the binding of the 3
domain by 2m has a species hierarchy and a temperature dependence
similar to that of the folding of MHC1 heavy chain by 2m (30). These
data support a model in which a 2m- 3 interaction is a required
intermediate in the folding of MHC1 heavy chain. Such a model would
predict that a 2m molecule that retains the ability to interact with
the 3 domain but is defective in its ability to interact with the
1/ 2 domains of MHC1 would function as a competitive inhibitor of
native 2m with a dominant negative effect on MHC1 folding.
Furthermore, the concentration dependence of the dominant negative
effect would relate to the affinity of 2m for the 3 domain. In
this study we demonstrate that 2m molecules with mutations of
critical residues in the 2m- 1/ 2 interface can block native
2m folding of H-2Dd MHC1 at concentrations similar to
those allowing 2m interaction with the H-2Dd 3
domain. This provides very strong evidence for a 2m- 3-limiting intermediate in extracellular H-2Dd MHC1 folding.
In our studies, we have observed only the dominant negative effect of
2m mutants on the H-2Dd haplotype. Although it is possible
that the limiting 2m- 3 step is haplotype-specific, the lack of a
dominant negative effect on H-2Kd MHC1 may be due to our choice
of 2m mutants. Differential effects of 2m mutants on MHC1
haplotypes have been described previously (49). Experiments using
additional MHC1 haplotypes and 2m mutations are planned to define
the generality of our observations. It is likely that dominant negative
2m molecules can be generated that block folding of MHC1 haplotypes
other than murine H-2Dd.
Although the data we present are limited to extracellular MHC1
folding, the binding parameters and kinetic intermediates of 2m
interactions are likely to play an important role in MHC1 assembly in
the ER. The 2m interaction with the 3 domain can be further
evaluated with other fragments of MHC1 heavy chain and whole MHC1 using
SPR. The addition of MHC binding peptides and chaperone molecules such
as calreticulin, tapasin, transporter associated with antigen
processing, and Erp57 may allow for the understanding of the
biochemistry of physiologic MHC1 folding in the ER. The use of mutant
2m molecules in these studies could help define the roles of various
chaperones in transitional steps between 2m binding and complete
MHC1 folding. The transfection of 2m mutant genes into mammalian
cells could supply information on the relevance of the 2m- 3
interaction to the complete MHC1 assembly process in the ER. However,
even if the mutant 2m effects on folding are limited to
extracellular MHC1, these mutant effects could alter the exogenous
peptide generation of antigen-MHC1 complexes for T-cell stimulation.
To assess the effect of the 2m mutant molecules on formation of
stimulatory MHC1-antigenic peptide complexes, we tested their ability
to block antigenic peptide and native 2m- mediated MHC1 folding at
37 °C. The W60A mutant 2m molecules were able to block this
folding. Because the mutants were also dominant negative for this
antigenic peptide-mediated folding, we tested whether mutant 2m
could block the functional response of a T-cell hybridoma specific for
peptide-H-2Dd complexes. At low peptide concentrations,
W60A/D53K 2m was able to block the T-cell response. It was also of
interest to assess the effects of these mutants on endogenously loaded
antigenic peptides. Activation of a T-cell hybridoma by a transfectant
cell line with endogenous peptide was more resistant to inhibition than
cell lines loaded exogenously with peptide. If additional work supports
a selective effect of mutant 2m on exogenous versus endogenous peptide loading, these mutants may be useful in defining whether there is a role for exogenous peptide loading in in
vivo CTL-mediated responses and pathology. Mutants of 2m have
also been generated that interfere with the binding of the non-TCR MHC1
ligands, Ly49A (58, 59) and CD8 (60), to MHC1. Although the effects on
CD8 binding were demonstrated with mutation of position 58 of 2m,
mutation of position 60 also diminished CD8 binding to MHC1 (60).
However, the effects on MHC1 folding we observed with the W60A mutants
are independent of CD8. In addition, the functional inhibition we
observed of the B4.2.3 T-cell hybridoma cannot be explained by an
effect on CD8 binding, because B4.2.3 does not express CD8. Different
mutations of 2m between positions 52 and 63 have been generated
(46). Although the ability of these mutants to fold MHC1 expressed by
peptide transport-deficient cells was not evaluated, some of these
mutants interfered with the generation of a peptide-specific epitope in
HLA-B27. There was only minimal blockade of CTL lysis by two of these
mutants, and the blockade did not correlate with effects on the
peptide-specific epitope. This suggests possible alternative effects of
these mutant 2m molecules, such as antagonism of CD8 binding.
The folding of free MHC1 heavy chain on the surface of cells by 2m
plays an important role in normal cells (55, 61, 62), as well as in
peptide transport-deficient cells. This folding can have immunologic
consequences due to the enhanced presentation of exogenous peptide
fragments to CTL (39, 63-65). Such presentation of extracellularly
processed (41, 66-68) class I restricted peptides could cause lysis of
uninfected bystander cells in a CTL response to virus. Understanding
the mechanism of MHC1 folding and developing reagents that can
interfere with this folding may suggest clinically relevant strategies
to prevent such aberrant responses.
 |
ACKNOWLEDGEMENTS |
We thank Drs. Jorge Laborda and David H. Margulies for valuable discussion and review of this work.
 |
FOOTNOTES |
*
This work was supported by the Howard Hughes Medical
Institute and Montgomery County Public Schools student intern
program.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Contributed equally to this work.
§
To whom correspondence should be addressed: DMA, CBER, FDA, 29 Lincoln Dr., Bldg. 29B-3NN08, HFM-561, Bethesda, MD 20892. Tel.:
301-827-0719; Fax: 301-827-0852; E-mail: kozlowski@cber.fda.gov.
Published, JBC Papers in Press, November 25, 2002, DOI 10.1074/jbc.M208381200
 |
ABBREVIATIONS |
The abbreviations used are:
MHC1, major
histocompatibility class I molecules;
2m, 2-microglobulin;
CTL, cytotoxic T-lymphocyte;
TCR, T-cell receptor;
h 2m, human
2-microglobulin;
APC, antigen-presenting cells;
SPR, surface plasmon
resonance;
RU, response units;
ER, endoplasmic reticulum;
PBS, phosphate-buffered saline;
BSA, bovine serum albumin;
IL, interleukin.
 |
REFERENCES |
| 1.
|
Townsend, A.,
and Bodmer, H.
(1989)
Annu. Rev. Immunol.
7,
601-624[Medline]
[Order article via Infotrieve]
|
| 2.
|
Jones, E. Y.,
Tormo, J.,
Reid, S. W.,
and Stuart, D. I.
(1998)
Immunol. Rev.
163,
121-128[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Germain, R. N.,
and Margulies, D. H.
(1993)
Annu. Rev. Immunol.
11,
403-450[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Ljunggren, H. G.,
and Thorpe, C. J.
(1996)
Histol. Histopathol.
11,
267-274[Medline]
[Order article via Infotrieve]
|
| 5.
|
Ozato, K.,
Evans, G. A.,
Shykind, B.,
Margulies, D. H.,
and Seidman, J. G.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
2040-2043[Abstract/Free Full Text]
|
| 6.
|
Bjorkman, P. J.,
Saper, M. A.,
Samraoui, B.,
Bennett, W. S.,
Strominger, J. L.,
and Wiley, D. C.
(1987)
Nature
329,
512-518[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Davis, M. M.,
Boniface, J. J.,
Reich, Z.,
Lyons, D.,
Hampl, J.,
Arden, B.,
and Chien, Y.
(1998)
Annu. Rev. Immunol.
16,
523-544[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Saper, M. A.,
Bjorkman, P. J.,
and Wiley, D. C.
(1991)
J. Mol. Biol.
219,
277-319[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Santos-Aguado, J.,
Biro, P. A.,
Fuhrmann, U.,
Strominger, J. L.,
and Barbosa, J. A.
(1987)
Mol. Cell. Biol.
7,
982-990[Abstract/Free Full Text]
|
| 10.
|
Ribaudo, R. K.,
and Margulies, D. H.
(1995)
J. Immunol.
155,
3481-3493[Abstract]
|
| 11.
|
Salter, R. D.
(1992)
Hum. Immunol.
35,
40-49[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Seong, R. H.,
Clayberger, C. A.,
Krensky, A. M.,
and Parnes, J. R.
(1988)
J. Exp. Med.
167,
288-299[Abstract/Free Full Text]
|
| 13.
|
Zijlstra, M.,
Bix, M.,
Simister, N. E.,
Loring, J. M.,
Raulet, D. H.,
and Jaenisch, R.
(1990)
Nature
344,
742-746[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Allen, H.,
Fraser, J.,
Flyer, D.,
Calvin, S.,
and Flavell, R.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
7447-7451[Abstract/Free Full Text]
|
| 15.
|
Bix, M.,
and Raulet, D.
(1992)
J. Exp. Med.
176,
829-834[Abstract/Free Full Text]
|
| 16.
|
Solheim, J. C.,
Johnson, N. A.,
Carreno, B. M.,
Lie, W. R.,
and Hansen, T. H.
(1995)
Eur. J. Immunol.
25,
3011-3016[Medline]
[Order article via Infotrieve]
|
| 17.
|
Fink, A. L.
(1999)
Physiol. Rev.
79,
425-449[Abstract/Free Full Text]
|
| 18.
|
Solheim, J. C.
(1999)
Immunol. Rev.
172,
11-19[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Cresswell, P.,
Bangia, N.,
Dick, T.,
and Diedrich, G.
(1999)
Immunol. Rev.
172,
21-28[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Rock, K. L.,
Gramm, C.,
and Benacerraf, B.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
4200-4204[Abstract/Free Full Text]
|
| 21.
|
Otten, G. R.,
Bikoff, E.,
Ribaudo, R. K.,
Kozlowski, S.,
Margulies, D. H.,
and Germain, R. N.
(1992)
J. Immunol.
148,
3723-3732[Abstract]
|
| 22.
|
Elliott, T.,
Cerundolo, V.,
Elvin, J.,
and Townsend, A.
(1991)
Nature
351,
402-406[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Elliott, T.,
Elvin, J.,
Cerundolo, V.,
Allen, H.,
and Townsend, A.
(1992)
Eur. J. Immunol.
22,
2085-2091[Medline]
[Order article via Infotrieve]
|
| 24.
|
Hyafil, F.,
and Strominger, J. L.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
5834-5838[Abstract/Free Full Text]
|
| 25.
|
Parker, K. C.,
and Strominger, J. L.
(1985)
Biochemistry
24,
5543-5550[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Hochman, J. H.,
Shimizu, Y.,
DeMars, R.,
and Edidin, M.
(1988)
J. Immunol.
140,
2322-2329[Abstract]
|
| 27.
|
Pedersen, L. O.,
Hansen, A. S.,
Olsen, A. C.,
Gerwien, J.,
Nissen, M. H.,
and Buus, S.
(1994)
Scand. J. Immunol.
39,
64-72[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Shields, M. J.,
Moffat, L. E.,
and Ribaudo, R. K.
(1998)
Mol. Immunol.
35,
919-928[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Whitman, M. C.,
Strohmaier, J.,
O'Boyle, K.,
Tingem, J. M.,
Wilkinson, Y.,
Goldstein, J.,
Chen, T.,
Brorson, K.,
Brunswick, M.,
and Kozlowski, S.
(2000)
Mol. Immunol.
37,
141-149[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Hebert, A. M.,
Strohmaier, J.,
Whitman, M. C.,
Chen, T.,
Gubina, E.,
Hill, D. M.,
Lewis, M. S.,
and Kozlowski, S.
(2001)
Biochemistry
40,
5233-5242[Medline]
[Order article via Infotrieve]
|
| 31.
|
Herskowitz, I.
(1987)
Nature
329,
219-222[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Perlmutter, R. M.,
and Alberola-Ila, J.
(1996)
Curr. Opin. Immunol.
8,
285-290[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Gill, S. C.,
and von Hippel, P. H.
(1989)
Anal. Biochem.
182,
319-326[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Shields, M. J.,
Assefi, N.,
Hodgson, W.,
Kim, E. J.,
and Ribaudo, R. K.
(1998)
J. Immunol.
160,
2297-2307[Abstract/Free Full Text]
|
| 35.
|
Shields, M. J.,
Kubota, R.,
Hodgson, W.,
Jacobson, S.,
Biddison, W. E.,
and Ribaudo, R. K.
(1998)
J. Biol. Chem.
273,
28010-28018[Abstract/Free Full Text]
|
| 36.
|
Horton, R. M.,
Cai, Z. L., Ho, S. N.,
and Pease, L. R.
(1990)
Biotechniques
8,
528-535[Medline]
[Order article via Infotrieve]
|
| 37.
|
Bikoff, E. K.,
Otten, G. R.,
and Robertson, E. J.
(1991)
Eur. J. Immunol.
21,
1997-2004[Medline]
[Order article via Infotrieve]
|
| 38.
|
Chen, W.,
Yewdell, J. W.,
Levine, R. L.,
and Bennink, J. R.
(1999)
J. Exp. Med.
189,
1757-1764[Abstract/Free Full Text]
|
| 39.
|
Kozlowski, S.,
Takeshita, T.,
Boehncke, W. H.,
Takahashi, H.,
Boyd, L. F.,
Germain, R. N.,
Berzofsky, J. A.,
and Margulies, D. H.
(1991)
Nature
349,
74-77[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Takahashi, H.,
Cohen, J.,
Hosmalin, A.,
Cease, K. B.,
Houghten, R.,
Cornette, J. L.,
DeLisi, C.,
Moss, B.,
Germain, R. N.,
and Berzofsky, J. A.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
3105-3109[Abstract/Free Full Text]
|
| 41.
|
Kozlowski, S.,
Corr, M.,
Takeshita, T.,
Boyd, L. F.,
Pendleton, C. D.,
Germain, R. N.,
Berzofsky, J. A.,
and Margulies, D. H.
(1992)
J. Exp. Med.
175,
1417-1422[Abstract/Free Full Text]
|
| 42.
|
Takeshita, T.,
Takahashi, H.,
Kozlowski, S.,
Ahlers, J. D.,
Pendleton, C. D.,
Moore, R. L.,
Nakagawa, Y.,
Yokomuro, K.,
Fox, B. S.,
Margulies, D. H.,
et al..
(1995)
J. Immunol.
154,
1973-1986[Abstract]
|
| 43.
|
Johnsson, B.,
Lofas, S.,
and Lindquist, G.
(1991)
Anal. Biochem.
198,
268-277[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Ashwell, J. D.,
Cunningham, R. E.,
Noguchi, P. D.,
and Hernandez, D.
(1987)
J. Exp. Med.
165,
173-194[Abstract/Free Full Text]
|
| 45.
|
Li, H.,
Natarajan, K.,
Malchiodi, E. L.,
Margulies, D. H.,
and Mariuzza, R. A.
(1998)
J. Mol. Biol.
283,
179-191[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Fukazawa, T.,
Hermann, E.,
Edidin, M.,
Wen, J.,
Huang, F.,
Kellner, H.,
Floege, J.,
Farahmandian, D.,
Williams, K. M.,
and Yu, D. T.
(1994)
J. Immunol.
153,
3543-3550[Abstract]
|
| 47.
|
Achour, A.,
Persson, K.,
Harris, R. A.,
Sundback, J.,
Sentman, C. L.,
Lindqvist, Y.,
Schneider, G.,
and Karre, K.
(1998)
Immunity
9,
199-208[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Tormo, J.,
Natarajan, K.,
Margulies, D. H.,
and Mariuzza, R. A.
(1999)
Nature
402,
623-631[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Shields, M. J.,
Hodgson, W.,
and Ribaudo, R. K.
(1999)
Mol. Immunol.
36,
561-573[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Garboczi, D. N.,
Madden, D. R.,
and Wiley, D. C.
(1994)
J. Mol. Biol.
239,
581-587[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Ljunggren, H. G.,
Stam, N. J.,
Ohlen, C.,
Neefjes, J. J.,
Hoglund, P.,
Heemels, M. T.,
Bastin, J.,
Schumacher, T. N.,
Townsend, A.,
Karre, K.,
et al..
(1990)
Nature
346,
476-480[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Abastado, J. P.,
Casrouge, A.,
and Kourilsky, P.
(1993)
J. Immunol.
151,
3569-3575[Abstract]
|
| 53.
|
Noun, G.,
Reboul, M.,
Abastado, J. P.,
Jaulin, C.,
Kourilsky, P.,
and Pla, M.
(1996)
J. Immunol.
157,
2455-2461[Abstract]
|
| 54.
|
Anderson, K. S.,
Alexander, J.,
Wei, M.,
and Cresswell, P.
(1993)
J. Immunol.
151,
3407-3419[Abstract]
|
| 55.
|
Smith, M. H.,
and Barber, B. H.
(1990)
Mol. Immunol.
27,
169-180[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Elliott, T.
(1991)
Immunol. Today
12,
386-388[CrossRef][Medline]
[Order article via Infotrieve]
|
| 57.
|
Ribaudo, R. K.,
and Margulies, D. H.
(1992)
J. Immunol.
149,
2935-2944[Abstract]
|
| 58.
|
Wang, J.,
Whitman, M. C.,
Natarajan, K.,
Tormo, J.,
Mariuzza, R. A.,
and Margulies, D. H.
(2002)
J. Biol. Chem.
277,
1433-1442[Abstract/Free Full Text]
|
| 59.
|
Michaelsson, J.,
Achour, A.,
Rolle, A.,
and Karre, K.
(2001)
J. Immunol.
166,
7327-7334[Abstract/Free Full Text]
|
| 60.
|
Glick, M.,
Price, D. A.,
Vuidepot, A. L.,
Andersen, T. B.,
Hutchinson, S. L.,
Laugel, B.,
Sewell, A. K.,
Boulter, J. M.,
Dunbar, P. R.,
Cerundolo, V.,
Oxenius, A.,
Bell, J. I.,
Richards, W. G.,
and Jakobsen, B. K.
(2002)
J. Biol. Chem.
277,
20840-20846[Abstract/Free Full Text]
|
| 61.
|
Rock, K. L.,
Gamble, S.,
Rothstein, L.,
Gramm, C.,
and Benacerraf, B.
(1991)
Cell
65,
611-620[CrossRef][Medline]
[Order article via Infotrieve]
|
| 62.
|
Smith, J. D.,
Lie, W. R.,
Gorka, J.,
Myers, N. B.,
and Hansen, T. H.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
7767-7771[Abstract/Free Full Text]
|
| 63.
|
Vitiello, A.,
Potter, T. A.,
and Sherman, L. A.
(1990)
Science
250,
1423-1426[Abstract/Free Full Text]
|
| 64.
|
Rock, K. L.,
Rothstein, L. E.,
Gamble, S. R.,
and Benacerraf, B.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
7517-7521[Abstract/Free Full Text]
|
| 65.
|
Kane, K. P.,
Sherman, L. A.,
and Mescher, M. F.
(1991)
Eur. J. Immunol.
21,
2289-2292[Medline]
[Order article via Infotrieve]
|
| 66.
|
Sherman, L. A.,
Burke, T. A.,
and Biggs, J. A.
(1992)
J. Exp. Med.
175,
1221-1226[Abstract/Free Full Text]
|
| 67.
|
Falo, L. D., Jr.,
Colarusso, L. J.,
Benacerraf, B.,
and Rock, K. L.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
8347-8350[Abstract/Free Full Text]
|
| 68.
|
Kozlowski, S.,
Corr, M.,
Shirai, M.,
Boyd, L. F.,
Pendleton, C. D.,
Berzofsky, J. A.,
and Margulies, D. H.
(1993)
J. Immunol.
151,
4033-4044[Abstract]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Md. I. Hassan, A. Waheed, S. Yadav, T. P. Singh, and F. Ahmad
Zinc {alpha}2-Glycoprotein: A Multidisciplinary Protein
Mol. Cancer Res.,
June 1, 2008;
6(6):
892 - 906.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-M. Tsimberidou, H. M. Kantarjian, S. Wen, S. O'Brien, J. Cortes, W. G. Wierda, C. Koller, S. Pierce, M. Brandt, E. J. Freireich, et al.
The Prognostic Significance of Serum {beta}2 Microglobulin Levels in Acute Myeloid Leukemia and Prognostic Scores Predicting Survival: Analysis of 1,180 Patients
Clin. Cancer Res.,
February 1, 2008;
14(3):
721 - 730.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-C. Chang, T. Ogino, D. W. Mullins, J. L. Oliver, G. V. Yamshchikov, N. Bandoh, C. L. Slingluff Jr., and S. Ferrone
Defective Human Leukocyte Antigen Class I-associated Antigen Presentation Caused by a Novel beta2-Microglobulin Loss-of-function in Melanoma Cells
J. Biol. Chem.,
July 7, 2006;
281(27):
18763 - 18773.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Duprat, M.-P. Lefranc, and O. Gascuel
A simple method to predict protein-binding from aligned sequences--application to MHC superfamily and {beta}2-microglobulin
Bioinformatics,
February 15, 2006;
22(4):
453 - 459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. A. York, E. P. Grant, A. M. Dahl, and K. L. Rock
A Mutant Cell with a Novel Defect in MHC Class I Quality Control
J. Immunol.,
June 1, 2005;
174(11):
6839 - 6846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. H. Borysik, S. E. Radford, and A. E. Ashcroft
Co-populated Conformational Ensembles of {beta}2-Microglobulin Uncovered Quantitatively by Electrospray Ionization Mass Spectrometry
J. Biol. Chem.,
June 25, 2004;
279(26):
27069 - 27077.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|