|
Originally published In Press as doi:10.1074/jbc.M209827200 on December 6, 2002
J. Biol. Chem., Vol. 278, Issue 8, 6093-6100, February 21, 2003
Mcm1 Binds Replication Origins*
Victoria K.
Chang ,
Michael J.
Fitch§¶,
Justin J.
Donato§ ,
Tim W.
Christensen§,
A. Margaret
Merchant§, and
Bik K.
Tye**
From the Department of Molecular Biology and Genetics, Cornell
University, Ithaca, New York 14853-2703 and the
Department of Chemistry, Drew University,
Madison, New Jersey 07940
Received for publication, September 25, 2002, and in revised form, November 13, 2002
 |
ABSTRACT |
Mcm1 is an essential protein required for the
efficient replication of minichromosomes and the transcriptional
regulation of early cell cycle genes in Saccharomyces
cerevisiae. In this study, we report that Mcm1 is an abundant
protein that associates globally with chromatin in a punctate pattern.
We show that Mcm1 is localized at replication origins and plays an
important role in the initiation of DNA synthesis at a chromosomal
replication origin in vivo. Using purified Mcm1 protein, we
show that Mcm1 binds cooperatively to multiple sites at autonomously
replicating sequences. These results suggest that, in addition to its
role as a transcription factor for the expression of replication genes, Mcm1 may influence the local structure of replication origins by direct binding.
 |
INTRODUCTION |
The mechanism for the initiation of DNA synthesis is fundamental
to all eukaryotes. The protein factors involved in this process and the
sequence of events that lead to the initiation of DNA synthesis are
highly conserved (1, 2). However, the criteria for site selection
appear to differ dramatically among eukaryotes (3). At the one extreme,
Saccharomyces cerevisiae initiates DNA synthesis from
defined DNA segments known as autonomously replicating sequences
(ARSs)1 of about 100-200 bp
(4). At the other extreme, any random DNA segment is a potential site
for initiation in Xenopus oocytes (5). The unifying common
denominators that define all replication origins are unknown. Although
the entire repertoire of replication origins in the yeast genome has
been mapped (6, 7), researchers have yet to come up with an algorithm
that independently identifies replication origins.
Replication origins in S. cerevisiae were initially
identified as DNA sequences known as ARSs which support the autonomous replication of recipient plasmids (8, 9). ARSs are modular in
structure, containing sequence elements that are interchangeable between certain ARSs (10, 11). They share an essential 11-bp AT-rich
sequence known as the ARS consensus sequence or ACS, which requires the
presence of other auxiliary elements to function (4). An auxiliary
element B2/DUE/ATR shared by all ARSs is located 3' of the T-rich
strand of the ACS (12). Another element frequently associated with ARSs
is the B3 element. The ACS is the binding sequence for the origin
recognition complex, which serves as the launching pad for the
assembly of the prereplication complex (pre-RC) (13). The B2 element is
an AT-rich sequence that serves as the site for the initial unwinding
of origin DNA and the incorporation of the first nucleotides (14). The
B3 element is a 12-bp degenerate sequence which Abf1 binds. Abf1 is a
transcription factor that stimulates the activity of certain ARSs (10,
15). Although ARSs have modular structures, not all ARSs have the same
modules or arrangement of modules. For example, the replication
enhancer sequence REN but not B3 stimulates the activity of ARS1501
independent of orientation or spacing with respect to the ACS (16). The
B3 element is present in two copies in ARS121 and ARS1501, one copy in
ARS1, and not at all in ARS307. Some ARSs, such as ARS1 (10) and ARS307
(17), contain a single ACS, whereas others, such as ARS121 (15),
ARS110, and ASR310 (18), contain repetitive ACSs. Because only a couple of modules are obligate components, and others are auxiliary
components, there would be many ways to assemble combinations of
modules into a functional unit. Thus, although ARSs are modular in
structure they share little sequence homology. It is becoming
increasingly clear that ARSs that function in the context of a plasmid
may only be part of a larger structure that must be preserved for regulation or efficient function in its native environment (18-20). Therefore, analysis of extended sequences of an ARS is important for
identifying new elements of chromosomal replication origins.
In an attempt to identify common denominators for site selection,
researchers have shifted their emphasis from sequence analysis to the
characterization of factors that bind replication origins (2). Among
the common factors recruited to and involved in the establishment of
pre-RCs (origin recognition complex, Mcm2-7 helicase, Cdc6, and Cdt1),
only the origin recognition complex has been shown to bind specifically
origin DNA. Thus, the identification of additional factors that can
bind to and/or facilitate the assembly of pre-RCs at replication
origins may pave the way toward a broader definition of replication
initiation sites for all eukaryotes. For this reason, S. cerevisiae remains the best model for identifying factors that
bind replication origins because of its well characterized replication
origins and amenable genetics.
Mcm1 was identified initially as a factor required for the stable
maintenance of minichromosomes in S. cerevisiae (21). Because of its role as a general transcription factor that regulates diverse genes including the cell cycle expression of a number of
replication initiation factors, it is generally believed to play an
indirect role in replication initiation (22). Among the genes regulated
by Mcm1 are genes that encode critical components of the pre-RC such as
CDC6, MCM3, MCM5, MCM6, and
MCM7 (23, 24). Mcm1 is the founding member of a family of
combinatorial transcription factors known as the MADS box proteins
(25). MADS proteins interact with multiple cofactors to regulate
diverse genes by binding cooperatively with their cofactors to their
combinatorial cognate sequences. The mechanisms by which Mcm1 regulates
the expression of different genes vary widely. It may act as a positive regulator that recruits transcription activation machinery (26) or as a
negative regulator that recruits repression complexes (27). It is also
believed to play a role in positioning nucleosomes (28) or interfering
with nucleosome assembly (29). The crystal structure of the
Mcm1· 2·DNA ternary complex has been solved (30). Like
other MADS box proteins, Mcm1 dimers bind a 10-bp consensus sequence
CC(AT)6GG interacting symmetrically with each half of the
binding site to form a bent DNA structure (31, 32). Direct and indirect
DNA binding assays suggest that a conserved 5'-ATTAGG in one half of
the dyad symmetry element is important for Mcm1 binding, whereas
variants in the other half are tolerated, conferring versatility to
Mcm1 sequence recognition (33).
In this study, we show that Mcm1 is a sequence-specific DNA-binding
protein that imparts a global presence on chromatin. Chromatin immunoprecipitation experiments reveal that Mcm1 is localized at ARSs
in vivo. In vitro footprinting analysis shows
that Mcm1 binds and induces DNase I hypersensitivity in the immediate
vicinity of the minimal ARS domain, suggesting that Mcm1 may play a
direct role in organizing the local structure of chromosomal
replication origins.
 |
MATERIALS AND METHODS |
Strains and Plasmids--
Plasmids used in this study were
YCp101 (ARS1 CEN5), YCpAB121 (ARS121 CEN3), YCpHML (ARSHML CEN5),
YCpH2B (ARSH2B CEN5), YCpHO (ARSHO CEN5), and YCp131a (ARS131a CEN5).
Vectors used for subcloning ARS restriction fragments were pLC5 (LEU2
CEN5) and YCp56 (URA3 CEN5), which are both pBR322-based plasmids
containing the mp18 polylinker inserted between the HindIII
and RI sites.
Yeast strain 8534-8C (MAT his3 34 leu2-3,-112
ura3-52) and an isogenic mcm1-1 mutant made by gene
transplacement (34) were used in two-dimensional agarose gel analysis.
Yeast strains 8534-8C and RM9-3A (MAT ura3-52 leu2-3,-112
his3-11,-15 mcm1-1) were used in plasmid stability assays.
Escherichia coli strain BL21(DE3) was used as a host strain
from which the GST-Mcm1 fusion protein was purified. MJF190
(MATa ura3-52 lys2-801 ade2-101 leu2-D1 his3-D200
trp1-D63 MCM1-13MYC) was used for immunofluorescence microscopy
and chromatin immunoprecipitation (chIP).
Oligonucleotide List--
All oligonucleotides used in this
study were purchased from Invitrogen or the Cornell University
BioResource Center (Ithaca, NY). The following PCR primer pairs were
used to amplify ARS fragments for mobility shift and DNase I
footprinting experiments: for ARS121 fragment I, ars121( 446)
(5'-gagataatacgcacgtgatgaaat-3') and ars121( 142R)
(5'-ccgccgaaatgggtaataa-3']); for ARS121 fragment II, ars121( 269)
(5'-tagccttatgtgttggtttg-3') and ars121(+78R) (5'-atttctattttctgctattcatc-3'); for ARS121 fragment III, ars121(+46) (5'atatattttggatgaatagcaga-3') and ars121(+433R)
(5'-aatagtcacgtgatctcttttag-3'); for ARS1 fragment I, ars1bot
(5'-ttgcggtgaaatggtaaaagtc-3') and ars1top
(5'-atggcgttattggtgttgatgta-3'); for ARS1 fragment II, ars1footupbot
(5'-tcttagcatttttgacgaaatttgct-3') and ars1footuptop (5'-ggtgggacaggtgaacttttgg-3'); for ARS307 fragment I, ars307( 335) (5'-attatatcgatttcttttg-3') and ars307(+50rev)
(5'-tctcttctttattttctgc-3'); and for ARS307 fragment II, ars307( 35)
(5'-tcgggcgtgaatgtgtc-3') and ars307(+245rev)
(5'-tcgaagaaatgccagtgatg-3').
The following PCR primers pairs were used in chIP experiments. The
nucleotide sequences of those primers mentioned above are not listed
here: for ARS121 fragment II, ars121( 269) and ars121(+78R); for ARS1
fragment I, ars1bot and ars1top; for ARS305, ars305-1 (5'-ctccgtttttagccccccgtg-3') and ars305-2
(5'-gattgaggccacagcaagaccg-3'); for ARS307 fragment II, ars307( 35)
and ars307(+245rev); for CDC6 promoter, cdc6topmultiplex
(5'-cgacgcgggtaagccaagac-3') and CDC6botmultiplex (5'-tgcagccaactcaatttcctaag-3'); and for the ATP11 gene, atp11bot (5'-tggagctgcttctacgactactga-3') and atp11top (5'-aggggcagcggttgtgag-3').
Minichromosome Maintenance Assays--
Minichromosomes were
transformed into yeast using the lithium acetate method (35).
Minichromosome stability assays were performed on a minimum of three
independent transformants at room temperature as described previously
(36). Standard deviation from the mean value of three samples is less
than 10%.
Two-dimensional Gel Electrophoresis--
Procedures for
two-dimensional gel electrophoresis analysis of replicating DNA have
been described by Brewer and Fangman (37). For the study of
ORI1, actively replicating DNA was prepared from isogenic wild
type and mcm1-1 mutant strains. The probes for detecting ORI1 were prepared from ARS1 plasmid DNA digested with NcoI,
gel purified, and 32P-labeled by random oligonucleotide
priming (38).
Yeast Chromatin Spreads--
Yeast chromatin spreads were
performed on a yeast strain containing 13Myc::Mcm1 as
described previously (39) except that 1.5% paraformaldehyde rather
than 3% was used in the spread. Primary antibodies used were rabbit
anti-H2B and mouse anti-Myc (Covance) as described previously (40).
Secondary antibodies used are anti-mouse Oregon Green and anti-rabbit
Texas Red (Molecular Probes). DNA is stained with DAPI.
Chromatin Immunoprecipitation--
Chromatin IP experiments were
performed using formaldehyde cross-linking as described by Hecht
et al. (41) with minor modifications. Affinity-purified
Mcm7, Mcm1-Myc, and HA antibodies were used to immunoprecipitate
chromatin cross-linked complexes. Individual PCRs were carried out with
selected primer pairs and 5 µCi of [ 32P]dATP in the
following conditions: 2 cycles (94 °C, 2 min; 96 °C, 1 min;
54 °C, 4 min), 24 cycles (94 °C, 1 min; 54 °C, 1.5 min), and 1 cycle (70 °C, 5 min). PCR for the chIP was performed in a multiplex
reaction with the ATP11 primers included in the CDC6, ARS1,
and ARS305 reactions. All three primer pairs were added in the same
reaction for the chIP of ARS121 and ARS307.
Purification of GST-Mcm1 Fusion Protein--
GST-Mcm1 fusion
protein was expressed in E. coli strain BL21(DE3) pLysS and
purified as described (36). Eluted samples were dialyzed overnight
against buffer 1 (20 mM HEPES pH 7.5, 1 mM CaCl2, 1 mM dithiothreitol, 50 µM
zinc acetate, 10% glycerol, 60 mM NaCl, 0.1 mg/ml bovine
serum albumin, 7 mM MgCl2, 1 mM
EDTA). The purity of GST-Mcm1 fusion protein was verified on 8%
SDS-PAGE and stored frozen at 80 °C.
Radioactive Labeling of DNA Fragments by PCR--
PCR primers
were labeled by incubating 50 pmol of primer, 30 µCi of
[ -32P]ATP, and 10 units of T4 polynucleotide kinase
for 15 min at 37 °C. The reactions were stopped at 65 °C for 10 min, ethanol precipitated, and resuspended in water. The complementary
primer, dNTPs, Taq polymerase, 10 ng of DNA template, 10×
PCR buffer, and MgCl2 were added. PCR amplification was
carried out for 35 cycles. ARS121, ARS1, and ARS307 primers used for
mobility shift and DNase I footprinting experiments are listed above.
Mobility Shift Experiments--
Purified proteins were mixed
with radioactively labeled DNA (~100 fmol) in buffer 1 to a final
volume of 20 µl. 500 ng of poly(dI·dC) was added to each reaction
and incubated at room temperature for 20 min prior to gel
electrophoresis (5-6% TBE, 5% glycerol PAGE). Gels were dried onto
3MM paper and either exposed to film or PhosphorImager screen. Specific
competitor DNA used is
actaatttacccagaaaggaaatttccttataaggaaaataaatgcaattcattaagtcg. Nonspecific competitor DNA used is tcgacacgcgcgcgtgattacaaagacgatgacgataagctagccgcgcgtg.
DNase I Footprinting--
DNase I footprinting was performed as
described for mobility shift reactions. A precalibrated amount of DNase
I (Sigma) was added in a volume of 0.01 ml for 1 min at room
temperature. The reaction was stopped by precipitation in a mixture of
ethanol, 0.3 M sodium acetate, and 1 µg of linear
acrylamide. The precipitate was washed with 70% ethanol, dried, and
resuspended in formamide buffer before loaded onto a 6 M
urea, 6% polyacrylamide sequencing gel. DNA sequencing reactions were
performed using the dsDNA cycle sequencing system (Invitrogen).
 |
RESULTS |
Mcm1 Is Essential for Efficient Plasmid Replication and Initiation
of DNA Synthesis at a Chromosomal Replication Origin--
The first
clue that the Mcm1 protein is essential for the efficient replication
of ARSs comes from the ARS-specific minichromosome maintenance defect
of the mcm1-1 mutant (42). Using the plasmid stability assay
that measures ARS activity, representative ARSs were tested (complete
list not shown). These include single copy ARSs (ARS121, ARS1),
moderately repetitive ARSs (ARSTel131a) (43), early firing
(ARS121, ARS1), and late firing ARSs (6) located either at the silent
mating type locus (ARSHML) (19) or telomere (ARSTel131a) (44). Compared
with their activity in wild type cells, these six representative ARSs
replicate much less efficiently in the mcm1-1 mutant (Fig.
1A). Plasmids bearing these
ARSs are lost at a rate of 1-5%/cell division in wild type strain and
14-23%/cell division in the mcm1-1 mutant. Thus, the Mcm1
protein is required for the efficient initiation at ARSs. Because the
mcm1-1 mutation affects the activity of ARSs that differ in
chromosomal location, copy number, and temporal order of replication
during S phase, this observation suggests that Mcm1 may operate through
a common mechanism of action at different types of ARSs.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 1.
Mcm1 is required for efficient
replication. Replication activity is measured by plasmid stability
and two-dimensional gels in wild type (WT) and
mcm1-1 mutant yeast strains. A, ARS activity
assayed by plasmid stability in wild type 8534-8C and mcm1-1
mutant. A variety of ARS fragments were tested including the single
copy ARS121, ARS1, ARSHML, ARSH2B, and ARSHO and the moderately
repetitive subtelomeric X-ARSTel131a. For each ARS type, at least three
independent transformants were grown in nonselective medium for 8-10
generations. B, origin initiation assayed by two-dimensional
gel. Autoradiograms of replicating DNA prepared from isogenic wild type
and mcm1-1 mutant strains are shown, separated by
two-dimensional gel electrophoresis. For ARS1, DNA was digested with
NcoI and probed with the 5-kb
NcoI-NcoI fragment. The direction of
electrophoresis was left to right for the first dimension and top to
bottom for the second dimension. The solid arrow points to
"bubble" arcs; the hollow arrow points to Y arcs.
|
|
To show that the requirement of Mcm1 for replication initiation also
applies to chromosomal origins, initiation bubbles generated de
novo from ORI1, which corresponds to ARS1, were analyzed by two-dimensional gel (Fig. 1B). Robust initiation activity is
observed at ORI1 in the wild type strain, but this activity is greatly reduced in the mcm1-1 mutant as indicated by increased
passive replication through the ORI1 region (strong "Y" arc intensity).
Mcm1 Is an Abundant Chromatin-associated Protein--
Because the
mcm1-1 mutation was isolated from a mutant screen that also
identified several members of the pre-RC (Mcm2-Mcm7, Mcm10), we
investigated the possibility that Mcm1 may be directly involved in DNA
replication separate from its role as a transcription factor. As a
general transcription regulatory factor and a sequence-specific DNA-binding protein, Mcm1 is expected to be associated with chromatin in modest abundance.
The distribution of Mcm1 on chromatin was visualized by
immunofluorescence microscopy of chromatin spreads of G1
phase cells in which the endogenous MCM1 gene has been
replaced by MCM1-Myc and probed with either anti-Myc or
anti-H2B antibodies (Fig. 2). Mcm1 is
localized in more than 500 foci distributed throughout the genome to
give a global punctate pattern similar to that observed for histone
H2B. A general comparison and overlay of these staining patterns
suggest that the abundance of Mcm1, in terms of the number of intensely
stained foci, may be similar to histone H2B protein. However, Mcm1 does
not colocalize with histone H2B. Considering that Mcm1 is a
sequence-specific DNA-binding protein whereas histones interact with
DNA in a sequence-nonspecific manner, the similarities in abundance and
genomewide distribution of these two proteins were unexpected.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 2.
Mcm1 is an abundant
chromatin-associated protein. Micrographs of 13Myc::Mcm1
and histone H2B protein localization in effectively spread yeast
chromatin are shown. The 13Myc::Mcm1 cells were arrested in
G1 phase with factor, stained with DAPI (A),
and probed with anti-Myc (Mcm1) (B) or anti-H2B
(C) antibodies. The overlay of Mcm1 with DAPI staining
(D) and histone H2B staining (E) shows imperfect
colocalization of Mcm1 and H2B.
|
|
Mcm1 Is Specifically Localized to Replication Origins in
Vivo--
Mcm1 appears to be a highly abundant protein that has a
global presence on chromatin. To investigate whether Mcm1
specifically binds replication origins in vivo, we
carried out chromatin immunoprecipitation experiments (Fig.
3A). Mcm1·DNA complexes
cross-linked by formaldehyde were precipitated with anti-Mcm1
(anti-Myc) antibodies (Fig. 3A, lane 3). Specific
PCR primer pairs were used to amplify four well characterized
chromosomal replication origins corresponding to ARS1, ARS121, ARS305,
and ARS307. Each primer pair was designed to amplify a 200-400-bp
region encompassing the essential ACS and the surrounding flanking
region. Also amplified were the CDC6 promoter and the
ATP11 gene to use as a positive or negative control for
cross-linking. In addition, antibodies specific to Mcm7 (lane 2) and HA (lane 1) were used as positive or negative
controls, respectively, for immunoprecipitation.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 3.
Mcm1 binds chromosomal replication origins
in vivo. Chromatin IP experiments show in
vivo cross-linking of Mcm1 to single copy chromosomal replication
origins ARS121, ARS305, ARS1, and ARS307. A, mid-log phase
cells (YPH499-Mcm1myc) were cross-linked with 1% formaldehyde. Cell
extracts were immunoprecipitated with anti-Myc (Mcm1), anti-Mcm7
(positive control), or anti-HA (negative control). Specific PCR primers
to ARS1, ARS305, ARS121, ARS307, CDC6, and ATP11
were used to analyze the in vivo binding of Mcm1.
Lanes 1-3 show cross-linking with anti-HA, anti-Mcm7, and
anti-Myc (Mcm1) antibodies, respectively. Lanes 4 and
5 show decreasing amounts of input DNA with no
cross-linking. B, the numerical value shown is the intensity
ratio of the ARS signal relative to the ATP11 signal
(negative control) normalized against that of the input DNA.
|
|
When Mcm1 (or Mcm7) DNA complexes were immunoprecipitated, ARS121 and
CDC6 were specifically amplified to give a strong signal (Fig. 3B). Because Mcm1 and Mcm7 have been shown to bind
cooperatively to the promoter of
CDC6,2
amplification of CDC6 from anti-Mcm1 and anti-Mcm7
immunoprecipitation serves as a positive control. These signals were
normalized against that obtained from the immunoprecipitates of the HA
antibody. ARS305, ARS307, and ARS1 were also specifically amplified
though not as strongly as ARS121 or CDC6 (Fig.
3B). Within the resolution of the chIP experimental
approach, both Mcm7, a known component of the pre-RC (45), and Mcm1
appear to be localized in close proximity to replication origins.
Because Mcm1 has specific DNA binding properties that the Mcm2-7
complex lacks, we sought to determine which cis-acting
sequences are responsible for the binding of Mcm1 to replication
origins in vivo.
Mcm1 Binds Specific Sequences at ARSs--
To investigate where
Mcm1 binds at ARSs, we purified an E. coli-expressed
GST-Mcm1 fusion protein (Fig.
4A) and carried
out DNA binding assays on ARS121, ARS1, and ARS307. For each ARS, we
designed PCR primer pairs that produced two or three overlapping 200-400-bp DNA fragments that encompass a 989-bp region of ARS121 (Fig. 4B), a 420-bp region of ARS1 (Fig. 4C), and
a 580-bp region of ARS307 (Fig. 4D). Increasing amounts of
Mcm1 protein were incubated with ARS121 fragments I-III, ARS1
fragments I and II, or ARS307 fragments I and II in the presence of
carrier DNA.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
Mcm1 binds several ARSs in
vitro. A, Gelcode Blue-stained
SDS-polyacrylamide gel of purified, E. coli-expressed
GST-Mcm1 (4 µg, lane 1) and molecular weight markers
(lane 2) are shown. B-D, purified E. coli GST-Mcm1 protein was incubated with radiolabeled fragments of
ARS121, ARS1, and ARS307 followed by PAGE. B, Mcm1 binds
specifically to three distinct regions of ARS121: the central 347-bp
fragment II containing the ACS, ATR, and proximal B3 element
(lanes 6-12); the 304-bp fragment I containing a distal B3
element and the 5'-flanking domain C (lanes 1-5); and the
387-bp fragment III containing the ATR element and the 3'-flanking
domain B (lanes 13-17). Lanes 2-5,
7-12, and 14-17 have increasing amounts of
purified Mcm1 (serially diluted 1:3, with 10.8 pmol in lanes
5, 12, and 17); no Mcm1 was added in
lanes 1, 6, and 13. C, Mcm1
binds specifically to two regions of ARS1: the central 300-bp fragment I containing ACS,
B1, B2, and B3 elements (lanes 1-5) and the 3'-flanking
120-bp fragment II containing domain B (lanes 6-10).
Lanes 2-5 and 7-10 have increasing amounts of
purified Mcm1 (serially diluted 1:3, with 32.4 pmol in lanes
5 and 10); no Mcm1 was added in lanes 1 and
6. D, Mcm1 binds specifically to two regions of
ARS307: fragment I (lanes 1-3) and fragment II containing
ACS, B1, and B2 elements (lanes 4-8). Lanes 2 and 3 and 5-8 have increasing amounts of
purified Mcm1; lanes 3 and 8, 21.6 pmol;
lanes 2 and 7, 10.8 pmol; lane 6, 3.6 pmol; lane 5, 1.2 pmol; no Mcm1 was added in lanes
1 and 4. The higher molecular weight complexes are
indicated by a bracket. The cis-acting DNA
sequence elements important in ARS function are shown in a schematic
diagram above each of the Mcm1·DNA binding experiments: essential ACS
element (box A), A-T-rich region (box ATR), and
auxiliary elements (boxes B1, B2, and
B3). Naked free DNA or mobility-shifted Mcm1·DNA complexes
are labeled with arrows.
|
|
Mcm1 binds strongly to fragment II of ARS121, which contains the
proximal B3, ACS, and ATR, and fragment III (domain B), which contains
the ATR and adjacent 3'-flanking sequence (Fig. 4B). The
binding of fragment II appears to be cooperative, showing an all or
none binding pattern within a 3-fold difference in concentration (compare lanes 10 and 11). In comparison to
ARS121, Mcm1p binds weakly to both fragment I and fragment II of ARS1,
requiring almost 10 times as much Mcm1p to produce a total shift of the
same mole equivalent of DNA (Fig. 4C, 32.4 pmol, lanes
5 and 10 and Fig. 4B, 3.6 pmol, lane
11). At low concentrations of Mcm1 (Fig. 4C, lanes 3 and 4, 8 and 9), a
prominent species of Mcm1p·DNA complex is evident. But at
higher concentrations (lanes 5 and 10)
Mcm1p·DNA complexes of higher molecular weight and heterogeneous
mobility are formed (indicated by a bracket). Mcm1p also
binds cooperatively to ARS307 (Fig. 4D, lanes 6 and 7). Mcm1p binds fragment II, which contains the ACS, B1,
and B2 elements but lacks the B3 element, to form a complex of uniform
mobility at low concentrations (lanes 5 and 6)
but complexes of heterogeneous mobility at higher concentrations (lanes 7 and 8). In all, the binding of Mcm1 to
these ARS DNA fragments appears to be specific,
concentration-dependent, and highly cooperative.
Furthermore, Mcm1p binds different ARSs with different affinities.
Mcm1 Binds Cooperatively to Multiple Sites at ARS121--
To
confirm that binding of Mcm1 is sequence-specific and to determine the
exact nucleotide sequence that is recognized we performed in
vitro DNase I footprinting analysis on each of the ARS fragments.
Purified Mcm1 was incubated with different ARS fragments from ARS121,
treated with DNase I nuclease, and run on a denaturing gel to visualize
the DNase I protection patterns (Fig.
5).

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 5.
Mcm1 binds specific sequences in ARS121.
Mcm1 binds to multiple sites between the essential ACS and auxiliary B3
element in ARS121. A, footprint of the Watson strand of
fragment II of ARS121. a, Mcm1 protects four closely spaced
MCE sites I-IV separated by hypersensitive residues. b, the
DNase I protection patterns of the four Mcm1 sites are shown in
expanded scale. Lanes 1-6 contain decreasing amounts of
purified Mcm1 at 43.2, 21.6, 10.8, 3.6, 1.2, and 0.4 pmol,
respectively; no Mcm1 was added in lane 7. The DNA
sequencing reactions are loaded in lanes marked
G, A, T, and C. Bold
lines, Mcm1-protected sites; rectangle, ACS; thin
lines, B3 elements; and *, DNase I hypersensitive sites.
B, footprint of the Crick strand of fragment II of ARS121.
Lanes 1-4 contain decreasing amounts of purified Mcm1 at
43.2, 21.6, 10.8, and 3.6 pmol, respectively; no Mcm1 was added in
lane 5. The DNA sequencing reactions are loaded in
lanes marked G, A, T, and
C. C, nucleotide sequence of the Mcm1-protected
sites and hypersensitive residues in ARS121. ARS121 DNA sequence (489 bases) includes the ACS (box), ATR (dashed box),
and two B3 (italics) elements. The DNase I protection
pattern (lines) and hypersensitive residues
(circles) are indicated above and below the DNA sequence.
Full or half-MCE sites are marked in shaded boxes. The four
adjacent Mcm1-protected sites that coincide with Mcm1 consensus
elements are labeled as MCE I-MCE IV.
|
|
Protection of multiple sites in the central region of ARS121 between
the B3 element and the essential ACS by Mcm1 is evident on both strands
of fragment II (Fig. 5, A and B). There are at least eight protected sites on this DNA fragment, some corresponding to
full Mcm1 consensus elements (MCEs) and others not (Fig.
5C). Two of these protected sites overlap the two B3
elements (Fig. 5A, a). Four adjacent
Mcm1-protected sites, labeled MCE I-IV, are clearly
apparent (Fig. 5A, b). Two of the MCEs, I and
III, are more strongly protected than MCE sites II and IV (Fig.
5A, b; compare lanes 1 and
2). Furthermore, protection of sites I and III precedes that
of the other sites as the amount of Mcm1 increases by 2-fold. Upon Mcm1
binding, there is also increased DNase I hypersensitivity in the
boundary sequences between each of the four MCEs, suggesting distortion
of the Watson-Crick base pairing at these sequences. In the region
extending from MCE sites I-IV toward the ACS and ATR region, increased
DNase I hypersensitivity occurs at a high frequency (Fig. 5,
B and C). Although one or two protected MCEs
appear to be located close to the ACS region, the minimal functional
domain of ARS121 (ACS-ATR) is largely free of Mcm1 protection.
Nucleotide analysis of the DNase I-protected regions show that a
majority of the Mcm1 binding sites resemble the 10-bp MCE, CC(AT)6GG, or the 5-bp half-site. For inspection, these
protected sequences broken down into 15 half-sites were aligned (Fig.
6A). The consensus sequence
from this alignment is C(C/T)(T/A)A(T/A), which is in general agreement
with the MCE half-site. To verify specificity of binding, we compared
the binding affinities of Mcm1 and the mutant Mcm1-1 protein for ARS121
DNA (Fig. 6B). Mcm1-1, which contains a P97L substitution,
is the only known mcm1 mutant that causes a defect in
plasmid replication (21). GST-Mcm1 binds ARS121 DNA efficiently
(lanes 2 and 3), whereas GST-Mcm1-1 binds poorly
(lanes 4 and 5), correlating origin binding with
minichromosome maintenance.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 6.
Binding of Mcm1 to ARS121 DNA is competed by
MCEs. A, alignment of 15 half-sites of Mcm1-protected
sequences at ARS121. The numbers under the consensus denote
the frequency of occurrence of each base among the 15 half-sites.
B, Mcm1-1 is defective in binding to ARS121. 100 fmol of
32P-labeled ARS121 DNA is incubated with Mcm1 at 2 (lane 2) and 4 pmol (lane 3) and Mcm1-1 at 2 (lane 4) and 4 pmol (lane 5). C,
competition binding of ARS121 DNA by specific and nonspecific
competitor DNAs. Mcm1 (lanes 2-8) is added to 100 fmol of
32P-labeled ARS121 DNA in the presence of increasing
concentrations of specific (sp) competitor DNA (lanes
3-5) and nonspecific (nsp) competitor DNA (lanes
6-8). D, competitive binding study of C
plotted as unbound fraction against increasing concentrations of
specific and nonspecific competitor DNA. Values are determined by
PhosphorImaging using ImageQuant.
|
|
A DNA competition experiment was also carried out to verify the binding
specificity of Mcm1 for ARS121 (Fig. 6C). A 60-nucleotide DNA fragment from the MCM7 promoter, which contains two
MCEs, was used as a specific competitor (lanes 3-5), and a
55-nucleotide DNA fragment from a plasmid vector that does not contain
obvious MCE half-sites was used as the nonspecific competitor
(lanes 6-8). The specific competitor competes efficiently
with ARS121 DNA for the binding of Mcm1. At the same concentration as
the ARS121 DNA probe, binding of Mcm1 is about 50% competed, and at 10 times the concentration of the labeled probe almost all Mcm1 binding is
competed (Fig. 6D). Under the same conditions, the
nonspecific competitor has little effect on the binding of Mcm1 to the
ARS121 DNA probe (Fig. 6D).
Mcm1 Binds Cooperatively at Multiple Sites at
ARS1--
Interaction between Mcm1 and ARS1 was also investigated by
DNase I footprinting analysis. In fragment I of ARS1, Mcm1 protects three closely spaced sites in the 3'-flanking region outside the minimal ARS (Fig. 7A,
b). These three sites map to two recognizable MCEs that
overlap a known B3 element. At higher Mcm1 concentrations, protection
in this region occurs with the simultaneous appearance of
hypersensitivity at the boundary between the MCEs and B3 element (Fig.
7A, b, lanes 1 and 2). In
addition, weaker protected and hypersensitive sites are apparent near
the B1 and B2 regions (Fig. 7A, a, lane
1, and 7B). Using other fragments of ARS1 (domain C),
we did not observe sequence-specific binding (data not shown). Instead,
we observed some degree of "white-out" along the entire fragment,
suggesting that the entire region may be protected nonspecifically. These results show that in both ARS121 and ARS1, Mcm1 binds
cooperatively to multiple MCEs outside the minimal functional domain
(ACS-B2/ATR). In addition, Mcm1 appears to footprint MCEs that overlap
the B3 elements in both ARS121 and ARS1.

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 7.
Mcm1 binds specific sequences in ARS1.
A: a, Mcm1 protects closely spaced MCEs that
overlap the B3 element in fragment I of ARS1. Lanes 1-5
contain decreasing amounts of purified Mcm1 diluted 1:3 in each
lane; no Mcm1 was added in lane 6. The expanded
DNase I protection pattern of the two MCEs is shown in b.
Lines, Mcm1-protected sites; *, DNase I hypersensitive
sites; bold lines, MCEs; and thin lines, B3
element. B, nucleotide sequence of the Mcm1-protected sites
and hypersensitive residues in ARS1. This ARS1 DNA sequence (150 bases)
includes the important DNA sequence elements ACS, B1, and B2
(boxes) and B3 (italics). The DNase I protection
pattern (lines) and hypersensitive residues
(circles) are mapped. Full or half-MCE sites are marked in
shaded boxes. The two adjacent Mcm1-protected sites that
coincide with the MCEs are labeled as MCE I and MCE
II.
|
|
 |
DISCUSSION |
Mcm1 was initially identified as a protein essential for the
maintenance of minichromosomes. It was subsequently shown that Mcm1 is
a general transcription factor that regulates diverse genes including
replication genes such as CDC6, MCM3,
MCM5, MCM6, and MCM7 (24). For
this reason, the requirement for Mcm1 in minichromosome maintenance was
attributed to its role in regulating the expression of proteins
essential for replication initiation. However, unlike most general
transcription factors, Mcm1 is essential for viability (21), suggesting
that it may have other essential functions. In this study, we show that
Mcm1 is required not only for plasmid replication but also for the
initiation of replication at a chromosomal replication origin. Mcm1 is
an abundant chromatin-associated protein whose global presence on
chromatin can be visualized by immunofluorescence microscopy as
punctate stains similar to those of histone H2B. A genomic search for
the Mcm1 binding motif CCNNNWWRGG derived from known Mcm1 binding sites
at promoters indicates that this motif occurs in 17% of the 6,270 intergenic regions of the S. cerevisiae genome
(web.wi.mit.edu/young/). Keeping in mind that binding motif is not a
predictor of protein binding in vivo and that a search
algorithm does not recognize binding sites that deviate from consensus
sequence (24), an estimate of ~1,000 genomic locations for Mcm1 is
consistent with the distribution of Mcm1 in immunofluorescence
microscopy. We show that Mcm1 is localized to replication origins
in vivo by chIP. Gel mobility shift and DNase I protection
assays show that Mcm1 binds to specific DNA sequences in all ARSs
tested. A mutation in Mcm1 that is defective in minichromosome
replication is also defective in binding to ARS DNA. These results
together suggest that Mcm1 plays a direct role in DNA replication by
binding to replication origins.
For the three ARSs studied, Mcm1 binds strongly to ARS121, less
strongly to ARS307, and weakly to ARS1. A comparison of the Mcm1
protection patterns of these ARSs is shown in Fig.
8. The location and nucleotide sequences
of the Mcm1 binding sites at these ARSs have a number of common
features yet differ in their overall pattern and frequency. We have
mapped the Mcm1 binding sites to specific nucleotide sequences. Mcm1
protects about 11 sites in ARS121 (989 bp) and fewer sites in ARS307
(580 bp) and in ARS1 (420 bp). The varied protection patterns of
ARS121, ARS1, and ARS307 suggest that the degree of involvement of Mcm1
at individual ARSs may be quite different. Differential affinities of
Mcm1 to promoters with a varying number of MCEs have also been observed (33, 46). The affinity of Mcm1 to ARS DNA is similar to that reported
for promoter DNA in the absence of a cofactor (33). Involvement of
cofactors that stimulate the binding of Mcm1 to origin DNA in
vivo cannot be ruled out.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 8.
Schematic representation of MCEs and
hypersensitive sites at ARSs. A summary of the DNase I protection
sites and hypersensitive sites produced by Mcm1 and known Abf1 binding
sites are shown for ARS121 (refer to Fig. 5), ARS1 (refer to Fig. 6),
and ARS307 (data not shown). Each ARS is aligned relative to three
domains: domain C (5'-flanking sequences), domain A (5' 3'
orientation of the T-rich strand of ACS), and domain B (3'-flanking
sequences). Relevant ARS sequence elements are labeled as ACS
(box A), B1 (box B1), B2 (box B2) or
A-T-rich (box ATR), and B3 (gray box). The
Mcm1-protected sites are indicated as black boxes and
hypersensitive sites as open circles.
|
|
Most of the Mcm1 binding sites are outside of the ACS, B1, or B2/ATR
elements. Previous studies demonstrated the importance of the B3
element in ARS121 and ARS1 by site-directed mutagenesis (10, 47). In
this study, we show that Mcm1 binds both ARS1 and ARS121 at sites that
overlap each of the B3 elements. Furthermore, the mcm1-1
mutant affects the activity of both ARSs. Although Abf1 has been shown
to bind B3 in vitro, the abf1 mutant only affects
the activity of ARS121 but not ARS1 (48). The apparently contradictory
results for the role of Abf1 at ARS1 could be explained if the
degenerate "B3" element were the collective site of action of
auxiliary factors such as Mcm1 and Abf1 (49, 50), which have relaxed
recognition sequences. Consistent with this hypothesis, the Abf1
consensus motif TCRNNNNNNACG occurs in 24% of intergenic regions
(web.wi.mit.edu/young/). Furthermore, unlike the B1 and B2 elements,
which are strictly associated with the B domain, B3 may be located in
either domain B or domain C of an ARS (Fig. 8).
In ARS121 and ARS1, the Mcm1 protection sites are interspersed with
DNase I hypersensitive sites, suggesting that binding of Mcm1 may
induce bending of DNA. A majority of the protected regions contain
recognizable 10-bp CC(A/T)6GG MCE sites or half-sites; however, some do not. It is possible that sequence-specific binding of
Mcm1 at a few high affinity sites may stimulate association of Mcm1
with neighboring weaker sites. This explanation is consistent with the
observation that Mcm1 forms a distinct protein-DNA complex at low
concentrations and higher molecular weight complexes of heterogeneous
mobility at higher concentrations. Indeed, binding of Mcm1 to multiple
sites at ARSs appears to be cooperative. An example for a nucleating
sequence in the cooperative binding of a replication initiator protein
has been reported for the binding of the E. coli DnaA
protein to OriV of the RK2 plasmid (51).
What might be the possible function of Mcm1 that binds mostly outside
of the minimal functional domain of ARSs? It is possible that Mcm1
together with other auxiliary factors, such as Abf1, may regulate the
activity of an ARS by altering the accessibility of the ACS and B2/ATR
element to replication initiation factors. It may do so in one of
several ways. First, it may play a role in positioning nucleosomes as
suggested for Abf1 (52, 53) to modulate the accessibility of the ACS-B2
region. Indeed, Mcm1 together with its cofactor 2 have been shown to
bind their cognate sequence to phase nucleosomes (29, 54). Conversely,
Mcm1, without the 2 protein, has also been implicated in interfering with nucleosomal array assembly by binding to the recombination enhancer sequence near HML in a mating type cells
(29). Second, Mcm1 binding to origin DNA may recruit replication
initiation factors there. Mcm1, together with its cofactors, has been
shown to act as a recruiting platform for transcriptional repression or
activation complexes (27, 55). It is not difficult to imagine that Mcm1
may play a similar role at ARSs to recruit pre-RCs. Third, one can also
envision a role for Mcm1 in bending or looping DNA to enhance
accessibility of the minimal functional domain of ARSs. A classical
example for looping can be found in the replication origin of
OriP of Epstein-Barr virus (56, 57). The Epstein-Barr viral
encoded transcription factor EBNA has been shown to bind multiple sites
flanking OriP to form a loop structure that facilitates the
binding of the pre-RC (58-60). Finally, it is possible that the
structural changes induced by Mcm1 binding could facilitate interaction
between the large number of replication factors associated at
replication origins. As proposed for DnaA and integration host factor at E. coli OriC, the binding of
auxiliary factors causes DNA bending that helps juxtapose and
facilitate interaction between replication initiation factors bound at
faraway cis-acting elements (61).
In summary, genetic and biochemical evidence from this and other
studies is consistent with Mcm1 playing a direct role in replication
initiation at replication origins. Further analysis is necessary to
elucidate the precise functions that Mcm1 may serve at individual ARSs
on plasmids and at their native chromosomal locations. The global
presence of Mcm1 on chromatin suggests that Mcm1 may play a ubiquitous
role regulating chromatin structure at a genomic scale. A direct role
for Mcm1 in DNA replication may have important implications for other
MADS box transcription factors, especially those that stimulate
mitogenic growth in vertebrates.
 |
ACKNOWLEDGEMENTS |
We thank Shlomo Eisenberg for critical
reading of this manuscript and Mike Grunstein for the gift of histone
H2B antibodies.
 |
FOOTNOTES |
*
This work is supported in part by National Institutes of
Health Grant GM34190 (to B. K. T.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported by National Institutes of Health Training Grants
GM07273 or GM07616.
¶
Present address: Scripps Research Institute, La Jolla, CA 92037.
GAANN fellow.
**
To whom correspondence should be addressed: Dept. of Molecular
Biology and Genetics, Cornell University, 325 Biotechnology Bldg.,
Ithaca, NY 14853-2703. E-mail: bt16@cornell.edu.
Published, JBC Papers in Press, December 6, 2002, DOI 10.1074/jbc.M209827200
2
M. Fitch, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
ARS(s), autonomously
replicating sequence(s);
ACS, ARS consensus sequence;
chIP, chromatin
immunoprecipitation;
DAPI, 4,6-diamidino-2-phenylindole;
GST, glutathione S-transferase;
HA, hemagglutinin;
MCE(s), Mcm1
consensus element(s);
pre-RC, prereplication complex;
ORI, origin.
 |
REFERENCES |
| 1.
|
Kelly, T. J.,
and Brown, G. W.
(2000)
Annu. Rev. Biochem.
69,
829-880[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Lei, M.,
and Tye, B. K.
(2001)
J. Cell Sci.
114,
1447-1454[Abstract]
|
| 3.
|
Gilbert, D. M.
(2001)
Science
294,
96-100[Abstract/Free Full Text]
|
| 4.
|
Broach, J., Li, Y.,
Feldman, J.,
Jayaram, M.,
Abraham, J.,
Nasmyth, K.,
and Hicks, J.
(1983)
Cold Spring Harbor Symp. Quant. Biol.
47,
1165-1173[Abstract/Free Full Text]
|
| 5.
|
Blow, J. J.,
Gillespie, P. J.,
Francis, D.,
and Jackson, D. A.
(2001)
J. Cell Biol.
152,
15-26[Abstract/Free Full Text]
|
| 6.
|
Raghuraman, M. K.,
Winzeler, E. A.,
Collingwood, D.,
Hunt, S.,
Wodicka, L.,
Conway, A.,
Lockhart, D. J.,
Davis, R. W.,
Brewer, B. J.,
and Fangman, W. L.
(2001)
Science
294,
115-121[Abstract/Free Full Text]
|
| 7.
|
Wyrick, J. J.,
Aparicio, J. G.,
Chen, T.,
Barnett, J. D.,
Jennings, E. G.,
Young, R. A.,
Bell, S. P.,
and Aparicio, O. M.
(2001)
Science
294,
2357-2360[Abstract/Free Full Text]
|
| 8.
|
Stinchcomb, D. T.,
Struhl, K.,
and Davis, R. W.
(1979)
Nature
282,
39-43[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Chan, C. S.,
and Tye, B. K.
(1980)
Proc. Natl. Acad. Sci. U. S. A.
77,
6329-6333[Abstract/Free Full Text]
|
| 10.
|
Marahrens, Y.,
and Stillman, B.
(1992)
Science
255,
817-822[Abstract/Free Full Text]
|
| 11.
|
Rao, H.,
Marahrens, Y.,
and Stillman, B.
(1994)
Mol. Cell. Biol.
14,
7643-7651[Abstract/Free Full Text]
|
| 12.
|
Newlon, C. S.
(1996)
in
DNA Replication in Eukaryotic Cells
(DePamphilis, M. L., ed)
, Cold Spring Harbor University Press, Cold Spring Harbor, NY
|
| 13.
|
Bell, S.,
and Stillman, B.
(1992)
Nature
357,
128-134[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Bielinsky, A.-K.,
and Gerbi, S. A.
(1999)
Mol. Cell
3,
477-486[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Walker, S. S.,
Malik, A. K.,
and Eisenberg, S.
(1991)
Nucleic Acids Res.
19,
6255-6262[Abstract/Free Full Text]
|
| 16.
|
Raychaudhuri, S.,
Byers, R.,
Upton, T.,
and Eisenberg, S.
(1997)
Nucleic Acids Res.
25,
5057-5064[Abstract/Free Full Text]
|
| 17.
|
Theis, J. F.,
and Newlon, C. S.
(1994)
Mol. Cell. Biol.
14,
7652-7659[Abstract/Free Full Text]
|
| 18.
|
Theis, J. F.,
and Newlon, C. S.
(2001)
Mol. Cell. Biol.
21,
2790-2801[Abstract/Free Full Text]
|
| 19.
|
Dubey, D. D.,
Davis, L. R.,
Greenfeder, S. A.,
Ong, L. Y.,
Zhu, J.,
Broach, J.,
Newlon, C.,
and Huberman, J. A.
(1991)
Mol. Cell. Biol.
11,
5346-5355[Abstract/Free Full Text]
|
| 20.
|
Celniker, S. E.,
Sweder, K.,
Srienc, F.,
Bailey, J. E.,
and Campbell, J. L.
(1984)
Mol. Cell. Biol.
4,
2455-2466[Abstract/Free Full Text]
|
| 21.
|
Passmore, S.,
Maine, G. T.,
Elble, R.,
Christ, C.,
and Tye, B. K.
(1988)
J. Mol. Biol.
204,
593-606[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
McInerny, C. J.,
Partridge, J. F.,
Mikesell, G. E.,
Creemer, D. P.,
and Breeden, L. L.
(1997)
Genes Dev.
11,
1277-1288[Abstract/Free Full Text]
|
| 23.
|
Spellman, P.,
Sherlock, G.,
Zhang, M. Q.,
Iyer, V. R.,
Anders, K.,
Eisen, M. B.,
Brown, P. O.,
Botstein, D.,
and Futcher, B.
(1998)
Mol. Biol. Cell
9,
3273-3297[Abstract/Free Full Text]
|
| 24.
|
Simon, I.,
Barnett, J.,
Hannett, N.,
Harbison, C. T.,
Rinaldi, N. J.,
Volkert, T. L.,
Wyrick, J. J.,
Zeitlinger, J.,
Gifford, D. K.,
Jaakkola, T. S.,
and Young, R. A.
(2001)
Cell
106,
697-708[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Treisman, R.
(1995)
Nature
376,
468-469[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Koranda, M.,
Schleiffer, A.,
Endler, L.,
and Ammerer, G.
(2000)
Nature
406,
94-98[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Gavin, I. M.,
Kladde, M. P.,
and Simpson, R. T.
(2000)
EMBO J.
19,
5875-5883[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Roth, S. Y.,
Shimizu, M.,
Johnson, L.,
Grunstein, M.,
and Simpson, R. T.
(1992)
Genes Dev.
6,
411-425[Abstract/Free Full Text]
|
| 29.
|
Wu, C.,
Weiss, K.,
Yang, C.,
Harris, M.,
Tye, B.-K.,
Newlon, C.,
Simpson, R.,
and Haber, J.
(1998)
Genes Dev.
12,
1726-1737[Abstract/Free Full Text]
|
| 30.
|
Tan, S.,
and Richmond, T. J.
(1998)
Nature
39,
660-666
|
| 31.
|
Acton, T. B.,
Zhong, H.,
and Vershon, A. K.
(1997)
Mol. Cell. Biol.
17,
1881-1889[Abstract]
|
| 32.
|
West, A. G.,
and Sharrocks, A. D.
(1999)
J. Mol. Biol.
286,
1311-1323[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Passmore, S.,
Elble, R.,
and Tye, B. K.
(1989)
Genes Dev.
3,
921-935[Abstract/Free Full Text]
|
| 34.
|
Christ, C.,
and Tye, B. K.
(1991)
Genes Dev.
5,
751-763[Abstract/Free Full Text]
|
| 35.
|
Ausubel, F. M.,
Brent, T.,
Kingston, R. E.,
Moore, D. D.,
Seidman, J. G.,
Smith, J. A.,
and Struhl, K.
(1998)
Current Protocols in Molecular Biology
, John Wiley and Sons, New York
|
| 36.
|
Lei, M.,
Kawasaki, Y.,
and Tye, B. K.
(1996)
Mol. Cell. Biol.
16,
5081-5090[Abstract]
|
| 37.
|
Brewer, B. J.,
and Fangman, W. L.
(1987)
Cell
51,
463-471[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Feinberg, A. P.,
and Vogelstein, B.
(1983)
Anal. Biochem.
132,
6-13[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Bishop, D. K.
(1994)
Cell
79,
1081-1092[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Young, M.,
Suzuki, K.,
Yan, H.,
Gibson, S.,
and Tye, B. K.
(1997)
Genes Cells
2,
631-643[Abstract]
|
| 41.
|
Hecht, A.,
Strahl-Bolsinger, S.,
and Grunstein, M.
(1996)
Nature
383,
92-96[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Maine, G. T.,
Sinha, P.,
and Tye, B. K.
(1984)
Genetics
106,
365-385[Abstract/Free Full Text]
|
| 43.
|
Chan, C. S. M.,
and Tye, B.-K.
(1983)
J. Mol. Biol.
168,
505-523[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Chan, C. S. M.,
and Tye, B.-K.
(1983)
Cell
33,
563-573[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Tanaka, T.,
Knapp, D.,
and Nasmyth, K.
(1997)
Cell
90,
649-660[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Mai, B.,
Miles, S.,
and Breeden, L. L.
(2002)
Mol. Cell. Biol.
22,
430-441[Abstract/Free Full Text]
|
| 47.
|
Walker, S. S.,
Francesconi, S. C.,
and Eisenberg, S.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
4665-4669[Abstract/Free Full Text]
|
| 48.
|
Rhode, P. R.,
Elsasser, S.,
and Campbell, J. L.
(1992)
Mol. Cell. Biol.
12,
1064-1077[Abstract/Free Full Text]
|
| 49.
|
Diffley, J. F. X.,
and Stillman, B.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
2120-2124[Abstract/Free Full Text]
|
| 50.
|
Walker, S. S.,
Francesconi, S. C.,
Tye, B. K.,
and Eisenberg, S.
(1989)
Mol. Cell. Biol.
9,
2914-2921[Abstract/Free Full Text]
|
| 51.
|
Doran, K. S.,
Helinski, D. R.,
and Konieczny, I.
(1999)
J. Biol. Chem.
274,
17918-17923[Abstract/Free Full Text]
|
| 52.
|
Venditti, P.,
Costanzo, G.,
Negri, R.,
and Camilloni, G.
(1994)
Biochim. Biophys. Acta
1219,
677-689[Medline]
[Order article via Infotrieve]
|
| 53.
|
Lipford, J. R.,
and Bell, S. P.
(2001)
Mol. Cell
7,
21-30[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Simpson, R. T.
(1990)
Nature
343,
387-389[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Kumar, R.,
Reynolds, D. M.,
Shevchenko, A.,
Shevchenko, A.,
Goldstone, S. D.,
and Dalton, S.
(2000)
Curr. Biol.
10,
896-906[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Frappier, L.,
and O'Donnell, M.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
10875-10879[Abstract/Free Full Text]
|
| 57.
|
Su, W.,
Middleton, T.,
Sugden, B.,
and Echols, H.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
10870-10874[Abstract/Free Full Text]
|
| 58.
|
Dhar, S. K.,
Yoshida, K.,
Machida, Y.,
Khaira, P.,
Chaudhuri, B.,
Wohlschlegel, J. A.,
Leffak, M.,
Yates, J.,
and Dutta, A.
(2001)
Cell
106,
287-296[CrossRef][Medline]
[Order article via Infotrieve]
|
| 59.
|
Schepers, A.,
Ritzi, M.,
Bousset, K.,
Kremmer, E.,
Yates, J. L.,
Harwood, J.,
Diffley, J. F.,
and Hammerschmidt, W.
(2001)
EMBO J.
20,
4588-4602[CrossRef][Medline]
[Order article via Infotrieve]
|
| 60.
|
Chaudhuri, B., Xu, H.,
Todorov, I.,
Dutta, A.,
and Yates, J. L.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
10085-10089[Abstract/Free Full Text]
|
| 61.
|
Polaczek, P.,
Kwan, K.,
Liberies, D. A.,
and Campbell, J. L.
(1997)
Mol. Microbiol.
26,
261-275[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Bystricky, H. Van Attikum, M.-D. Montiel, V. Dion, L. Gehlen, and S. M. Gasser
Regulation of Nuclear Positioning and Dynamics of the Silent Mating Type Loci by the Yeast Ku70/Ku80 Complex
Mol. Cell. Biol.,
February 1, 2009;
29(3):
835 - 848.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Miano, X. Long, and K. Fujiwara
Serum response factor: master regulator of the actin cytoskeleton and contractile apparatus
Am J Physiol Cell Physiol,
January 1, 2007;
292(1):
C70 - C81.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Rognon, Z. Kozovska, A. T. Coste, G. Pardini, and D. Sanglard
Identification of promoter elements responsible for the regulation of MDR1 from Candida albicans, a major facilitator transporter involved in azole resistance
Microbiology,
December 1, 2006;
152(12):
3701 - 3722.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Coic, K. Sun, C. Wu, and J. E. Haber
Cell Cycle-Dependent Regulation of Saccharomyces cerevisiae Donor Preference during Mating-Type Switching by SBF (Swi4/Swi6) and Fkh1.
Mol. Cell. Biol.,
July 1, 2006;
26(14):
5470 - 5480.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Abraham and A. K. Vershon
N-Terminal Arm of Mcm1 Is Required for Transcription of a Subset of Genes Involved in Maintenance of the Cell Wall
Eukaryot. Cell,
November 1, 2005;
4(11):
1808 - 1819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Nieduszynski, J. J. Blow, and A. D. Donaldson
The requirement of yeast replication origins for pre-replication complex proteins is modulated by transcription
Nucleic Acids Res.,
April 28, 2005;
33(8):
2410 - 2420.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Alter and G. H. Golub
Integrative analysis of genome-scale data by using pseudoinverse projection predicts novel correlation between DNA replication and RNA transcription
PNAS,
November 23, 2004;
101(47):
16577 - 16582.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. K. Chang, J. J. Donato, C. S. Chan, and B. K. Tye
Mcm1 Promotes Replication Initiation by Binding Specific Elements at Replication Origins
Mol. Cell. Biol.,
July 15, 2004;
24(14):
6514 - 6524.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Fitch, J. J. Donato, and B. K. Tye
Mcm7, a Subunit of the Presumptive MCM Helicase, Modulates Its Own Expression in Conjunction with Mcm1
J. Biol. Chem.,
July 3, 2003;
278(28):
25408 - 25416.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|