![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 8, 6420-6426, February 21, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§,
, and
From the
Laboratory of Parasitic Diseases, NIAID,
National Institutes of Health, Bethesda, Maryland 20892, the
¶ Cátedra de Bioquimica y Biologia Molecular, Facultad de
Ciencias Medicas, Universidad Nacional de Cordoba, Cordoba 5000, Argentina, and the
Rocky Mountain Laboratory, NIAID, National
Institutes of Health, Hamilton, Montana 59840
Received for publication, August 15, 2002, and in revised form, October 15, 2002
| |
ABSTRACT |
|---|
|
|
|---|
Encystation-specific cysteine protease (ESCP) was
the first membrane-associated protein described to be part of the
lysosome-like peripheral vacuoles in the intestinal parasite
Giardia lamblia. ESCP is homologous to cathepsin C enzymes
of higher eukaryotes, but is distinguished from other lysosomal
cysteine proteases because it possesses a transmembrane domain and a
short cytoplasmic tail. Tyrosine-based motifs within tails of membrane
proteins are known to participate in endosomal/lysosomal protein
sorting in higher eukaryotes. In this study, we show that a YRPI motif
within the ESCP cytoplasmic tail is necessary and sufficient to mediate
ESCP sorting to peripheral vacuoles in Giardia. Deletion
and point mutation analysis demonstrated that the tyrosine residue is
critical for ESCP sorting, whereas amino acids located at the Y+1
(Arg), Y+2 (Pro), and Y+3 (Ile) positions show minimal effect. Loss of the motif resulted in surface localization, whereas addition of the
motif to a variant-specific surface protein resulted in lysosomal localization. Although Giardia trophozoites lack a
morphologically discernible Golgi apparatus, our findings indicate that
this parasite directs proteins to the lysosomes using a conserved
sorting signal similar to that used by yeast and mammalian cells.
Because Giardia is one of the earliest branching protist,
these results demonstrate that sorting motifs for specific protein
traffic developed very early during eukaryotic evolution.
Lysosomes are membrane-bound acidic organelles involved in
degradation of endogenous and exogenous macromolecules via biosynthetic or endocytic pathways, respectively (1, 2). In mammalian cells,
trafficking between the trans-Golgi network
(TGN),1 endosomes, and
lysosomes involves several pathways. Mannose 6-phosphate receptors,
TGN-38, furin, sortilin, and other proteins are cycled between the TGN
and endosomes without ever reaching the lysosomes. Soluble hydrolases
bind to mannose 6-phosphate receptors in the TGN by
6-phosphomannosyl residues and travel to endosomes, where they
dissociate from their receptor and subsequently reach lysosomes (3, 4).
Structural lysosome-associated membrane proteins are sorted from the
TGN to the lysosomes through endosomes by way of tyrosine-based motifs.
In addition, other proteins are transported directly to the lysosomes
without trafficking through endosomes (5). Yeast, unlike mammalian
cells, contains an endosomal or prevacuolar compartment and a large
vacuole that functions like a lysosome. Carboxypeptidase Y is
transported to the yeast vacuole by its receptor, Vps10p, which returns
to the Golgi by the yeast retromer complex. Alternatively, yeast
alkaline phosphatase is transported to the vacuole by a different
mechanism that avoids the yeast prevacuolar compartment (5).
In yeast and mammalian cells, a clear distinction between early/late
endosomes and lysosomes has been established. In contrast, Giardia lamblia possesses peripheral vacuoles (PVs) located
underneath the plasma membrane that function as endosomes and lysosomes
and are therefore considered a primitive endosomal/lysosomal complex (6). These vacuoles, also called peripheral vesicles, are acidic organelles because they can be labeled with lysosomal markers like
acridine orange (6) and LysoSensor (7). PVs can take up horseradish
peroxidase without delivering it to any other subcellular compartment,
suggesting that PVs may be a unique endocytic compartment (6). In
addition, numerous soluble enzymes such as acid phosphatase, cathepsins
B, and RNase are also present in these vacuoles, indicating their
lysosomal nature (8-10); nevertheless, no receptors involved in the
sorting of any of these enzymes have yet been described.
Interestingly, PVs are important not only for food degradation, but
also for completion of the life cycle of this intestinal parasite.
Giardia cycles between the disease-causing flagellated trophozoite and the environmentally resistant cyst, which is released with feces and is responsible for transmission of the disease (11). The
participation of PVs has also been described to influence secretory
granule discharge during cyst wall formation (12), and PVs act as
secretory organelles that release cyst wall-disrupting enzymes during
excystation (10, 13).
In mammalian cells as well as in yeast, specific sorting signals direct
transmembrane proteins to endosomes and/or lysosomes, either from the
TGN or from the cell surface, and involve tyrosine-based motifs
(YXX We recently reported that a cysteine protease of the cathepsin C family
is implicated in the processing of a cyst wall protein during
encystation and that this enzyme localizes to the peripheral vacuoles
of non-encysting Giardia trophozoites (7). This
encystation-specific cysteine protease (ESCP) possesses a
transmembrane domain and a 12-amino acid cytoplasmic tail, unlike
cathepsin C enzymes from higher eukaryotes. In the present study, we
show that a tyrosine-based sorting signal (YRPI) within the ESCP
cytoplasmic tail functions in the sorting of ESCP to lysosome-like
peripheral vacuoles in Giardia.
Expression of ESCP in Trophozoites--
To constitutively
express ESCP along with three influenza hemagglutinin (HA) epitopes
(YPYDVPDYAYPYDVPDYAYPYDVPDYA) at the C terminus, the plasmid pTubH7pac
carrying the variant-specific surface protein gene vsph7
(16) was modified to introduce the tag just before the TGA stop codon
and an ApaI site immediately following the vsph7
ATG start codon. First, one round of PCR was performed using sense
oligonucleotide
5'-ggtacgcgtacccctacgatgtaccagactatgcatagggatccgacttaggtagtaaacgtcatggt-3' and antisense oligonucleotide
5'-tcgacgcgtaatcgggaacatcatacggataagcgtagtcaggcacatcatatggatagatatccgccttcc cgcggcagacgaacca-3' (with the MluI site in boldface,
the BamHI site underlined, and the EcoRV site in
italics), which were restricted with MluI and ligated
together. Another round of PCR using the same strategy allowed the
insertion of an ApaI site using sense 5'-cctGGGCCCttaattaattgcctaatagcaagcact-3' and antisense
5'-taaGGGCCCcatggttttatttccgcccgtccagact-3' primers (with the
ApaI site in uppercase), resulting in pTubH7HApac. To
exchange the escp gene for the vsph7 gene,
pTubH7HApac was digested with ApaI and EcoRV to
release vsph7. The DNA fragment corresponding to the entire
escp coding region was amplified from Giardia
genomic DNA (isolate WB/clone 1267) by PCR using sense 5'-ctgGGGCCCcttttcatcttggcgctcctg-3' and antisense
5'-taagatatctgcaattattggacggtattt-3' primers carrying
ApaI and EcoRV sites, respectively; digested; and
ligated into the restricted vector, resulting in pTubESCPHApac.
Construction of ESCP Variants--
A site-directed mutagenesis
kit (QuikChange, Stratagene) was employed to construct
deletion/mutations of ESCP inside pTubESCPHApac using two complementary
mutagenic oligonucleotide primers based on escp sequence
reported previously (GenBankTM/EBI accession number
AF293408) (7). For VSPH7/ESCP Transmembrane Domain and Cytoplasmic Tail
Chimeras--
VSPH7-HA, G. lamblia Cultivation and Transfection--
Trophozoites of
isolate WB/clone 1267 (18) were cultured as described (19). Encystation
of trophozoite monolayers was accomplished following the method
described by Boucher and Gillin (20). Trophozoites were transfected
with the constructs by electroporation and selected by puromycin as
previously described (16, 21, 22).
Immunofluorescence Assays--
For fixed cells, trophozoites
cultured in growth medium were harvested and processed as described
previously (23). Primary anti-HA mAb (Sigma) was used to detect ESCP
and ESCP variants, and anti-HA mAb or VSPH7-specific mAb G10/4 (27) was
used to detect VSPH7 and VSPH7 variants. For assays of viable
trophozoites, the cells were washed twice with PBS and 0.1% growth
medium and incubated with the specific mAb G10/4 for VSPH7 surface
localization. For CWP2 localization, mAb 7D2 (30) was directly labeled
with Texas Red (Molecular Probes, Inc., Eugene, OR) following the
manufacturer's instructions and used in encysting trophozoites
transfected with pTubESCPHApac. The specimens were examined with a
Zeiss Axioplan fluorescence microscope and/or a Leica TCS-NT/SP
confocal microscope. Controls included omission of primary antibody and
staining of untransfected cells.
LysoTracker Staining--
For PV localization,
Giardia trophozoites were incubated at 37 °C for 3 h
in growth medium containing 70 nM LysoTrackerTM
Red DND-99 (Molecular Probes, Inc.) as suggested by the manufacturer, chilled, washed twice with PBS and 0.1% growth medium, and attached to
coverslips for 30 min at 37 °C. After 40 min of fixation with 4%
formaldehyde, the cells were blocked with 10% normal goat serum in PBS
containing 0.1% Triton X-100 for 30 min and then incubated for 1 h with anti-HA antibody in PBS containing 3% normal goat serum and
0.1% Triton X-100. Fluorescein-conjugated anti-mouse IgG secondary
antibody (Cappel, West Chester, PA) was used to reveal the labeling patterns.
Immunoblot Analysis--
Western blotting was performed as
previously reported (23). Briefly, 10 µg of total protein/lane from
transfected non-encysting trophozoites were resuspended in 30 µl of
Laemmli sample buffer (Bio-Rad) with 2-mercaptoethanol, boiled for 5 min, and electrophoresed on a 4-12% Tris/glycine-polyacrylamide gel.
The proteins were transblotted onto polyvinylidene difluoride membranes
(Invitrogen) and probed with anti-HA antibody (1:2000 dilution).
Immunoelectron Microscopy--
Encysting Giardia
trophozoites were rinsed twice with PBS and 0.1% growth medium;
chilled; attached to Thermanox coverslips (Nunc, Naperville, IL); and
processed as described previously (24), except that the primary
antibody for tagged ESCP was anti-HA mAb diluted 1:1000.
ESCP Localizes to Peripheral Vacuoles in
Giardia--
HA-tagged ESCP was constitutively expressed in WB/1267
trophozoites. With anti-HA mAb, ESCP showed a PV localization
pattern and colocalized with LysoTracker (Fig.
1 and Supplemental Fig. 1), a probe for
acidic organelles in living cells (25). To verify that the HA tag does
not interfere with ESCP sorting, tagged variants of ESCP carrying V5
and FLAG epitopes as well as green fluorescent protein were expressed
and localized to the PVs by immunofluorescence assays using specific
mAbs (data not shown). In addition, acid phosphatase
(GenBankTM/EBI accession number AAK97085) and the
variant-specific surface protein VSPH7 tagged with HA localized to the
PVs2 and the plasma membrane,
respectively, indicating that the HA tag at the C terminus does not
influence protein trafficking (see below).
ESCP Sorting Requires a Tyrosine-based Motif--
To analyze
whether the YRPI motif located in the cytoplasmic tail of ESCP
determines its localization to the PVs, we constructed a series of
variants of this enzyme by deletions and mutations (see "Experimental
Procedures" and Figs. 2A and
4A). The sorting of these variants was examined by
immunofluorescence assays using anti-HA mAb. As was previously
documented, ESCP localizes to the PVs in Giardia (7), but
the truncated version
Mutation of YRPI ( The ESCP Cytoplasmic Tail Relocates VSPH7 from the Surface to the
PVs--
VSPH7 is a variant-specific surface protein of
Giardia clone GS/M-H7 that possesses a single transmembrane
domain and a conserved CRGKA cytoplasmic tail and that covers the
entire cell surface, including the flagella (26). VSPH7 is not
expressed in Giardia clone WB/1267, allowing detection of
VSPH7 at the surface of transfected WB trophozoites using
VSPH7-specific mAb G10/4 (16, 27). First, it was important to determine
whether VSPH7 does have also a sorting motif for its plasma membrane
localization. In this way, expression of VSPH7-HA (VSPH7 with an HA tag
at its C terminus),
To analyze whether the ESCP cytoplasmic tail can modify VSPH7 sorting,
two different chimeras were expressed in WB/1267 trophozoites: VSPH7-HA
possessing the transmembrane domain of ESCP (cH7TM) and VSPH7-HA
possessing the ESCP cytoplasmic tail instead of its own conserved tail
(cH7CT) (Fig. 6A).
Expression of cH7TM resulted in no change in localization because the
chimera remained in the plasma membrane (Fig. 6B).
Immunofluorescence assay using G10/4, a mAb that recognizes the VSPH7
extracellular domain, confirmed the surface localization of cH7TM in
viable trophozoites (Supplemental Fig. 3). These results indicate that
the 27-amino acid transmembrane domain of VSPH7 does not contain a
specific signal for surface localization and that a protein carrying
the 24-amino acid ESCP transmembrane domain is transported to the
plasma membrane. In contrast, cH7CT was localized to the PVs, the same
subcellular localization as ESCP (Fig. 6C). Moreover, in
viable cells, mAb G10/4 failed to detect cH7CT at the surface of the
trophozoite (Supplemental Fig. 3). Taken together, these results show
that the cytoplasmic tail of ESCP has all the information necessary to
direct proteins to Giardia peripheral vesicles. Furthermore, these findings suggest that a long transmembrane domain is essential for VSPs to be transported to the plasma membrane (see
"Discussion").
ESCP Also Localizes in Encystation-specific Secretory Vesicles
(ESVs) during Encystation--
ESCP expression and activity increase
during encystation and are involved in the processing of one of the
proteins forming the cyst wall (CWP2) (7). Although CWP2 and ESCP
colocalize in encysting cells, how and where this interaction takes
place are unknown (7). Here, we analyzed ESCP/CWP2 interaction during encystation by immunofluorescence and ESCP subcellular localization by
immunoelectron microscopy in encysting trophozoites.
Using directly labeled anti-CWP2 mAb and anti-HA mAb for the detection
of ESCP, we found that, at the beginning of encystation, ESCP was in
the PVs close to the encysting trophozoite plasma membrane, whereas
CWP2 was detected in the ESVs (Fig.
7A). In contrast, during cyst
wall formation, both colocalized in the developing cyst wall and in the
cyst wall in mature cysts (Fig. 7A).
Immunoelectron microscopy showed ESCP in ESVs as well as on the surface
and in the PVs of encysting cells (Fig. 7B and Supplemental Fig. 4). The fact that ESCP could be found inside ESVs close to peripheral vacuoles and its localization at the surface suggest that
ESVs interact with PVs during ESV discharge and/or at the time of
release onto the surface of encysting trophozoites.
In higher eukaryotes, the endoplasmic reticulum and the Golgi
complex play a central role in the correct protein folding and transport. Proteins transported to endosomes or lysosomes are generally
sorted away from the trafficking pathway taken by secretory proteins
and are instead targeted to the endocytic compartments (28).
Giardia does have an endomembranous system that differs from
that of higher eukaryotes (29). Giardia lacks organelles that resemble early and late endosomes and instead has peripheral vacuoles with hydrolytic activity. The property of these organelles to
accumulate macromolecules and, at the same time, the presence of
lysosome-like soluble hydrolases suggest that this parasite possesses
an endosomal/lysosomal system represented in this single organelle (6).
In addition, these vacuoles seem to perform multiple cellular functions
because they also act as secretory organelles at certain points of the
Giardia life cycle (7, 13). Despite these differences, in a
number of ways, protein transport in Giardia resembles that
in higher eukaryotes. One example is the constitutive secretion of VSPs
(26, 27) and the regulated secretion of CWPs (23, 30, 31). In addition, signal peptides target VSPs and CWPs through the secretory pathway in
Giardia (26, 27), and conserved motifs such as the BiP chaperone/endoplasmic reticulum retention motif (KDEL) are present in
this parasite (32).
The tyrosine-based motif (YRPI) involved in ESCP transport to the PVs
in Giardia is another example of similarity of secretory mechanisms to more evolved cells. In higher eukaryotes, a
tyrosine-based signal defines a motif that has the consensus
YXX To better understand protein sorting signals in the primitive eukaryote
G. lamblia, we performed additional experiments using a type
I membrane protein, the variant-specific surface protein VSPH7. When
VSPH7 (VSP of Giardia clone GS/M) is expressed in Giardia clone WB/1267, it shows a surface pattern (16). Like all VSPs described so far (26, 27, 35-38), VSPH7 possesses a 27-amino
acid transmembrane domain and a conserved 5-amino acid cytoplasmic tail
(CRGKA). When the 24-residues ESCP transmembrane segment replaced the
VSPH7 transmembrane domain, the localization of the VSPH7 chimera
remained unchanged. In addition, when VSPH7 lacking the cytoplasmic
tail was expressed, the protein appeared on the surface, similar to
when the CRGKA tail of VSPH7 was exchanged for 5 alanine residues.
These results are consistent with the hypothesis that the length of the
transmembrane domain is critical for protein localization, supporting
the model wherein short transmembrane domains ( When the cytoplasmic tail of VSPH7 was substituted for the ESCP
counterpart, the localization of VSPH7 changed from the cell surface to
the PVs. These findings suggest that the transmembrane domain directs
the transport of membrane-associated proteins in Giardia
unless they have a sorting signal that specifically routes the protein
to another organelle.
There are at least two different mechanisms involved in protein
trafficking to the PVs in Giardia. This study shows that a conserved tyrosine-based motif in the cytoplasmic tail of ESCP is
critical for ESCP localization to the PVs. In contrast, soluble PV
proteins such as acid phosphatase and cathepsins B do not contain a
tyrosine-based motif. It is possible that these soluble lysosomal proteins, similar to those in the mammalian system, require a receptor-mediated sorting process that involves mannose 6-phosphate receptor- and adaptor-like proteins. Although mannose 6-phosphate receptor-like proteins have not been reported in Giardia,
proteins with some homology to the It is also well known that the Giardia secretory system
undergoes radical changes during encystation (23, 30, 46-48). The most
remarkable events are the presence of a well defined Golgi apparatus
and the biogenesis of ESVs that transport newly synthesized CWPs to the
plasma membrane for release and cyst wall formation. In the
present study, during encystation, ESCP was seen inside ESVs and in the
plasma membrane in addition to the PVs. Because ESCP is involved in the
processing of CWP2 during cyst wall formation, it is possible that PVs
fuse with ESVs where interaction between the enzyme ESCP and the
substrate CWP2 takes place. After CWP2 processing, both proteins could
then be released by exocytosis in a way that involves a
calcium-dependent process (49). The findings presented here
confirm the previous suggestion that ESVs interact with PVs during the
latter stages of encystation (31).
As an early diverging protist, Giardia seems to have a
relatively elementary subcellular organization (11). In particular, it
has one of the most basic systems for protein transport and degradation
(11). However, it also shares many characteristics with higher
eukaryotes, as in the case of conserved sorting motifs. Further studies
regarding different sorting signals in Giardia and the
molecules interacting with them will provide new insight to better
understand the evolution of intracellular protein transport and
subcellular organization in eukaryotes and also contribute to defining
new targets for therapeutic intervention.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
, where X is any amino acid and
is an
amino acid with a bulky hydrophobic side chain) and/or acidic cluster
dileucine motifs located in their cytoplasmic tails. These motifs can
be found in single or multiple copies and also in combination (14). The
interaction of proteins carrying these motifs with adaptor proteins
(APs) and GGA (Golgi-localized,
gamma-ear-containing ADP-ribosylation
factor-binding) proteins seems to be critical for endosomal/lysosomal
protein transport (14, 15).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
K/A, a second EcoRV site was
introduced at the end of the sequence coding for the ESCP transmembrane
domain. The plasmid was restricted with EcoRV and ligated
together, thereby eliminating the sequence corresponding to the ESCP
cytoplasmic tail. For
K/K, two complementary primers were designed
to omit bases 1588-1606. For
Y/A, the same strategy was followed,
introducing a deletion of bases 1606-1624 (see Fig. 2A).
For the
YRPI,
Y,
RP, and
I point mutations, the
corresponding amino acids were replaced with alanine residues (see Fig.
4A). ESCP variants were confirmed by sequencing using dye
terminator cycle sequencing (Beckman Coulter).
H7, and
H7-AA were used as controls (see
Fig. 5A). The last two constructs were made following the
same strategy described for ESCP deletions and mutations. The chimeras
cH7TM and cH7CT (see Fig. 6A) were generated by PCR using
primers that have complementary sequences to the ESCP transmembrane
domain and cytoplasmic tail, respectively, following the protocol
described by Geiser et al. (17). The correct sequences of
all constructs were verified by sequencing.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (15K):
[in a new window]
Fig. 1.
ESCP colocalizes with a lysosomal
marker inside the peripheral vacuoles of transfected trophozoites.
Upon immunofluorescence, anti-HA mAb detected the tagged
enzyme ESCP in vesicles near the plasma membrane (visualized in
green), which colocalized (merge visualized in
yellow) with the lysosomal probe LysoTracker (visualized in
red). Magnification is ×1000.
K/A showed surface localization indicated by
staining of the trophozoite surface and flagella (Fig. 2B
and Supplemental Fig. 2). Expression of
K/K, which still has the
YXX
motif, resulted in no change in ESCP localization
(Fig. 2B). In contrast,
Y/A, which lacks the YRPIIA
sequence, relocated the enzyme to the plasma membrane (Fig. 2B). Western blot analysis of total protein extracted from
transfected trophozoites confirmed the expression of ESCP and its
variants. In every case, 65- and 45-kDa bands corresponding to the
immature and mature forms of ESCP, respectively, were observed (Fig.
3) (7). These results prompted us
to perform a more detailed analysis of the YRPI sorting signal because
only the construct lacking this motif failed to localize ESCP to
peripheral vacuoles.

View larger version (22K):
[in a new window]
Fig. 2.
Deletions of the ESCP cytoplasmic tail
misroute ESCP to the plasma membrane. A, shown is a
representation of ESCP and ESCP tail deletions tagged with three HA
epitopes (3xHA) at their C termini. The luminal and
transmembrane domains are depicted by white and blue
bars, respectively. The complete amino acid sequence of the
cytoplasmic tail is represented in one-letter code. The signal peptide
and the propeptide were omitted in these illustrations. The
tyrosine-based motif (YRPI) is in red. B, anti-HA
mAb detected ESCP on peripheral vacuoles, but the deletion
K/A (ESCP
without its cytoplasmic tail, KSRGTKYRPIIA) was instead misrouted to
the plasma membrane. Deletion of sequence KSRGTK localized
K/K to
the PVs, but deletion of sequence YRPIIA misrouted
Y/A to the
surface. Plasma membrane and flagellum staining denotes surface
localization. 4,6-diamidino-2-phenylindole stained the
Giardia nuclei. Magnification is ×630.

View larger version (33K):
[in a new window]
Fig. 3.
Western blot assay of tagged ESCP
variants. Ten micrograms of total proteins from WB/1267
trophozoites transfected with ESCP,
K/A,
K/K, and
Y/A were
loaded per lane. The constructs showed different levels of expression;
but in all cases, 65- and 45-kDa bands, corresponding to the immature
and mature forms of ESCP, respectively, are visible
(arrowheads). ESCP variants were detected using anti-HA
antibody at 1:2000 dilution. MW, molecular weight.
YRPI) to alanine residues resulted in missorting
of the protein to the plasma membrane, showing that this motif is
essential for ESCP localization (Fig. 4,
A and B). Exchanging tyrosine (
Y) with alanine
localized
Y to the surface, whereas replacement of the residue that
follow tyrosine at position +3 (
I) had an intermediate effect
because the enzyme was detected both at the surface and in the PVs
(Fig. 4, A and B). However, when Arg and Pro were
replaced, the enzyme remained in the PVs (data not shown). These
results indicate that the tyrosine within the cytoplasmic tail is
critical for ESCP peripheral vacuole localization.

View larger version (25K):
[in a new window]
Fig. 4.
The tyrosine-based motif in the ESCP
cytoplasmic tail is essential for lysosomal localization. A,
shown is an illustration of ESCP tyrosine-based motif point mutations.
The tyrosine-based motif (YRPI) is show in red, and alanine
substitutions are underlined. The signal peptide and the
propeptide were omitted in these illustrations. 3xHA, three
HA epitopes. B, point mutations of the tyrosine-based motif
(
YRPI) and tyrosine (
Y) changed the enzyme location to the plasma
membrane. Replacement of residue Y+3 (
I) localized ESCP to the PVs
and to the surface, suggesting a moderate effect on lysosomal sorting.
Expression was determined using anti-HA mAb.
4,6-diamidino-2-phenylindole stained the Giardia nuclei.
Magnification is ×630.
H7 (tagged VSPH7 without its cytoplasmic tail),
and
H7-AA (tagged VSPH7 with the amino acids in its tail changed to
alanine residues) showed the same localization profile on the surface
of trophozoites compared with expression of native VSPH7, as determined
using either anti-HA mAb (Fig. 5,
A and B) or mAb G10/4 (data not shown). Thus,
these result shows that the HA epitope does not affect VSPH7 localization and that the conserved CRGKA cytoplasmic tail is not
involved in VSPH7 plasma membrane sorting.

View larger version (25K):
[in a new window]
Fig. 5.
Surface transmembrane protein VSPH7 does not
have a sorting signal within the cytoplasmic tail. A, shown
is a representation of VSPH7 and tagged VSPH7 variants. The
extracellular and transmembrane domains of VSPH7 are shown as
yellow and gray bars, respectively. The amino
acid sequence of the VSPH7 cytoplasmic tail is shown in one-letter
code. The signal peptide was omitted in these illustrations.
3xHAe, three HA epitopes. B, VSPH7 expression in
transfected WB/1267 trophozoites showed surface localization using
VSPH7-specific mAb G10/4. VSPH7-HA and the truncated version
H7 were
detected also on the surface using anti-HA mAb or mAb G10/4 (data not
shown). 4,6-diamidino-2-phenylindole stained the Giardia
nuclei. Magnification is ×630.

View larger version (51K):
[in a new window]
Fig. 6.
VSPH7 carrying the ESCP cytoplasmic tail is
displaced from the surface to the peripheral vesicles. A,
shown is an illustration of ESCP and tagged VSPH7 chimeras.
Bars denote different domains of ESCP and VSPH7-HA. The
tyrosine-based motif (YRPI) of ESCP is show in red.
3xHA, three HA epitopes. B, the localization of
cH7TM, in which VSPH7 has the transmembrane domain of ESCP, remained on
the surface, covering the entire parasite surface including the
flagella. C, cH7CT, in which VSPH7-HA carries the ESCP
cytoplasmic tail, relocated to the PVs close to the plasma membrane.
Chimeras were detected using anti-HA mAb. PC,
phase-contrast. Magnification is ×630.

View larger version (92K):
[in a new window]
Fig. 7.
ESCP colocalizes with CWP2 during encystation
and is detected in secretory vesicles and on the surface of
Giardia. A, in encysting trophozoites
(ET), ESCP was detected in the PVs (visualized in
green), and CWP2 was found inside ESVs (visualized in
red). During cyst wall formation (CWF) and in the
mature cyst (C), both proteins colocalized (visualized in
yellow). Immunofluorescence assay was done using anti-HA mAb
and mAb 7D2 to detect ESCP and CWP2, respectively. B, shown
are the results from immunoelectron microscopy of an encysting
trophozoite, in which ESCP was localized to the PVs (white
arrowheads), inside ESVs (black arrowheads), and in the
nascent cyst wall (arrows). The inset shows a
higher magnification of ESCP localization in the secretory granule
membrane. ESCP was detected using anti-HA mAb and
fluoronanogold-labeled anti-mouse IgG Fab antibody.
N, nucleus. Magnification is ×15,000.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
or NPXY (33). In vitro analyses
have shown that this motif interacts with the µ-subunits of almost
all APs described so far (14, 15). Despite that each µ-subunit has a
preference for 1 amino acid at the X position favoring a
nonpolar, an arginine-rich, and an acidic amino acid for AP1,
AP2, and AP3, respectively, there is also an overlapping specificity
(YIPL) among them (34). Furthermore, AP µ-subunits also
have predilections for the
position, preferring leucine and
isoleucine over other hydrophobic amino acids (34). In the case of
Giardia, the YRPI motif within the ESCP cytoplasmic tail
appears to be a putative adaptor-binding domain because it has a
proline and an isoleucine at the Y+2 and Y+3 positions, respectively.
The exchange of YRPI for alanine residues altered the localization of
ESCP from the PVs to the plasma membrane. Moreover, recognition
by tyrosine plays a major role in ESCP localization because its
replacement was sufficient to relocate the enzyme to other cellular
organelles. Point mutation of residues Y+1/Y+2 and Y+3 showed that only
the isoleucine at position +3 has a moderate effect on ESCP subcellular
localization. It is possible that, as was described for other proteins
(15), residues Y+2 and Y+3 may help expose the tyrosine residue to the
adaptor subunit, rather than being involved in adaptor recognition.
17 residues) direct
proteins to the endoplasmic reticulum and cis-Golgi, and
proteins with long transmembrane domains (
23 residues) direct
proteins to the plasma membrane (39-43). Transmembrane proteins in
Giardia seem to follow the same criteria. Similar to VSPs,
other proteins such as dipeptidyl peptidase IV (44) and syntaxin-1
(GenBankTM/EBI accession number
AF293409),2,3 which have long
transmembrane domains, also localized to the plasma membrane, whereas
syntaxin-2 (accession number AF293410), a protein with a short
transmembrane domain, localized at the Golgi of encysting
trophozoites.4 In addition, a
recent report showed that when the VSPH7 transmembrane domain and
cytoplasmic tail were added to the extracellular domain of a
membrane-anchored SAG1 protein of Toxoplasma gondii, the protein was localized to the surface, including the flagella of Giardia trophozoites (45). This agrees with the idea that
the transmembrane domain, but not a motif or special structure inside the VSPH7 extracellular domain, is critical for its localization. Furthermore, we found that the VSPH7 cytoplasmic tail does not contain
a trafficking motif, but, because it is highly conserved, may have an
additional unknown function.
-subunit (
-adaptin
gene, GenBankTM/EBI accession number AF486293) and
-subunit (
-adaptin gene, accession number AF486294) as well as
the µ-subunit (GiMuA, accession number AAL82729; and
GiMuB, accession number AY078978) of putative APs have been identified,
supporting this idea.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. Dennis M. Dwyer and Cecilia Arighi for helpful discussion and John T. Conrad and Liudmila Kulakova for technical suggestions.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The on-line version of this article (available at
http://www.jbc.org) contains Supplemental Figs. 1-4.
§ To whom correspondence should be addressed: Lab. of Parasitic Diseases, NIAID, NIH, Bldg. 4, Rm. B1-06, 900 Rockville Pike, Bethesda, MD 20892. Tel.: 301-496-6920; Fax: 301-402-2689; E-mail: mtouz@niaid.nih.gov.
Published, JBC Papers in Press, December 3, 2002, DOI 10.1074/jbc.M208354200
2 M. C. Touz and T. E. Nash, unpublished data.
3 M. C. Touz, M. J. Nores, N. Gottig, and H. D. Luján, unpublished data.
4 M. C. Touz, H. D. Luján, and T. E. Nash, unpublished data.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: TGN, trans-Golgi network; PV, peripheral vacuole; AP, adaptor protein; ESCP, encystation-specific cysteine protease; HA, hemagglutinin; VSP, variant-specific surface protein; mAb, monoclonal antibody; PBS, phosphate-buffered saline; CWP, cyst wall protein; ESVs, encystation-specific secretory vesicles.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Schekman, R., and Orci, L. (1996) Science 271, 1526-1533[Abstract] |
| 2. | Hunziker, W., and Geuze, H. J. (1996) Bioessays 18, 379-389[CrossRef][Medline] [Order article via Infotrieve] |
| 3. | Le Borgne, R., and Hoflack, B. (1998) Biochim. Biophys. Acta 1404, 195-209[Medline] [Order article via Infotrieve] |
| 4. | Conibear, E., and Stevens, T. H. (1998) Biochim. Biophys. Acta 1404, 211-230[Medline] [Order article via Infotrieve] |
| 5. | Gu, F., Crump, C. M., and Thomas, G. (2001) Cell. Mol. Life Sci. 58, 1067-1084[CrossRef][Medline] [Order article via Infotrieve] |
| 6. | Lanfredi-Rangel, A., Attias, M., de Carvalho, T. M., Kattenbach, W. M., and De Souza, W. (1998) J. Struct. Biol. 123, 225-235[CrossRef][Medline] [Order article via Infotrieve] |
| 7. |
Touz, M. C.,
Nores, M. J.,
Slavin, I.,
Carmona, C.,
Conrad, J. T.,
Mowatt, M. R.,
Nash, T. E.,
Coronel, C. E.,
and Luján, H. D.
(2002)
J. Biol. Chem.
277,
8474-8481 |
| 8. | Feely, D. E., and Dyer, J. K. (1987) J. Protozool. 34, 80-83[Medline] [Order article via Infotrieve] |
| 9. | Lindmark, D. G. (1988) Exp. Parasitol. 65, 141-147[CrossRef][Medline] [Order article via Infotrieve] |
| 10. | Ward, W., Alvarado, L., Rawlings, N. D., Engel, J. C., Franklin, C., and McKerrow, J. H. (1997) Cell 89, 437-444[CrossRef][Medline] [Order article via Infotrieve] |
| 11. |
Adam, R. D.
(2001)
Clin. Microbiol. Rev.
14,
447-475 |
| 12. | McCaffery, J. M., Faubert, G. M., and Gillin, F. D. (1994) Exp. Parasitol. 79, 236-249[CrossRef][Medline] [Order article via Infotrieve] |
| 13. | Slavin, I., Saura, A., Carranza, P. G., Touz, M. C., Nores, M. J., and Luján, H. D. (2002) Mol. Biochem. Parasitol. 122, 95-98[CrossRef][Medline] [Order article via Infotrieve] |
| 14. | Dell'Angelica, E. C., and Payne, G. S. (2001) Cell 106, 395-398[CrossRef][Medline] [Order article via Infotrieve] |
| 15. |
Bonifacino, J. S.,
and Dell'Angelica, E. C.
(1999)
J. Cell Biol.
145,
923-926 |
| 16. | Elmendorf, H. G., Singer, S. M., Pierce, J., Cowan, J., and Nash, T. E. (2001) Mol. Biochem. Parasitol. 113, 157-169[CrossRef][Medline] [Order article via Infotrieve] |
| 17. | Geiser, M., Cebe, R., Drewello, D., and Schmitz, R. (2001) BioTechniques 31, 88-90[Medline] [Order article via Infotrieve] |
| 18. | Nash, T. E., Aggarwal, A., Adam, R. D., Conrad, J. T., and Merritt, J. W., Jr. (1988) J. Immunol. 141, 636-641[Abstract] |
| 19. | Keister, D. B. (1983) Trans. R Soc. Trop. Med. Hyg. 77, 487-488[CrossRef][Medline] [Order article via Infotrieve] |
| 20. |
Boucher, S. E.,
and Gillin, F. D.
(1990)
Infect. Immun.
58,
3516-3522 |
| 21. | Singer, S. M., Yee, J., and Nash, T. E. (1998) Mol. Biochem. Parasitol. 92, 59-69[CrossRef][Medline] [Order article via Infotrieve] |
| 22. |
Yee, J.,
and Nash, T. E.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
5615-5619 |
| 23. |
Luján, H. D.,
Mowatt, M. R.,
Conrad, J. T.,
Bowers, B.,
and Nash, T. E.
(1995)
J. Biol. Chem.
270,
29307-29313 |
| 24. |
Hayman, J. R.,
Hayes, S. F.,
Amon, J.,
and Nash, T. E.
(2001)
Infect. Immun.
69,
7057-7066 |
| 25. |
Wubbolts, R.,
Fernandez-Borja, M.,
Oomen, L.,
Verwoerd, D.,
Janssen, H.,
Calafat, J.,
Tulp, A.,
Dusseljee, S.,
and Neefjes, J.
(1996)
J. Cell Biol.
135,
611-622 |
| 26. | Nash, T. E., and Mowatt, M. R. (1992) Mol. Biochem. Parasitol. 51, 219-227[CrossRef][Medline] [Order article via Infotrieve] |
| 27. | Nash, T. E., Conrad, J. T., and Mowatt, M. R. (1995) J. Eukaryotic Microbiol. 42, 604-609[Medline] [Order article via Infotrieve] |
| 28. | Traub, L. M., and Kornfeld, S. (1997) Curr. Opin. Cell Biol. 9, 527-533[CrossRef][Medline] [Order article via Infotrieve] |
| 29. | Adam, R. D. (2000) Int. J. Parasitol. 30, 475-484[CrossRef][Medline] [Order article via Infotrieve] |
| 30. | Mowatt, M. R., Luján, H. D., Cotten, D. B., Bowers, B., Yee, J., Nash, T. E., and Stibbs, H. H. (1995) Mol. Microbiol. 15, 955-963[CrossRef][Medline] [Order article via Infotrieve] |
| 31. | Luján, H. D., Mowatt, M. R., and Nash, T. E. (1997) Microbiol. Mol. Biol. Rev. 61, 294-304[Abstract] |
| 32. | Luján, H. D., Mowatt, M. R., Conrad, J. T., and Nash, T. E. (1996) Biol. Cell 86, 11-18[CrossRef][Medline] [Order article via Infotrieve] |
| 33. |
Marks, M. S.,
Woodruff, L.,
Ohno, H.,
and Bonifacino, J. S.
(1996)
J. Cell Biol.
135,
341-354 |
| 34. |
Ohno, H.,
Aguilar, R. C.,
Yeh, D.,
Taura, D.,
Saito, T.,
and Bonifacino, J. S.
(1998)
J. Biol. Chem.
273,
25915-25921 |
| 35. | Papanastasiou, P., Bruderer, T., Li, Y., Bommeli, C., and Kohler, P. (1997) Mol. Biochem. Parasitol. 86, 13-27[Medline] [Order article via Infotrieve] |
| 36. | Papanastasiou, P., McConville, M. J., Ralton, J., and Kohler, P. (1997) Biochem. J. 322, 49-56 |
| 37. |
Luján, H. D.,
Mowatt, M. R., Wu, J. J., Lu, Y.,
Lees, A.,
Chance, M. R.,
and Nash, T. E.
(1995)
J. Biol. Chem.
270,
13807-13813 |
| 38. |
Nash, T. E.,
Luján, H. T.,
Mowatt, M. R.,
and Conrad, J. T.
(2001)
Infect. Immun.
69,
1922-1923 |
| 39. |
Honsho, M.,
Mitoma, J. Y.,
and Ito, A.
(1998)
J. Biol. Chem.
273,
20860-20866 |
| 40. |
Yang, M.,
Ellenberg, J.,
Bonifacino, J. S.,
and Weissman, A. M.
(1997)
J. Biol. Chem.
272,
1970-1975 |
| 41. |
Itin, C.,
Schindler, R.,
and Hauri, H. P.
(1995)
J. Cell Biol.
131,
57-67 |
| 42. | Itin, C., Foguet, M., Kappeler, F., Klumperman, J., and Hauri, H. P. (1995) Biochem. Soc. Trans. 23, 541-544[Medline] [Order article via Infotrieve] |
| 43. |
Watson, R. T.,
and Pessin, J. E.
(2001)
Am. J. Physiol.
281,
C215-C223 |
| 44. | Touz, M. C., Nores, M. J., Slavin, I., Piacenza, L., Acosta, D., Carmona, C., and Luján, H. D. (2002) Biochem. J. 364, 703-710[CrossRef][Medline] [Order article via Infotrieve] |
| 45. |
Marti, M., Li, Y.,
Kohler, P.,
and Hehl, A. B.
(2002)
Infect. Immun.
70,
1014-1016 |
| 46. |
Luján, H. D.,
Marotta, A.,
Mowatt, M. R.,
Sciaky, N.,
Lippincott-Schwartz, J.,
and Nash, T. E.
(1995)
J. Biol. Chem.
270,
4612-4618 |
| 47. | Reiner, D. S., McCaffery, M., and Gillin, F. D. (1990) Eur. J. Cell Biol. 53, 142-153[Medline] [Order article via Infotrieve] |
| 48. | Reiner, D. S., McCaffery, J. M., and Gillin, F. D. (2001) Cell Microbiol. 3, 459-472[CrossRef][Medline] [Order article via Infotrieve] |
| 49. |
Touz, M. C.,
Gottig, N.,
Nash, T. E.,
and Luján, H. D.
(2002)
J. Biol. Chem.
277,
50557-50563 |
This article has been cited by other articles:
![]() |
X. Que, J. C. Engel, D. Ferguson, A. Wunderlich, S. Tomavo, and S. L. Reed Cathepsin Cs Are Key for the Intracellular Survival of the Protozoan Parasite, Toxoplasma gondii J. Biol. Chem., February 16, 2007; 282(7): 4994 - 5003. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gottig, E. V. Elias, R. Quiroga, M. J. Nores, A. J. Solari, M. C. Touz, and H. D. Lujan Active and Passive Mechanisms Drive Secretory Granule Biogenesis during Differentiation of the Intestinal Parasite Giardia lamblia J. Biol. Chem., June 30, 2006; 281(26): 18156 - 18166. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Touz, L. Kulakova, and T. E. Nash Adaptor Protein Complex 1 Mediates the Transport of Lysosomal Proteins from a Golgi-like Organelle to Peripheral Vacuoles in the Primitive Eukaryote Giardia lamblia Mol. Biol. Cell, July 1, 2004; 15(7): 3053 - 3060. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||