|
Originally published In Press as doi:10.1074/jbc.M210326200 on December 23, 2002
J. Biol. Chem., Vol. 278, Issue 9, 7108-7118, February 28, 2003
Efficient Reduction of Target RNAs by Small Interfering
RNA and RNase H-dependent Antisense Agents
A COMPARATIVE ANALYSIS*
Timothy A.
Vickers ,
Seongjoon
Koo,
C.
Frank
Bennett,
Stanley T.
Crooke,
Nicholas M.
Dean, and
Brenda F.
Baker
From the GeneTrove Division and Antisense Core Research Department,
Isis Pharmaceuticals, Inc., Carlsbad, California 92008
Received for publication, October 9, 2002, and in revised form, December 20, 2002
 |
ABSTRACT |
RNA interference can be considered as an
antisense mechanism of action that utilizes a double-stranded RNase to
promote hydrolysis of the target RNA. We have performed a comparative
study of optimized antisense oligonucleotides designed to work by an
RNA interference mechanism to oligonucleotides designed to work by an
RNase H-dependent mechanism in human cells. The potency,
maximal effectiveness, duration of action, and sequence specificity of
optimized RNase H-dependent oligonucleotides and small
interfering RNA (siRNA) oligonucleotide duplexes were evaluated and
found to be comparable. Effects of base mismatches on activity were
determined to be position-dependent for both siRNA
oligonucleotides and RNase H-dependent oligonucleotides. In
addition, we determined that the activity of both siRNA
oligonucleotides and RNase H-dependent oligonucleotides is
affected by the secondary structure of the target mRNA. To
determine whether positions on target RNA identified as being
susceptible for RNase H-mediated degradation would be coincident with
siRNA target sites, we evaluated the effectiveness of siRNAs designed
to bind the same position on the target mRNA as RNase
H-dependent oligonucleotides. Examination of 80 siRNA
oligonucleotide duplexes designed to bind to RNA from four distinct
human genes revealed that, in general, activity correlated with the
activity to RNase H-dependent oligonucleotides designed to
the same site, although some exceptions were noted. The one major
difference between the two strategies is that RNase H-dependent oligonucleotides were determined to be active
when directed against targets in the pre-mRNA, whereas siRNAs were not. These results demonstrate that siRNA oligonucleotide- and RNase H-dependent antisense strategies are both valid
strategies for evaluating function of genes in cell-based assays.
 |
INTRODUCTION |
RNA interference has become a powerful and widely
used tool for the analysis of gene function in invertebrates and plants (1, 2). Introduction of long double-stranded RNA into the cells of
these organisms leads to the sequence-specific degradation of
homologous gene transcripts. The long double-stranded RNA molecules are
metabolized to small 21-23-nucleotide interfering RNAs
(siRNAs)1 by the action of an
endogenous ribonuclease, Dicer (3, 4). The siRNA molecules bind to a
protein complex, termed RNA-induced silencing complex, which contains a
helicase activity that unwinds the two strands of RNA molecules,
allowing the antisense strand to bind to the targeted RNA molecule (4,
5) and an endonuclease activity that hydrolyzes the target RNA at the
site where the antisense strand is bound. It is unknown whether the
antisense RNA molecule is also hydrolyzed or recycles and binds to
another RNA molecule. Therefore, RNA interference is an antisense
mechanism of action, since ultimately a single-stranded RNA molecule
binds to the target RNA molecule by Watson-Crick base pairing rules and
recruits a ribonuclease that degrades the target RNA.
In mammalian cells, long double-stranded RNA molecules were found to
promote a global change in gene expression, obscuring any gene-specific
silencing (6, 7). This reduction in global gene expression is thought
to be mediated in part through activation of double-stranded
RNA-activated protein kinase which phosphorylates and inactivates the
translation factor eukaryotic initiation factor 2 (8). Recently, it
has been shown that transfection of synthetic 21-nucleotide siRNA
duplexes into mammalian cells does not elicit the RNA-activated protein
kinase response, allowing effective inhibition of endogenous genes in a
sequence-specific manner (9, 10). These siRNAs are too short to trigger
the nonspecific double-stranded RNA responses, but they still promote
degradation of complementary RNA sequences (9, 11).
Multiple mechanisms exist by which short synthetic oligonucleotides can
be used to modulate gene expression in mammalian cells (12). A commonly
exploited antisense mechanism is RNase H-dependent degradation of the targeted RNA. RNase H is a ubiquitously expressed endonuclease that recognizes a DNA-RNA heteroduplex, hydrolyzing the
RNA strand (13, 14). Antisense oligonucleotides that contain at least
five consecutive deoxynucleotides are substrates for human RNase H (15,
16). Thus, the RNase H-dependent antisense mechanism
differs from the siRNA mechanism by utilizing RNase H, instead of a
double-stranded RNase, as the terminating mechanism.
Initial reports in which siRNA was compared with single-stranded
antisense approaches to gene knockdown have indicated that the siRNA is
more potent and effective than a traditional antisense approach (4,
10). However, the antisense molecules used in these experiments were
single-stranded unmodified RNA, which is rapidly degraded and does not
recruit RNase H to cleave the target. Phosphorothioate
oligodeoxynucleotides are first generation antisense agents that have
been widely used to modulate gene expression in cell-based
assays, in animal models, and in the clinic (18). The
phosphorothioate modification dramatically increases the nuclease resistance of the oligonucleotide and still supports RNase H activity (19). Further improvements to phosphorothioate oligodeoxynucleotides have been made, resulting in second generation oligonucleotides such as
2'-O-methyl or 2'-O-methoxyethyl
modifications (15, 20). The 2'-O-methoxyethyl modification
is particularly attractive, since it increases the potency of the
oligonucleotide, further increases nuclease resistance, decreases
toxicity, and increases oral bioavailability (21-24).
In this report, we compare oligonucleotides that were designed to work
by a siRNA mechanism (siRNA oligonucleotides) to optimized first and
second generation antisense oligonucleotides that were designed to work
by an RNase H-dependent mechanism (RNase H
oligonucleotides). Active siRNA oligonucleotides and homologous RNase
H-dependent oligonucleotides were evaluated for relative
potency, efficacy, duration of action, sequence specificity, and site
of action within the cell to determine whether significant advantages
could be found for the different antisense strategies in cell-based
assays. Our results suggest that in human cell culture assays,
double-stranded oligoribonucleotides that work by siRNA mechanism
exhibit similar potency, efficacy, specificity, and duration of action
as RNase H oligonucleotides. Furthermore, as we have previously found
for RNase H oligonucleotides, not all sites on the target RNA are good
target sites for siRNA molecules. Like RNase H-dependent oligonucleotides, activity of siRNAs is affected by the secondary structure of the target RNA. Finally, siRNAs and RNase H
oligonucleotides appear to work upon the target mRNA at different
stages of its processing/metabolism.
 |
EXPERIMENTAL PROCEDURES |
Oligonucleotide Synthesis and siRNA Duplex
Formation--
Synthesis and purification of phosphorothioate-modified
oligodeoxynucleotides or chimeric
2'-O-methoxyethyl/deoxyphosphorothioate modified
oligonucleotides was performed using an Applied Biosystems 380B
automated DNA synthesizer as described previously (22). Sequences of
oligonucleotides and placement of 2'-O-methoxyethyl modifications are detailed in Tables I and II. RNA oligonucleotides were synthesized at Dharmacon Research, Inc. (Boulder, CO). siRNA duplexes were formed by combining 30 µl of each 50 µM
RNA oligonucleotide solution and 15 µl of 5× annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate) followed by heating for 1 min at
90 °C and then 1 h at 37 °C. Successful annealing was
confirmed by nondenaturing polyacrylamide gel electrophoresis. The
melting temperatures (Tm) were experimentally
determined for a subset of siRNA tested as described previously (15).
In each case, the measured Tm values were greater
than 55 °C. The predicted Tm values for all siRNA
duplexes used in this paper were >50 °C (100 mM salt,
0.1 µM oligonucleotide).
Cell Culture--
T24 cells, (American Type Tissue Culture
Collection, Manassas, VA) were cultivated in Dulbecco's
modified Eagle's medium supplemented with 10% fetal bovine serum in
six-well culture dishes at a density of 250,00 cells/well.
Oligonucleotides were administered to cells using Lipofectin reagent
(Invitrogen) as described previously (25, 26). Other transfection
reagents were evaluated (e.g. Transit TKO, LipofectAMINE
2000, and Oligofectamine) and found to provide similar levels of
siRNA-mediated target reduction in T24 cells (data not shown); however,
Lipofectin was determined to be superior to the other transfection
reagents for RNase H-dependent oligonucleotide
administration. In addition, LipofectAMINE was found to be more toxic
to the cells than Lipofectin, and Transit TKO failed to provide
consistent results for delivery of siRNA molecules. Optimal
Lipofectin/oligonucleotide ratios were empirically determined for both
siRNAs and RNase H-dependent oligonucleotides. For RNase H
antisense oligonucleotides, cells were incubated with a mixture of 3 µg/ml Lipofectin per 100 nM oligonucleotide in OptiMEM
medium (Invitrogen), whereas siRNA duplexes were incubated with a
mixture of 6 µg/ml Lipofectin per 100 nM siRNA duplex. Since concentrations reported in the paper represent concentration of
the siRNA duplex, the same weight/Lipofectin ratio was maintained for
siRNA duplexes and antisense oligonucleotides. After 4 h, the
transfection mixture was aspirated from the cells and replaced with
fresh Dulbecco's modified Eagle's medium plus 10% fetal calf serum
and incubated at 37 °C, 5% CO2 until harvest.
To induce CD54 mRNA expression, oligonucleotide-treated cells were
incubated overnight and then treated with 5 ng/ml TNF- (R&D Systems,
Minneapolis, MN) for 2-3 h prior to harvest of cells for RNA
expression analysis. For analysis of cell surface expression of CD54
protein, cells were induced with 5 ng/ml TNF- immediately following
the transfection and incubated overnight.
RNA Expression Analysis--
Total RNA was harvested at the
indicated times following the beginning of transfection using an RNeasy
Mini preparation kit (Qiagen, Valencia, CA) according to the
manufacturer's protocol. Gene expression was analyzed using
quantitative RT-PCR essentially as described elsewhere (27). Briefly,
200 ng of total RNA was analyzed in a final volume of 50 µl
containing 200 nM gene-specific PCR primers, 0.2 mM each dNTP, 75 nM fluorescently labeled
oligonucleotide probe, 1× RT-PCR buffer, 5 mM
MgCl2, 2 units of Platinum Taq DNA polymerase
(Invitrogen), and 8 units of ribonuclease inhibitor. Reverse
transcription was performed for 30 min at 48 °C followed by PCR: 40 thermal cycles of 30 s at 94 °C and 1 min at 60 °C using an
ABI Prism 7700 Sequence Detector (Applied Biosystems; Foster City,
CA). All mRNA expression was normalized to levels of GAPDH
mRNA, also determined by quantitative RT-PCR, from the same total
RNA samples. The following primer/probe sets were used: c-raf kinase (accession number X03484), forward primer
(AGCTTGGAAGACGATCAGCAA), reverse primer
(AAACTGCTGAACTATTGTAGGAGAGATG), and probe
(AGATGCCGTGTTTGATGGCTCCAGCX); CD54 (accession number
J03132), forward primer (CATAGAGACCCCGTTGCCTAAA), reverse primer
(TGGCTATCTTCTTGCACATTGC), and probe
(CTCCTGCCTGGGAACAACCGGAAX); PTEN (accession number U92436),
forward primer (AATGGCTAAGTGAAGATGACAATCAT), reverse primer
(TGCACATATCATTACACCAGTTCGT), and probe
(TTGCAGCAATTCACTGTAAAGCTGGAAAGGX); Bcl-x (accession
number Z23115), forward primer (TGCAGGTATTGGTGAGTCGG), reverse primer
(TCCAAGGCTCTAGGTGGTCATT), and probe
(TCGCAGCTTGGATGGCCACTTACCTX); GAPDH (accession number
X01677), forward primer (GAAGGTGAAGGTCGGAGTC), reverse primer
(GAAGATGGTGATGGGATTTC), and probe (CAAGCTTCCCGTTCTCAGCCX); COREST (accession number NM_015156), forward primer
(ACAATCCCATTGACATTGAGGTT), reverse primer (TTTGCTCTATTTTTAGCTTGTGTGCT),
and probe (AAGGAGGTTCCCCCTACTGAGACAGTTCCTX); Notch homolog 2 (accession number NM_024408), forward primer
(TGGCAACTAACGTAGAAACTCAACA), reverse primer (TGCCAAGAGCATGAATACAGAGA),
and probe (ACAACTATAGACTTGCTCATTGTTCAGACTGATTGCCX); PAK1
(accession number U51120), forward primer (TGTGATTGAACCACTTCCTGTCA), reverse primer (GGAGTGGTGTTATTTTCAGTAGGTGAA), and probe
(TCCAACTCGGGACGTGGCTACAX); CARD-4 (accession number
NM_006092), forward primer (GCAGGCGGGACTATCAGGA), reverse primer
(AGTTTGCCGACCAGACCTTCT), and probe
(TCCACTGCCTCCAT- GATGCAAGCCX).
Flow Cytometry--
Following oligonucleotide treatment, cells
were detached from the plates with Dulbecco's phosphate-buffered
saline (without calcium and magnesium) supplemented with 4 mM EDTA. Cells were transferred to microcentrifuge tubes,
pelleted at 5000 rpm for 1 min, and washed in 2% bovine serum albumin,
0.2% sodium azide in Dulbecco's phosphate-buffered saline at 4 °C.
PE anti-human CD54 antibody (catalog no. 555511; Pharmingen, San Diego,
CA) was then added at 1:20 in 0.1 ml of the above buffer. The antibody was incubated with the cells for 30 min at 4 °C in the dark. Cells were washed again as above and resuspended in 0.3 ml of PBS buffer with
0.5% paraformaldehyde. Cells were analyzed on a Becton Dickinson FACScan. Results are expressed as percentage of control expression based upon the mean fluorescence intensity.
Luciferase Assays--
For luciferase-based reporter gene
assays, 10 µg of plasmid pGL3-5132-S0 or pGL3-5132-S20 (26) was
introduced into COS-7 cells at 70% confluence in 10-cm dishes using
SuperFect Reagent (Qiagen). Following a 2-h treatment, cells were
trypsinized and split into 24-well plates. Cells were allowed to adhere
for 1 h, and then RNase H or siRNA oligonucleotides were added in
the presence of Lipofectin reagent as detailed above. All
oligonucleotide treatments were performed in duplicate or triplicate.
Following the 4-h oligonucleotide treatment, cells were washed, and
fresh Dulbecco's modified Eagle's medium containing 10% fetal calf
serum was added. The cells were incubated overnight at 37 °C. The
following morning, cells were harvested in 150 µl of passive lysis
buffer (Promega, Madison, WI), and 60 µl of lysate was added to each well of a black 96-well plate followed by 50 µl of luciferase assay
reagent (Promega). Luminescence was measured using a Packard TopCount
microplate scintillation counter.
Statistical Analyses of Gene Screen Data--
Simple statistical
analyses were conducted to examine the association between siRNA and
RNase H oligonucleotide screens. Similarity between the two screens for
a given gene was measured by using correlation coefficients and average
difference. Two different correlation measures were employed:
Pearson's product-moment correlation coefficient, which measures a
linear relationship between siRNA and RNase H oligonucleotide screens,
and Spearman's rank-order correlation coefficient, which measures a
linear relationship between the potency of siRNA and RNase H
oligonucleotide screens. One-sample one-tailed t tests were
conducted for observed correlation coefficients to assess whether they
are significantly greater than the null hypothesis of no correlation.
Statistical inference on observed average difference was conducted by
randomizing sample pairs of siRNA and RNase H oligonucleotide screen.
Again, one-tailed tests were used to determine whether the observed
distances are significantly smaller than those expected from random
chance. The association between siRNA and RNase H oligonucleotide
screen was further examined by the receiver operating characteristic (ROC) analysis. First, siRNAs were classified as potent when the percentage inhibition rate was smaller than the median value of 67.4%
for the CD54 siRNA screen and 57.1% for the PTEN screen. An arbitrary
cut-off was then set for RNase H oligonucleotide screens. RNase H
oligonucleotides with percentage inhibition rates smaller than this
cut-off value were classified as potent. From the classification of
siRNAs and RNase H oligonucleotides, a 2 × 2 contingency table
was constructed. Finally, true positive rate (TPR) and false positive
rate (FPR) were determined based on this table. For example, TPR is the
number of cases where potent RNase H oligonucleotides correspond to
potent siRNAs divided by the number of potent siRNAs. Similarly, FPR is
the number of cases where potent RNase H oligonucleotides corresponds
to nonpotent siRNAs divided by the number of nonpotent siRNAs. For
CD54, a cut-off value of 70% gives TPR = 75% and FPR = 45%. For the PTEN gene, a cut-off of 40% gives TPR = 72% and
FPR = 44%. By varying these cut-off values, a ROC curve can be
drawn on a plane spanned by FPR and TPR. The area under the ROC curve
provides a measure of overall accuracy.
 |
RESULTS |
Active RNase H-dependent Antisense Oligonucleotide
Target Sites Predict siRNA Target Sites--
Since both siRNAs and
RNase H-dependent oligonucleotides must hybridize to target
RNA and subsequently direct specific RNases to bind and cleave the
bound RNA (15, 28), we examined whether an active RNase H
oligonucleotide site would also be an active siRNA site. Initially,
siRNAs were designed and synthesized based upon the target sequences of
active RNase H oligonucleotides previously identified. ISIS 5132 is a
20-base phosphorothioate oligodeoxynucleotide that targets the
3'-untranslated region of human c-raf kinase mRNA and
specifically reduces expression of both mRNA and protein (29). An
siRNA duplex (si5132) composed of 21-nt sense and 21-nt antisense
strands was designed using the first 19 nucleotides of the target site
for ISIS 5132 in the paired region and unpaired 2-nt 3'-dTdT overhangs.
T24 cells were treated with oligonucleotides at doses ranging from 3 to
300 nM as detailed under "Experimental Procedures."
Total RNA was analyzed for expression of c-raf mRNA by
quantitative RT-PCR. The results, shown in Fig.
1A, are normalized to GAPDH
mRNA expression. Both ISIS 5132 (solid bars)
and the corresponding siRNA to the same target site (open
bars) were found to inhibit the expression of the
c-raf kinase mRNA, each with an IC50 of
~50 nM. siRNAs targeted to human CD54 and Bcl-X had no
effect on the expression of c-raf (data not shown).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1.
Comparative activity of RNase
H-dependent oligonucleotides and siRNA
oligonucleotides. T24 cells were dosed at 3-300 nM
with RNase H or siRNA oligonucleotides as detailed under
"Experimental Procedures." Total RNA was harvested the following
day, and mRNA expression was assessed by quantitative RT-PCR.
Results shown represent percentage of untreated control expression. All
expression data are normalized to GAPDH mRNA expression.
A, c-raf kinase; B, Bcl-X;
C, PTEN. Solid bars, RNase
H-dependent oligonucleotides; open
bars, siRNA.
|
|
Chimeric oligonucleotides in which 2'-O-methoxyethyl
(2'-MOE) substituted nucleosides flank a central unmodified
2'-oligodeoxynucleotide region that serves as substrate for RNase H
region have been shown to have increased potency and duration of action
as compared with phosphorothioate oligodeoxynucleotides (22). ISIS
16009 is a 20-base chimeric oligonucleotide that has previously been
demonstrated to be an effective inhibitor of human Bcl-X (31). Another
20-base chimeric oligonucleotide, ISIS 116847, has been shown to
effectively inhibit expression of the human PTEN gene (32). The siRNA
versions, si16009 and si116847, as well as the homologous parent RNase
H-dependent oligonucleotides were transfected into T24
cells at doses ranging from 10 to 200 nM. In both cases the
2'-MOE chimeric RNase H-dependent oligonucleotides
(solid bars) were slightly more potent inhibitors of mRNA expression than the corresponding siRNA (open
bars) (Fig. 1, B and C). In the case
of Bcl-X, the RNase H-dependent oligonucleotide has an
IC50 of ~30 nM, whereas the siRNA version,
si16009, has an IC50 of ~100 nM. PTEN is more
potently inhibited, with IC50 values of 10 and 25 nM for the RNase H oligonucleotide and siRNA, respectively.
RNase H-dependent oligonucleotides and siRNAs were also
compared for activity in T24 cells against CD54 (ICAM-1), a gene whose expression is induced by cytokine treatment. ISIS 2302, a first generation phosphorothioate oligodeoxynucleotide, hybridizes to the
3'-untranslated region of human CD54 (ICAM-1) and was previously shown
to be a potent and specific inhibitor of CD54 expression (33). Whereas
ISIS 2302 reduced ICAM-1 expression by 85%, si2302 had no inhibitory
effect on message levels at concentrations as high as 200 nM as measured by quantitative RT-PCR (data not shown).
Screening for Optimized RNase H and siRNA Oligonucleotides--
In
order to identify potent antisense agents, many investigators design
and test multiple oligonucleotides that target different sites and
regions of the target mRNA (33, 34). To determine if the lack of
activity of the CD54 siRNA molecule was due to suboptimal siRNA design
or to a blocking activity induced by TNF- treatment, we designed 40 siRNA and 40 2'-MOE chimeric oligonucleotides to the same sites of the
CD54 mRNA (Table I). The siRNA
duplexes were composed of 21-nt sense and 21-nt antisense
strands, paired in a manner to have a 19-nt duplex region and a 2-nt
overhang at each 3' terminus (Table I). The target sites included
various regions of the human CD54 message including 5'-untranslated
region (5'-UTR), coding region, and 3'-UTR. T24 cells were treated with oligonucleotides at a single concentration of 100 nM as
described under "Experimental Procedures." Active sequences were
identified in both the RNase H oligonucleotide and siRNA screens (Fig.
2). In the RNase H oligonucleotide screen
(solid bars), 12 of 40 oligonucleotides were
found to inhibit expression of CD54 mRNA by greater than 50% as
compared with the untreated control, whereas the siRNA screen
(open bars) identified 9 of 40 sequences as
active by the same criteria. Comparison of the active target sites
revealed that five of the nine active siRNA sites were also identified as active sites in the RNase H oligonucleotide screen. Similarly, the
majority of sites where the RNase H-dependent
oligonucleotide failed to inhibit expression, the siRNA also failed.
The data also indicate that regions of greater activity or "hot
spots" along the RNA transcript can be identified for both siRNA
oligonucleotides and RNase H-dependent oligonucleotides.
For example, homologous siRNAs and RNase H-dependent
oligonucleotides both show good activity in the ~200 nucleotide span
from base 1781 to 1971 of the 3'-untranslated region. These results
demonstrate that the initial lack of activity for the CD54 directed
siRNA molecules is not due to induction of an inhibitory factor by
TNF- treatment and that not all siRNA molecules designed to
hybridize to an RNA transcript are effective.
View this table:
[in this window]
[in a new window]
|
Table I
Sequence of CD54 RNase H-dependent oligonucleotides and
siRNAs
All oligonucleotides are full phosphorothioate with
2'-O-methoxyethyl substitutions at positions 1-5 and 16-20
(boldface type). Residues 6-15 are unmodified oligodeoxynucleotides,
so they can serve as substrates for RNase H. The corresponding siRNAs
use the same start position but are 19 rather than 20 nucleotides in
length and have dTdT additions at the 3'-end of each strand. The
GenBankTM accession number for CD54 is J03132.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 2.
CD54 antisense screen. A series of 40 chimeric oligonucleotides designed to work by an RNase
H-dependent mechanism and a series of corresponding siRNAs
were administered to T24 cells in the presence of Lipofectin
transfection reagent. The following day, CD54 expression was induced,
and RNA was harvested. CD54 mRNA expression was analyzed by
quantitative RT-PCR. Results represent the percentage of induced CD54
mRNA relative to untreated control. Solid
bars, RNase H oligonucleotides; open
bars, siRNAs. The target site start position is the 5'-most
nucleotide in the mRNA target.
|
|
Cell surface CD54 protein expression was also evaluated by flow
cytometry. Comparison of mRNA reduction and protein reduction for
the siRNA and RNase H-dependent oligonucleotides screens
are shown in Fig. 3A. In
general, the results are highly correlated with the same active targets
identified by either mRNA or protein reduction. However, several
oligonucleotides were identified that appear to produce a more robust
reduction of protein compared with the corresponding RNA (Fig. 3,
A and B). Note, however, that CD54 RNA and
protein were measured at different times following TNF- induction,
which may account for the discrepancies.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 3.
Comparison of mRNA and protein reduction
in CD54 siRNA oligonucleotide screen. A, cell surface
expression of CD54 was analyzed by flow cytometry following siRNA
administration and overnight induction of CD54 as detailed under
"Experimental Procedures." Solid bars,
mRNA reduction; striped bars, protein
reduction. B, comparison of RNase H-dependent
oligonucleotide and siRNA reduction of CD54 cell surface protein
expression. Results are presented as percentage of untreated control
expression. Solid bars, RNase
H- dependent oligonucleotides; open
bars, siRNAs.
|
|
Statistical analyses described under "Experimental Procedures" were
applied to siRNA and RNase H oligonucleotide screening data for CD54
mRNA reduction. The data were composed of two independent RNase H
oligonucleotide screens and five independent siRNA screens that were
averaged to produce composite siRNA/RNase H-dependent oligonucleotide screens. Pearson's correlation coefficient was determined to be 0.424 with a p value of 0.0032, and
Spearman's correlation coefficient was 0.426 with a p value
of 0.0039. The average difference between the two screens was 18.5%
with a p value of 0.0056. These results indicate that a
significant overlap exists between siRNA and RNase H oligonucleotide
screens in terms of correlation coefficients and average difference.
The association between siRNA and RNase H oligonucleotide activity was
further analyzed using ROC analysis. The area under the ROC curve is a summary of the overall diagnostic accuracy of the test that measures the correspondence between potent siRNA and RNase
H-dependent oligonucleotide sites. The area under the ROC
curve is 0.75 for CD54, suggesting that a significant concordance
exists between siRNA and RNase H-dependent oligonucleotide
binding sites on target RNAs.
A second comparative analysis was performed using 36 2'-MOE chimeric
oligonucleotides, 18 nucleotides in length, and a series of
corresponding siRNAs (Table II) targeted
to the human PTEN message. PTEN mRNA is constitutively expressed in
T24 cells. Cells were treated with siRNAs or RNase
H-dependent oligonucleotides as described under
"Experimental Procedures." As defined by a target mRNA
reduction of 50% or greater, 22 of the 36 RNase
H-dependent oligonucleotides (solid
bars) were identified as active (Fig. 4). In contrast, the siRNA screen
(open bars) identified only 12 of 36 sites as
active, defined by the same criteria. Of the 12 active siRNA
oligonucleotide sites, 10 were shared as active with the RNase
H-dependent oligonucleotide screen, with only 2 of the
active siRNAs not identified in the RNase H-dependent
oligonucleotide screen.
View this table:
[in this window]
[in a new window]
|
Table II
Sequence of human PTEN RNase H-dependent oligonucleotides
and siRNAs
All oligonucleotides are full phosphorothioate with
2'-O-methoxyethyl substitutions at positions 1-4 and 15-18
(boldface type). Residues 5-14 are unmodified
2'-oligodeoxynucleotides, so they can serve as substrates for RNase H. The corresponding siRNAs use the same start position but are 19 rather
than 18 nucleotides in length and have dTdT additions at the 3'-end of
each strand. The GenBankTM accession number for PTEN is U92436
|
|

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 4.
PTEN oligonucleotide screen. A
series of 36 chimeric RNase H-dependent oligonucleotides
and a series of corresponding siRNAs were administered to T24 cells in
the presence of Lipofectin reagent. After 16 h, total RNA was
harvested, and PTEN mRNA levels were accessed by quantitative
RT-PCR as detailed under "Experimental Procedures." Results are the
percentage of PTEN mRNA relative to untreated control.
Solid bars, chimeric RNase H
oligonucleotides; open bars, siRNA
oligonucleotides.
|
|
The RNase H/siRNA oligonucleotide screens for PTEN were repeated three
separate times. A statistical analysis of the composite data from the
three experiments was performed as detailed above. Pearson's
correlation coefficient was determined to be 0.425 with a p
value of 0.0049, and Spearman's correlation coefficient was 0.318 with
a p value of 0.0299. The average difference between the two
screens was 21.3% with p value of 0.0038. These results suggest that a significant association exists between siRNA- and RNase
H-dependent oligonucleotide screens in terms of Pearson's correlation coefficient and average difference. ROC analysis of these
data give a value of 0.588 for PTEN. Whereas the data for the PTEN
screens are not as highly significant as those for CD54, they do
demonstrate a reasonable, although not perfect, correlation between
siRNA and RNase H-dependent oligonucleotide binding sites.
Effect of RNA Secondary Structure on Activity--
We have
previously demonstrated that the secondary structure of the mRNA
target strongly influences activity of RNase H-dependent oligonucleotides in cell culture (26). A luciferase reporter system was
developed in which the target site for ISIS 5132 was cloned into the
5'-UTR of the luciferase reporter plasmid pGL3-Control. Sequence
immediately adjacent to the target sequence was altered to form various
RNA secondary structures that included the 5132 target sequence. These
structures ranged from one in which the entire target site was
sequestered in a 20-base stem closed by a UUGC tetraloop
(pGL3-5132-S20) to one that had little predicted secondary structure
likely to inhibit hybridization of RNase H oligonucleotide to target
(pGL3-5132-S0) (26).
The activities of ISIS 5132 and si5132 were compared using the
pGL3-5132-S20 and pGL3-5132-S0 constructs. The reporter plasmids were
transfected into COS-7 cells as detailed under "Experimental Procedures." Following the plasmid transfection, cells were seeded in
24-well plates and treated with ISIS 5132 or si5132 at doses ranging
from 10 to 300 nM. Lysates from the treated cells were assayed for luciferase activity 16 h later. When directed against the message with no structure (pGL3-5132-S0), both ISIS 5132 (open circles) and si5132 (open
triangles) effectively reduced luciferase expression in a
dose-dependent manner with IC50 values between 30 and 100 nM (Fig. 5), which
is consistent with the observed IC50 for endogenous message
reduction. Conversely, neither the RNase H oligonucleotide
(solid circles) nor siRNA (solid
triangles) were found to inhibit luciferase expression when
directed against the highly structured target (pGL3-5132-S20) at
concentrations up to 300 nM. Therefore, the secondary
structure of the target has an equally important effect on reduction of
target RNA by both types of antisense oligonucleotides.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 5.
Inhibition of alternate structure clones by
ISIS 5132/si5132. Cells were transfected with luciferase reporter
plasmids and then treated with chimeric RNase H-dependent
oligonucleotide/siRNA at doses ranging from 3 to 300 nM.
Luciferase expression was measured the following day. Results are the
percentage of luciferase expression compared with the untreated
control. Open circles/triangles,
pGL5132-S0 target; solid
circles/triangles, pGL5132-S20 target.
Circles, ISIS 5132. Triangles, si5132.
|
|
Sequence Specificity of RNase H-dependent
Oligonucleotides and siRNA--
The sequence fidelity of the RNA
interference pathway has been evaluated to a limited extent in several
hallmark systems, including C. elegans (35) and
Drosophila cell extracts (28), and more recently in
mammalian cell culture (9, 36). Several investigators have reported
that incorporation of one or two mismatches into a siRNA construct,
with respect to the target RNA, is sufficient to disable
RNA interference activity against the target RNA. A common attribute of
each of the mismatch constructs tested thus far, however, has been
location of the mismatches in the center domain of the construct. To
further define the fidelity of the RNA interference pathway for perfect
Watson-Crick base pair matched sequences, we tested an additional type
of construct, wherein a mismatch was incorporated in each of the 5'-
and 3'-terminal domains of the siRNA targeting PTEN (si116847). The
same mismatches were also incorporated into ISIS 116847, an RNase H
oligonucleotide. When the mismatches were placed in the center of the
sequence, a complete loss of activity was observed for both siRNAs and
RNase H-dependent oligonucleotides at a concentration of
100 nM (Fig. 6). In contrast
to the duplex with two mismatches positioned in the center of the siRNA
(gridded bars), the siRNA with mismatches in the
outside domains (open bars) demonstrated only a
moderate loss of activity in comparison with the perfect match
construct (cross-hatched bars). The results for the RNase
H-dependent oligonucleotide were similar, although the
RNase H-dependent oligonucleotide containing mismatches on
the ends demonstrated a greater loss of activity than was observed for
the homologous siRNA (71% versus 52% control).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 6.
Sequence specificity of RNase H and siRNA
oligonucleotides. The effect of base mismatches on siRNA/RNase
H-dependent oligonucleotides activity was evaluated. Two
mismatches were incorporated in the center (MM2_2) or on the ends
(MM2_1) of the ISIS 116847 or si116847 sequence as shown. Sequence
changes in the MM2_1 and MM2_2 oligonucleotides are
underlined. The day after RNase H-dependent
oligonucleotide/siRNA treatment, total RNA was harvested, and PTEN
mRNA reduction was assessed by quantitative RT-PCR. The results
shown are percentage of untreated control expression. Black
bars, mock-treated; cross-hatched
bars, perfect match; open bars, 2MM_1;
gridded bars, 2MM_2.
|
|
Comparison of Potency and Efficacy--
Comparison of the relative
potency of siRNAs directed to the same site on the target RNA as an
optimized RNase H oligonucleotide revealed that the RNase H
oligonucleotide exhibited similar or better potency as defined by
IC50 values compared with the siRNA (Fig. 1). The siRNA and
RNase H-dependent oligonucleotides also exhibited a similar
level of efficacy as defined by the maximal level of target RNA
reduction. Since the siRNA molecules used for these analysis were not
selected as the optimal siRNA molecules for the respective target based
upon screening numerous siRNA sequences, we compared the most effective
siRNA molecule derived from the siRNA screen (Fig. 4) with an optimized
second generation chimeric oligonucleotide to PTEN. The different
antisense agents, tested at concentrations ranging from 10 to 200 nM in T24 cells, produced a similar dose-response curve
with IC50 values near 10 nM (Fig.
7A). Additionally, both agents
reduced PTEN mRNA levels by greater than 90%.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 7.
Comparative potency. T24 cells were
dosed at 10-200 nM with optimized RNase H oligonucleotides
or siRNAs. Total RNA was harvested the following day, and mRNA
expression was assessed by quantitative RT-PCR. Results shown are
percentage of untreated control expression. All expression data are
normalized to GAPDH mRNA expression. A, PTEN;
B, CD54 (ICAM-1). Solid bars, RNase
H-dependent oligonucleotides; open
bars, siRNA.
|
|
Similarly, the most effective siRNA from the CD54 screen was compared
with its corresponding second generation RNase H oligonucleotide, which
showed a similar degree of efficacy in the primary screen. T24 cells
were treated with either the siRNA, si121747, or the oligonucleotide,
ISIS 121747, at concentrations ranging from 10 to 200 nM.
As with PTEN, the CD54 siRNA and chimeric oligonucleotide produced
similar dose-response curves with IC50 values of ~15 nM for the siRNA and 30 nM for the
oligonucleotide for reduction of TNF- -induced CD54 mRNA
expression. The efficacy was almost identical with maximal reduction of
~85% for both antisense agents.
Duration of Action--
We compared the duration of action of a
second generation RNase H oligonucleotide and siRNA in T24 cells using
human Bcl-X as a target (Fig. 8). Cells
were seeded in six-well dishes so that they would be 80-90% confluent
at the time of harvest. In T24 cells, inhibition of Bcl-X by siRNA
(open bars) was found to be maximal at 24 h
post-transfection and returned to normal levels by day 5. The results
were similar for RNase H oligonucleotide treatment (solid
bars) except that maximal activity was achieved at 8 h.
In both cases, activity began to taper off between 48 and 96 h,
and by 120 h, no significant inhibition of targeted message was
seen with either the RNase H oligonucleotide or the siRNA.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 8.
Duration of action. Cells were seeded in
six-well dishes so that they would be 80-90% confluent at the time of
harvest. RNase H-dependent oligonucleotide/siRNA treatment
was at 100 nM with ISIS 16009 or si16009 as detailed above.
Total RNA was harvested 8, 24, 48, 72, 96, 120, and 144 h after
the initiation of transfection. Bcl-x mRNA levels were accessed by
quantitative RT-PCR and normalized to GAPDH expression in the same
cells. Solid bars, RNase H-dependent
oligonucleotide; open bars, siRNA.
|
|
Effects of Targeting Intron Sequences--
To compare the site of
activity of siRNA oligonucleotides and RNase H-dependent
oligonucleotides and directly, siRNA duplexes were designed based upon
several previously identified active RNase H oligonucleotide sites that
target intron sequences (shown in Table
III), with the assumption that RNA
transcripts containing introns would only be found in the nucleus. The
target sites for COREST and PAK1 are contained completely within the
introns, whereas the target sites for caspase recruitment domain 4 and
Notch homolog 2 overlap the indicated intron/exon boundary with 10 nucleotides on either side (Table III). T24 cells were treated with the
RNase H oligonucleotide or the corresponding siRNA at a single dose of
200 nM as described above. The results are shown in Fig.
9. In all cases, the RNase H
oligonucleotides effectively reduced the targeted message
(striped bars), whereas an RNase H
oligonucleotide targeted to another gene, tumor necrosis factor
receptor 2, had no effect on gene expression (gray
bars). In contrast, the homologous siRNAs did not reduce
mRNA levels for any of the four genes in which introns were
targeted (open bars); nor was any nonspecific reduction observed using siRNAs targeted to tumor necrosis factor receptor 2 (cross-hatched bars). As a control, another gene,
c-raf, was included, in which the target was in the exon. As
previously demonstrated (Fig. 1A), the siRNA targeted to the
c-raf exon did reduce message expression. These data support
the hypothesis that siRNA activity is primarily cytoplasmic and
therefore does not interact with pre-mRNA.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of intron targeting. siRNA
duplexes were designed based upon several previously identified active
RNase H-dependent oligonucleotide sites that target intron
sequence (shown in Table III). Cells were treated with siRNAs and
homologous RNase H-dependent oligonucleotides at 200 nM, and total RNA was harvested 20 h after the
initiation of transfection. mRNA levels for each gene were accessed
by quantitative RT-PCR normalized to GAPDH expression. Black
bars, mock-transfected; striped bars,
specific RNase H-dependent oligonucleotide; open
bars, specific siRNA; gray bars, RNase
H-dependent oligonucleotide control;
cross-hatched bars, siRNA control.
|
|
 |
DISCUSSION |
Multiple mechanisms exist by which synthetic oligonucleotides can
be used to regulate gene expression in mammalian cells (12). To date,
the most successful strategy has been to design oligonucleotides that
hybridize to a target RNA by Watson-Crick base-pairing rules (i.e. antisense oligonucleotides). Once bound, antisense
oligonucleotides can disable target RNAs by two broadly defined
processes: disruption of RNA function by occupancy of critical sites
and degradation of targeted RNA. Within these two broadly defined
processes, multiple mechanisms are possible. Examples of "occupancy
only" mechanisms include inhibition of translation (37), modulation
of pre-mRNA splicing (38), and modulation of polyadenylation (39).
In each case, the antisense oligonucleotides were found to be potent and selective regulators of gene expression.
Several endogenous enzymes can be exploited to promote targeted
cleavage of RNAs in cells. One of the most widely exploited mechanisms
is RNase H-mediated cleavage of targeted RNA. RNase H represents a
ubiquitously expressed family of cellular enzymes that hydrolyze the
RNA strand of an RNA-DNA heteroduplex. There are additional RNases
present in mammalian cells that can be exploited for antisense
inhibition of gene expression. As an example, we have reported that a
single-stranded phosphorothioate modified RNA molecule can promote
selective loss of Ha-ras in human cells (40).
Small interfering RNAs have been gaining widespread acceptance as a
valuable tool for inhibiting gene expression in mammalian cells. In
mammalian cells, like RNase H-dependent oligonucleotides, siRNAs bind to targeted RNA by Watson-Crick base pairing and induce site-specific cleavage of the RNA by specific RNases. The RNase that
recognizes the duplex formed by the siRNA molecule has not been
identified to date; however, the substrate specificity suggest that it
is a double-stranded specific RNase (28). Since siRNA is an antisense
mechanism resulting in loss of target RNA, we sought to directly
compare siRNA-mediated with RNase H-mediated degradation of target RNA
(12).
It has recently been reported that siRNA efficacy is highly dependent
upon target position (36). Since RNase H-dependent oligonucleotides are also known to be dependent upon target position (34, 41), siRNAs were designed to previously identified RNase H-dependent oligonucleotide binding sites to determine
whether active RNase H-dependent oligonucleotide binding
sites would be predictive of active siRNA sites. In three of four cases
(ISIS 5132, ISIS 116847, and ISIS 16009), active siRNAs that targeted a
site previously shown to be a good target site for RNase
H-dependent oligonucleotides showed activity comparable
with that of the RNase H-dependent oligonucleotide. One
hypothesis for the lack of activity observed against the ISIS 2302 target, CD54, was that the siRNA mechanism is not amenable to silencing
of TNF- -induced genes. This turned out not to be the case, since
screening 40 siRNA molecules targeting different regions of the CD54
mRNA identified several active siRNAs.
Analysis of oligonucleotide screens against both CD54 and PTEN
confirmed that target position is an important factor in determining siRNA activity. Our data suggest that there is an imperfect correlation between RNase H and siRNA oligonucleotide activity when they are designed to bind different regions of the target RNA. In general, sites
on the target RNA that were not active with RNase
H-dependent oligonucleotides were similarly not good sites
for siRNA. Conversely, a significant degree of correlation between
active RNase H oligonucleotides and siRNA was found, suggesting that if
a site is available for hybridization to an RNase H oligonucleotide,
then it is also available for hybridization and cleavage by the siRNA
complex. However, some exceptions were noted, with sites identified
that apparently were poor RNase H-dependent oligonucleotide
targets but effective siRNA targets and vice versa. This
dichotomy could be due to additional factors other than RNA
accessibility, such as sequence preferences for the respective
nucleases. Differences in activity between siRNAs and RNase
H-dependent oligonucleotides may also result from
structural differences between pre-mRNA and mRNA, which appear to be the targets for RNase H and siRNA oligonucleotides, respectively. Our data suggest that the secondary structure of the target RNA is an
important determinant of activity for both siRNA and RNase H antisense
oligonucleotides, and it can be assumed that the structure of a
pre-mRNA containing intron sequences will be different from the
structure of mature mRNA.
To determine whether siRNA molecules were more potent or effective
inhibitors of gene expression in human cells, we compared an optimized
siRNA molecule to an optimized 2'-MOE chimeric antisense molecule
targeting either PTEN or CD54. In both cases, the oligonucleotides working by either antisense mechanism exhibited similar potencies in
T24 cells. Additionally, both types of oligonucleotides inhibited the
respective target genes by more than 90%. Some investigators have
reported greater siRNA efficacy in cultured cells (9, 36). However,
others have reported activity comparable with what we report in this
paper (11, 42, 43). One possible explanation for this difference would
be that the siRNA molecules used in our studies were not optimally
designed. For example, it has been demonstrated that a 5'-phosphate
group is required for optimal siRNA activity (44). Since the siRNA
oligonucleotides used in these experiments were not synthesized with
5'-phosphates, it is possible that greater potency would have been
observed had the siRNA oligonucleotides been phosphorylated. However,
published experiments (45) have revealed that there are no differences in efficiencies of 5'-phosphorylated and nonphosphorylated siRNAs in
mammalian cells, since siRNA duplexes with free 5'-hydroxyls and 2-nt
3' overhangs are readily phosphorylated in the cell. Our own results
confirm these observations (i.e. we did not see an increase
in activity with siRNA molecules containing a 5'-phosphate) (data not
shown). A more plausible explanation for the decreased siRNA potency in
our study compared with others is the method chosen to quantify target
reduction. Most other published studies have measured siRNA efficacy at
the protein level. We chose instead to assay target reduction at the
mRNA level using quantitative RT-PCR. Comparison of target protein
and mRNA reduction demonstrates that several oligonucleotides
appear to produce a more robust reduction of protein compared with the
corresponding mRNA (Fig. 3, A and B).
Additionally, the extreme sensitivity of quantitative RT-PCR compared
with other assay methods may overrepresent RNA reduced to very low levels.
Both siRNA and the RNase H-dependent oligonucleotides gave
similar duration of action in cultured cells, each showing a gradual recovery of mRNA expression over 4-6 days. These results are in agreement with those reported previously for siRNAs (36) and second
generation RNase H oligonucleotides (22). First generation phosphorothioate-modified oligodeoxynucleotides exhibit a duration of
action and tissue half-life ranging from 24 to 48 h (46, 47). In
contrast, the second generation 2'-MOE-modified oligonucleotides used
for the these studies exhibit a significant increase in nuclease resistance, resulting in a prolonged duration of action and tissue half-life from 5 to 10 days (22, 23). If one takes into account the
biostability of phosphorothioate-modified 2'-MOE antisense (23, 48) and
predicted stability of unmodified double-stranded RNA oligonucleotides,
this result is somewhat surprising and suggests that the siRNA
molecules may be protected from nucleases in cells. From this limited
comparison, the onset of the RNase H-dependent activity
appears to be slightly earlier than that of the siRNA. This may be a
result of differences arising from the RNase H oligonucleotide acting
in the nucleus on the pre-mRNA while siRNA acts cytoplasmically on
the mature mRNA. Our data as well as other published data (49, 50)
suggest that the siRNA mechanism of action is restricted to the
cytoplasm. In contrast, our results as well as previous publications
(51, 52) suggest that RNase H oligonucleotides are capable of binding
to pre-mRNA in the cell nucleus. There may be specific applications
in which it may be desired to utilize an RNase H oligonucleotides to
inhibit all RNA variants derived from a single transcript or
alternatively to selectively discriminate alternative spliced
transcripts using siRNA in the cytoplasm.
The fidelity for perfect base pair matches for both types of
oligonucleotides was investigated by designing oligonucleotides with
internal or external 2-base mismatches. Activity was completely lost
when 2-base mismatches were made in the central domain of either the
RNase H-dependent oligonucleotide or siRNA. When mismatches were placed near the ends of the sequence, activity was reduced, but
not completely. The loss of activity was greater for the RNase H-dependent oligonucleotide than the siRNA but not
significantly so. Therefore, the two types of antisense
oligonucleotides exhibit similar sequence selectivity.
In conclusion, we have compared RNase H-dependent antisense
oligonucleotides with siRNA molecules targeting several human genes in
cell-based assays. These studies have demonstrated that optimized siRNA
and RNase H-dependent oligonucleotides behave similarly in
terms of potency, maximal effects, specificity, and duration of action
and efficiency. It remains to be determined whether siRNA molecules
work broadly for in vivo applications. In a preliminary
report of a siRNA molecule delivered to mice, the authors administered
the oligonucleotide by rapid tail vein injection of a large volume of
fluid (high pressure delivery) (53). It is not clear whether
administration of siRNA molecules by more clinically acceptable
practices will result in effective delivery to target tissues. In
contrast, delivery of RNase H oligonucleotides to a variety of target
tissues by a parenteral and nonparenteral routes of administration with
subsequent inhibition of gene expression has been well documented in
rodents, non-human primates, and humans (17, 23, 30, 32, 48, 54-57).
Both strategies, however, appear to be equally valid approaches for
cell-based analysis of gene function in vitro.
 |
ACKNOWLEDGEMENT |
We thank John Reed for critical review of
the manuscript.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: GeneTrove Division,
Isis Pharmaceuticals, Inc., 2292 Faraday Ave., Carlsbad, CA 92008. Tel.: 760-603-2367; E-mail: tvickers@isisph.com.
Published, JBC Papers in Press, December 23, 2002, DOI 10.1074/jbc.M210326200
 |
ABBREVIATIONS |
The abbreviations used are:
siRNA, small
interfering RNA;
RT, reverse transcriptase;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
ROC, receiver operating
characteristic;
TPR, true positive rate;
FPR, false positive rate;
nt, nucleotide;
2'-MOE, 2'-O-methoxyethyl;
ICAM, intercellular
adhesion molecule;
TNF, tumor necrosis factor.
 |
REFERENCES |
| 1.
|
Fraser, A. G.,
Kamath, R. S.,
Zipperlen, P.,
Martinez-Campos, M.,
Sohrmann, M.,
and Ahringer, J.
(2000)
Nature
408,
325-330[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Gönczy, P.,
Echeverri, G.,
Oegema, K.,
Coulson, A.,
Jones, S. J.,
Copley, R. R.,
Duperon, J.,
Oegema, J.,
Brehm, M.,
Cassin, E.,
Hannak, E.,
Kirkham, M.,
Pichler, S.,
Flohrs, K.,
Goessen, A.,
Leidel, S.,
Alleaume, A. M.,
Martin, C.,
Ozlu, N.,
Bork, P.,
and Hyman, A. A.
(2000)
Nature
408,
331-336[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Grishok, A.,
Tabara, H.,
and Mello, C. C.
(2000)
Science
287,
2494-2497[Abstract/Free Full Text]
|
| 4.
|
Zamore, P. D.,
Tuschl, T.,
Sharp, P. A.,
and Bartel, D. P.
(2000)
Cell
101,
25-33[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Zamore, P. D.
(2002)
Science
296,
1265-1269[Abstract/Free Full Text]
|
| 6.
|
Tuschl, T.,
Zamore, P. D.,
Lehmann, R.,
Barkel, D. P.,
and Sharp, P. A.
(1999)
Genes Dev.
13,
3191-3197[Abstract/Free Full Text]
|
| 7.
|
Caplen, N. J.,
Fleenor, J.,
and Morgan, A. F. A.
(2000)
Gene (Amst.)
252,
95-105[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Der, S. D.,
Yang, Y. L.,
Weissmann, C.,
and Williams, B. R. G.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
3279-3283[Abstract/Free Full Text]
|
| 9.
|
Elbashir, S. M.,
Harborth, J.,
Lendeckel, W.,
Yalcin, A.,
Weber, K.,
and Tuschl, T.
(2001)
Nature
411,
494-498[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Caplen, N. J.,
Parrish, S.,
Imani, F.,
Fire, A.,
and Morgan, R. A.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
9742-9747[Abstract/Free Full Text]
|
| 11.
|
Novina, C. D.,
Murray, M. F.,
Dykxhoorn, D. M.,
Beresford, P. J.,
Riess, J.,
Lee, S.-K.,
Collman, R. G.,
Lieberman, J.,
Shankar, P.,
and Sharp, P. A.
(2002)
Nat. Med.
8,
681-686[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Crooke, S. T.
(1999)
Biochim. Biophys. Acta
1489,
30-42
|
| 13.
|
Crouch, R. J.,
and Dirksen, M. L.
(1982)
Cold Spring Harbor Monogr. Ser.
14,
211-254
|
| 14.
|
Lima, W. F., Wu, H.,
and Crooke, S. T.
(2001)
Methods Enzymol.
341,
430-440[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Monia, B. P.,
Lesnik, E. A.,
Gonzalez, C.,
Lima, W. F.,
McGee, D.,
Guinosso, C. J.,
Kawasaki, A. M.,
Cook, P. D.,
and Freier, S. M.
(1993)
J. Biol. Chem.
268,
14514-14522[Abstract/Free Full Text]
|
| 16.
|
Wu, H.,
Lima, W. F.,
and Crooke, S. T.
(1999)
J. Biol. Chem.
274,
28270-28278[Abstract/Free Full Text]
|
| 17.
|
Webb, A.,
Cunningham, D.,
Cotter, F.,
Clarke, P. A.,
di Stefano, F.,
Ross, P.,
Corbo, M.,
and Dziewanowska, Z.
(1997)
Lancet
349,
1137-1141[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Henry, S. P.,
Monteith, D.,
and Levin, A. A.
(1997)
Anti-cancer Drug Des.
12,
395-408[Medline]
[Order article via Infotrieve]
|
| 19.
|
Eckstein, F.
(2000)
Antisense Nucleic Acid Drug Dev.
10,
117-121[Medline]
[Order article via Infotrieve]
|
| 20.
|
Agrawal, S.,
Jiang, Z.,
Zhao, Q.,
Shaw, D.,
Cai, Q.,
Roskey, A.,
Channavajjala, L.,
Saxinger, C.,
and Zhang, R.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2620-2625[Abstract/Free Full Text]
|
| 21.
|
Henry, S.,
Stecker, K.,
Brooks, D.,
Monteith, D.,
Conklin, B.,
and Bennett, C. F.
(2000)
J. Pharmacol. Exp. Ther.
292,
468-479[Abstract/Free Full Text]
|
| 22.
|
McKay, R. A.,
Miraglia, L. J.,
Cummins, L. L.,
Owens, S. R.,
Sasmor, H.,
and Dean, N. M.
(1999)
J. Biol. Chem.
274,
1715-1722[Abstract/Free Full Text]
|
| 23.
|
Geary, R. S.,
Khatsenko, O.,
Bunker, K.,
Crooke, R.,
Moore, M.,
Burchkin, T.,
Truong, L.,
Sasmor, H.,
and Levin, A. A.
(2001)
J. Pharmacol. Exp. Ther.
296,
898-904[Abstract/Free Full Text]
|
| 24.
|
Geary, R. S.,
Watanabe, T. A.,
Truong, L.,
Freier, S.,
Lesnik, E. A.,
Sioufi, N. B.,
Sasmor, H.,
Manoharaon, M.,
and Levin, A. A.
(2001)
J. Pharmacol. Exp. Ther.
296,
890-897[Abstract/Free Full Text]
|
| 25.
|
Chiang, M.-Y.,
Chan, H.,
Zounes, M. A.,
Freier, S. M.,
Lima, W. F.,
and Bennett, C. F.
(1991)
J. Biol. Chem.
266,
18162-18171[Abstract/Free Full Text]
|
| 26.
|
Vickers, T. A.,
Wyatt, J. R.,
and Freier, S. M.
(2000)
Nucleic Acids Res.
28,
1340-1347[Abstract/Free Full Text]
|
| 27.
|
Winer, J.,
Kwang, C.,
Jung, S.,
Shackel, I.,
and Williams, P. M.
(1999)
Anal. Biochem.
270,
41-49[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Elbashir, S. M.,
Martinez, J.,
Patkaniowska, A.,
Lendeckel, W.,
and Tuschl, T.
(2001)
EMBO J.
20,
6877-6888[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Monia, B. P.,
Sasmor, H.,
Johnston, J. F.,
Freier, S. M.,
Lesnik, E. A.,
Muller, M.,
Geiger, T.,
Altmann, K.-H.,
Moser, H.,
and Fabbro, D.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
15481-15484[Abstract/Free Full Text]
|
| 30.
|
Yacyshyn, B. R.,
Bowen-Yacyshyn, M. B.,
Jewell, L.,
Tami, J. A.,
Bennett, C. F.,
Kisner, D. L.,
Shanahan, J.,
and William, R.
(1998)
Gastroenterology
114,
1133-1142[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Taylor, J. K.,
Zhang, Q. Q.,
Monia, B. P.,
Marcusson, E. G.,
and Dean, N. M.
(1999)
Oncogene
18,
4495-4504[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Butler, M.,
McKay, R. A.,
Popoff, I. J.,
Gaarde, W. A.,
Witchell, D.,
Murray, S. F.,
Dean, N. M.,
Bhanot, S.,
and Monia, B. P.
(2002)
Diabetes
51,
1028-1034[Abstract/Free Full Text]
|
| 33.
|
Bennett, C. F.,
Condon, T. P.,
Grimm, S.,
Chan, H.,
and Chiang, M. Y.
(1994)
J. Immunol.
152,
3530-3540[Abstract]
|
| 34.
|
Monia, B. P.,
Johnston, J. F.,
Geiger, T.,
Muller, M.,
and Fabbro, D.
(1996)
Nat. Med.
2,
668-675[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Parrish, S. F. J., Xu, S.,
Mello, C.,
and Fire, A.
(2000)
Mol. Cell
6,
1077-1087[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Holen, T.,
Amarzguioui, M.,
Wiiger, M.,
Babaie, E.,
and Prydz, H.
(2002)
Nucleic Acids Res.
30,
1757-1766[Abstract/Free Full Text]
|
| 37.
|
Baker, B. F.,
Lot, S. S.,
Condon, T. P.,
Cheng-Flournoy, S.,
Lesnik, E. A.,
Sasmor, H. M.,
and Bennett, C. F.
(1997)
J. Biol. Chem.
272,
11994-12000[Abstract/Free Full Text]
|
| 38.
|
Kole, R.,
and Mercatante, D.
(2001)
in
Antisense Technology: Principles, Strategies and Applications
(Crooke, S. T., ed)
, pp. 517-539, Marcel Dekker, Inc., New York
|
| 39.
|
Vickers, T. A.,
Wyatt, J. R.,
Burckin, T.,
Bennett, C. F.,
and Freier, S. M.
(2001)
Nucleic Acids Res.
29,
1293-1299[Abstract/Free Full Text]
|
| 40.
|
Wu, H.,
Macleod, A. R.,
Lima, W. F.,
and Crooke, S. T.
(1998)
J. Biol. Chem.
273,
2532-2542[Abstract/Free Full Text]
|
| 41.
|
Bennett, C. F.,
Chiang, M.-Y.,
Wilson-Lingardo, L.,
and Wyatt, J. R.
(1994)
Nucleic Acids Res.
22,
3202-3209[Abstract/Free Full Text]
|
| 42.
| Heidenreich, O., Krauter, J., Riehle, H., Hadwiger, P., John, M., Heil,
G., Vornlocher, H.-P., and Nordheim, A. (2002) Blood, in
press
|
| 43.
|
Lee, J. C.,
Schickling, O.,
Stegh, A. H.,
Oshima, R. G.,
Dinsdale, D.,
Cohen, G. M.,
and Peter, M. E.
(2002)
J. Cell Biol.
158,
1051-1066[Abstract/Free Full Text]
|
| 44.
|
Nykänen, A.,
Haley, B.,
and Zamore, P. D.
(2001)
Cell
107,
309-321[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Elbashir, S. M.,
Harborth, J.,
Weber, K.,
and Tuschl, T.
(2002)
Methods
26,
199-213[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Dean, N. M.,
and McKay, R.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
11762-11766[Abstract/Free Full Text]
|
| 47.
|
Agrawal, S.,
Temsamani, J.,
and Tang, J. Y.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
7595-7599[Abstract/Free Full Text]
|
| 48.
|
Zhang, Z.,
Cook, J.,
Nickel, J., Yu, R.,
Stecker, K.,
Myers, K.,
and Dean, N. M.
(2000)
Nat. Biotechnol.
18,
862-867[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Martinez, J.,
Patkaniowska, A.,
Urlaub, H.,
Lührmann, R.,
and Tuschl, T.
(2002)
Cell
110,
563-574[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Zeng, Y.,
and Cullen, B. R.
(2002)
RNA
8,
855-860[Abstract]
|
| 51.
|
Lorenz, P.,
Misteli, T.,
Baker, B. F.,
Bennett, C. F.,
and Spector, D. L.
(2000)
Nucleic Acids Res.
28,
582-592[Abstract/Free Full Text]
|
| 52.
|
Condon, T. P.,
and Bennett, C. F.
(1996)
J. Biol. Chem.
271,
30398-30403[Abstract/Free Full Text]
|
| 53.
|
Lewis, D. L.,
Hagstrom, J. E.,
Loomis, A. G.,
Wolff, J. A.,
and Herweijer, H.
(2002)
Nat. Genet.
32,
107-108[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Geary, R., Yu, R.,
Leeds, J.,
Templin, M.,
Watanabe, T.,
Henry, S.,
and Levin, A.
(2001)
in
Antisense Technology: Principles, Strategies and Applications
(Crooke, S. T., ed)
, pp. 119-154, Marcel Dekker, Inc., New York
|
| 55.
|
Butler, M.,
Stecker, K.,
and Bennett, C. F.
(1997)
Lab. Invest.
77,
379-388[Medline]
[Order article via Infotrieve]
|
| 56.
|
Mehta, R. C.,
Stecker, K. K.,
Cooper, S. R.,
Templin, M. V.,
Tsai, Y. J.,
Condon, T. P.,
Bennett, C. F.,
and Hardee, G. E.
(2000)
J. Invest. Dermatol.
115,
805-812[CrossRef][Medline]
[Order article via Infotrieve]
|
| 57.
|
Nyce, J. W.,
and Metzger, W. J.
(1997)
Nature
385,
721-725[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. G. Fong, T. A. Vickers, E. A. Farber, C. Choi, U. J. Yun, Y. Hu, S. H. Yang, C. Coffinier, R. Lee, L. Yin, et al.
Activating the synthesis of progerin, the mutant prelamin A in Hutchinson-Gilford progeria syndrome, with antisense oligonucleotides
Hum. Mol. Genet.,
July 1, 2009;
18(13):
2462 - 2471.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Klingelhoefer, L. Moutsianas, and C. Holmes
Approximate Bayesian feature selection on a large meta-dataset offers novel insights on factors that effect siRNA potency
Bioinformatics,
July 1, 2009;
25(13):
1594 - 1601.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Zhou, J. Zhang, C. Wang, J. R. Bliesath, Q. He, D. Yu, Z. Li-He, and F. Wong-Staal
A method for detecting and preventing negative RNA interference in preparation of lentiviral vectors for siRNA delivery
RNA,
April 1, 2009;
15(4):
732 - 740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. I. Rudnick, J. Swaminathan, M. Sumaroka, S. Liebhaber, and A. M. Gewirtz
Effects of local mRNA structure on posttranscriptional gene silencing
PNAS,
September 16, 2008;
105(37):
13787 - 13792.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. R. Clark, J. S. Pober, and M. S. Kluger
Knockdown of TNFR1 by the sense strand of an ICAM-1 siRNA: dissection of an off-target effect
Nucleic Acids Res.,
March 27, 2008;
36(4):
1081 - 1097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. A. Vickers, W. F. Lima, J. G. Nichols, and S. T. Crooke
Reduced levels of Ago2 expression result in increased siRNA competition in mammalian cells
Nucleic Acids Res.,
October 8, 2007;
35(19):
6598 - 6610.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Shao, C. Y. Chan, A. Maliyekkel, C. E. Lawrence, I. B. Roninson, and Y. Ding
Effect of target secondary structure on RNAi efficiency
RNA,
October 1, 2007;
13(10):
1631 - 1640.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ichihara, Y. Murakumo, A. Masuda, T. Matsuura, N. Asai, M. Jijiwa, M. Ishida, J. Shinmi, H. Yatsuya, S. Qiao, et al.
Thermodynamic instability of siRNA duplex is a prerequisite for dependable prediction of siRNA activities
Nucleic Acids Res.,
September 25, 2007;
35(18):
e123 - e123.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Chen, J. N. Rao, T. Zou, L. Liu, B. S. Marasa, L. Xiao, X. Zeng, D. J. Turner, and J.-Y. Wang
Polyamines are required for expression of Toll-like receptor 2 modulating intestinal epithelial barrier integrity
Am J Physiol Gastrointest Liver Physiol,
September 1, 2007;
293(3):
G568 - G576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Matveeva, Y. Nechipurenko, L. Rossi, B. Moore, P. Saetrom, A. Y. Ogurtsov, J. F. Atkins, and S. A. Shabalina
Comparison of approaches for rational siRNA design leading to a new efficient and transparent method
Nucleic Acids Res.,
April 10, 2007;
(2007)
gkm088v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. E. Swayze, A. M. Siwkowski, E. V. Wancewicz, M. T. Migawa, T. K. Wyrzykiewicz, G. Hung, B. P. Monia, and a. C. F. Bennett
Antisense oligonucleotides containing locked nucleic acid improve potency but cause significant hepatotoxicity in animals
Nucleic Acids Res.,
January 28, 2007;
35(2):
687 - 700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Holen
Efficient prediction of siRNAs with siRNArules 1.0: An open-source JAVA approach to siRNA algorithms
RNA,
September 1, 2006;
12(9):
1620 - 1625.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Nishitsuji, M. Kohara, M. Kannagi, and T. Masuda
Effective Suppression of Human Immunodeficiency Virus Type 1 through a Combination of Short- or Long-Hairpin RNAs Targeting Essential Sequences for Retroviral Integration.
J. Virol.,
August 1, 2006;
80(15):
7658 - 7666.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. T. Samuel, C. S. Choi, T. G. Phillips, A. J. Romanelli, J. G. Geisler, S. Bhanot, R. McKay, B. Monia, J. R. Shutter, R. A. Lindberg, et al.
Targeting foxo1 in mice using antisense oligonucleotide improves hepatic and peripheral insulin action.
Diabetes,
July 1, 2006;
55(7):
2042 - 2050.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Kusov, T. Kanda, A. Palmenberg, J.-Y. Sgro, and V. Gauss-Muller
Silencing of Hepatitis A Virus Infection by Small Interfering RNAs.
J. Virol.,
June 1, 2006;
80(11):
5599 - 5610.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Y. Ogurtsov, S. A. Shabalina, A. S. Kondrashov, and M. A. Roytberg
Analysis of internal loops within the RNA secondary structure in almost quadratic time
Bioinformatics,
June 1, 2006;
22(11):
1317 - 1324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Hough, I. Clements, P. J. Welch, and K. A. Wiederholt
Differentiation of Mouse Embryonic Stem Cells after RNA Interference-Mediated Silencing of OCT4 and Nanog
Stem Cells,
June 1, 2006;
24(6):
1467 - 1475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Chan, M. Gilbert, K. M. Thompson, H. N. Marsh, D. M. Epstein, and P. S. Pendergrast
Co-expression of anti-NF{kappa}B RNA aptamers and siRNAs leads to maximal suppression of NF{kappa}B activity in mammalian cells
Nucleic Acids Res.,
March 3, 2006;
34(5):
e36 - e36.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Koller, S. Propp, H. Zhang, C. Zhao, X. Xiao, M. Chang, S. A. Hirsch, P. J. Shepard, S. Koo, C. Murphy, et al.
Use of a Chemically Modified Antisense Oligonucleotide Library to Identify and Validate Eg5 (Kinesin-Like 1) as a Target for Antineoplastic Drug Development
Cancer Res.,
February 15, 2006;
66(4):
2059 - 2066.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kalota, L. Karabon, C. R. Swider, E. Viazovkina, M. Elzagheid, M. J. Damha, and A. M. Gewirtz
2'-Deoxy-2'-fluoro-{beta}-D-arabinonucleic acid (2'F-ANA) modified oligonucleotides (ON) effect highly efficient, and persistent, gene silencing
Nucleic Acids Res.,
January 18, 2006;
34(2):
451 - 461.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. KRAYNACK and B. F. BAKER
Small interfering RNAs containing full 2'-O-methylribonucleotide-modified sense strands display Argonaute2/eIF2C2-dependent activity
RNA,
January 1, 2006;
12(1):
163 - 176.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Atkinson, K. W. Young, S. J. Ennion, J. N. C. Kew, S. R. Nahorski, and R. A. J. Challiss
Altered Expression of Gq/11{alpha} Protein Shapes mGlu1 and mGlu5 Receptor-Mediated Single Cell Inositol 1,4,5-Trisphosphate and Ca2+ Signaling
Mol. Pharmacol.,
January 1, 2006;
69(1):
174 - 184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Holen, S. E. Moe, J. G. Sorbo, T. J. Meza, O. P. Ottersen, and A. Klungland
Tolerated wobble mutations in siRNAs decrease specificity, but can enhance activity in vivo
Nucleic Acids Res.,
August 19, 2005;
33(15):
4704 - 4710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. L. Juliano, V. R. Dixit, H. Kang, T. Y. Kim, Y. Miyamoto, and D. Xu
Epigenetic manipulation of gene expression: a toolkit for cell biologists
J. Cell Biol.,
June 20, 2005;
169(6):
847 - 857.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Watts, V. P. Manchem, T. A. Leedom, A. L. Rivard, R. A. McKay, D. Bao, T. Neroladakis, B. P. Monia, D. M. Bodenmiller, J. X.-C. Cao, et al.
Reduction of Hepatic and Adipose Tissue Glucocorticoid Receptor Expression With Antisense Oligonucleotides Improves Hyperglycemia and Hyperlipidemia in Diabetic Rodents Without Causing Systemic Glucocorticoid Antagonism
Diabetes,
June 1, 2005;
54(6):
1846 - 1853.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Valgardsdottir, I. Chiodi, M. Giordano, F. Cobianchi, S. Riva, and G. Biamonti
Structural and Functional Characterization of Noncoding Repetitive RNAs Transcribed in Stressed Human Cells
Mol. Biol. Cell,
June 1, 2005;
16(6):
2597 - 2604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Rosette, R. B. Roth, P. Oeth, A. Braun, S. Kammerer, J. Ekblom, and M. F. Denissenko
Role of ICAM1 in invasion of human breast cancer cells
Carcinogenesis,
May 1, 2005;
26(5):
943 - 950.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. S. E. Heale, H. S. Soifer, C. Bowers, and J. J. Rossi
siRNA target site secondary structure predictions using local stable substructures
Nucleic Acids Res.,
February 18, 2005;
33(3):
e30 - e30.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Yuan, P. K. M. Cheung, H. M. Zhang, D. Chau, and D. Yang
Inhibition of Coxsackievirus B3 Replication by Small Interfering RNAs Requires Perfect Sequence Match in the Central Region of the Viral Positive Strand
J. Virol.,
February 15, 2005;
79(4):
2151 - 2159.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Westerhout, M. Ooms, M. Vink, A. T. Das, and B. Berkhout
HIV-1 can escape from RNA interference by evolving an alternative structure in its RNA genome
Nucleic Acids Res.,
February 1, 2005;
33(2):
796 - 804.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Hasselblatt, B. Hockenjos, C. Thoma, H. E. Blum, and W.-B. Offensperger
Translation of stable hepadnaviral mRNA cleavage fragments induced by the action of phosphorothioate-modified antisense oligodeoxynucleotides
Nucleic Acids Res.,
January 7, 2005;
33(1):
114 - 125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Drygin, S. Barone, and C. F. Bennett
Sequence-dependent cytotoxicity of second-generation oligonucleotides
Nucleic Acids Res.,
December 16, 2004;
32(22):
6585 - 6594.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Moreno, A. Hidalgo, F. Cava, R. Fernandez-Lafuente, J. M. Guisan, and J. Berenguer
Use of an Antisense RNA Strategy To Investigate the Functional Significance of Mn-Catalase in the Extreme Thermophile Thermus thermophilus
J. Bacteriol.,
November 15, 2004;
186(22):
7804 - 7806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Yano, K. Hirabayashi, S.-i. Nakagawa, T. Yamaguchi, M. Nogawa, I. Kashimori, H. Naito, H. Kitagawa, K. Ishiyama, T. Ohgi, et al.
Antitumor Activity of Small Interfering RNA/Cationic Liposome Complex in Mouse Models of Cancer
Clin. Cancer Res.,
November 15, 2004;
10(22):
7721 - 7726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Davidson, S. Harel, V. A. Arboleda, G. F. Prunell, M. L. Shelanski, L. A. Greene, and C. M. Troy
Highly Efficient Small Interfering RNA Delivery to Primary Mammalian Neurons Induces MicroRNA-Like Effects before mRNA Degradation
J. Neurosci.,
November 10, 2004;
24(45):
10040 - 10046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Hu, S. Hipolito, R. Lynn, V. Abraham, S. Ramos, and F. Wong-Staal
Relative gene-silencing efficiencies of small interfering RNAs targeting sense and antisense transcripts from the same genetic locus
Nucleic Acids Res.,
August 27, 2004;
32(15):
4609 - 4617.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Xu, H. Kang, M. Fisher, and R. L. Juliano
Strategies for Inhibition of MDR1 Gene Expression
Mol. Pharmacol.,
August 1, 2004;
66(2):
268 - 275.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ding, C. Y. Chan, and C. E. Lawrence
Sfold web server for statistical folding and rational design of nucleic acids
Nucleic Acids Res.,
July 1, 2004;
32(suppl_2):
W135 - W141.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Wu, W. F. Lima, H. Zhang, A. Fan, H. Sun, and S. T. Crooke
Determination of the Role of the Human RNase H1 in the Pharmacology of DNA-like Antisense Drugs
J. Biol. Chem.,
April 23, 2004;
279(17):
17181 - 17189.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Li, H. Yin, and J. Kuret
Casein Kinase 1 Delta Phosphorylates Tau and Disrupts Its Binding to Microtubules
J. Biol. Chem.,
April 16, 2004;
279(16):
15938 - 15945.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Carette, R. M. Overmeer, F. H. E. Schagen, R. Alemany, O. A. Barski, W. R. Gerritsen, and V. W. van Beusechem
Conditionally Replicating Adenoviruses Expressing Short Hairpin RNAs Silence the Expression of a Target Gene in Cancer Cells
Cancer Res.,
April 15, 2004;
64(8):
2663 - 2667.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Schuck, A. Manninen, M. Honsho, J. Fullekrug, and K. Simons
Generation of single and double knockdowns in polarized epithelial cells by retrovirus-mediated RNA interference
PNAS,
April 6, 2004;
101(14):
4912 - 4917.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Pancoska, Z. Moravek, and U. M. Moll
Efficient RNA interference depends on global context of the target sequence: quantitative analysis of silencing efficiency using Eulerian graph representation of siRNA
Nucleic Acids Res.,
March 1, 2004;
32(4):
1469 - 1479.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ui-Tei, Y. Naito, F. Takahashi, T. Haraguchi, H. Ohki-Hamazaki, A. Juni, R. Ueda, and K. Saigo
Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference
Nucleic Acids Res.,
February 9, 2004;
32(3):
936 - 948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Yoshinari, M. Miyagishi, and K. Taira
Effects on RNAi of the tight structure, sequence and position of the targeted region
Nucleic Acids Res.,
February 3, 2004;
32(2):
691 - 699.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ooms, K. Verhoef, E. Southern, H. Huthoff, and B. Berkhout
Probing alternative foldings of the HIV-1 leader RNA by antisense oligonucleotide scanning arrays
Nucleic Acids Res.,
February 3, 2004;
32(2):
819 - 827.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Liang, M. C. Osborne, B. P. Monia, S. Bhanot, W. A. Gaarde, C. Reed, P. She, T. L. Jetton, and K. T. Demarest
Reduction in Glucagon Receptor Expression by an Antisense Oligonucleotide Ameliorates Diabetic Syndrome in db/db Mice
Diabetes,
February 1, 2004;
53(2):
410 - 417.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
W. Wu, E. Hodges, J. Redelius, and C. Hoog
A novel approach for evaluating the efficiency of siRNAs on protein levels in cultured cells
Nucleic Acids Res.,
January 22, 2004;
32(2):
e17 - e17.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ding and C. E. Lawrence
A statistical sampling algorithm for RNA secondary structure prediction
Nucleic Acids Res.,
December 15, 2003;
31(24):
7280 - 7301.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. C. Shaw, A. Afzal, A. S. Lewin, A. M. Timmers, P. E. Spoerri, and M. B. Grant
Decreased Expression of the Insulin-like Growth Factor 1 Receptor by Ribozyme Cleavage
Invest. Ophthalmol. Vis. Sci.,
September 1, 2003;
44(9):
4105 - 4113.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Kretschmer-Kazemi Far and G. Sczakiel
The activity of siRNA in mammalian cells is related to structural target accessibility: a comparison with antisense oligonucleotides
Nucleic Acids Res.,
August 1, 2003;
31(15):
4417 - 4424.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-Y. Zhang, J. Mao, D. Zhou, Y. Xu, H. Thonberg, Z. Liang, and C. Wahlestedt
mRNA accessible site tagging (MAST): a novel high throughput method for selecting effective antisense oligonucleotides
Nucleic Acids Res.,
July 15, 2003;
31(14):
e72 - e72.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Grunweller, E. Wyszko, B. Bieber, R. Jahnel, V. A. Erdmann, and J. Kurreck
Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2'-O-methyl RNA, phosphorothioates and small interfering RNA
Nucleic Acids Res.,
June 15, 2003;
31(12):
3185 - 3193.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Bohula, A. J. Salisbury, M. Sohail, M. P. Playford, J. Riedemann, E. M. Southern, and V. M. Macaulay
The Efficacy of Small Interfering RNAs Targeted to the Type 1 Insulin-like Growth Factor Receptor (IGF1R) Is Influenced by Secondary Structure in the IGF1R Transcript
J. Biol. Chem.,
April 25, 2003;
278(18):
15991 - 15997.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hemmings-Mieszczak, G. Dorn, F. J. Natt, J. Hall, and W. L. Wishart
Independent combinatorial effect of antisense oligonucleotides and RNAi-mediated specific inhibition of the recombinant Rat P2X3 receptor
Nucleic Acids Res.,
April 15, 2003;
31(8):
2117 - 2126.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|