|
Originally published In Press as doi:10.1074/jbc.M201601200 on December 18, 2002
J. Biol. Chem., Vol. 278, Issue 9, 7600-7606, February 28, 2003
Developmental Regulation of Apolipoprotein B mRNA
Editing Is an Autonomous Function of Small Intestine Involving
Homeobox Gene Cdx1*
Amy P.
Patterson §,
Zhigang
Chen ,
Deborah C.
Rubin¶,
Virginie
Moucadel ,
Juan Lucio
Iovanna ,
H. Bryan
Brewer Jr.**, and
Thomas L.
Eggerman §§
From the NHLBI, National Institutes of Health,
Bethesda, Maryland 20892, ¶ Department of Medicine, Washington
University School of Medicine, St. Louis, Missouri 63110, Laboratoire de Recherche de Physiologie et Pathologie
Digestives, INSERM E.116, 13009 Marseille, France,
** Molecular Disease Branch, NHLBI, National Institutes of
Health, Bethesda, Maryland 20892,  Division
of Diabetes, Endocrinology and Metabolic Diseases, NIDDK, National
Institutes of Health, Bethesda, Maryland 20892, and
§§ Department of Laboratory Medicine, W. G. Magnuson Clinical Center, National Institutes of Health, Bethesda,
Maryland 20892
Received for publication, February 15, 2002, and in revised form, November 20, 2002
 |
ABSTRACT |
Apolipoprotein B mRNA editing is
developmentally regulated in the human and rodent small intestine,
changing from <1% at day 14 to ~90% by day 20 in the rat fetus.
This regulation is coincident with the developmental formation of the
crypt-to-villus axis functional unit, a continuous and rapidly renewing
system involving cell generation, migration, and differentiation.
Utilizing small intestine isografts implanted into the subcutaneous
tissue of adult recipients, apolipoprotein B mRNA editing
was developmentally up-regulated, parallel to that seen with an intact
control. In contrast, apoB mRNA expression remains nearly constant
in the isograft, unlike the normal intact small intestine.
Immunohistochemical analyses demonstrated that apoB-48 protein existed
predominantly in well differentiated enterocytes along the villus
surface whereas apoB-100 was in the lamina propria and crypts. ApoB
mRNA editing levels were very low in the crypt-like rat intestinal
cell line, IEC-6 (~0.3%), but very high in well differentiated
enterocytes (~91.5%). The expression of homeobox gene Cdx1 increased
18-fold in small intestine in vivo during the same time
course when apoB mRNA editing increased from ~2 to ~90%. The
overexpression of Cdx1 in IEC-6 cells increased apoB mRNA editing
over 10-fold compared with the vector control. This increase was
associated with a significant increase of activating factor ACF,
a component of the apoB mRNA editing complex. Taken together, these
data suggest that the developmental regulation of apoB mRNA editing
is an autonomous cytodifferentiation function of small intestine for
which homeobox gene Cdx1 may play an important role.
 |
INTRODUCTION |
Dietary lipids are sources of energy and precursors of cell
components. The small intestine plays a primary role in the absorption and transport of dietary lipids through the synthesis and secretion of
lipoprotein particles, especially chylomicrons. Produced by both the
small intestine and liver, apolipoprotein B
(apoB)1 functions as a
requisite lipoprotein particle structural component. ApoB is also a
major independent risk factor for premature coronary artery disease
(1). In humans, the small intestinal enterocytes produces predominantly
apoB-48, which is found in chylomicrons. The human liver produces
exclusively apoB-100, which is the major lipoprotein in very low
density lipoproteins (VLDL) and low density lipoproteins (LDL)
and functions as a ligand for the low density lipoprotein receptor.
Both apoB-48 and apoB-100 are encoded by a single gene located on human
chromosome 2. The two forms are generated as a result of apoB mRNA
editing, a post-transcriptional specific conversion of a cytodine to a
uracil at nucleotide position 6666, resulting in the replacement of a
CAA(Q) codon with an in-frame translational UAA (stop) codon
(2).
ApoB mRNA editing is dependent on a group of trans
protein factors that recognize the cis elements around the
mRNA editing site (2) and consequently is very site-specific.
However, the editing level can be regulated by a number of factors
including thyroid hormone (3), growth hormone (4, 5), fasting and refeeding (6), developmental stage (7-9), estrogen (10), ethanol (11,
12), and insulin (13). Most of regulatory studies are performed with
rat liver or rat liver cell cultures. Expression level modulation or
protein phosphorylation are proposed as the mechanisms regulating apoB
mRNA editing (14). However, little is known about apoB mRNA
editing regulation in the small intestine beyond the observation of
increased editing during development, especially the rapid
up-regulation 2-3 days before birth in rat (7-9). As our laboratory
and others have shown (7, 8), during rat fetal development, apoB
mRNA editing level in the rat small intestine increases from <1%
at 14 days post-conception to 90% by day 20. Post-natally, 90-95% of
apoB transcripts are edited. In contrast, editing in the rat liver
remains at low levels (~8-10%) during fetal and neonatal
development until the third post-natal week when editing increases
dramatically and attains adult levels (40-60%) by 35 days of age
(7).
The small intestine undergoes significant change during fetal
development. The human fetal small intestine is covered with a
multilayered stratified epithelium before 7-8 weeks of age. By 9-10
weeks, villi lined by simple columnar epithelium have begun to form and
become vascularized in the duodenum and proximal jejunum (15, 16).
Functional adrenergic receptors and innervation by Auerbach's plexus
appear at 9 weeks. Primitive crypts appear at 10-12 weeks, followed by
lymphopoiesis at 15 weeks (17). Amniotic fluid, continually swallowed
by the human fetus as early as 16 weeks of gestation, contains a
significant quantity of lipid (15, 17). In addition, biliary lipid
secretion occurs as early as 22 weeks (17). During this time, the human
fetal intestine increasingly edits apoB transcripts from <10% at 11 weeks to an adult-like 85% level by 20 weeks of gestation (7, 9). The developmental regulation of apoB mRNA editing is coincident with the onset of intestinal ontogenesis in human, which is characterized with the formation and maturation of the crypt-to-villus axis (7, 9).
Similarly, the rodent intestinal endoderm undergoes cytodifferentiation
to form an epithelial monolayer overlaying nascent villi. The axis of
differentiation from the crypt to villus becomes first evident between
17 and 18 days of gestation when apoB mRNA editing increases
rapidly to adult levels (7, 9, 18).
The crypt-to-villus axis is the functional unit of the intestinal
epithelium, a continuous and rapidly renewing system involving cell
generation, migration, and differentiation, from the stem cell
population located at the bottom of the crypt to the extrusion of the
terminally differentiated cells at the tip of the villus (19). The
crypt-to-villus renewing system is sustained in older life after
initially being formed in the fetus. Villi are primarily lined by
functional adsorptive and goblet cells whereas the crypts contain stem
cells, poorly differentiated and proliferative cells, a subset of
differentiated secretary cells, and the Paneth cells (20, 21). Gene
expression in intestinal cells is tightly regulated to control cell
proliferation, migration, and differentiation along the crypt-to-villus
axis and are still not completely understood (20, 22, 23). Several
lines of evidence suggest that homeobox genes related to the
Drosophila melanogaster caudal gene are involved in the
regulation of intestinal differentiation (24). Cdx1 and Cdx2 are the
predominant homeobox transcription factors of the small intestine and
are specifically expressed in the small intestine and colon (25, 26).
Cdx1 is a negatively regulated target of p53 in intestinal cells and is
involved in the regulatory networks of apoptosis, proliferation, and
differentiation (27-29). Both Cdx1 and Cdx2 affect cellular
proliferation and differentiation of IEC-6 cells, an undifferentiated
rat intestinal epithelial cell line and regulate the intestinal
epithelial cell phenotype (30-32).
This study focused on how the developmental regulation of apoB mRNA
editing relates to the formation of the crypt-to-villus axis in small
intestinal epithelium and the potential effect of Cdx1 and Cdx2 upon
editing. Our data demonstrated that like the self-renewing
crypt-to-villus axis, small intestinal apoB mRNA editing is an
autonomous process that involves the action of Cdx1 protein.
 |
MATERIALS AND METHODS |
Intestinal Isograft Implantation--
Fetal Balb/c mice were
obtained on day 15 to 16 of gestation. Small intestines were excised
and implanted in the subcutaneous tissue of adult Balb/c mouse
recipients as described previously (33). The isografts were retrieved
from the subcutaneous tissue of recipient mice at 6, 14, 21, and 31 days following transplantation. Small intestines harvested from normal
Balb/c mice served as controls. All tissues were stored in liquid
nitrogen before RNA extraction. Total RNA was isolated from the tissues
using the quanidinium thiocyanate/CsCl method (7). For light microscopy
of paraffin-embedded tissue, small intestine prior to implantation and
isograft ex situ developed for 4 weeks were fixed in
Bouin's fixative and embedded in paraffin. Sections were cut at 6 µm, mounted on glass slides, and stained with hematoxylin and eosin.
Immunohistochemical Analysis--
Tissues prepared from human
small intestine were fixed in Bouin's solution for immunohistochemical
analysis, sectioned at 5 µm thick, and deparaffinized as described
previously (33). Endogenous peroxidase activity was quenched with 30 min incubation in 3% H2O2/97% methanol.
Slides were washed three times in Tris-buffered saline, pretreated with
3% goat serum to block nonspecific antibody binding, and incubated
2 h at room temperature with monoclonal anti-human-apolipoprotein B antibodies (clones ABB3 and ABB5 for apoB-100 only, and clones AB-BL and AB-B2 for both apoB-48 and apoB-100; Canadian Bioclinical Ltd., Scarborough, Canada). Slides were then washed with Tris-buffered saline and subsequently incubated with biotinylated rabbit anti-IgG as secondary antibody for
30 min at room temperature. Slides were washed with Tris-buffered saline and developed in 3,3'-diaminobenzidine tetrahydrochloride (Vector Laboratories). The tissue was counterstained with hematoxylin, mounted with Permount, and viewed by fluorescent microscopy.
Preparation of Fully Differentiated Villus-like
Cells--
Viable epithelial cells from small intestine villi were
isolated as described previously (34). Briefly, the small intestine (jejunum) from adult rat was opened longitudinally and washed in
phosphate-buffered saline. The small intestine fragment was transferred
to a beaker containing 25 ml of ice-cold Matrisperse cell release
solution (Becton Dickinson Labware) and incubated at 4 °C
overnight without agitation. Then, the beaker was gently shaken for 10 min to separate the epithelium. The remaining fragment was removed, and
the cells released from small intestinal fragment were collected by
centrifugation at 1500 rpm, 4 °C for 5 min. The total RNA was
isolated from the cell preparation using the Trizol reagent
(Invitrogen) according to the manufacturer's instructions.
Construction of Cdx1 and Cdx2 Expression Vectors and
Establishment of Stable Cell Lines--
The sequences encoding the
reading frame of human Cdx1 and Cdx2 including a Kozak consensus
sequence, start codon, and termination codon was synthesized by reverse
transcription-polymerase chain reaction using human small intestine RNA
as template and subcloned into EcoRI/BamHI sites
of pcDNA3.1( )/Myc-His (Invitrogen) and pIRESneo2/pIREShyg2
(Clontech) to yield the Cdx1 and Cdx2 expression constructs with a cytomegalovirus promoter. The nucleotide sequence of
Cdx1 and Cdx2 in the expression plasmids was confirmed by sequencing from both directions.
IEC-6 cells were obtained from the American Type Culture Collection,
Manassas, VA and maintained under an atmosphere of 5% CO2 in Dulbecco's modified Eagle's medium containing 5%
fetal bovine serum, 10 µg/ml insulin, 4 mM
L-glutamine, 50 units/ml penicillin, and 50 µg/ml
streptomycin. The Cdx1 and Cdx2 plasmids were transfected into IEC-6
cells using LipofectAMINE reagent as described by the supplier
(Invitrogen). The stably transfected cells were selected by resistance
to 0.6 mg/ml G418 in the culture medium. Surviving colonies were
pooled, and total RNA was isolated with Trizol reagent (Invitrogen) for
the analyses of apoB mRNA editing and gene expression. For Cdx1 and
Cdx2 co-expression, Cdx1-pIRESneo2 was first transfected into IEC-6
cells. The stably transfected Cdx1/IEC-6 cells selected by 0.6 mg/ml
G418 were then transfected by Cdx2-pIREShyg2 and selected by 40 µg/ml
hygromycin. The dual expression of Cdx1 and Cdx2 in the final surviving
cell colonies was confirmed by RT-PCR with primers against the
expressing genes.
ApoB mRNA Editing and RNA Expression Level Assay--
The
apoB mRNA editing assay was performed as described previously (14).
Briefly, total RNA samples (2-5 µg) were pretreated with 10 units of
DNase (Promega) at 37 °C for 1 h to remove potential genomic
DNA contaminants and reverse-transcribed by Moloney murine leukemia
virus reverse transcriptase using a random primer at 37 °C for
1 h. The resulting cDNA was used for apoB PCR amplification to
determine apoB mRNA editing level or quantitation of RNA levels by
PCR method.
To determine apoB mRNA editing, apoB covering the editing site
region was PCR amplified as follows: 1) mouse apoB, 5 cycles of 50 s at 94 °C, 1 min at 58 °C, 2 min at 72 °C and 30 cycles of
50 s at 94 °C, 1 min at 54 °C, 2 min at 72 °C; and 2) rat
apoB, 35-40 cycles of 50 s at 94 °C, 1 min at 56 °C, 2 min
at 72 °C. The apoB PCR products were purified by GeneClean kit
(Bio101) and annealed to 32P end-labeled extension primer
at 42 °C for 1-2 h after denaturation at 94 °C for 3 min. The
primer annealed apoB was extended by Sequenase in the presence of
ddGTP at 37 °C for 10 min, and the ratio between apoB-48 and
apoB-100 was determined by PhosphoImager evaluating the
extension products separated by 8% urea-polyacrylamide gel.
For the determination of apoB mRNA editing in IEC-6 cells, PCR
primer extension instead of direct Sequenase extension described above
was utilized because of the low abundance of apoB mRNA. 3 of 10 µl of purified apoB PCR products were mixed with 32P
end-labeled extension primer and thermal stable Sequenase (Applied Biosystems), and the primer extension was performed by PCR according to
the manufacturer's instruction. The primer extension products were
separated, and apoB mRNA editing was determined by PhosphoImager as
described above.
To quantitate the mRNA expression level by PCR, aliquots of
cDNA synthesized by random primer were PCR amplified in the
presence of a pair of gene-specific primers and 0.3 µl of
[ -32P]dCTP (3000 Ci/mmol, 10 Ci/ml; Amersham
Biosciences). The 32P-labeled PCR products were
separated by 6% polyacrylamide gel in TBE (Invitrogen) and quantitated
by PhosphoImager. The PCR conditions for each gene in IEC-6 cell
related analyses were as follows: 1) Cdx1, 35 cycles of 1 min at
94 °C, 1 min at 61 °C, 2 min at 72 °C; 2) Cdx2 and APOBEC-1,
35 cycles of 1 min at 94 °C, 1 min at 58 °C, 2 min at 72 °C;
3) -2-microglobulin, 27 cycles of 1 min at 94 °C, 1 min at
55 °C, 2 min at 72 °C; and 4) ACF, 35 cycles of 1 min at
94 °C, 1 min at 53 °C, 2 min at 72 °C.
The apoB mRNA expression levels for mouse isograft samples were
determined by dot blot hybridization. Serial dilutions of total RNA
samples were blotted onto a nitrocellulose membrane. The apoB RNA
hybridizations were performed at 42 °C overnight using a
random-priming 32P-labeled cDNA probe consisting of a
1.1-kb rat apoB cDNA sequence. The relative signal intensity was
determined by scanning laser densitometry and normalized to -actin.
For the quantitation of APOBEC-1, ACF, and -2-microglobulin
expression in isografts, PCR was performed in one tube reaction
containing primers for all the three genes by 30 cycles of 30 s at
94 °C, 1 min at 53 °C, 2 min at 72 °C.
For the ontogeny comparison between Cdx1 and Cdx2 expression and apoB
mRNA editing, total RNA was isolated by the Trizol reagent using
the middle portion of CD-1 mouse small intestine except for day 14, which used the whole small intestine tissue because of limited amount
of tissue available. Aliquots of cDNA synthesized by random primer
were analyzed for apoB mRNA editing and expression of Cdx1, Cdx2,
and -actin. The PCR conditions were 30 (for Cdx1 and Cdx2) or 23 cycles (for -actin) of 30 s at 94 °C, 1 min at 53 °C, 2 min at 72 °C.
Oligonucleotide Primers--
The oligonucleotide primers used in
gene construction and quantitative RT-PCR are listed below.
Cdx1-outside 5' primer, cggaattccccgcggccaccatgtatgtgggctatgtgc; Cdx1-outside 3' primer, cgggatcccggggctatggcagaaactcctctttc;
Cdx2-outside 5' primer, cggaattcccctcgccaccatgtacgtgagctacc;
Cdx2-outside 3' primer, cgggatccgggtcactgggtgacggtggggtttagc; human
Cdx1-S, agcgcagaggccgacgccctacga; human Cdx1-AS,
ggggctatggcagaaactcctctttc; human Cdx2-S, ggaacctgtgcgagtggatg; human
Cdx2-AS, gcagggaagacaccggactc; rat APOBEC-1-S, ccccgggaacttcggaaagag; rat APOBEC-1-AS, gggggtaccttggccaatg; rat ACF-S,
acatctcagcaacagagctctc; rat ACF-AS, ttcatccacgtaggcgcttag; rat
-2-microglobulin-S, aagcccaacttcctcaactgctac; rat
-2-microglobulin-AS, gatgattcagagctccatagagcttg; mouse APOBEC-1-S, gaagaattgagccccacgagtttg; mouse APOBEC-1-AS, gtaccttggccaataagcttcgt; mouse ACF-S, aagcaggaagccaagaatgcaatc; mouse ACF-AS,
caacttctggttctgcccagtctac; mouse Cdx1-S, gacgccctacgaatggatgc; mouse
Cdx1-AS, agggtagaaactcctccttgacg; mouse Cdx2-S,
cccagcggccagcggcgaaacctgt; mouse Cdx2-AS, tatttgtcttttgtcctggttttc; mouse -actin-S, tgggacgacatggagaagatctg; mouse -actin-AS, ctgtggtggtgaagctgtagc.
 |
RESULTS |
The Developmental Regulation of Small Intestine ApoB mRNA
Editing Was Recapitulated in Organ Isografts--
The progressive
increase of small intestine apoB mRNA editing up to an adult level
coincides with the fetal intestinal epithelium cytodifferentiation. The
luminal contents and enterohepatic circulation in small intestine
potentially could play a role in editing regulation. For example,
epidermal growth factor is present in a significant quantity in
amniotic fluid, saliva, and bile (35). Insulin concentrations increases
steadily from an undetectable level before 12 weeks of gestation up to
30 milliunits/ml between 12 and 35 weeks of gestation in humans.
Epidermal growth factor and glucocorticoids can regulate production of
apoB-48, apoB-100, and lipid particles including chylomicrons,
very low density lipoproteins, and high density lipoprotein in jejunal
explants (35). To assess whether the increased apoB mRNA editing
observed during small intestinal development is because of endoderm
cytodifferentiation or regulation from intraluminal contents including
bile, local hormones, and neural intervention, segments of small
intestine were taken from fetal Balb/c mice at age 15-16 days, prior
to epithelial cytodifferentiation, and transplanted to the subcutaneous
tissue of adult Balb/c recipients. The isografts were allowed to
develop ex situ and were subsequently harvested for analysis
at 6, 14, 21, and 31 days following transplantation. As shown in Fig.
1A, the histology of the
grafts at the time of transplantation (16 days) consisted of a simple
stratified endoderm surrounded by loosely packed mesenchyme. Four weeks
later following transplantation, the isograft showed an ex
situ development of grossly normal vasculature, crypts, and villi,
recapitulating the normal development of small intestine (33). The
editing analyses showed that apoB mRNA editing in isografts
increased sharply from ~22% at 16 days, the initial time point for
transplantation, to ~93% at 6 days following transplantation, and
the editing level remained thereafter (Fig. 1B). This
pattern is identical to that seen with the normal control. These data
suggest that the developmental regulation of apoB mRNA editing is
an autonomous function of small intestine, independent of luminal
contents, enterohepatic circulation, innervation, and anatomic
location.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
The effect of anatomic location on apoB
mRNA editing and apoB mRNA expression during development.
Segments of mouse small intestine at 16 days of gestation were
implanted into subcutaneous tissue of adult mouse recipients and
allowed to develop ex situ. The isografts were retrieved at
6, 14, 21, and 31 days following transplantation. ApoB mRNA editing
and expression in the isograft were analyzed. A, tissue
comparison of small intestine prior to transplantation and isograft
allowed to develop ex situ for 4 weeks using H & E staining.
Shown are apoB mRNA editing (B), apoB (C),
and APOBEC-1 and ACF mRNA expression analyses of isograft and
intact control small intestine (D).
|
|
On the other hand, the expression level of apoB mRNA in isografts
was different from that of the normal control. As shown in Fig.
1C, apoB mRNA expression in the normal control was low at day 16 of gestation but increased from ~2 to ~84% of peak value at birth. The expression peaked at post-natal 7 days and then declined
gradually as observed previously (36). In contrast, the apoB mRNA
level in small intestinal isografts gradually rose during this period
with the highest value about 26% of the peak normal value in normal
control. These data indicate that luminal contents, enterohepatic
circulation, innervation, and/or anatomic location may play an
important role in regulating apoB mRNA expression level. APOBEC-1
and ACF are the core enzyme components in apoB mRNA editing
complex. Expression of both gene products was readily detected in
isografts as shown in Fig. 1D. This indicates that there is
sufficient APOBEC-1 in the presence of ACF to support the editing in
isografts although they had different relative gene expression levels
when compared with an intact control.
ApoB Protein Production and ApoB mRNA Editing Is Fully Attained
in Well Differentiated Enterocytes of the Villus Surface--
The
developmental regulation of apoB mRNA editing in the small
intestine is coincident with the endoderm cytodifferentiation that
forms the crypt-to-villus axis. The crypt-to-villus axis is a
self-renewing system with cell generation and migration from the bottom
crypt-like cells to the top villus with well differentiated cells. We
examined the histological distribution of apoB-48 and apoB-100 in human
small intestine to see where the edited apoB protein is located. As
shown in Fig. 2, A and
B, apoB proteins were predominantly distributed in the well
differentiated enterocytes along the villus surface when using an
antibody recognizing both apoB-48 and apoB-100. When using an antibody
recognizing apoB-100 only, the apoB staining was mainly found in the
lamina propria and crypts. Taking the staining around the crypt as a
reference, the intensity of apoB protein staining in villus surface
cells was higher when stained for both apoB-48 and apoB-100 but was lower when stained for apoB-100 only (Fig. 2, C and
D), indicating the presence of apoB-48 in the enterocyte
along villus surface. These data suggest that apoB mRNA editing
mainly occurs in well differentiated cells along the villus
surface.

View larger version (124K):
[in this window]
[in a new window]
|
Fig. 2.
Expression and distribution of apolipoprotein
B along the crypt-villus axis. Cryosections of human adult small
intestine were stained with antibodies that recognized apoB-48 and
B-100 total proteins (A) or apoB-100 only (B).
C and D are enlargements of A and
B regions, which contain crypts.
|
|
IEC-6 is a commercially available crypt-like undifferentiated rat
intestinal epithelial cell line (37). Fully differentiated villus-like
cells can be prepared from rat small intestine by a method described
previously (34). Therefore, both fully differentiated villus-like cells
from rat small intestine and undifferentiated crypt-like IEC-6 cells
were obtained to compare their apoB mRNA editing levels. As shown
in Fig. 3B, the RNA expression
of sucrase isomaltase, a specific marker for intestinal
differentiation, was only detected in the enterocytes prepared from the
proximal small intestine but not in IEC-6 cells. The apoB mRNA
expression level was barely detectable even with a high PCR cycle
number in IEC-6 cells whereas the level in villus enterocytes was very high (Fig. 3B). The apoB mRNA editing analyses
demonstrated that the villus-like cells from the small intestine had a
editing level (~91.6%) comparable with the whole tissue (~93%)
(Fig. 3A). In contrast, IEC-6 cells only had a background
level of apoB mRNA editing (~0.3%), which was detected by a more
sensitive primer extension based on PCR cycles (see "Materials and
Methods") because of a low abundance of apoB mRNA expression.
These data are consistent with the immunohistological observation of
apoB protein location described above in Fig. 2 and indicate that
enterocytes attain the ability of editing apoB mRNA transcripts and
expression of apoB mRNA as they differentiate and migrate from the
crypt to villus.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 3.
Comparison of apoB mRNA editing and
expression between fully differentiated villus cells and
undifferentiated crypt-like IEC-6 cells. Adult rat small intestine
(lanes 1 and 2), differentiated villus
enterocytes isolated from adult rat jejunum (lanes 3 and
4), and crypt-like IEC-6 cells (lanes 5 and
6) are compared for their apoB mRNA editing and mRNA
expression. A, apoB mRNA editing was evaluated by direct
or PCR cycle primer extension assay for small intestine and enterocytes
or IEC-6 cells, respectively. Whole small intestine was included as a
reference. B, the mRNA expression levels of sucrase
isomaltase, a marker specific for differentiated enterocytes, and apoB
were analyzed in comparison to -2-microglobulin. 35 and 40 cycles of
PCR were performed for the apoB detection of enterocytes and IEC-6
cells, respectively.
|
|
The Ontogeny of ApoB mRNA Editing Closely Follows That of Cdx1
Overexpression, and Overexpression of Cdx1 in IEC-6 Cells Significantly
Increases ApoB mRNA Editing--
Cdx1 and Cdx2 are considered to
be important regulatory factors during the fetal development of small
intestine (24). Overexpression of Cdx1 and Cdx2 in crypt-like IEC-6
cells increases proliferation and differentiation (30-32). Because
apoB mRNA editing dramatically changes during fetal development,
the potential roles of Cdx1 and Cdx2 in affecting apoB mRNA editing
were evaluated. As shown in Fig. 4,
changes in apoB mRNA editing, as well as APOBEC-1, ACF, Cdx1, and
Cdx2 expression, were evaluated during fetal development. In comparing
the changes from day 14 to day 18 post-conception, apoB mRNA
editing increased from ~2 to ~90% (Fig. 4A), and Cdx1 expression increased 18-fold (Fig. 4D) whereas APOBEC-1 and
ACF increased about 2-fold (Fig. 4, B and C). In
contrast, Cdx2 expression demonstrated no particular pattern (Fig.
4E).

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 4.
The comparative ontogeny between apoB
mRNA editing and the expression of Cdx1 and Cdx2. Total RNA
was isolated from small intestine tissues of different ages and
analyzed for apoB mRNA editing (A) and expression levels
of APOBEC-1 (B), ACF (C), Cdx1 (D),
and Cdx2 (E) by RT-PCR normalized to -actin. Values are
means + S.D. and represent two to four determinations for each
group.
|
|
The potential effect of Cdx1 and Cdx2 on apoB mRNA editing was also
evaluated by overexpression studies. Cdx1 overexpression in IEC-6 cells
caused a significant increase of apoB mRNA editing from <1 up to
27% (Fig. 5A). Editing
increases were also observed for overexpression of Cdx2 and Cdx1+Cdx2
in IEC-6 cells. However, there was considerable clonal variability in
the amount of editing induced by Cdx1 (13.6% ± 4.4% (S.E.),
n = 11), Cdx2 (5.3% ± 1.9% (S.E.), n = 16), and Cdx1+Cdx2 (3.5% ± 1.6% (S.E.), n = 6).
Compared with vector control (1.2% ± 0.1% (S.E.), n = 8), there was a significantly statistical difference for Cdx1
overexpression (p < 0.01 by analysis of variance using
a StatView program) but not for Cdx2 or the co-expression of Cdx1 and
Cdx2.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 5.
The effect of Cdx1 overexpression on apoB
mRNA editing in IEC-6 cells. A, total RNA was
isolated from stable Cdx1 transfectants and analyzed for apoB mRNA
editing by PCR-primer extension in vector control (lanes 1 and 2) and Cdx1 overexpressing cells (lanes
3-5). B, the expression levels of Cdx1, Cdx2,
APOBEC-1, ACF, and -2-microglobulin were determined by
semi-quantitative RT-PCR.
|
|
To investigate the potential mechanism by which Cdx1 increases apoB
mRNA editing, expression of the editing components, APOBEC-1 and
ACF, were evaluated. In these experiments, the vector control had
editing ~0.8% whereas Cdx1 overexpression increased the editing to
22-27% (Fig. 5A). Cdx1 overexpression also significantly
increased the expression of activating factor ACF, a component of the
apoB mRNA editing complex. In contrast, the catalytic component
APOBEC-1 remained relatively unchanged (Fig. 5B). The
expression of apoB mRNA was not significantly modulated by either
Cdx1 or Cdx2 overexpression (data not shown), consistent with the
intestine isograft data, which suggested that other factors such as
luminal contents or enterohepatic circulation may play an important
role in regulating apoB mRNA expression. The concurrent increase of
Cdx1 expression and apoB mRNA editing in normal small intestinal
development and the up-regulation of editing in Cdx1 overexpressing
IEC-6 cells suggest that Cdx1 may play an important role in the
developmental regulation of apoB mRNA editing.
 |
DISCUSSION |
The regulation of apoB mRNA editing has been investigated
extensively in the last decade with most of the regulatory studies being carried out on rat liver or hepatocytes. However, very little has
been established about the small intestine, the other major source of
apolipoprotein B. ApoB mRNA editing in the small intestine dramatically increases 2-3 days before birth in rodents (7-9). Coincident with this editing change is the onset of intestinal ontogenesis in both the human and rat (9).
The major event of fetal intestinal ontogenesis is the formation of the
crypt-to-villus axis, the functional unit of the small intestine (33).
The development of crypt-to-villus axis in fetus can be recapitulated
in the intestinal isograft (33). Therefore, the isograft method was
utilized to examine whether the normal luminal environment,
innervation, anatomic location, or intestinal endoderm
cytodifferentiation is required for the development of apoB mRNA
editing. We found that apoB mRNA editing developed similarly in the
isograft as it did in the intact control. These data suggest that the
development of apoB mRNA editing is an autonomous function of small
intestine like the generation of intestinal epithelium from endoderm.
In contrast, the pattern of apoB mRNA expression was altered in the
isografts. In the intact control, apoB mRNA expression increased
dramatically and peaked 7 days after birth, which is similar to results
described previously (36). The dramatic increase of apoB mRNA
expression was not observed in the small intestinal isografts.
Enterocytes that develop ex situ expressed significantly lower amounts of apoB mRNA during the first two post-natal weeks and do not exhibit the developmental down-regulation of apoB mRNA that occurs in the intact control. In addition, enterocytes that develop ex situ express progressively increased apoB
mRNA by 4 weeks of age. The expression of other intestinal gene
products in the isograft model has been reported having appropriate
expression for fatty acid binding protein (L-FABP) and
apolipoprotein (apo) AIV or increased expression for
epimorphin/syntaxin 2 (33, 38). In this study, the mRNA expression
levels of the housekeeping gene -2-microglobulin are comparable
between isografts and intact control in this setting (see Fig.
1D), indicating a specificity of the apoB effect. The sum of
these data suggests that intestinal luminal contents, neonatal
developmental factors, enterohepatic circulation, and/or local factors
reflecting the anatomic location such as innervation control the
developmental up and down-regulation of apoB mRNA levels during
in situ development.
The crypt-to-villus axis in the small intestine is a continuous and
rapidly renewing system involving cell proliferation, migration, and
differentiation from the stem cell population located at the bottom of
the crypt to the extrusion of the terminally differentiated cells at
the tip of the villus (20). The crypt-to-villus axis formed during
fetal development is sustained throughout life, continually replicating
the normal ontogeny. With immunohistological analyses of adult human
small intestine, we found that apoB-48 was predominantly located in
surface villus cells, which are differentiated mature cells that
migrated from the crypts (20). The well differentiated villus cells
prepared from rat adult small intestine had an apoB mRNA editing
level comparable with small intestine tissue whereas the crypt-like
cells, IEC-6, had no detectable editing (see Fig. 3). These two lines
of evidence suggest that the intestinal stem-like cells in crypts have
little apoB mRNA editing. Subsequently the cells increase editing
as they proliferate, differentiate, and migrate from the bottom of
crypts during development.
The rat intestinal cell line IEC-6 retains the characteristics of
normal rat crypt jejunal cells (37). We found that apoB mRNA
expression was barely detectable and required a high cycle PCR for
detection, and no apoB mRNA editing was detected. This is
consistent with the report that IEC-6 cells are unable to synthesize apolipoproteins and lipoproteins (39). On the other hand, human crypt
intestinal epithelial cells are able to synthesize apolipoproteins and
lipoproteins with a predominance of apoB-100 (40). This indicates that
human crypt intestinal epithelial cells, in contrast to IEC-6 cells,
can edit apoB mRNA transcripts at a low level. Taken together, the
very limited apoB mRNA editing observed in crypt cell lines and the
adult tissue level of editing in well differentiated villus cells
support the concept that as differentiation occurs when the crypt cells
develop into villus cells, there is a corresponding increase of apoB
mRNA editing. This proposal is also supported by Caco-2 studies
where maturation increases apoB mRNA editing (41).
A fully developed intestinal epithelium results from a complex series
of cellular transitions. Cytodifferentiation of endoderm to form the
crypt-to-villus axis is a particularly critical time in mouse
intestinal development (42) and is when the rapid up-regulation of apoB
mRNA editing occurs. Homeobox genes are essential in controlling normal embryonic development (43). Cdx1 and Cdx2 are the predominant homeobox transcription factors specifically expressed in the small intestine and colon and have been proposed as important regulatory factors during endoderm cytodifferentiation (24, 44). The expression
pattern of Cdx1 and Cdx2 is largely preserved even in the fetal small
intestine isograft model (45). Expression of Cdx1 and Cdx2 induces
crypt-like IEC-6 cells to develop into differentiated mature
villus-like cells (30, 31). In this study, we found that Cdx1 mRNA
expression increased 18-fold when apoB mRNA editing increased from
~2% to an adult level (~90%) whereas Cdx2 expression did not
change significantly (see Fig. 4). Overexpression of Cdx1 in crypt-like
IEC-6 cells increased apoB mRNA editing from 0.8% to as high as
22-27% (see Fig. 5). These findings suggest that Cdx1 may play an
important role in the development regulation of apoB mRNA editing.
Overexpression of Cdx2, as well as Cdx1 plus Cdx2, also increased the
editing in IEC-6 cells but not to statistically significant levels. The absence of a combination effect may reflect the reported antagonism between Cdx1 and Cdx2 (46).
There was considerable variability in the degree of editing induction
in the Cdx1 and Cdx2 overexpression studies in IEC-6 cells. One
possible explanation for this variability could be differences in
transfection efficiencies with subsequent variable expression levels.
Alternatively, this variation could be because of the complex nature of
Cdx1 and Cdx2 as transcription factors including potential antagonism
between factors regulated by Cdx1 and Cdx2. It has been reported that
persistent Cdx1 expression promotes IEC-6 cell proliferation and
differentiation whereas conditional inductive Cdx1 expression inhibits
proliferation but has no effect on differentiation (31, 32). An effect
of Cdx2 upon differentiation has been reported for conditional
inductive Cdx2 expression in IEC-6 cells and persistent expression in
Caco-2 cells (30, 47). In addition, Cdx2 can be inactivated by
phosphorylation at serine 60 (48, 49). Thus, the effect of Cdx1 or Cdx2
can be modified by multiple factors that could contribute to the
variation seen in apoB mRNA editing observed in overexpressing
IEC-6 cells.
The apoB mRNA expression level was not changed by overexpressing
either Cdx1 or Cdx2 (data not shown). This contrasts to the ontogeny in
normal small intestine where both apoB mRNA expression and editing
were increased significantly. The lower level of apoB mRNA
expression in isografts and the absence of Cdx1 and Cdx2 overexpression
affecting apoB mRNA levels in IEC-6 cells suggest that factors
other than Cdx1 or Cdx2 are involved in the developmental regulation of
apoB mRNA expression.
ApoB mRNA editing is dependent on a group of proteins that
recognize the apoB mRNA substrate to form an editing enzyme
complex. APOBEC-1 and ACF are the core enzyme components of the
complex. APOBEC-1 is the catalytic enzyme component and forms an
in vitro functional editing enzyme, together with ACF. A
number of other proteins have also been found recently (50) including
editing inhibitory factors, CUGBP2, and GRY-RBP. However, the exact
roles for each protein component in regulating editing remain to be elucidated. The potential roles of APOBEC-1 and ACF in the
developmental regulation of apoB mRNA editing in small intestine
was investigated with rat/human whole small intestine tissue and Caco-2
cells by comparing their mRNA abundance and editing levels (8, 51). APOBEC-1 increased progressively whereas ACF mRNA abundance was relatively consistent, indicating that APOBEC-1 expression potentially determined the level of apoB mRNA editing. In this study, ACF appeared to have a role in determining apoB mRNA editing. We found that during mouse small intestine ontogeny editing increased from ~2
to ~90% whereas both ACF and APOBEC-1 expression nearly doubled (see
Fig. 4). In addition, when using Cdx1 overexpressing rat IEC-6 cells,
APOBEC-1 remained relatively unchanged, and ACF expression significantly increased when apoB mRNA editing also increased significantly (see Fig. 5).
In summary, our findings suggest that 1) the developmental regulation
of apoB mRNA editing in fetus is an autonomous function of the
small intestine; 2) apoB mRNA editing level increases as the
intestinal epithelial cells mature and ascend from the crypt, simulating the developmental regulation of editing observed during small intestinal cytodifferentiation; 3) the increased levels of
homeobox gene Cdx1 expression coincides with the increased apoB
mRNA editing observed during normal small intestine development; and 4) Cdx1 overexpression increases apoB mRNA editing and ACF expression in crypt-like IEC-6 cells. These results suggest that Cdx1
may play an important role in the developmental regulation of apoB
mRNA editing.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grant R01-DK46122 (to D. C. R.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Office of Biotechnology
Activities, NIH, 6705 Rockledge Dr., Suite 750, Bethesda, MD 20892. Tel.: 301-496-9838; Fax: 301-496-9839; E-mail:
pattersa@od.nih.gov.
Published, JBC Papers in Press, December 18, 2002, DOI 10.1074/jbc.M201601200
 |
ABBREVIATIONS |
The abbreviation used is:
apoB, apolipoprotein
B.
 |
REFERENCES |
| 1.
|
Young, S. G.
(1990)
Circulation
82,
1574-1594[Abstract/Free Full Text]
|
| 2.
|
Anant, S.,
and Davidson, N. O.
(2001)
Curr. Opin. Lipidol.
12,
159-165[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Inui, Y.,
Giannoni, F.,
Funahashi, T.,
and Davidson, N. O.
(1994)
J. Lipid Res.
35,
1477-1489[Abstract]
|
| 4.
|
Sjoberg, A.,
Oscarsson, J.,
Bostrom, K.,
Innerarity, T. L.,
Eden, S.,
and Olofsson, S. O.
(1992)
Endocrinology
130,
3356-3364[Abstract/Free Full Text]
|
| 5.
|
Linden, D.,
Sjoberg, A.,
Asp, L.,
Carlsson, L.,
and Oscarsson, J.
(2000)
Am. J. Physiol. Endocrinol. Metab.
279,
E1335-E1346[Abstract/Free Full Text]
|
| 6.
|
Baum, C. L.,
Teng, B. B.,
and Davidson, N. O.
(1990)
J. Biol. Chem.
265,
19263-19270[Abstract/Free Full Text]
|
| 7.
|
Patterson, A. P.,
Tennyson, G. E.,
Hoeg, J. M.,
Sviridov, D. D.,
and Brewer, H. B., Jr.
(1992)
Arterioscler. Thromb.
12,
468-473[Abstract/Free Full Text]
|
| 8.
|
Funahashi, T.,
Giannoni, F.,
DePaoli, A. M.,
Skarosi, S. F.,
and Davidson, N. O.
(1995)
J. Lipid Res.
36,
414-428[Abstract]
|
| 9.
|
Giannoni, F.,
Chou, S. C.,
Skarosi, S. F.,
Verp, M. S.,
Field, F. J.,
Coleman, R. A.,
and Davidson, N. O.
(1995)
J. Lipid Res.
36,
1664-1675[Abstract]
|
| 10.
|
Seishima, M.,
Bisgaier, C. L.,
Davies, S. L.,
and Glickman, R. M.
(1991)
J. Lipid Res.
32,
941-951[Abstract]
|
| 11.
|
Lau, P. P.,
Cahill, D. J.,
Zhu, H. J.,
and Chan, L.
(1995)
J. Lipid Res.
36,
2069-2078[Abstract]
|
| 12.
|
Van Mater, D.,
Sowden, M. P.,
Cianci, J.,
Sparks, J. D.,
Sparks, C. E.,
Ballatori, N.,
and Smith, H. C.
(1998)
Biochem. Biophys. Res. Commun.
252,
334-339[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Thorngate, F. E.,
Raghow, R.,
Wilcox, H. G.,
Werner, C. S.,
Heimberg, M.,
and Elam, M. B.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
5392-5396[Abstract/Free Full Text]
|
| 14.
|
Chen, Z.,
Eggerman, T. L.,
and Patterson, A. P.
(2001)
Biochem. J.
357,
661-672[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Grand, R. J.,
Watkins, J. B.,
and Torti, F. M.
(1976)
Gastroenterology
70,
790-810[Medline]
[Order article via Infotrieve]
|
| 16.
|
Moxey, P. C.,
and Trier, J. S.
(1978)
Anat. Rec.
191,
269-285[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Davidson, N. O.,
Drewek, M. J.,
Gordon, J. I.,
and Elovson, J.
(1988)
J. Clin. Invest.
82,
300-308[Medline]
[Order article via Infotrieve]
|
| 18.
|
Mathan, M.,
Moxey, P. C.,
and Trier, J. S.
(1976)
Am. J. Anat.
146,
73-92[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Babyatsky, M. W.,
and Podolsky, D. K.
(1999)
in
Textbook of Gastroenterology
(Yamada, T., ed), 3rd Ed.
, pp. 547-584, J. B. Lippincott, Philadelphia
|
| 20.
|
Pageot, L. P.,
Perreault, N.,
Basora, N.,
Francoeur, C.,
Magny, P.,
and Beaulieu, J. F.
(2000)
Microsc. Res. Tech.
49,
394-406[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Clatworthy, J. P.,
and Subramanian, V.
(2001)
Mech. Dev.
101,
3-9[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Beaulieu, J. F.
(1999)
Front Biosci.
4,
D310-D321[Medline]
[Order article via Infotrieve]
|
| 23.
|
Shaw-Smith, C. J.,
and Walters, J. R.
(1997)
Gut
40,
5-8[Free Full Text]
|
| 24.
|
Silberg, D. G.,
Swain, G. P.,
Suh, E. R.,
and Traber, P. G.
(2000)
Gastroenterology
119,
961-971[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Walters, J. R.,
Howard, A.,
Rumble, H. E.,
Prathalingam, S. R.,
Shaw-Smith, C. J.,
and Legon, S.
(1997)
Gastroenterology
113,
472-477[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
James, R.,
and Kazenwadel, J.
(1991)
J. Biol. Chem.
266,
3246-3251[Abstract/Free Full Text]
|
| 27.
|
Moucadel, V.,
Totaro, M.,
Dell, C.,
Soubeyran, P.,
Dagorn, J.,
Freund, J.,
and Iovanna, J.
(2002)
Biochem. Biophys. Res. Commun.
297,
607-615[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Moucadel, V.,
Soubeyran, P.,
Vasseur, S.,
Dusetti, N. J.,
Dagorn, J. C.,
and Iovanna, J. L.
(2001)
Eur. J. Cell Biol.
80,
156-163[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Soubeyran, P.,
Haglund, K.,
Garcia, S.,
Barth, B. U.,
Iovanna, J.,
and Dikic, I.
(2001)
Oncogene
20,
4180-4187[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Suh, E.,
and Traber, P. G.
(1996)
Mol. Cell. Biol.
16,
619-625[Abstract]
|
| 31.
|
Soubeyran, P.,
Andre, F.,
Lissitzky, J. C.,
Mallo, G. V.,
Moucadel, V.,
Roccabianca, M.,
Rechreche, H.,
Marvaldi, J.,
Dikic, I.,
Dagorn, J. C.,
and Iovanna, J. L.
(1999)
Gastroenterology
117,
1326-1338[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Lynch, J.,
Suh, E. R.,
Silberg, D. G.,
Rulyak, S.,
Blanchard, N.,
and Traber, P. G.
(2000)
J. Biol. Chem.
275,
4499-4506[Abstract/Free Full Text]
|
| 33.
|
Gutierrez, E. D.,
Grapperhaus, K. J.,
and Rubin, D. C.
(1995)
Am. J. Physiol.
269,
G500-G511[Abstract/Free Full Text]
|
| 34.
|
Perreault, N.,
and Beaulieu, J. F.
(1998)
Exp. Cell Res.
245,
34-42[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Levy, E.,
and Menard, D.
(2000)
Microsc. Res. Tech.
49,
363-373[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Higuchi, K.,
Kitagawa, K.,
Kogishi, K.,
and Takeda, T.
(1992)
J. Lipid Res.
33,
1753-1764[Abstract]
|
| 37.
|
Quaroni, A.,
Wands, J.,
Trelstad, R. L.,
and Isselbacher, K. J.
(1979)
J. Cell Biol.
80,
248-265[Abstract/Free Full Text]
|
| 38.
|
Goyal, A.,
Singh, R.,
Swietlicki, E. A.,
Levin, M. S.,
and Rubin, D. C.
(1998)
Am. J. Physiol.
275,
G114-G124[Abstract/Free Full Text]
|
| 39.
|
Mehran, M.,
Seidman, E.,
Gurbindo, C.,
and Levy, E.
(1994)
Can. J. Physiol. Pharmacol.
72,
1272-1276[Medline]
[Order article via Infotrieve]
|
| 40.
|
Levy, E.,
Beaulieu, J. F.,
Delvin, E.,
Seidman, E.,
Yotov, W.,
Basque, J. R.,
and Menard, D.
(2000)
J. Lipid Res.
41,
12-22[Abstract/Free Full Text]
|
| 41.
|
Giannoni, F.,
Field, F. J.,
and Davidson, N. O.
(1994)
J. Lipid Res.
35,
340-350[Abstract]
|
| 42.
|
Gordon, J. I.,
and Hermiston, M. L.
(1994)
Curr. Opin. Cell Biol.
6,
795-803[CrossRef][Medline]
[Order article via Infotrieve]
|
| 43.
|
Charite, J.,
de Graaff, W.,
Consten, D.,
Reijnen, M. J.,
Korving, J.,
and Deschamps, J.
(1998)
Development
125,
4349-4358[Abstract]
|
| 44.
|
Subramanian, V.,
Meyer, B.,
and Evans, G. S.
(1998)
Differentiation
64,
11-18[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Duluc, I.,
Lorentz, O.,
Fritsch, C.,
Leberquier, C.,
Kedinger, M.,
and Freund, J. N.
(1997)
J. Cell Sci.
110,
1317-1324[Abstract]
|
| 46.
|
Lorentz, O.,
Cadoret, A.,
Duluc, I.,
Capeau, J.,
Gespach, C.,
Cherqui, G.,
and Freund, J. N.
(1999)
Oncogene
18,
87-92[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Lorentz, O.,
Duluc, I.,
Arcangelis, A. D.,
Simon-Assmann, P.,
Kedinger, M.,
and Freund, J. N.
(1997)
J. Cell Biol.
139,
1553-1565[Abstract/Free Full Text]
|
| 48.
|
Rings, E. H.,
Boudreau, F.,
Taylor, J. K.,
Moffett, J.,
Suh, E. R.,
and Traber, P. G.
(2001)
Gastroenterology
121,
1437-1450[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Taylor, J. K.,
Levy, T.,
Suh, E. R.,
and Traber, P. G.
(1997)
Nucleic Acids Res.
25,
2293-2300[Abstract/Free Full Text]
|
| 50.
|
Davidson, N. O.
(2002)
J. Clin. Invest.
109,
291-294[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Henderson, J. O.,
Blanc, V.,
and Davidson, N. O.
(2001)
Biochim. Biophys. Acta
1522,
22-30[Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. W. M. Chan, N. A. Wong, Y. Liu, D. Bicknell, H. Turley, L. Hollins, C. J. Miller, J. L. Wilding, and W. F. Bodmer
Gastrointestinal differentiation marker Cytokeratin 20 is regulated by homeobox gene CDX1
PNAS,
February 10, 2009;
106(6):
1936 - 1941.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Liu, X. Zhang, C.-K. So, S. Wang, P. Wang, L. Yan, R. Myers, Z. Chen, A. P. Patterson, C. S. Yang, et al.
Regulation of Cdx2 expression by promoter methylation, and effects of Cdx2 transfection on morphology and gene expression of human esophageal epithelial cells
Carcinogenesis,
February 1, 2007;
28(2):
488 - 496.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Chen, T. L. Eggerman, and A. P. Patterson
ApoB mRNA editing is mediated by a coordinated modulation of multiple apoB mRNA editing enzyme components
Am J Physiol Gastrointest Liver Physiol,
January 1, 2007;
292(1):
G53 - G65.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Diaz, F. Delers, M. Maynard, S. Demignot, F. Zoulim, J. Chambaz, C. Trepo, V. Lotteau, and P. Andre
Preferential association of Hepatitis C virus with apolipoprotein B48-containing lipoproteins.
J. Gen. Virol.,
October 1, 2006;
87(Pt 10):
2983 - 2991.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|