![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 9, 7624-7629, February 28, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3/4 Fucosyltransferase III for Its Localization and Sorting in
the Golgi of Baby Hamster Kidney Cells*
§¶,
§¶,
§¶,
,
, and
§**
From the
Laboratory of Glycobiology, Instituto de
Tecnologia Química e Biológica, Apartado 127, 2780 Oeiras, the § Instituto de Biologia Experimental e
Tecnológica, Apartado 12, 2780 Oeiras, Portugal, and the
Cell Biology and Biophysics Programme, EMBL, D-69017 Heidelberg,
Germany
Received for publication, September 11, 2002, and in revised form, December 4, 2002
| |
ABSTRACT |
|---|
|
|
|---|
Human fucosyltransferase III (EC 2.4.1.65)
(FT3wt) is localized in the Golgi of baby hamster kidney cells
and synthesizes Lewis determinants associated with cell adhesion
events. Replacement of the amino acid residues from the transmembrane
domain (TM) Cys-16, Gln-23, Cys-29, and Tyr-33 by Leu (FT3np) caused a
shift in enzyme localization to the plasma membrane. The
mislocalization caused a dramatic decrease in the amount of
biosynthetic products of FT3wt, the Lewis determinants. Determination
of the expression levels on the surface with mutants of the enzyme,
where one, two, or three of these residues were replaced by Leu,
suggested that Cys from the TM was required for the localization of FT3
in the Golgi. Furthermore, Cys-23 and Cys-29 mediated the formation of disulfide-bonded dimers but not higher molecular weight oligomers. In vitro reconstitution of intra-Golgi transport showed
that FT3wt was incorporated into coatomer protein (COP) I vesicles,
contrary to FT3np. These data suggested that Cys, Gln, and Tyr residues are important for FT3wt sorting into the transport vesicles possibly due to interactions with other membrane proteins.
Glycosyltransferases
(GTs)1 mediate the transfer
of monosaccharide residues from the corresponding nucleotide sugar
donor onto glycoproteins or glycolipids during their transport along
the secretory pathway. Human GTs are distributed along the Golgi from the cis to the
trans regions as well as the trans-Golgi network
(TGN). They are not committed to a single cisterna but their
localization overlaps that of other GTs in adjacent cisternae. The
mechanisms underlying the sequential distribution and localization of
GTs along the exocytic pathway are not fully understood. The presence
of polar residues inside the transmembrane domain (TM) is known to
drive The cisternal maturation model, which explains several aspects of
transport across the Golgi, proposes that anterograde cargo progresses
through the Golgi within the cisternae, whereas Golgi resident proteins
are concentrated into retrograde transport coatomer protein (COP)
I-coated vesicles, which fuse with previous cisternae, thereby
promoting Golgi maturation (15-19). Golgi resident GTs such as
mannosidase II and N-acetylglucosaminyltransferase I
(cis/medial Golgi), or FT3wt is localized in the trans-Golgi and TGN of Baby
Hamster Kidney (BHK) cells (4). The molecular basis underlying its correct localization has not been elucidated until recently.
In the present work, we have observed that the replacement of Cys-16,
Gln-23, Cys-29, and Tyr-33 from the TM of FT3wt by Leu residues (FT3np)
caused a shift of the enzyme from the Golgi to the plasma membrane.
This resulted in a decrease of the biosynthetic products of FT3wt, the
Lewis determinants. Enzyme dimerization mediated by the TM Cys was
observed and was abolished in the mutants where both Cys were mutated.
Furthermore, TM Cys were required for the localization of FT3wt in the
Golgi. Concomitantly, FT3wt was concentrated into COPI vesicles
contrary to the mutant FT3np, indicating that the Cys, Gln, and Tyr
residues are important for the sorting of FT3wt into the transport vesicles.
Materials--
Dulbecco's modified Eagle's medium (DMEM) was
obtained from Sigma. Fetal calf serum, penicillin/streptomycin, and
geneticin were obtained from Invitrogen.
The rabbit antiserum anti-fucosyltransferase III was raised by
Eurogentec (Seraing, Belgium) against the human fucosyltransferase III
peptide HHWDIMSNPKSRLPPSPRPQGQRC coupled to ovalbumin, and the antibody
was purified as described before (46). The polyclonal antibody
anti-calnexin was a kind gift from Prof. Ari Helenius (ETH,
Switzerland). The monoclonal antibodies against
sialyl-Lewisa, Lewisx, and
sialyl-Lewisx motifs were a kind gift from Prof. Leonor
David and Dr. Celso Reis (IPATIMUP, Portugal). The following primary
antibodies were used: mouse monoclonal anti-Lewisa
(Biogenesis), mouse monoclonal anti-Golgi 58K protein (Sigma); mouse
monoclonal anti-AP-1 and AP-2 ( Cell Culture--
BHK-21B cells were grown in DMEM supplemented
with 10% fetal calf serum, 100 units/ml penicillin, 0.1 mg/ml
streptomycin. Semi-confluent cells were transfected by the calcium
phosphate precipitation method with 5 µg of plasmid DNA and selected
using several medium exchanges with DMEM containing 10% fetal calf
serum and 1.5 mg/ml geneticin, for 2-3 weeks. Single clones were
obtained after serial dilution of the selected cell pools and further
propagated in the presence of 1.5 mg/ml geneticin. Cells were grown in
a humidified incubator at 37 °C, under a 5% CO2 atmosphere.
Plasmid Construction--
The mutants pCRFT3np1 to pCRFT3np14
(Fig. 1) were generated by PCR-based site-directed mutagenesis of the
previously described vector pCRFT3 (4) encoding the full-length
wild-type enzyme. PCR was performed using the Expand High Fidelity DNA
polymerase mixture (Roche Molecular Biochemicals) and the supplied
buffer, according to the manufacturer's protocol, at standard
concentrations of 0.2 mM of each deoxynucleotide and 0.3 µM of each forward primer (TIB MOLBIO, Berlin, Germany),
indicated in Table I, and of the reverse mutagenesis primer 5'-GGCCTCTCAGGTGAACCAAGCCGCTATGCT for pCRFT3wt, FT3np, FT3np2, FT3np5, FT3np7, or
5'-TCACTTGCCGCTGTTTGCGACGTAATTTTTGTCGAATCCAGCTCCGGTGAACCAAGCCGC for the other mutants. PCR conditions were 30 cycles with 15 s of denaturation at 94 °C, 20 s of annealing at 50 °C, 2 min of elongation at 72 °C, and a final elongation for 8 min, at
72 °C. DNA fragments were cloned into the eukaryotic expression
vector pCR3 using a TA cloning kit (Invitrogen). Positive clones were identified using standard techniques, and mutations were verified by
automated DNA sequencing.
Cell Surface Biotinylation--
Cell surface proteins were
biotinylated essentially according to Tang et al. (21).
Cells were grown to half-confluency, washed three times with PBS,
incubated with 0.5 mg/ml sulfo-NHS-SS-biotin (Pierce) in PBS containing
1 mM CaCl2 and 1 mM
MgCl2 (PBSCM) for 2 × 20 min. Cells were washed two
times with PBSCM containing 50 mM NH4Cl
followed by DMEM with 10% fetal calf serum, and extracted with PBS
containing 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 5 mM EDTA, 0.5 µg/ml leupeptin, 1 µg/ml pepstatin, and 10 mM lysine, centrifuged at 10,000 × g for
15 min at 4 °C, and the supernatant was incubated with 50 µl of
streptavidin-agarose suspension for 2 h at 4 °C. The agarose
beads were washed five times with 10 mM Tris-HCl buffer, pH
8.0, containing 0.5 M NaCl, 1 mM EDTA, 1%
Nonidet P-40. The biotinylated proteins were eluted by boiling in SDS
sample buffer and analyzed by SDS-PAGE followed by Western blot.
Immunofluorescence Microscopy--
Half-confluent cells grown on
glass coverslips were washed with PBS containing 0.5 mM
MgCl2, fixed with 3% (w/v) paraformaldehyde in PBS for 30 min, and permeabilized with 0.1% (w/v) Triton X-100 for 15 min. Fixed
cells were blocked with 1% bovine serum albumin in PBS for 1 h,
incubated at room temperature for 2 and 1 h with primary and
secondary antibodies, respectively. Antibodies were diluted in PBS
containing 1% bovine serum albumin and washes were done with PBS.
Coverslips were mounted in Airvol and examined on a Bio-Rad MRC1024
confocal microscope or a Leica DMRB microscope. Where indicated, cells
were incubated with DMEM containing 750 µg/ml cycloheximide for
4 h at 37 °C prior to fixation.
Subcellular Fractionation and Vesicle Preparation--
For Golgi
isolation, cells were grown to confluency in three 175 cm2
flasks, inoculated on a 250-ml spinner and grown at 37 °C for 2 days. Golgi isolation was done according to Balch et al.
(22) with some modifications. Prior to harvest, cells were incubated with 12 µg/ml cycloheximide for 10 min at 37 °C. Cells were
centrifuged at 500 × g for 5 min and washed twice with
ice-cold PBS and twice with homogenization buffer (20 mM
Hepes-KOH pH 7.0, 0.25 M sucrose). Pellet was resuspended
in four volumes of homogenization buffer containing a protease
inhibitor mixture (1 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml
pepstatin, 1 µg/ml antipain, 1 mM benzamidine/HCl, and 40 µg/ml phenylmethylsulfonyl fluoride) and homogenized through a
16-µm gap on a ball homogenizer. The sucrose concentration was adjusted to 37% (w/w) with a 62% (w/w) stock solution in 20 mM Hepes-KOH pH 7.0. The homogenate was transferred to a
SW40 tube and overlaid with 4.5 ml of 35% (w/w) sucrose solution in 20 mM Hepes-KOH pH 7.0 and 2.5 ml of 29% (w/w) sucrose
solution in 20 mM Hepes-KOH pH 7.0. After centrifugation at
26,000 rpm for 2.5 h, the Golgi-enriched fraction was collected at
the 29/35% (w/w) sucrose interface. Contamination for endoplasmic
reticulum was monitored by Western blot with anti-calnexin antibody.
The fraction was aliquoted, snap frozen in liquid nitrogen, and stored
at
Vesicles were prepared as described before for rat liver Golgi-enriched
fractions (20). The reaction mixtures consisted of 250 µl containing
20 µg of the Golgi-enriched fraction, 5 mg/ml rat liver cytosol, an
ATP-regenerating system (20 mM ATP, 100 mM
creatine phosphate, and 100 units/ml creatine kinase), 0.5 mM GTP, 1 mM dithiothreitol, and the following
protease inhibitors: 0.5 mM benzamidine-HCl, 0.5 mg/ml
leupeptin, and 0.2 mg/ml soybean trypsin inhibitor. The mixture was
buffered with budding buffer (25 mM Hepes pH 7.0, 115 mM potassium acetate, 2.5 mM MgCl2,
1 mM dithiothreitol). After a 30-min incubation, the
mixture was centrifuged for 15 min at 23,000 × g, the
supernatant was loaded on top of 5 µl of 50% (w/w) and 50 µl of
30% (w/w) sucrose and further centrifuged for 45 min at 120,000 × g on a TLA55 rotor. The vesicle fraction was found in the
30/50% (w/w) sucrose interface and processed for Western blot analysis
or electron microscopy. Immunodepletion of coatomer from cytosol was
performed as described before by Lanoix et al. (20).
Electron Microscopy--
Vesicle pellets obtained from the
budding assay were resuspended in budding buffer and were incubated for
5 min on a formvar and carbon-coated copper grids under a humid
environment at room temperature. Grids were washed with PBS, fixed with
4% paraformaldehyde in 0.2 M phosphate buffer, pH 7.4 for
10 min and further washed with PBS and water. Grids were incubated for
10 min on ice with 0.3% uranyl acetate in 1.8% methyl cellulose.
Samples were observed on a BioTwin Philips electron microscope.
Protein Extraction and Western Blot Analysis--
For dimer
detection, BHK cells grown to confluency were resuspended in MNT buffer
(25 mM MES, pH 6.5, 1% (w/v) Triton X-100) containing 150 mM NaCl in the presence of 30 mM
N-ethylmaleimide (NEM). After incubation for 1 h on
ice, samples were centrifuged at 15,000 × g for 15 min
at 4 °C. The pellet was resuspended in the same volume of MNT, and
protein from the pellet and supernatant was precipitated with ethanol
and analyzed under non-reducing SDS-PAGE followed by Western blot.
Detection was performed by the ECL Plus method (Amersham Biosciences).
Quantitation studies of fucosyltransferase on blot were based on a
calibration curve of peak area versus FT3 concentration
between 1 and 14 ng of standard protein (2). The Scion software was
used for peak area determination.
Cys-16, Gln-23, Cys-29, and Tyr-33 from the Transmembrane Domain of
FT3wt Are Required for Its Localization in the Golgi--
The
full-length membrane-bound form of fucosyltransferase III has been
stably expressed in BHK cells (BHK-FT3wt) (Fig. 2, A-C)
(4). The enzyme was found to localize in the trans-Golgi and
TGN of BHK cells. Several authors have shown evidence for the
importance of the TM and flanking regions for localization of proteins
in the Golgi (
After examining the TM of FT3wt we have identified amino acid residues
more likely to participate in protein-protein interactions within the
hydrophobic environment of the membrane. The amino acids Cys-16 and
Cys-29, possibly involved in intramembrane disulfide bond formation,
Gln-23, a polar amino acid rarely found in TM (5, 29), Tyr-33, possibly
involved in hydrogen bonding, have been identified as the most likely
candidates and were mutated to Leu residues, creating the mutant FT3np
(Fig. 1).
Stable BHK cells expressing FT3wt or FT3np were constructed, and the
mutant was localized by immunofluorescence microscopy. In
non-permeabilized cells, FT3np was detected on the plasma membrane (Fig. 2D) contrary to FT3wt
(Fig. 2A). When FT3np cells were permeabilized with 0.1%
Triton X-100, additional fluorescence with a perinuclear distribution
characteristic of Golgi, which colocalized with the Golgi marker 58K
was detected (Fig. 2E). As a positive control FT3wt showed
colocalization with this marker (Fig. 2B). This labeling disappeared for FT3np (Fig. 2F) after incubation with 750 µg/ml cycloheximide but not for FT3wt (Fig. 2C) indicating
that it corresponded to a fraction of FT3np in transit to the PM. Thus,
the mutant FT3np reached its final PM localization after transport
through the GA. These results indicated that specific amino acid
residues, Cys-16, Gln-23, Cys-29, and Tyr-33, from the TM of FT3wt
played a critical role in the correct localization of the enzyme in the Golgi/TGN of BHK cells. Non-transfected BHK cells did not express fucosyltransferase III (data not shown) as previously reported (4).
In order to investigate the relative importance of each of the four
mutated amino acids for Golgi localization of FT3wt, we have
constructed and stably expressed in BHK cells the mutants FT3np1 to
FT3np14 where one, two or three of these residues were replaced by Leu
(Fig. 1). We selected cell clones that produced approximately similar
amounts of total fucosyltransferase. We then determined their
expression level on the cell surface by Western blot of the
biotinylated PM proteins isolated with streptavidin-agarose (Fig.
3). FT3wt was detected at low levels on
the PM, comparable to the background determined for the control
calnexin, an intracellular membrane protein resident in the ER. FT3np
was highly detected on the PM thus corroborating the microscopy
studies. From the single amino acid mutants FT3np1 to FT3np4, most
striking was the presence of FT3np2 (C29L) at higher levels on the PM
(88%), which indicated that Cys-29 played an important
role for Golgi localization of the enzyme (Fig. 3C). Mutants
where this residue was replaced by Leu (FT3np5, FT3np8, FT3np9,
FT3np11, FT3np12, FT3np13) were all detected on the cell surface to a
variable extent. FT3np6 (Q23L, Y33L) was detected on the PM at levels
comparable to FT3wt, which indicated its localization in the Golgi.
This suggested important roles for Cys-16 and Cys-29 for the retention process. In total cell extracts FT3np6 appeared as two bands, but on
the PM only the heavier one was detected possibly because of more
extensive post-translational modifications such as
O-glycosylation. FT3np9 (C16L, C29L) appeared on the cell
surface as three bands probably because of post-translational
modifications. The quantitation of the PM levels from all the mutants
(Fig. 3C) suggested that the four amino acid residues were
important for retention of FT3wt in the Golgi.
Plasma Membrane Targeting of FT3np Led to a Significant Decrease in
the Biosynthetic Products of Fucosyltransferase III--
BHK cells,
when transfected with the wild-type form of fucosyltransferase III,
acquired new glycosylation properties and started to express the
Lea, sLea, Lex, and
sLex determinants, as detected by immunofluorescence
microscopy, using monoclonal antibodies anti-Lea PR5C5
(30), anti-sLea CA19-9 (31), anti-Lex SH1 (32),
and anti-sLex FH6 (33) (Fig.
4). The Lea is the major
de novo product observed since FT3wt has the predominant
On the other hand, for BHK-FT3np it was observed that the Lewis
determinants were formed only to a very minor extent (Fig. 4,
E-H), even if the mutant form was active. FT3np had a
comparable enzyme activity, 8.62 ± 0.66 µU/106
cells, to FT3wt, 8.67 ± 2.50 µU/106 cells. Since
FT3np was localized on the PM it did not meet the GDP-Fuc donor
substrate, which was concentrated intraGolgi, and, therefore, the
biosynthesis of the Lewis determinants was severely inhibited. The low
amounts of Lewis determinants that were observed were probably due to
the fraction of FT3np in transit through the Golgi.
Dimers of FT3wt in the Golgi Membranes Are Mediated by
Intramembrane Disulfide Bond Formation--
We have previously
observed that FT3wt does not form large salt insoluble oligomers at the
pH value of the Golgi lumen (4) similar to that found for other
trans-Golgi and TGN GTs, such as FT3wt Is Incorporated into Transport Vesicles in Contrast to
FT3np--
The cisternal maturation model is currently accepted to
explain some properties of the transport through the Golgi (16, 36). It
has been shown that cargo progresses through the Golgi together with
the cisternae (17) whereas Golgi resident proteins, such as GTs, are
retrieved into retrograde transport vesicles (20). We have isolated a
Golgi fraction from the BHK-FT3wt and BHK-FT3np cells and induced the
formation of vesicles, which we have separated in a sucrose gradient
and collected from the 30/50% interface according to the method
previously described (20). The assay was performed at 4 and 37 °C,
and the vesicle population was stained with uranyl acetate and observed
by negative staining electron microscopy. At 37 °C (Fig.
6A), a considerable number of
vesicles was detected contrary to that observed at 4 °C (Fig. 6B). These vesicles appeared irregular in shape because they
were produced in the presence of GTP, and a large proportion of
coatomer had already been released. The vesicles were analyzed by
Western blot for several protein markers (Fig. 6C). It was
observed that ~7% of the starting amount of FT3wt used in the assay
was incorporated into the vesicles at 37 °C. The medial-Golgi
soluble NEM-sensitive soluble factor attachment receptor (SNARE) GS28
(18) was also incorporated (~12% of the starting amount) into the
vesicles, as well as the p24
Preliminary results have indicated that the isolated transport vesicles
are COP I vesicles. When the budding assay was done in the presence of
coatomer-depleted cytosol, it was observed that FT3wt was not
incorporated in the vesicles at 37 °C. These results were in
agreement with those previously described for other Golgi resident
proteins: In this article, we present evidence that four amino acid
residues, Cys-16, Gln-23, Cys-29, and Tyr-33, from the TM of FT3wt are
required for its localization in the Golgi. The mutation of these amino
acid residues to Leu caused a shift in fucosyltransferase III
localization from the trans-Golgi/TGN to the plasma
membrane, as detected by immunofluorescence microscopy and cell surface biotinylation.
Studies from different groups with different enzymes have implicated
the TM, as well as flanking amino acids, from the luminal ( Transfection of BHK cells with FT3wt, which is targeted to the
trans-Golgi and the TGN (4), conferred the cells the new glycosylation capacity to perform the biosynthesis of the Lewis determinants, Lea, Lex, and sLex.
However, when the enzyme was targeted to the PM the biosynthesis of the
Lewis determinants was dramatically reduced even if FT3wt and FT3np had
similar activities and were expressed in similar amounts. Since FT3np
was in transit through the Golgi, its time of residence in this
compartment should be much lower than that of FT3, and therefore the
efficiency of Lewis determinants biosynthesis observed was much lower
for FT3np than for FT3wt. Similarly, previous results have shown that
soluble secretory forms of glycosyltransferases with low residence
times in the Golgi, such as fucosyltransferase VI (sFT6, Ref. 35) and
soluble In this work, we have also showed that FT3wt dimerization occurred
within the TM through disulfide bond formation involving Cys-16 and
Cys-29. The dimerization did not inactivate the enzyme since FT3wt and
FT3np had similar enzyme activities. The formation of one disulfide
bond mediated by Cys-16 or Cys-29 prevented a second disulfide bond
since higher molecular weight oligomers have not been observed by
non-reducing SDS-PAGE; this probably is caused by steric hindrance.
Intramembrane disulfide bond formation might consist of a regulated
process. Other GTs from the trans-Golgi and TGN have been
shown to dimerize (GM2 synthase, Refs. 40 and 41;
We cannot exclude that the introduction of Leu residues
into positions 16, 23, 29, and 33 in the TM might have created a new targeting signal to the PM. However, this is not probable since substitution of the TM of In vitro studies have indicated that the correct
localization of Golgi resident proteins, namely GTs, is due to their
concentration into retrograde COP I-coated vesicles in a process that
is dependent on GTP hydrolysis (20). We have found that FT3wt, a late
acting glycosyltransferase, was also incorporated into transport
vesicles contrary to its related plasma membrane mutant FT3np. Such
vesicles also contained the medial Golgi SNARE GS28 or the p24 family
proteins (p24 The results obtained strongly support that the composition of the Golgi
is maintained constant because of the incorporation of resident
proteins such as FT3wt into retrograde COP I-coated vesicles. FT3np,
which was transiently detected in the Golgi, but whose final
destination was the PM, was never detected in this transport vesicle population.
The molecular basis for FT3wt concentration in the retrograde transport
vesicles involves Cys-16, Gln-23, Cys-29, and Tyr-33 from its
transmembrane domain. These amino acid residues might mediate
interactions with other proteins or specific lipids necessary for
sorting into COP I vesicles. Cross-linking and immunoprecipitation experiments are presently in progress in order to detect and identify potential FT3wt-binding proteins important for the sorting process.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
3/4 fucosyltransferase III (FT3wt) (EC 2.4.1.65) preferentially transfers fucose (Fuc) from the GDP-Fuc donor
onto type I (Gal
3GlcNAc)-containing glycolipids and glycoproteins (1, 2) with the biosynthesis of Lewisa (Lea),
sialyl-Lewisa (sLea), and Lewisb
(Leb) determinants, which are involved in cell adhesion
events (3). FT3wt also synthesizes the type II (Gal
4GlcNAc)-derived
carbohydrates, the Lewisx (Lex),
sialyl-Lewisx (sLex), and Lewisy
(Ley), although to a lower extent (1, 4).
-helix association (5) and to be important for the correct localization of protein M in the Golgi (6). The luminal domain of GTs
has also been shown to be important for the formation of protein-protein complexes. It has been observed that
cis/medial GTs form large insoluble oligomers,
contrary to late Golgi GTs that usually exist as dimers (7-9).
Furthermore, changing the targeting of cis/medial
Golgi mannosidase II to the endoplasmic reticulum (ER) leads to
accumulation of N-acetylglucosaminyltransferase I
in the ER (7, 10) in a kin-recognition mechanism. On the other hand, it has been observed that increasing the length of the TM
of
2,6-sialyltransferase caused a shift in localization from the
Golgi to the plasma membrane (11, 12). Recent evidence has also shown
that the cytoplasmic tail was essential for the correct Golgi
localization of fucosyltransferase I (13) and
3-galactosyltransferase (14).
4-galactosyltransferase
(trans-Golgi and TGN) have been shown to be concentrated
into COP I vesicles in a process that is dependent on GTP hydrolysis by
ADP-ribosylation factor (Arf)-1 and its effector Arf GTPase-activating
protein (GAP) 1 (18, 20).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1 and
2
adaptins, respectively) (Sigma); rabbit polyclonal anti-CD71 (Santa
Cruz Biotechnology), mouse monoclonal anti-
COP (Sigma), mouse
monoclonal anti-GS28 (Transduction Laboratories), mouse monoclonal
anti-apolipoprotein E (ApoE) (Transduction Laboratories). The secondary
antibodies used were: goat anti-mouse IgG tetramethylrhodamine
-isothiocyanate (TRITC) conjugate (Sigma); goat anti-rabbit IgG
fluorescein isothiocyanate (FITC) conjugate (Sigma); goat anti-mouse
horseradish peroxidase-labeled polyclonal (Dianova); goat anti-rabbit
horseradish peroxidase-labeled (Amersham Biosciences); goat anti-mouse
IgM-Texas red conjugate (Jackson ImmunoResearch). All other chemicals
were obtained from commercial sources and were of the highest purity available.
Forward mutagenesis primers of the transmembrane fucosyltransferase III
mutant forms
80 °C.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
2,6-sialyltransferase, Refs. 11 and 23;
1,4-galactosyltransferase, Refs. 7 and 24;
N-acetylglucosaminyltransferase I, Refs. 21 and 25; core 2
1,6-N-acetylglucosaminyltransferase, Ref. 26). More polar
amino acids and/or Cys residues within the TM have been suggested to
play an important role in the process, e.g.
1,4-galactosyltransferase (27, 28) and protein M from the avian
coronavirus infectious bronchitis virus (6).

View larger version (33K):
[in a new window]
Fig. 1.
Schematic representation of FT3wt and the
transmembrane mutant forms. FT3wt is composed of a short
cytoplasmic tail (cyt), the transmembrane domain
(tm), a stem region (stem), and the catalytic
domain (cat).

View larger version (13K):
[in a new window]
Fig. 2.
Localization of FT3np in BHK cells by
indirect immunofluorescence microscopy. BHK-FT3wt
(A-C) and BHK-FT3np (D-F) cells
were fixed with 3% paraformaldehyde and incubated with rabbit
polyclonal anti-fucosyltransferase III antibody and mouse monoclonal
anti-58K protein. Incubations with 0.1% Triton X-100 and 750 µg/ml
CHX are indicated on top of the figure. Secondary antibodies
were anti-rabbit IgG FITC and anti-mouse IgG TRITC conjugates. Cells
were photographed on Leica DMRB microscope. Scale bar, 10 µm.

View larger version (40K):
[in a new window]
Fig. 3.
Western blot analysis of fucosyltransferase
mutants. Biotinylated plasma membrane proteins (A) or
proteins from cell extracts (B) of BHK cells stably
transfected with FT3wt or mutants were analyzed. Plasma membrane
proteins were biotinylated with sulfo-NHS-SS-biotin, isolated with
steptavidin-agarose and fucosyltransferase forms were detected using an
antibody against a peptide from the catalytic domain (lanes
1-16) whereas calnexin (CNX; lane 17) was
detected with a polyclonal antibody anti-calnexin as a measure of the
background for cell surface biotinylation. C, quantitation
of data presented in panels A and B; average and
deviation of 3-5 independent experiments are shown. The surface
expression of FT3np was arbitrarily set as 1, and the surface
expression of the other mutants was represented as a percentage of
this.
4 fucosyltransferase activity (Fig. 4A). Though, in
vitro, FT3wt preferentially fucosylates sialylated acceptors (2,
4), in vivo, the amount of de novo
sLea formed was very low (Fig. 4B), probably
because of competition between fucosyltransferase III and endogeneous
2,3-sialyltransferase. Probably the latter enzyme is not capable of
sialylating fucosylated structures similar to its rat liver homologue
(34). Therefore, if fucosyltransferase III acts on type I acceptors
before
2,3-sialyltransferase, Lea determinants are
predominantly formed. The BHK-FT3wt cells also became capable of
de novo synthesis of Lex and sLex
(Fig. 4, C and D) as previously observed from the
detailed carbohydrate analysis of a reporter glycoprotein (35).
Staining of Lea (Fig. 4A) where higher
fluorescence intensities were observed, showed a vesicular-dispersed
pattern through the cytoplasm. These vesicles were not identified;
however, they did not consist of endosomes since they did not
colocalize with the transferrin receptor (TfR) (data not shown). Both
Lex and sLex (Fig. 4, C and
D) showed a perinuclear pattern characteristic of the Golgi
and a few vesicles scattered through the cytoplasm, the staining levels
being higher for the sialylated Lex motif.

View larger version (30K):
[in a new window]
Fig. 4.
Detection of Lewis motifs in BHK-FT3wt and
BHK-FT3np cells by indirect immunofluorescence. BHK-FT3wt
(A-D), BHK-FT3np (E-H), and BHK cells
(I-L) were fixed with 4% paraformaldehyde and
permeabilized with 0.1% Triton X-100. Cells were probed with the
antibodies anti-Lea PR5C5 (A, E,
I), anti-sLea CA19-9 (B,
F, J), anti-Lex SH1 (C,
G, K), and anti-sLex FH6
(D, H, L). Secondary antibodies were
anti-mouse IgG FITC conjugate (A-C, E-G,
I-K) or anti-mouse IgM Texas Red Dye conjugate
(D, H, L). Scale bar, 10 µm.
1,4
galactosyltransferase and
1,2 fucosyltransferase (8). However, the
protein dimerizes and exists as a mixture of monomers and
disulfide-bonded dimers (4). In the present work, we have analyzed the
formation of dimers in FT3wt mutants where one cysteine (FT3np2 and
FT3np4), both cysteines (FT3np9) or both cysteines, the glutamine and
the tyrosine (FT3np) were replaced by leucines. It was observed that
when both cysteine residues were changed (FT3np9 and FT3np), the dimer
formation was abolished (Fig. 5). In the
single cysteine mutants FT3np2 and FT3np4, it was observed that the
presence of a single cysteine residue in the TM was enough for the
formation of disulfide-bonded dimers. No other higher molecular weight
complexes mediated by disulfide bonds were observed, probably due to
steric hindrance of the catalytic domain.

View larger version (36K):
[in a new window]
Fig. 5.
Formation of disulfide-mediated dimers of
fucosyltransferase III. BHK cells expressing FT3np2, FT3np4 (one
cysteine mutated to leucine), FT3np9 (both cysteines mutated to
leucines), and FT3np (both cysteines, the glutamine and the tyrosine
mutated to leucines) were solubilized with MNT buffer containing 150 mM NaCl. The extract was centrifuged for 15 min at
15,000 × g, and the pellet (P) and
supernatant (S) were analyzed by non-reducing SDS-PAGE and
Western blot. D, dimer; M, monomer.
3, p24
2, p24
1, and p24
1
subunits of the p24 complex (10-20% of the starting material), known
to recycle between the ER-Golgi intermediate compartment (ERGIC) and
early Golgi compartments (37). In contrast, FT3np did not show a
difference in behavior between 4 and 37 °C and was not incorporated
into vesicles at 37 °C, similar to that found for the TfR or the
soluble anterograde cargo ApoE.

View larger version (63K):
[in a new window]
Fig. 6.
Western blot analysis of COP I vesicles from
BHK-FT3wt and BHK-FT3np cells. Vesicles were produced at 4 (A) or 37 °C (B) as described under
"Experimental Procedures" and analyzed by negative staining
electron microscopy. Arrow (
) indicates a typical
vesicle. Western blot analysis of the vesicle fractions (C)
was performed with antibodies against the catalytic domain of
fucosyltransferase III,
COP, GS28, p24
3, p24
2, p24
1,
p24
1, apolipoprotein E (ApoE), and transferrin receptor
(TfR). The starting material is indicated as a standard
curve between 2.5 and 20%. Scale bar, 200 nm.
-mannosidase, N-acetylglucosaminyltransferase I, and
4-galactosyltransferase (20).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
4-galactosyltransferase, Ref. 24;
2,6-sialyltransferase, Ref.
11; N-acetylglucosaminyltransferase I and mannosidase II, Refs. 7 and 12; N-acetylglucosaminyltransferase V, Ref. 38; N-acetylglucosaminyltransferase I and II, Ref. 8) and from the cytoplasmic domain (
2-fucosyltransferase, Ref. 13;
3-galactosyltransferase, Ref. 14;
6
N-acetylglucosaminyltransferase, Ref. 26) in the correct
localization of GTs along the exocytic pathway. In general, there is no
clear evidence for the influence of each of these domains, separately,
for their correct localization. Our finding that for FT3wt, four amino
acid residues from the TM are sufficient for its localization in the
Golgi, provides a tool to elucidate the molecular mechanism underlying
its Golgi retention/retrieval.
3-galactosyltransferase (s
3GT, Ref. 39) kept their
glycosylation capacity in vivo but with a lower efficiency.
A 20-fold overexpression of sFT6 only produced small amounts of
fucosylated products (10%
3-monofucosylated and 7%
3-difucosylated) (35). Furthermore, a 2-fold overexpression of
s
3GT produced lower amounts of cell-associated
3-galactosylated glycoproteins than full-length
3-galactosyltransferase (39).
2-mannosidase, Ref. 42; GD3 synthase, Ref. 43;
4-galactosyltransferase, Ref. 28;
2-fucosyltransferase, Ref. 8;
fucosyltransferase VI, Ref. 44; Gal
3-glucuronyltransferase, Ref.
45).
4-Galactosyltransferase has been shown to form homodimers mediated by Cys-29 and/or His-32 from the TM, and dimerization was
associated with Golgi localization (28). On the other hand,
2,6-sialyltransferase has been shown to dimerize through Cys-24 from
its TM, dimerization not being required for Golgi localization or
enzyme activity, but possibly necessary to induce higher multiplicity oligomerization (9). For FT3, it was found that mutation of Cys-29 led
to increased levels of expression on the PM (FT3np2). Furthermore, when
Cys-16 and Cys-29 were not mutated (FT3np6), levels of expression on
the cell surface comparable to those of FT3wt were detected. These
results suggested that Cys from the TM might play a role in Golgi
retention of FT3.
2,6-sialyltransferase by a peptide with
the same number of Leu residues did not have an effect on Golgi
localization of the enzyme (11). Furthermore, the substitution of a
single residue to Leu (FT3np1, FT3np2, FT3np3, and FT3np4) was enough
to induce a localization shift to the PM.
3,
2,
1,
1) but not anterograde cargo such as
the plasma membrane TfR or soluble ApoE.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Prof. Ari Helenius (ETH, Switzerland) for the antibody anti-calnexin. We thank Prof. Leonor David and Dr. Celso Reis (IPATIMUP, Portugal) for anti-Lewis determinant antibodies.
| |
FOOTNOTES |
|---|
* This work was funded by Grants PRAXIS XXI BIO/12072/1998, BIOTEC 35679/99, and 38361 BCI/99 from the FCT, Portugal.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ Recipients of Fundação para a Ciência e a Tecnologia fellowships.
** To whom correspondence should be addressed: ITQB, Av. República, Apart. 127, 2780 Oeiras, Portugal. Tel.: 351-21-4469437; Fax: 351-21-4411277; E-mail: jcosta@itqb.unl.pt.
Published, JBC Papers in Press, December 18, 2002, DOI 10.1074/jbc.M209325200
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
GTs, glycosyltransferases;
ApoE, apolipoprotein E;
Arf, ADP-rybosylation
factor;
Arf-GAP, Arf GTPase-activating protein;
CHX, cycloheximide;
COP
I, coatomer protein I;
ER, endoplasmic reticulum;
ERGIC, ER-Golgi
intermediate compartment;
FT3wt,
3/4 fucosyltransferase III;
Lea/b/x/y, Lewisa/b/x/y;
NEM, N-ethylmaleimeide;
sLea/x
sialyl-Lewisa/x, SNARE, soluble NEM-sensitive factor
attachment protein receptor;
TfR, transferrin receptor;
TGN, trans-Golgi network;
TM, transmembrane domain;
TRITC, tetramethylrhodamine
-isothiocyanate;
FITC, fluorescein
isothiocyanate;
DMEM, Dulbecco's modified Eagle's medium;
MES, 4-morpholineethanesulfonic acid;
wt, wild type;
PM, plasma
membrane.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Kukowska-Latallo, J. F.,
Larsen, R. D.,
Nair, R. P.,
and Lowe, J. B.
(1990)
Genes Dev.
4,
1288-1303 |
| 2. |
Costa, J.,
Grabenhorst, E.,
Nimtz, M.,
and Conradt, H. S.
(1997)
J. Biol. Chem.
272,
11613-11621 |
| 3. | Lowe, J. B. (1994) in Molecular Glycobiology (Fukuda, M. , and Hindsgaul, O., eds) , pp. 163-205, Oxford University Press, New York |
| 4. | Sousa, V. L., Costa, M. T., Palma, A. S., Enguita, F., and Costa, J. (2001) Biochem. J. 357, 803-810[CrossRef][Medline] [Order article via Infotrieve] |
| 5. |
Gratkowski, H.,
Lear, J. D.,
and DeGrado, W. F.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
880-885 |
| 6. | Machamer, C. E., Grim, M. G., Esquela, A., Chung, S. W., Rolls, M., Ryan, K., and Swift, A. M. (1993) Mol. Biol. Cell 4, 695-704[Abstract] |
| 7. | Nilsson, T., Hoe, M. H., Slusarewicz, P., Rabouille, C., Watson, R., Hunte, F., Watzele, G., Berger, E. G., and Warren, G. (1994) EMBO J. 13, 562-574[Medline] [Order article via Infotrieve] |
| 8. |
Opat, A. S.,
Houghton, F.,
and Gleeson, P.
(2000)
J. Biol. Chem.
275,
11836-11845 |
| 9. |
Qian, R.,
Chen, C.,
and Colley, K. J.
(2001)
J. Biol. Chem.
276,
28641-28649 |
| 10. | Nilsson, T., Rabouille, C., Hui, N., Watson, R., and Warren, G. (1996) J. Cell Sci. 109, 1975-1989[Abstract] |
| 11. | Munro, S. (1991) EMBO J. 10, 3577-3588[Medline] [Order article via Infotrieve] |
| 12. | Munro, S. (1995) EMBO J. 14, 4695-4704[Medline] [Order article via Infotrieve] |
| 13. |
Milland, J.,
Taylor, S. G.,
Dodson, H. C.,
McKenzie, I. F.,
and Sandrin, M. S.
(2001)
J. Biol. Chem.
276,
12012-12018 |
| 14. |
Milland, J.,
Russell, S. M.,
Dodson, H. C.,
McKenzie, I. F.,
and Sandrin, M. S.
(2002)
J. Biol. Chem.
277,
10374-10378 |
| 15. | Storrie, B., Pepperkok, R., and Nilsson, T. (2000) Trends Cell Biol. 10, 385-391[CrossRef][Medline] [Order article via Infotrieve] |
| 16. |
Allan, B. B.,
and Balch, W. E.
(1999)
Science
285,
63-66 |
| 17. |
Mironov, A. A.,
Beznoussenko, G. V.,
Nicoziani, P.,
Martella, O.,
Trucco, A.,
Kweon, H. S., Di,
Giandomenico, D.,
Polishchuk, R. S.,
Fusella, A.,
Lupetti, P.,
Berger, E. G.,
Geerts, W. J.,
Koster, A. J.,
Burger, K. N.,
and Luini, A.
(2001)
J. Cell Biol.
155,
1225-1238 |
| 18. |
Lanoix, J.,
Ouwendijk, J.,
Stark, A.,
Szafer, E.,
Cassel, D.,
Dejgaard, K.,
Weiss, M.,
and Nilsson, T.
(2001)
J. Cell Biol.
155,
1199-1212 |
| 19. |
Martinez-Menarguez, J. A.,
Prekeris, R.,
Oorschot, V. M.,
Scheller, R.,
Slot, J. W.,
Geuze, H. J.,
and Klumperman, J.
(2001)
J. Cell Biol.
155,
1213-1224 |
| 20. | Lanoix, J., Ouwendijk, J., Lin, C. C., Stark, A., Love, H. D., Ostermann, J., and Nilsson, T. (1999) EMBO J. 18, 4935-4948[CrossRef][Medline] [Order article via Infotrieve] |
| 21. |
Tang, B. L.,
Wong, S. H.,
Low, S. H.,
and Hong, W.
(1992)
J. Biol. Chem.
267,
10122-10126 |
| 22. | Balch, W. E., Dunphy, W. G., Braell, W. A., and Rothman, J. E. (1984) Cell 39, 405-416[CrossRef][Medline] [Order article via Infotrieve] |
| 23. |
Wong, S. H.,
Low, S. H.,
and Hong, W.
(1992)
J. Cell Biol.
117,
245-258 |
| 24. | Nilsson, T., Lucocq, J. M., Mackay, D., and Warren, G. (1991) EMBO J. 10, 3567-3575[Medline] [Order article via Infotrieve] |
| 25. | Opat, A. S., Houghton, F., and Gleeson, P. A. (2001) Biochem. J. 358, 33-40[CrossRef][Medline] [Order article via Infotrieve] |
| 26. |
Zerfaoui, M.,
Fukuda, M.,
Langlet, C.,
Mathieu, S.,
Suzuki, M.,
Lombardo, D.,
and El-Battari, A.
(2002)
Glycobiology
12,
15-24 |
| 27. |
Aoki, D.,
Lee, N.,
Yamaguchi, N.,
Dubois, C.,
and Fukuda, M. N.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
4319-4323 |
| 28. |
Yamaguchi, N.,
and Fukuda, M. N.
(1995)
J. Biol. Chem.
270,
12170-12176 |
| 29. | Landolt-Marticorena, C., Williams, K. A., Deber, C. M., and Reithmeier, R. A. (1993) J. Mol. Biol. 229, 602-608[CrossRef][Medline] [Order article via Infotrieve] |
| 30. |
Young, W. W., Jr.,
Johnson, H. S.,
Tamura, Y.,
Karlsson, K. A.,
Larson, G.,
Parker, J. M.,
Khare, D. P.,
Spohr, U.,
Baker, D. A.,
Hindsgaul, O.,
and Lemieux, R. U.
(1983)
J. Biol. Chem.
258,
4890-4894 |
| 31. |
Fukushi, Y.,
Hakomori, S.,
Nudelman, E.,
and Cochran, N.
(1984)
J. Biol. Chem.
259,
4681-4685 |
| 32. |
Magnani, J. L.,
Nilsson, B.,
Brockhaus, M.,
Zopf, D.,
Steplewski, Z.,
Koprowski, H.,
and Ginsburg, V.
(1982)
J. Biol. Chem.
257,
14365-14369 |
| 33. |
Fukushi, Y.,
Nudelman, E.,
Levery, S. B.,
Hakomori, S.,
and Rauvala, H.
(1984)
J. Biol. Chem.
259,
10511-10517 |
| 34. |
Wlasichuk, K. B.,
Kashem, M. A.,
Nikrad, P. V.,
Bird, P.,
Jiang, C.,
and Venot, A. P.
(1993)
J. Biol. Chem.
268,
13971-13977 |
| 35. |
Grabenhorst, E.,
Nimtz, M.,
Costa, J.,
and Conradt, H. S.
(1998)
J. Biol. Chem.
273,
30985-30994 |
| 36. | Glick, B. S., Elston, T., and Oster, G. (1997) FEBS Lett. 414, 177-181[CrossRef][Medline] [Order article via Infotrieve] |
| 37. |
Dominguez, M.,
Dejgaard, K.,
Fullekrug, J.,
Dahan, S.,
Fazel, A.,
Paccaud, J. P.,
Thomas, D. Y.,
Bergeron, J. J.,
and Nilsson, T.
(1998)
J. Cell Biol.
140,
751-765 |
| 38. |
Sasai, K.,
Ikeda, Y.,
Tsuda, T.,
Ihara, H.,
Korekane, H.,
Shiota, K.,
and Taniguchi, N.
(2001)
J. Biol. Chem.
276,
759-765 |
| 39. |
Cho, S. K.,
and Cummings, R. D.
(1997)
J. Biol. Chem.
272,
13622-13628 |
| 40. |
Jaskiewicz, E.,
Zhu, G.,
Bassi, R.,
Darling, D. S.,
and Young, W. W., J.
(1996)
J. Biol. Chem.
271,
26395-26403 |
| 41. |
Zhu, G.,
Jaskiewicz, E.,
Bassi, R.,
Darling, D. S.,
and Young, W. W., Jr.
(1997)
Glycobiology
7,
987-996 |
| 42. |
Moremen, K. W.,
Touster, O.,
and Robbins, P. W.
(1991)
J. Biol. Chem.
266,
16876-16885 |
| 43. | Daniotti, J. L., Martina, J. A., Giraudo, C. G., Zurita, A. R., and Maccioni, H. J. (2000) J. Neurochem. 74, 1711-1720[CrossRef][Medline] [Order article via Infotrieve] |
| 44. |
Borsig, L.,
Katopodis, A. G.,
Bowen, B. R.,
and Berger, E. G.
(1998)
Glycobiology
8,
259-268 |
| 45. | Ouzzine, M., Antonio, L., Burchell, B., Netter, P., Fournel-Gigleux, S., and Magdalou, J. (2000) Mol. Pharmacol. 58, 1609-1615[Medline] [Order article via Infotrieve] |
| 46. | Morais, V. A., Serpa, J., Palma, A. S., Costa, T., Maranga, L., and Costa, J. (2001) Biochem. J. 353, 719-725[CrossRef][Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
![]() |
F. H. Fenteany and K. J. Colley Multiple Signals Are Required for {alpha}2,6-Sialyltransferase (ST6Gal I) Oligomerization and Golgi Localization J. Biol. Chem., February 18, 2005; 280(7): 5423 - 5429. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dupuy, A. Germot, R. Julien, and A. Maftah Structure/function study of Lewis {alpha}3- and {alpha}3/4-fucosyltransferases: the {alpha}1,4 fucosylation requires an aromatic residue in the acceptor-binding domain Glycobiology, April 1, 2004; 14(4): 347 - 356. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||