|
Originally published In Press as doi:10.1074/jbc.M210751200 on November 14, 2002
J. Biol. Chem., Vol. 278, Issue 9, 7725-7734, February 28, 2003
Rib72, a Conserved Protein Associated with the Ribbon Compartment
of Flagellar A-microtubules and Potentially Involved in the Linkage
between Outer Doublet Microtubules*
Kazuho
Ikeda §,
Jennifer A.
Brown§¶,
Toshiki
Yagi ,
Jan M.
Norrander¶,
Masafumi
Hirono ,
Eric
Eccleston¶ ,
Ritsu
Kamiya **, and
Richard W.
Linck¶
From the Department of Biological Sciences, Graduate
School of Science, University of Tokyo, Tokyo 113-0033, Japan and the
¶ Department of Genetics, Cell Biology, and Development,
University of Minnesota, Minneapolis, Minnesota 55455
Received for publication, October 21, 2002, and in revised form, November 14, 2002
 |
ABSTRACT |
Ciliary and flagellar axonemes are basically
composed of nine outer doublet microtubules and several functional
components, e.g. dynein arms, radial spokes, and
interdoublet links. Each A-tubule of the doublet contains a specialized
"ribbon" of three protofilaments composed of tubulin and other
proteins postulated to specify the three-dimensional arrangement of the
various axonemal components. The interdoublet links hold the doublet
microtubules together and limit their sliding during the flagellar
beat. In this study on Chlamydomonas reinhardtii, we cloned
a cDNA encoding a 71,985-Da polypeptide with three DM10
repeats, two C-terminal EF-hand motifs, and homologs extending to
humans. This polypeptide, designated as Rib72, is a novel component of
the ribbon compartment of flagellar microtubules. It remained
associated with 9-fold arrays of doublet tubules following extraction
under high and low ionic conditions, and anti-Rib72 antibodies revealed
an ~96-nm periodicity along axonemes, consistent with Rib72
associating with interdoublet links. Following proteolysis- and
ATP-dependent disintegration of axonemes, the rate of
cleavage of Rib72 correlated closely with the rate of sliding
disintegration. These observations identify a ribbon-associated protein
that may function in the structural assembly of the axoneme and in the
mechanism and regulation of ciliary and flagellar motility.
 |
INTRODUCTION |
In organisms ranging from protists to mammals, cilia and flagella
act as propulsive and sensory organelles (1). In mice and humans,
mutations affecting cilia lead to a variety of phenotypes, including
abnormalities in left-right axis development (e.g.
situs inversus), blindness, male sterility, polycystic
kidney disease, polydactyly, and respiratory and liver diseases (2-5).
This study describes a flagellar microtubule-associated protein that
has been contemporaneously discovered and studied by three
laboratories. The timely and detailed studies of this previously
unknown protein now shed light on its role in the structural assembly
of the ciliary axoneme and in the mechanism and regulation of motility.
Cilia and flagella are composed of ~250 different polypeptides, whose
assembly is nucleated by a modified centriole, the basal body, to form
a membrane-bound axoneme (6). The three-dimensionally precise and
complex structure of the axoneme is essential to its function,
e.g. the propagation of regular bending waves. In most eukaryotes, the axoneme is composed of nine outer doublet microtubules, two central singlet microtubules, and numerous axoneme-associated components. Outer dynein arms, inner dynein arms, radial spokes, and
interdoublet links are bound at precise points both around and
along the A-microtubule, with axial spacings characteristic of each of
the different components and species. In Chlamydomonas reinhardtii, outer dynein arms are attached to docking sites with axial repeats of 24-nm intervals (7, 8). Radial spokes and inner dynein
arms have more complex subspacings, but have an overall axial repeat of
96 nm (9, 10). These spacings are multiples of the 8-nm tubulin dimer
repeat; however, it is unlikely in Chlamydomonas, with only
one isoform each of - and -tubulin (11, 12), that the tubulin
lattice alone provides the three-dimensional spatial information for
the binding of all the different axonemal components. How the
evolutionarily conserved and precise structure of the axoneme is formed
remains an intriguing and important question.
This question has been partially addressed by evidence implicating a
unique feature of the A-microtubule as a scaffold for the
three-dimensional architecture of the axoneme. In organisms as
divergent as protists (Chlamydomonas), echinoderms, and
mollusks, extraction of doublet microtubules with the detergent
Sarkosyl causes the breakdown of A-microtubules into "ribbons" of
three adjoining protofilaments, as seen by electron microscopy
(13-18). In parallel with molecular cloning studies in sea urchin and
mouse (19-22), chemical cross-linking studies demonstrated that three polypeptides, tektins A, B, and C, remain as extended 5-nm diameter filaments after extraction of the ribbons with 2 M urea
(23). Structural studies indicated that a tektin polymer forms one of the protofilaments of the ribbons and A-microtubules, approximately in
the section of the wall to which the radial spokes and inner B-tubule
wall are attached (24). Other studies indicated that tektin A, which
has a dramatic steady-state turnover rate in ciliated epithelia, may
assemble into the ribbon of pre-existing doublet microtubules (25).
Tektins and ribbons have observed and/or predicted axial periodicities
of 16, 24, 32, 40, and 48 nm (17, 21, 24, 26). Collectively, these
observations led to the hypothesis that tektin filaments act as
molecular rulers that relay spatial information for the binding of
axonemal components within the axoneme. Associated with the ribbons of
Chlamydomonas flagella are polypeptides of 43 and ~70 kDa.
The Rib43a protein and RIB43a gene have been characterized
(18). Rib43a has homologs in species ranging from Caenorhabditis
elegans and Drosophila to human; and although it does
have a coiled-coil structure similar to half a tektin subunit, it has
no primary sequence homology to tektins. Further studies of ribbons and
their components will likely provide important insights into the
assembly and function of cilia and flagella.
Ciliary and flagellar beating is based on localized sliding between
adjacent outer doublet microtubules that oscillate back and forth
within a certain distance (27). Therefore, the outer doublets, while
remaining connected to each other, must have the freedom to undergo
shearing motion over a limited length. The classic experiment by
Summers and Gibbons (28) showed that, when ATP is added to fragmented
axonemes of sea urchin sperm after brief trypsin treatment, axonemes
disintegrate via sliding of the outer doublet microtubules. Subsequent
work by Sale and Satir (29) demonstrated that the dynein-mediated
sliding occurs in a polar minus-end direction. Summers and Gibbons (28)
suggested that trypsin disrupts the structure connecting adjacent outer doublet microtubules while leaving the force generator dynein functionally intact. An interdoublet microtubule connection was thought
to have the function of limiting the sliding distance and thus
converting sliding to bending; proteolytic disruption of this structure
presumably allows limitless sliding. In fact, electron microscope
studies indicated that interdoublet links and radial spokes are rapidly
lost due to the proteolysis, whereas dynein persists for some time
(30). The interdoublet links, also called nexin links, seem to be more
fundamental than radial spokes for axoneme function because later
studies with Chlamydomonas mutants indicated that axonemes
can beat without radial spokes under certain conditions (31, 32). We
may thus expect that the interdoublet links are essential both for
maintaining the axonemal structure and for producing regular bending
waves. However, despite the expected functional importance
of interdoublet links, little is known about their molecular identity
and properties. Some studies suggest that the link is highly elastic
and stretchable (33, 34), whereas other studies suggest that it can
reversibly detach from the outer doublets and thus is not necessarily
elastic (35, 36). Additional studies indicated that adjacent outer doublets are indeed connected by an elastic component (37, 38), and yet
the connection can reversibly detach from the outer doublets (38).
Clearly, more information must be obtained regarding the molecules that
constitute the interdoublet link.
The study reported here started independently in our two laboratories,
one aiming at characterizing the ~70-kDa ribbon component and the
other aiming at a protein constituting or associated with the
interdoublet links. To our surprise, our laboratories arrived at the
same protein. We report here the characterization of a 72-kDa
ribbon-associated protein that potentially functions in the structural
assembly of the axoneme and in maintaining the linkage of the nine
outer doublet microtubules during dynein-mediated sliding and flagellar
beating. Our results extend those of Patel-King et al. (39),
who also reported the predicted structure of the 72-kDa protein and
postulated it to be a regulatory subunit of a nucleoside-diphosphate kinase.
 |
EXPERIMENTAL PROCEDURES |
Strains and Culture--
The cell strains used in this study
were C. reinhardtii wild-type 137c, oda1
lacking the outer arm dynein (40), and pf14 lacking the
radial spokes (41). Cells were grown at 21 or 25 °C in Tris
acetate/phosphate medium (42) with aeration under a 12/12-h light/dark
cycle or in rich medium containing sodium acetate and additional
potassium phosphate under continuous light (43, 44).
Isolation of Axonemes--
Flagellar axonemes were isolated by
the dibucaine method of Witman et al. (45) or by the pH
shock method of Witman et al. (14, 15). Flagella were
demembranated to yield axonemes by extraction with Nonidet P-40
in HMDEK solution (30 mM HEPES, 5 mM
MgSO4, 1 mM
DTT,1 1 mM EGTA,
and 50 mM potassium acetate, pH 7.4) or in HSSD solution (10 mM HEPES, 1 mM SrCl2, 4%
sucrose, and 1 mM DTT, pH 7.5). Axonemes were finally
resuspended in HMDEK solution or purified by sucrose gradient
centrifugation (14, 43, 44) and resuspended in HSSD solution.
High and Low Salt Extraction of Axonemes--
Flagellar axonemes
were extracted with high ionic strength solution (HMDEK solution plus
0.6 M KCl) for 30 min at 4 °C. The suspension was then
dialyzed overnight against low ionic strength solution (2 mM HEPES, 0.2 mM EDTA, and 0.5 mM
DTT, pH 7.4). The integrity of the extracted axonemes was observed by
dark-field microscopy. The extracted axonemes were centrifuged at
10,000 × g for 10 min to obtain the pellet and
supernatant for SDS-PAGE analysis.
Isolation and Purification of Ribbons--
Axonemes were
fractionated into protofilament ribbons as previously described (18)
with the modifications described under "Results."
Sliding Disintegration--
Sliding disintegration of axonemes
was induced by a method based on the method of Summers and Gibbons
(28). Protease (trypsin, elastase, or nagarse) and ATP (final
concentration of 0.1 mM) were added to an axonemal
suspension at room temperature. These proteases have been shown to be
effective in inducing disintegration of Chlamydomonas
axonemes (46). The protein ratio of protease to axonemes was varied
between 1:2000 and 1:50. In some experiments, the progression of
disintegration was monitored using a dark-field microscope equipped
with a 100-watt mercury arc lamp and SIT camera (Hamamatsu Photonics,
Hamamatsu, Japan). The progress of sliding disintegration was
quantified by measuring the number of apparently intact axonemes
versus those that underwent disintegration. Because the
axonemes were not first fragmented, the outer doublet microtubules remained held together at the base even after disintegration took place. This condition facilitated the measurement of the numbers of
disintegrated axonemes. In other experiments, the progression of
disintegration was monitored spectrophotometrically by measuring the
turbidity of the samples at 350 nm after addition of ATP and protease.
For protein analysis of the disintegrating axonemes, aliquots of
samples were transferred at regular intervals to SDS-PAGE sample buffer
and immediately boiled for 3 min.
Sequencing of the 72-kDa Ribbon-associated Protein by Tandem Mass
Spectrometry--
This procedure was modified from that of Kinter and
Sherman (47) and conducted at room temperature except when stated
otherwise. The relevant protein band was cut from the gel and cut into
pieces of ~1 mm3. Gel pieces were extracted with 200 µl
of 50% methanol and 5% acetic acid overnight and again for 3 h. A 5-min incubation with 200 µl of acetonitrile was carried out to
dehydrate the gel pieces. The acetonitrile was discarded, and
dehydration was completed by centrifugation under vacuum for 3 min. Gel
pieces were rehydrated by incubation for 30 min in 30 µl of 10 mM DTT in 100 mM ammonium bicarbonate. The DTT
solution was discarded, and 30 µl of 100 mM iodoacetamide
in 100 mM ammonium bicarbonate was added with incubation
for 30 min. The iodoacetamide solution was discarded, and the gel
pieces were dehydrated with acetonitrile as described above. After
discarding the acetonitrile, the gel pieces were rehydrated with 200 µl of 100 mM ammonium bicarbonate for 10 min. The
ammonium bicarbonate was discarded, and the gel pieces were dehydrated
with acetonitrile as described above. After discarding the
acetonitrile, dehydration of the gel pieces was completed by
centrifugation under vacuum for 3 min.
30 µl of trypsin reagent (20 µg/ml of ice-cold 50 mM
ammonium bicarbonate) was added to the sample, and the gel pieces were allowed to rehydrate on ice for 10 min with occasional vortexing. The
gel pieces were centrifuged for 30 s, and excess trypsin solution was removed. 5 µl of 50 mM ammonium bicarbonate was added
to the sample, and the sample was vortexed. Digestion was carried out overnight at 37 °C. 30 µl of 50 mM ammonium
bicarbonate was added to the digest, and the sample was extracted for
10 min with occasional gentle vortexing. The gel pieces were
centrifuged for 30 s, and the peptide-containing supernatant was
transferred to a plastic microcentrifuge tube. This extraction
was repeated two more times, and the supernatants were combined.
The volume of the extract was reduced to <20 µl in a vacuum
centrifuge. 1 µl of peptide extract was manually injected onto a
ThermoHypersil BetaBasic18 C18 microbore column (50 × 0.18 mm, 150-Å pore size) running at 2 µl/min. A linear gradient
from 100% solution A (95% acetonitrile/water with 1% formic acid) to
40% solution B (5% acetonitrile/water with 1% formic acid) was run
for 40 min with direct nanoelectrospray into a Finnigan LCQ ion trap.
Data-dependent tandem mass spectra were acquired by
automatic switching between mass spectrometry and tandem mass
spectrometry mode by the instrument (described in the instrument
documentation) and were searched using Sequest software (48) against
the latest version of the expressed sequence tag data bases filtered
for Chlamydomonas.
Clones AV396026 and AV626093 were sequenced by the DNA Sequencing and
Synthesis Facility of Iowa State University (Ames, IA). Sequence
assembly and analysis were performed using the Wisconsin Package
Version 10.2 of Genetics Computer Group (Madison, WI). Molecular mass
and pI predictions were performed using the Compute pI/MW Program of
ExPaSy.2 Pattern and profile
searches were performed using ScanProsite, ExPaSy, and BLAST through
the NCBI Protein
Database.3
Peptide Sequencing of the 72-kDa Protease-sensitive Axonemal
Protein--
For determination of a partial sequence of the 72-kDa
protease-sensitive axonemal protein, axonemes obtained from a 5-liter culture of pf14 were extracted with high ionic strength
solution, followed by dialysis against low ionic strength solution. The extracted axonemes were concentrated by centrifugation and separated by
SDS-PAGE. The relevant band was excised and subjected to in-gel digestion with modified trypsin (Promega, Madison, WI) according to the method of Rosenfeld et al. (50). The
reaction was stopped by addition of 10% trifluoroacetic acid. The
polypeptides were eluted from the gel by soaking twice with 0.1%
trifluoroacetic acid in 60% acetonitrile for 40 min at room
temperature and fractionated by reverse-phase chromatography on an RPC
C2C18 column (Amersham Biosciences, Uppsala, Sweden). Fractions of four
discrete peaks were collected and subjected to sequencing on an ABI 494 instrument (Applied Biosystems, Foster City, CA) at the National
Institute for Basic Biology Center for Analytical Instruments (Okazaki, Japan).
Cloning and Sequencing of cDNA--
Two sets of degenerate
primers were designed from two peptide sequences (EQGGPLPYPGDPVDVYR and
TFEPLEADEYTLTYMENYK) and used to PCR-amplify fragments of genomic DNA.
A cDNA library (a gift from Dr. P. A. Lefebvre, University of
Minnesota, St. Paul, MN) was screened with the genomic fragments.
Clones that hybridized with both probes were sequenced using an ABI
PRISM 310 genetic analyzer (Applied Biosystems). The cDNA sequence
was completed using 5'- and 3'-RACE (5'-RACE system, Invitrogen). To
obtain a clone covering the entire coding region, reverse
transcription-PCR was carried out on total RNA using primers designed
from the end sequences determined by RACE (Superscript II reverse
transcriptase, Invitrogen).
Northern Blot Analysis--
Total RNA was prepared from
wild-type vegetative cells by the TRIzol regent method (Invitrogen)
every 10 min after deflagellation induced by pH shock (43). The RNA
samples were separated on a formaldehyde-containing 1.5% agarose gel
(51) and transferred to a Biodyne B membrane (Nihon Pall, Ltd., Tokyo,
Japan). An ~500-bp RIB72 cDNA fragment was
labeled with 32P and used as a probe. Hybridization was
performed according to standard methods (51). RSP14
(formerly CRY-1), a clone coding for the S14 ribosomal
protein that is not involved in flagellar assembly (52), was used as a
loading control in certain experiments.
Bacterial Expression of Rib72--
The coding region of
the cDNA was amplified by PCR with primers BE1
(CATGCCATGGCTGGCGGGGCGCCTCCG) and BE2
(CGCGGATCCGAGCCCCAGCAGGCCCAG), which contain the
recognition sites (underlined) for NcoI and BamHI, respectively. The PCR product was ligated into
the NcoI and BamHI sites of the bacterial
expression vector pQE60 (QIAGEN, Hilden, Germany), resulting
in a fusion protein containing a His tag sequence at its C terminus.
The expression of the fusion protein was induced by addition of
isopropyl- -D-thiogalactopyranoside to a logarithmically
growing culture of Escherichia coli to a final concentration
of 0.1 mM. The cells were suspended in Buffer A (50 mM sodium phosphate and 0.6 M NaCl, pH 8.0)
containing 1 mg/ml lysozyme, incubated on ice for 30 min, and lysed by
sonication. The lysate was centrifuged at 400,000 × g
for 30 min at 4 °C, and the resulting supernatant was applied to a
HiTrap chelating HP column (Amersham Biosciences). After the
column was washed with Buffer A containing 75 mM imidazole,
the recombinant protein was eluted with Buffer A containing 0.5 M imidazole. The eluted protein was dialyzed against 500 volumes of HMDEK solution containing 0.6 M KCl for
3 h at 4 °C. The dialysis solution was then exchanged three
times with HMDEK solution, each time with a lower KCl concentration (0.3, 0.1, and 0 M).
Polyclonal Antibody Production--
Bacterially expressed Rib72
was used as the antigen for production of anti-Rib72 antibody.
Recombinant protein was dialyzed against PBS and emulsified with
Freund's complete adjuvant (Naralai Tesque, Inc., Kyoto,
Japan). Two rabbits were immunized hypodermically twice with a 3-week
interval. Serum was obtained 1 week after the second injection.
Antibody was blot-purified (53) using Rib72 from pf14 axonemes.
SDS-PAGE and Immunoblotting--
Proteins were analyzed by
SDS-PAGE with a 7 or 7.5% acrylamide gel or 5-20% acrylamide
gradient gels by the method of Laemmli (54). Gels were stained with
Serva Blue R or silver (55). For quantitation, gels were loaded with
protein and stained with Serva Blue in the linear region of protein-dye
binding, scanned on a GS-700 imaging densitometer (Bio-Rad), and
analyzed by Molecular Analyst software (Bio-Rad). Immunoblot procedures
were modified from those of Towbin et al. (56). In the first
method, proteins were transferred to polyvinylidene difluoride
membranes (Millipore Corp., Bedford, MA), incubated with blocking
buffer (0.05% Tween 20 and 3% skimmed milk in PBS, pH 7.4), and
probed with primary antibodies diluted 1:200 in blocking buffer.
Immunoreactive bands were detected using alkaline
phosphatase-conjugated secondary antibody (Cappel Research Products,
Durham, NC) and a 5-bromo-4-chloro-3-indolyl phosphate/nitro blue
tetrazolium phosphatase substrate system (Kirkegaard & Perry
Laboratories, Inc., Gaithersburg, MD). In the second method, proteins
were transferred to nitrocellulose (Bio-Rad) in 10 mM CAPS,
pH 11, and 10% methanol at 24 mA for 30 min using a Genie Blotter
(Idea Scientific, Minneapolis, MN). Transferred proteins were stained
with 0.02% Ponceau S (Sigma) in 3% trichloroacetic acid. Blots were
blocked with SuperBlock® (Pierce) in PBS and 0.1% Tween
20 overnight at 4 °C. Antibodies were diluted 1:10 in SuperBlock,
washed with PBS and 0.1% Tween 20, and detected using
SuperSignal® WestPico® chemiluminescent
substrate according to the manufacturer (Pierce).
Immunofluorescence Microscopy--
Immunofluorescence microscopy
was performed according to Sanders and Salisbury (57) with minor
modifications. Whole cells or nucleoflagellar apparatuses isolated by
the method of Wright et al. (58) were fixed with 3%
formaldehyde for 5 min at room temperature, followed by treatment with
cold methanol ( 20 °C). Specimens were incubated with either
preimmune serum or antiserum (anti-Rib72 antibody) diluted 1:200 in IF
blocking buffer (5% normal goat serum, 5% glycerol, 1% fish
gelatin, and 10 mM sodium phosphate, pH 7.2). After washing
with blocking buffer, specimens were incubated with fluorescein
isothiocyanate-labeled anti-rabbit IgG antibody (Zymed
Laboratories Inc., South San Francisco, CA) diluted 1:500 in
blocking buffer. Samples were observed with an Axioplan microscope
(Zeiss, Oberkochen, Germany).
EM--
All procedures were performed at room temperature.
Immuno-EM of whole-mount axonemes was performed according to Linck
et al. (59) or Johnson (60) with some modifications.
Isolated axonemes (wild-type, oda1, and pf14) or
isolated ribbons were absorbed onto carbon-coated grids. Grids were
first rinsed with blocking solution (1% bovine serum albumin in PBS or
0.125-0.5% bovine serum albumin plus 0.125-0.5% fish gelatin in
TED buffer (10 mM Tris, 0.1 mM EDTA, 1 mM DTT, pH 8.0)) and then incubated for 1 h in
anti-Rib72 antibody diluted 1:20 to 1:500 in blocking solution. The
grids were washed with blocking solution. In some experiments, specimens were treated with primary antibody, washed, and then negatively stained with 1% uranyl acetate. For most other experiments, after primary antibody treatment and washing, specimens were
layered with secondary antibody for 1 h, i.e.
anti-rabbit IgG conjugated with 5- or 10-nm colloidal gold at 1:40
(4.4 × 108 gold particles/µl; Zymed
Laboratories Inc.) or 1:200 (8.5 × 108 gold
particles/µl; Ted Pella, Redding, CA) in TED buffer. Grids were
finally washed with PBS, followed by distilled water, or with
TED buffer and negatively stained with 1% uranyl acetate. For some
experiments, prior to immunostaining, axonemes were extracted on carbon
film with Sarkosyl solution for 30 min. For quantitation, gold
particles were counted according to the criteria described by Norrander
et al. (18) and here in Table I.
 |
RESULTS |
Identification and Cloning of Rib72, a Ribbon-associated
Polypeptide--
Extensive extraction of Chlamydomonas
flagellar axonemal microtubules with 0.7% Sarkosyl yielded a pure
preparation of three-protofilament ribbons consisting of tubulin and
associated proteins (Fig. 1a), as previously reported (14, 15, 18). Upon SDS-PAGE, such preparations
were composed of three major and several minor polypeptides (Fig.
2). Based on densitometry of SDS gels
from four independent preparations (e.g. Fig. 2, lane
c), the major ribbon polypeptides were present in the following
approximate amounts of total ribbon protein:  -tubulin, 72 ± 15%; Rib43a, 3 ± 2%; and an ~70-kDa polypeptide, 9 ± 1%. The molar ratio of these proteins would thus be 1 mol of
 -tubulin (100 kDa)/0.12 ± 0.11 mol of Rib43a (43 kDa)/0.18 ± 0.07 mol of ~70-kDa polypeptide; however, the
actual molar ratios of the ribbon proteins cannot yet be determined
because the dye-binding ratios for the different proteins are not
known. In addition, variations in the relative amounts of ribbon
proteins may result from the degree of Sarkosyl extraction and washing to which the preparations were subjected. Rigorous homogenization of
axonemes produced the most homogeneous preparations of
three-protofilament ribbons (Fig. 1, a and b),
but may also result in the fractionation or selective solubilization of
certain ribbon proteins. Gentler homogenization yielded ribbons with
supernumerary protofilaments and some contaminating A-tubules.

View larger version (133K):
[in this window]
[in a new window]
|
Fig. 1.
Immuno-EM localization of
Chlamydomonas Rib72 using whole sera, 5-nm
gold-conjugated goat anti-rabbit IgG, and uranyl acetate negative
stain. a and b, representative
samples of three-protofilament ribbons after incubation with preimmune
serum in TED buffer or anti-Rib72 antiserum in TED buffer,
respectively. Gold-conjugated antibodies (arrowhead)
specifically labeled ribbons. Affinity-purified anti-Rib72 antibody
gave results similar to whole antiserum (data not shown). c,
ribbons incubated with antibody in TED buffer + 0.5 M KCl.
Preimmune and affinity-purified controls in 0.5 M KCl were
not labeled (data not shown). More antigenic sites were labeled in high
salt solution, although the tripartite appearance of the ribbons was
disrupted. Bar = 100 nm.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 2.
SDS-PAGE of Chlamydomonas
flagellar axonemes (lane a) and of ribbons
(lanes b and c) isolated by
extraction of axonemes with 0.7% Sarkosyl in TED buffer at
4 °C. The major ribbon proteins are Rib72, tubulin, and Rib43a
(18). For lanes a and b, identical amounts of
axonemes were gently resuspended in equal volumes of either TED buffer
or TED buffer + Sarkosyl, respectively; incubated for 16 h;
centrifuged at 100,000 × g; resuspended in TED buffer;
and recentrifuged. Pellets were resuspended in SDS sample buffer, and
identical volumes were electrophoretically separated and stained with
Serva Blue. Lane c represents a sample of ribbons obtained
by resuspending axonemes vigorously in Sarkosyl with a glass
homogenizer. Samples of lane c are shown by negative
staining in Fig. 1. The average relative percentages (and molar ratios
relative to the tubulin dimer) of the major proteins in ribbons, as
determined by gel densitometry, are as follows:  -tubulin, 72 ± 15% (1 mol); Rib43a, 3 ± 2% (0.12 ± 0.11 mol); and an
~70-kDa polypeptide (Rib72), 9 ± 1% (0.18 ± 0.07 mol).
|
|
Tandem mass spectrometry of tryptic digests of the ~70-kDa
polypeptide (excised from stained polyacrylamide gels) yielded the
peptide sequences FYGYFK and LPGYTVCLPQSLSDK. A computer search of the
Chlamydomonas expressed sequence tag data base indicated positive matches with clones AV396026 and AV626093. These two clones
were obtained from the Kazusa DNA Research
Institute4 and were used to
construct an overlapping sequence of a full-length cDNA (to be
described below).
Identification of a Protein Whose Loss Correlates with Axonemal
Disintegration--
Axonemal proteins engaged in holding the nine
outer doublets together must remain attached to the axoneme as long as
the nine outer doublets are connected, but may be lost when the
axonemal structure is dissociated. To identify proteins that display
such properties, we exposed Chlamydomonas axonemes to high
and low salt conditions while examining the degree of dissociation by light microscopy and the pattern of proteins remaining in the axonemes
by SDS-PAGE. In these experiments, both wild-type cells and radial
spoke-deficient pf14 mutant cells were used because radial
spokes might also function to maintain the axonemal structure and thus
interfere with the identification of interdoublet links. Extraction of
axonemes with 0.6 M KCl, followed by dialysis against 2 mM HEPES, did not separate the nine outer doublets (data
not shown). The proteins responsible for maintaining the interdoublet connections must therefore be contained in the sedimentable fraction following centrifugation (Fig. 3).

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 3.
SDS-PAGE patterns of pf14
axonemes after high and low salt extraction. Flagellar
axonemes of pf14 were extracted with HMDEK solution
plus 0.6 M KCl, followed by centrifugation at 125,000 × g for 30 min. Lane 1, supernatant fraction
(S); lane 2, precipitate (P). The
precipitated axonemes were dialyzed against low ionic strength solution
and centrifuged. Lane 3, supernatant fraction; lane
4, precipitate. Microscope observations confirmed that the
axonemes did not disintegrate into individual outer doublets after
these treatments. Of the three proteolytically sensitive polypeptides
(cf. Fig. 4), only one (arrowhead) remained
associated with the high/low salt-extracted axoneme precipitate.
|
|
Next, wild-type axonemes were induced to disintegrate by addition of
trypsin and ATP (28). To monitor the progress of disintegration, aliquots were withdrawn from the reaction mixture at regular intervals, mixed with trypsin inhibitor, and observed by dark-field microscopy. Under these conditions, axonemal fragments underwent sliding
disintegration. However, because axonemal samples were not first
fragmented, most axonemes disintegrated by fraying apart at their
distal ends, but remaining intact at their proximal ends. From
videotaped images, the number of apparently intact axonemes
versus disintegrated axonemes was determined and used to
quantitate the disintegration process as a function of time (Fig.
4a). At the same time points, aliquots of samples were taken for SDS-PAGE analysis (Fig. 4, b and c). In the case shown in Fig. 4,
disintegration took place with a half-time of ~2 min. Upon SDS-PAGE
analysis designed to resolve proteins <200 kDa, three polypeptide
bands appeared to decrease in intensity at a rate similar to that of
the disintegration process (Fig. 4, b and c). Of
these three polypeptide bands, only one with an apparent molecular mass
of ~70 kDa was also present in the extracted/dialyzed pf14
axonemes (Fig. 3). To study this polypeptide further, it was cloned and
sequenced as follows.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 4.
Degradation of axonemal proteins upon
trypsin/ATP-induced sliding disintegration. a, time
course of disintegration of wild-type axonemes as observed by
dark-field microscopy; b, change in the SDS-PAGE patterns of
axonemal proteins; c, enlargement of boxed area
in b. Trypsin and ATP were added at time 0, 25 °C, and an
axoneme/trypsin ratio of 100:1. Aliquots were taken, and reactions were
stopped at the indicated time points by quickly pipetting into a
10-fold molar excess of ice-cold trypsin inhibitor. Bands marked by
bars and arrows in c disappeared
quickly upon trypsin treatment. The disappearance of bands indicated by
bars did not correlate with sliding disintegration in this
and other experiments using different concentrations of trypsin (data
not shown), whereas the disappearance of the bands marked by
arrows in b and c did correlate
closely with sliding disintegration at all trypsin concentrations
tested. Only the ~66-kDa band (asterisks in b
and c) also remained present in high and low salt-extracted
pf14 axonemes and was thus chosen for further study.
|
|
Cloning of the cDNA of the Protease-sensitive
Polypeptide--
pf14 axonemes were extracted with high and
low salt solutions and resolved by SDS-PAGE. The ~70-kDa polypeptide
band was cut out, digested with trypsin, and separated by reverse-phase
chromatography. Of the ~40 major peaks that appeared, five were
selected, and their amino acid sequences were determined. PCR was
carried out to amplify cDNA fragments corresponding to two of these
sequences, yielding probes A and B. Screening of the cDNA library
yielded four clones that hybridized with probe A and five clones that hybridized with probe B. Finally, extension of each cDNA by 5'- and
3'-RACE confirmed that these partial cDNAs were derived from a
single transcript.
Sequence of the cDNA and Predicted Structure of Rib72--
The
cDNAs corresponding to the ~70-kDa ribbon-associated polypeptide
and the ~70-kDa protease-sensitive polypeptide were sequenced and
found to be identical (GenBankTM/EBI accession number
AAM44303). The cDNA is predicted to encode a polypeptide of 71,985 Da with a pI of 7.15 and is referred to here as Rib72 due to its
association with the ribbon (see below). In agreement with Patel-King
et al. (39), sequence analysis indicated that near its C
terminus, Rib72 has two EF-hand motifs, characteristic of
calcium-binding proteins (Fig. 5). In addition, there are three ~100-residue DM10 domains, which
occur in related and/or unrelated proteins predicted from cDNA
sequences from C. elegans, Drosophila, and
mammals.3,5 Based on
several structure prediction programs, Rib72 could contain only highly
interrupted short stretches of -sheet and -helix of less than 17 and 48 residues, respectively, and only one potential region of coiled
coil of ~30 residues. BLAST searches indicated that Rib72 homologs of
unknown function are present in C. elegans, Drosophila, echinoderm, tunicate, mouse, and human.

View larger version (7K):
[in this window]
[in a new window]
|
Fig. 5.
Predicted structural motifs of Rib72.
NCBI BLAST identified three DM10 domains. These domains are of unknown
function, but are found in predicted polypeptides of C. elegans, Drosophila, and mammals and occur singly in
some nucleoside-diphosphate kinases. ScanProsite predicts two EF-hand
motifs at the C-terminal end of the polypeptide. An EF-hand binds a
calcium ion in a pentagonal bipyramidal configuration. No coiled-coil
regions are predicted. The scale indicates the positions of
amino acid residues.
|
|
Genetic Mapping--
To obtain a Rib72 genomic clone, the
Chlamydomonas bacterial artificial chromosome library
was screened using a 2.8-kb XhoI fragment from the expressed
sequence tag AV626093.6 Three
overlapping bacterial artificial chromosome clones were isolated
(27p11, 24g19, and 17k3). These bacterial artificial chromosome clones
map to linkage group II, overlapping with the S6175 molecular
marker (62) and in agreement with Patel-King et al. (39). No
known flagellar mutants are located in this region.
Up-regulation of Rib72 Message after Deflagellation--
When
Chlamydomonas cells are deflagellated, the levels of
mRNAs encoding proteins involved in flagellar assembly rapidly
increase, and flagella are regenerated within 2 h (62). We
investigated the cellular level of RIB72 mRNA
after deflagellation. Cells were deflagellated by pH shock, and total
RNA was isolated at 10-min intervals. Northern blot analysis showed
that the level of RIB72 mRNA increased ~5-fold
by 40 min after deflagellation (Fig. 6), indicating that Rib72 is involved in flagellar regeneration.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 6.
Northern blot analysis of Rib72 message after
deflagellation. a, Chlamydomonas wild-type
cells were deflagellated by pH shock, and total RNA was isolated at
10-min intervals after deflagellation. Each RNA sample was
electrophoretically resolved, blotted, and probed with a 3'-fragment of
RIB72 cDNA. A single band of 3 kb was
up-regulated after deflagellation. b, the relative
intensities of the signals were measured by densitometry.
|
|
Polyclonal Anti-Rib72 Antibodies--
Polyclonal
antiserum was raised against bacterially produced Rib72 protein.
Immunoblot analysis of axonemes and ribbons demonstrated that the
antiserum and affinity-purified anti-Rib72 antibody (53) specifically
recognized a single band corresponding to Rib72 (Fig. 7).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 7.
SDS-PAGE immunoblot characterization and
quantitation of Rib72 retention in ribbons. Identical amounts of
Chlamydomonas flagellar axonemes were gently resuspended in
equal volumes of either TED buffer (lanes a and
c) or TED buffer + Sarkosyl (lanes b and
d), incubated for 16 h, centrifuged, resuspended in TED
buffer, and recentrifuged. Pellets were resuspended in SDS sample
buffer, and identical volumes were electrophoretically separated and
stained with Serva Blue (lanes a and b). After
blotting, duplicate gel lanes show the specific staining of Rib72 in
axonemes (lane c) and ribbons (lane d) by
anti-Rib72 antiserum and chemiluminescent detection. The staining of
Rib72 was specific using whole antiserum (lanes c and
d) and affinity-purified anti-Rib72 antibody (data not
shown). Comparing lanes c and d, 87% of the
anti-Rib72 antibody staining intensity was retained in the Sarkosyl
ribbon fraction.
|
|
Proteolytic Cleavage of Rib72 Correlates with Sliding
Disintegration--
Anti-Rib72 antibody was used to more closely
examine the relationship between the proteolytic cleavage of Rib72 and
the protease/ATP-induced sliding disintegration of axonemes. Previous
studies indicated that trypsin, elastase, and nagarse are effective in
inducing sliding disintegration of Chlamydomonas axonemes;
the efficiency of disintegration is dependent upon the specific
protease (46). Axonemal disintegration was monitored by the turbidity
of the axonemal suspension (Fig. 8,
a-c) (30, 45, 63), and aliquots of the suspension were
removed at regular intervals for SDS-PAGE/immunoblot analysis. As shown
in Fig. 8 (a'-c'), Rib72 was cleaved into lower molecular
mass species with each of the three proteases; and in each case, the
time course of digestion paralleled that of the change in
turbidity.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 8.
Immunoblot analysis of Rib72 degradation
following protease-induced sliding disintegration.
a-c, shown are changes in the turbidity of suspensions of
wild-type axonemes after addition of 0.1 mM ATP with ( )
or without ( ) trypsin (a), elastase (b), or
nagarse (c). ATP and proteases were simultaneously added at
time 0 (arrowheads). a'-c', aliquots of the
suspensions used in the above experiments were withdrawn at the
indicated time points (arrowhead; 0, 30, 60, 90, 150, and
330 s), resolved on 7.5% gels, and probed by Western blotting
with anti-Rib72 antibody to show the proteolytic degradation of Rib72.
The axoneme/protease protein ratio was 100:1 in all three
suspensions.
|
|
Subcellular Localization of Rib72--
Indirect immunofluorescence
microscopy using anti-Rib72 antibody demonstrated that this protein was
localized along the length of the axonemes (Fig.
9). The staining intensity was greater in the outer dynein arm-less mutant oda1 than in the wild-type
axonemes, perhaps because the bulky dynein arms in fixed samples
blocked antibody access to the axoneme interior. In nucleoflagellar
apparatuses from both oda1 (Fig. 9) and wild-type (data not
shown) axonemes, no staining was detected in the basal bodies.

View larger version (140K):
[in this window]
[in a new window]
|
Fig. 9.
Differential interference contrast
(a) and fluorescence (b) images of a
nucleoflagellar apparatus separated from oda1
cells. The sample was incubated with anti-Rib72 antibody,
followed by labeling with fluorescein isothiocyanate-labeled
anti-rabbit IgG antibody. The fluorescein isothiocyanate fluorescence
was present along the length of the axonemes and only faintly at the
proximal portion. Staining at the regions corresponding to basal bodies
and transition zones was particularly weak. Bar = 5 µm.
|
|
Biochemical Localization of Rib72 in Microtubules--
Rib72 was
localized to the ribbon compartment by two independent methods:
immunoblotting of the Sarkosyl-insoluble fraction (described here) and
immuno-EM (following paragraphs). Two identical samples of axonemes
were gently resuspended in equal volumes of either TED buffer or TED
buffer + 0.7% Sarkosyl, incubated for 16 h at 4 °C,
centrifuged at 100,000 × g, gently resuspended in wash
buffer (TED buffer), and recentrifuged. Equivalent volumes of the
pellets were then analyzed by SDS-PAGE/immunoblotting (Fig. 7);
anti-Rib72 antibody staining was detected by chemiluminescence, and the
resulting film was analyzed by densitometry. In this experiment, 87%
of the anti-Rib72 antibody staining intensity was retained in the
ribbon fraction compared with the axoneme control.
Immuno-EM Localization of Rib72 in Microtubules--
Rib72 was
also localized to protofilament ribbons in a series of immuno-EM
experiments (Figs. 1, 10, and 11) and
quantitative determinations (Table I).
Anti-Rib72 antibodies, as detected by gold-conjugated secondary
antibodies, specifically labeled ribbons prepared by extensive Sarkosyl
extraction of wild-type axonemes (Fig. 1, a and
b), with background and control labeling being near zero
(e.g. Table I). Ribbons were labeled to a much greater
extent if 0.5 M KCl was included in the labeling solutions, in which case, the tripartite structure of the ribbons was disrupted (Fig. 1c); however, SDS-PAGE analysis confirmed that Rib72
and most other proteins were quantitatively retained in the high
salt-extracted ribbons (data not shown). These results indicate that
many more antigenic sites are exposed by the KCl treatment.

View larger version (152K):
[in this window]
[in a new window]
|
Fig. 10.
Immuno-EM of axoneme-to-ribbon
transitions. Wild-type axonemes (a-c) and
pf14 axonemes (d) were extracted on carbon film
with 0.7% Sarkosyl, followed by staining with anti-Rib72 antiserum,
gold-labeled secondary antibody, and uranyl acetate. Anti-Rib72
antibody did not frequently label intact A-microtubules, but began to
label A-tubules that were losing structural integrity
(arrowhead) and heavily labeled the emerging ribbons, often
with spacings of <23 nm. The apparent difference in the extent of
labeling between a and b-d is due to the size of
the gold particles (5 versus 10 nm, respectively) and
concentration of secondary antibody used (1:200 versus 1:40,
respectively). Occasionally, <5-nm wide fibrils are seen extending
from the ribbons and decorated by immunogold particles
(arrow). Bar = 160 nm for a and
100 nm for b-d.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Quantitation of immuno-EM labeling
The average numbers of gold particles attached to 10 µm each of
A-microtubules (those apparently intact and those apparently disrupted)
and ribbons are given. Gold particles within 23 nm (the length expected
for the bound first and second immunoglobulins) from those clearly
recognizable structures were counted along the restricted length of
A-microtubules or ribbons. The average density of particles in the
background was calculated from the number of particles that are
expected to be found within the width of a microtubule + 2 × 23 nm = ~80 nm. Total particles counted were as follows. For
preimmune serum: background, 0/8 µm; A-microtubules, 2/8 µm;
partially disrupted A-microtubules, 1/1.2 µm; and ribbons, 4/6 µm.
For anti-Rib72 antibody: background, 2/13 µm; A-microtubules, 36/12
µm; partially disrupted A-microtubules, 54/2.8 µm; and ribbons,
398/13.2 µm.
|
|
A greater degree of labeling also occurred when axonemes were attached
to carbon films and extracted in situ with Sarkosyl (Fig.
10), with the difference in the extent of labeling probably being due
to surface interactions between specimen and carbon film and/or to the
duration of Sarkosyl extraction (i.e. 30 min on the grid
versus 16 h in a test tube). In these experiments, anti-Rib72 antibodies only infrequently labeled intact A-tubules, but
labeled with greater frequency tubules that were losing structural integrity and finally heavily labeled the emerging ribbons (Table I),
with gold particles often spaced along the ribbons at 24 nm (Fig. 10,
a-c). In several cases, gold particles were observed to be
attached to a single 5-nm wide fibril that derived from the ribbons
(Fig. 10c). To avoid the possibility that radial
spoke-associated proteins might reside on ribbons and block antibody
access to Rib72, pf14 mutant axonemes were also examined by
Sarkosyl extraction, followed by immuno-EM (Fig. 10d). Gold
labeling was observed on partially disrupted A-tubules and ribbons, as
in wild-type axonemes.
Immuno-EM Localization of Rib72 in Axonemes--
Sarkosyl
extraction might reveal most or all of the antigenic sites of Rib72
along ribbons, but the detergent may also disrupt native axonemal
structure and potential periodicities along the A-tubules. Moreover, as
shown above, Rib72 is accessible to and cleaved by protease, permitting
ATP-induced disintegration. Consequently, we examined the localization
of Rib72 antigenic sites along whole-mount axonemes (wild-type and
mutant) with and without trypsin/ATP to induce disintegration (Fig.
11). The distribution of
gold-conjugated secondary antibody did not generally show an obvious
periodicity, but there were regions where gold particles were
distributed with a discrete axial separation of ~100 nm. The labeling
with anti-Rib72 antibody required longer incubation than with
antibodies against other axonemal proteins, and the most regular
labeling was obtained with oda1 axonemes compared with
wild-type axonemes, as suggested by the immunofluorescence
observations. In oda1 axonemes treated with trypsin and ATP,
labeling occurred along separated doublet microtubules with an apparent
axial periodicity of ~100 nm (Fig. 11a). Similarly, an
~100-nm axial periodicity was evident when samples were stained with
a relatively high concentration of anti-Rib72 antibody alone (no
secondary antibody). Such periodic staining was observed with
oda1 axonemes (data not shown) and pf14 axonemes lacking spokes (Fig. 11b). Attempts to localize the Rib72
antigen by thin-section electron microscopy have so far been
unsuccessful.

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 11.
Immuno-EM of intact outer doublet
microtubules showing a periodic localization of Rib72 epitopes.
a, protease/ATP-treated axonemes of oda1 stained
with anti-Rib72 antibody and gold-conjugated secondary antibody,
showing gold particles with an axial spacing of ~100 nm;
b, axonemes of a spoke-less mutant (pf14) stained
with a 1:20 dilution of anti-Rib72 antibody alone (no secondary
antibody), showing an axial spacing of ~96 nm. Bar = 100 nm.
|
|
Examination of Potential Calcium Effects on Sliding Disintegration
and on Ribbons--
Given the demonstration that the tryptic digestion
of Rib72 in axonemes is calcium-dependent (39), we examined
the rates of sliding disintegration in 1 mM
CaCl2 versus 1 mM EGTA (between pCa 3 and >8) in the presence of 5 mM
MgSO4, but found no observable difference. We also examined
the tryptic cleavage of Rib72 in isolated ribbons in CaCl2
and EGTA. In 0.1 mM CaCl2 versus 1 mM EGTA, no difference in Rib72 degradation was observed
when ribbons were incubated with 0.2 µg of trypsin for 5-60 min at
22 °C. Similarly, when ribbons were incubated in 1 mM
CaCl2 versus 1 mM EGTA for 30 min at
22 °C, no differences were observed within trypsin concentrations from 0.01 to 1 µg.
 |
DISCUSSION |
Rib72 is a novel Chlamydomonas flagellar
microtubule-associated protein recently described by Patel-King
et al. (39) and our laboratories (this report;
GenBankTM/EBI accession AAM44303). Rib72 (71,985 Da)
contains two C-terminal EF-hand motifs (39), but no extended stretches
of -sheet, -helix, or coiled coil; thus, it would seem unlikely to form fibrous polymers, unlike tektins from sea urchin ciliary and
flagellar A-tubule ribbons (21, 23, 59) or possibly Rib43a, another
component of Chlamydomonas ribbons (18). Rib72 also contains
three ~100-residue repeats, which Patel-King et al. (39)
attributed to forming a regulatory subunit of flagellar nucleoside-diphosphate kinase. More recently, the Simple Modular Architecture Research Tool5 categorized these repeat
sequences as DM10 domains of unknown function; only one DM10 domain is
present in some (but not all) nucleoside-diphosphate kinases. Thus, it
is possible that three such DM10 domains provide Rib72 with functions
in addition to (or instead of) regulating nucleoside-diphosphate kinase.
Structural Organization of Rib72 in Flagellar
Microtubules--
Our investigations here shed additional light on the
structural organization and potential function of Rib72 in axonemes. Upon immunofluorescence microscopy of fixed material (in which all
antigenic sites should be labeled), Rib72 was uniformly distributed along axonemes, but apparently absent from basal bodies (Fig. 9) (39).
Upon immunoblot analysis, ~87% of Rib72 remained associated with the
ribbon fraction (Fig. 7). The remaining Rib72 may arise from the
fragmentation and solubilization of the ribbons during extraction or,
alternatively, from a second, more soluble locus or subset of more
labile microtubules (e.g. newly assembled, regenerated microtubules). The molar ratio of the three major polypeptides of
ribbons is 1 mol of  -tubulin dimer/0.12 ± 0.11 mol of
Rib43a/~0.18 ± 0.07 mol of Rib72. Upon immuno-EM, anti-Rib72
antibodies labeled intact A-tubules infrequently (occasionally
appearing at ~100-nm intervals) (Fig. 11), but labeled with greater
frequency as the tubules lost structural integrity and finally heavily
labeled the emerging ribbons (Fig. 10 and Table I) and purified ribbons (Fig. 1). Occasionally, a <5-nm wide fibril extended beyond the three-protofilament ribbon and was labeled with anti-Rib72 antibody (Fig. 10c). Attempts to subfractionate the ribbons and
enrich for the fibrils led only to their complete dissolution. Finally,
in the protease digestion experiments, all three enzymes (trypsin, elastase, and nagarse) initially cleaved an ~10-kDa fragment from Rib72 (Fig. 8).
Taken together, these data and the properties of Rib72 suggest, but do
not distinguish, two models: 1) in which mostly linear Rib72
polypeptide chains lie along the protofilaments of the ribbon with an
axial repeat of 96 nm and with DM10 domains binding at regular
intervals to tubulin, Rib43a, or other proteins and 2) in which
globular molecules of Rib72 are periodically arranged along the
protofilaments of the ribbon with axial spacings of ~16 or 24 nm. In
either case, the results indicate that the majority of the Rib72
polypeptide chain is located on the inner microtubule surface, or it is
located on the outer microtubule surface but masked by
Sarkosyl-extractable proteins. Furthermore, the results suggest that an
~10-kDa terminal piece (potentially the C-terminal EF-hand) resides
on the outer microtubule surface, accessible to protease and antibody.
Association of Rib72 with Interdoublet Links--
The other
aspect of this study suggests that Rib72 interacts functionally with
the system of linkages that hold the doublet microtubules in their
9-fold configuration and limit microtubule sliding. The cleavage of
Rib72 by trypsin is concomitant with the sliding disintegration of the
nine outer doublet microtubules. Of the three polypeptides whose
disappearance correlated with axonemal disintegration (Fig. 4), only
Rib72 remained present in pf14 axonemes that retained their
9-fold configurations of doublet tubules after high and low ionic
strength extractions (Fig. 3). In addition, our immuno-EM suggests that
certain Rib72 antigenic sites are exposed at ~100-nm intervals along
outer doublet A-tubules (Fig. 11), which is close to the 96-nm axial
repeat of interdoublet links in species ranging from protists to
mammals (34-36, 64, 65). Relevant to the apparent association of
interdoublet links with the ribbon compartment of A-tubules, molluscan
ciliary axonemes have been shown to decompose (upon extraction at low and high ionic strength and heating) into a set of nine ribbons held
together by interdoublet links containing nexin (16). Thus, Rib72, a
ribbon component, would appear to be involved in the system of
interdoublet links, whose destruction triggers axonemal disintegration (28, 66).
Both the biochemical composition and functional properties of
interdoublet links have been controversial. Although early
ultrastructural studies (33, 34, 49) and theoretical considerations
(61) suggest that the links are elastic and highly extendable, later studies suggest they are not (35, 36, 65). Warner (35) examined
Tetrahymena cilia after extraction with high and low salt
solutions and showed that when doublet microtubules undergo sliding,
one end of the links binds to variable positions along the doublet
microtubules. This behavior of the interdoublet link is similar to what
we might expect for inner arm dyneins. Bozkurt and Woolley (36) found
that interdoublet links never appear to become stretched under
conditions in which axonemes are strongly bent, i.e. when
the interdoublet link is expected to be extensively stretched. On the
other hand, our physiological study directly measuring the longitudinal
elasticity in the axoneme has suggested that the axoneme does have a
longitudinal elasticity, but that the elastic component is capable of
dislocating along the microtubule (38). Therefore, it may be that the
link is both detachable and stretchable, whereas its stretched state is
too unstable to be observed by electron microscopy.
This investigation extends our understanding of Rib72 initially
described by Patel-King et al. (39) and raises a number of
questions concerning this protein and its functions in microtubule assembly and ciliary/flagellar motility. What is the molecular structure of Rib72 within the ribbon? What are the functions of the
DM10 and EF-hand domains in flagellar microtubule assembly and/or
the regulation of motility? What are the important details concerning
the interactions between Rib72 and the interdoublet links? These
questions pose testable hypotheses that will be addressed in our
ongoing investigations.
 |
ACKNOWLEDGEMENTS |
We thank Drs. Carolyn D. Silflow and Paul A. Lefebvre and members of their laboratories for the mapping of the
RIB72 gene.
 |
FOOTNOTES |
*
This work was supported by grants from the Ministry of
Education, Culture, Sports, Science, and Technology of Japan and from CREST of JST (Japan Science and Technology Corporation) (to
R. K.) and by United States Public Health Service Grant GM35648, National Science Foundation Research Training Group Grant DBI-9602237, University of Minnesota Grant-in-aid 17936, and Minnesota Medical Foundation Grant AO-169-00 (to R. W. L.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AAM44303.
§
Both authors contributed equally to this work.
Present address: Children's Research Inst., Children's
National Medical Center, Washington D. C.
**
To whom correspondence may be addressed. Tel.:
81-3-5841-4426; Fax: 81-3-5800-6842; E-mail:
kamiyar@biol.s.u-tokyo.acjp.

To whom correspondence may be addressed: Dept. of Genetics,
Cell Biology, and Development, 6-160 Jackson Hall, University of
Minnesota, 321 Church St., Minneapolis, MN 55455. Tel.: 612-624-5179; Fax: 612-626-6140; E-mail: linck@mail.ahc.umn.edu.
Published, JBC Papers in Press, November 14, 2002, DOI 10.1074/jbc.M210751200
2
Available at www.us.expasy.org.
3
Available at www.ncbi.nlm.nih.gov.
4
Available at www.kazusa.or.jp/en/.
5
Available at www.smart.ox.ac.uk.
6
P. Kathir, M. LaVoie, W. J. Brazelton,
N. A. Haas, P. A. Lefebvre, and C. D. Silflow,
Eukaryotic Cell, in press.
 |
ABBREVIATIONS |
The abbreviations used are:
DTT, dithiothreitol;
RACE, rapid amplification of cDNA ends;
PBS, phosphate-buffered
saline;
CAPS, 3-(cyclohexylamino)propanesulfonic acid;
EM, electron
microscopy.
 |
REFERENCES |
| 1.
| Linck, R. W. (2000) Encyclopedia of Life Sciences,
http://www.els.net
|
| 2.
|
Nonaka, S.,
Tanaka, Y.,
Okada, Y.,
Takeda, S.,
Harada, A.,
Kanai, Y.,
Kido, M.,
and Hirokawa, N.
(1998)
Cell
95,
829-837[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Pazour, G. J.,
San Agustin, J. T.,
Follit, J. A.,
Rosenbaum, J. L.,
and Witman, G. B.
(2002)
Curr. Biol.
14,
R378-R380
|
| 4.
|
Pennarum, G.,
Bridouz, A.-M.,
Escudier, E.,
Dastot-Le Moal, F.,
Cacheux, V.,
Amselem, S.,
and Duriez, B.
(2002)
Am. J. Respir. Biol.
26,
362-370
|
| 5.
|
Yoder, B. K.,
Tousson, A.,
Millican, L., Wu, J. H.,
Bugg, C. E., Jr.,
Shaffer, J. A.,
and Baldovetz, D. F.
(2002)
Am. J. Physiol.
282,
F541-F552[Abstract/Free Full Text]
|
| 6.
|
Dutcher, S. K.
(1995)
Trends Genet.
11,
398-404[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Takada, S.,
and Kamiya, R.
(1994)
J. Cell Biol.
126,
737-745[Abstract/Free Full Text]
|
| 8.
|
Takada, S.,
Wilkerson, C. G.,
Wakabayashi, K.,
Kamiya, R.,
and Witman, G. B.
(2002)
Mol. Biol. Cell
13,
1015-1029K[Abstract/Free Full Text]. K.
|
| 9.
|
Goodenough, U. W.,
and Heuser, J. E.
(1985)
J. Cell Biol.
100,
2008-2018[Abstract/Free Full Text]
|
| 10.
|
Mastronarde, D. N.,
O'Toole, E. T.,
McDonald, K. L.,
McIntosh, J. R.,
and Porter, M. E.
(1992)
J. Cell Biol.
118,
1145-1162[Abstract/Free Full Text]
|
| 11.
|
Silflow, C. D.,
Chisholm, R. L.,
Conner, T. W.,
and Ranum, L. P.
(1985)
Mol. Cell. Biol.
5,
2389-2398[Abstract/Free Full Text]
|
| 12.
|
James, S. W.,
Silflow, C. D.,
Stroom, P.,
and Lefebvre, P. A.
(1993)
J. Cell Sci.
106,
209-218[Abstract]
|
| 13.
|
Meza, I.,
Huang, B.,
and Bryan, J.
(1972)
Exp. Cell Res.
74,
535-540[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Witman, G. B.,
Carlson, K.,
Berliner, J.,
and Rosenbaum, J. L.
(1972)
J. Cell Biol.
54,
507-539[Abstract/Free Full Text]
|
| 15.
|
Witman, G. B.,
Carlson, K.,
and Rosenbaum, J. L.
(1972)
J. Cell Biol.
54,
540-555[Abstract/Free Full Text]
|
| 16.
|
Stephens, R. E.,
Oleszko-Szuts, S.,
and Linck, R. W.
(1989)
J. Cell Sci.
92,
391-402[Abstract/Free Full Text]
|
| 17.
|
Linck, R. W.
(1990)
in
Advances in Cell Biology
(Miller, K. R., ed)
, pp. 35-63, Jai Press Ltd., London
|
| 18.
|
Norrander, J. M.,
deCathelineau, A. M.,
Brown, J. A.,
Porter, M. E.,
and Linck, R. W.
(2000)
Mol. Biol. Cell
11,
201-215[Abstract/Free Full Text]
|
| 19.
|
Norrander, J. M.,
Amos, L. A.,
and Linck, R. W.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
8567-8571[Abstract/Free Full Text]
|
| 20.
|
Chen, R.,
Perrone, C. A.,
Amos, L. A.,
and Linck, R. W.
(1993)
J. Cell Sci.
106,
909-918[Abstract]
|
| 21.
|
Norrander, J. M.,
Perrone, C. A.,
Amos, L. A.,
and Linck, R. W.
(1996)
J. Mol. Biol.
257,
385-397[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Norrander, J.,
Larsson, M.,
Ståhl, S.,
Höög, C.,
and Linck, R.
(1998)
J. Neurosci.
18,
8912-8918[Abstract/Free Full Text]
|
| 23.
|
Pirner, M. A.,
and Linck, R. W.
(1994)
J. Biol. Chem.
269,
31800-31806[Abstract/Free Full Text]
|
| 24.
|
Nojima, D.,
Linck, R. W.,
and Egelman, E. H.
(1995)
Curr. Biol.
5,
158-167[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Stephens, R. E.
(2000)
Cell Motil. Cytoskeleton
47,
130-140[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Amos, W. B.,
Amos, L. A.,
and Linck, R. W.
(1986)
J. Cell Sci. Suppl.
5,
55-68[Medline]
[Order article via Infotrieve]
|
| 27.
|
Brokaw, C. J.
(1991)
J. Cell Biol.
114,
1201-1216[Abstract/Free Full Text]
|
| 28.
|
Summers, K. E.,
and Gibbons, I. R.
(1971)
Proc. Natl. Acad. Sci. U. S. A.
68,
3092-3096[Abstract/Free Full Text]
|
| 29.
|
Sale, W. S.,
and Satir, P.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
2045-2049[Abstract/Free Full Text]
|
| 30.
|
Summers, K. E.,
and Gibbons, I. R.
(1973)
J. Cell Biol.
58,
618-629[Abstract/Free Full Text]
|
| 31.
|
Huang, B.,
Ramanis, Z.,
and Luck, D. J. L.
(1982)
Cell
28,
115-124[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Omoto, C. K.,
Yagi, T.,
Kurimoto, E.,
and Kamiya, R.
(1996)
Cell Motil. Cytoskeleton
33,
88-94[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Warner, F. D.
(1976)
J. Cell Sci.
20,
101-114[Abstract]
|
| 34.
|
Olson, G. E.,
and Linck, R. W.
(1977)
J. Ultrastruct. Res.
61,
21-43[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Warner, F. D.
(1983)
Cell Motil.
3,
321-332
|
| 36.
|
Bozkurt, H. H.,
and Woolley, D. M.
(1993)
Cell Motil. Cytoskeleton
24,
109-118[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Yagi, T.,
and Kamiya, R.
(1995)
Cell Motil. Cytoskeleton
31,
207-214[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Minoura, I.,
Yagi, T.,
and Kamiya, R.
(1999)
Cell Struct. Funct.
24,
27-33[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Patel-King, R. S.,
Benashski, S. E.,
and King, S. M.
(2002)
J. Biol. Chem.
277,
34271-34279[Abstract/Free Full Text]
|
| 40.
|
Kamiya, R.
(1988)
J. Cell Biol.
107,
2253-2258[Abstract/Free Full Text]
|
| 41.
|
Piperno, G.,
Huang, B.,
Ramanis, Z.,
and Luck, D. J.
(1981)
J. Cell Biol.
88,
73-79[Abstract/Free Full Text]
|
| 42.
|
Gorman, D. S.,
and Levine, R. P.
(1965)
Proc. Natl. Acad. Sci. U. S. A.
54,
1665-1669[Free Full Text]
|
| 43.
|
Witman, G.
(1986)
Methods Enzymol.
134,
280-290[Medline]
[Order article via Infotrieve]
|
| 44.
|
King, S. M.,
Otter, T.,
and Witman, G. B.
(1986)
Methods Enzymol.
134,
291-306[Medline]
[Order article via Infotrieve]
|
| 45.
|
Witman, G.,
Plummer, J.,
and Sander, G.
(1978)
J. Cell Biol.
76,
729-747[Abstract/Free Full Text]
|
| 46.
|
Okagaki, T.,
and Kamiya, R.
(1986)
J. Cell Biol.
103,
1895-1902[Abstract/Free Full Text]
|
| 47.
|
Kinter, M.,
and Sherman, N. E.
(2000)
Protein Sequencing and Identification Using Tandem Mass Spectrometry
, pp. 153-157, Wiley-Interscience, New York
|
| 48.
|
Eng, J.,
McCormack, A.,
and Yates, J. R., III
(1994)
J. Am. Soc. Mass Spectrom.
5,
976-989[CrossRef]
|
| 49.
|
Gibbons, I. R.
(1963)
Proc. Natl. Acad. Sci. U. S. A.
50,
1002-1010[Free Full Text]
|
| 50.
|
Rosenfeld, J.,
Capdevielle, J.,
Guillemot, J. C.,
and Ferrara, P.
(1992)
Anal. Biochem.
203,
173-179[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 52.
|
Nelson, J. A.,
Savereide, P. B.,
and Lefebvre, P. A.
(1994)
Mol. Cell. Biol.
14,
4011-4019[Abstract/Free Full Text]
|
| 53.
|
Olmsted, J. B.
(1981)
J. Biol. Chem.
256,
11955-11957[Abstract/Free Full Text]
|
| 54.
|
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Blum, H.,
Beier, H.,
and Gross, H. J.
(1987)
Electrophoresis
8,
93-99[CrossRef]
|
| 56.
|
Towbin, H.,
Staehelin, T.,
and Gordon, J.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
4350-4354[Abstract/Free Full Text]
|
| 57.
|
Sanders, M. A.,
and Salisbury, J. L.
(1995)
Methods Cell Biol.
47,
163-169[Medline]
[Order article via Infotrieve]
|
| 58.
|
Wright, R. L.,
Salisbury, J.,
and Jarvik, J. W.
(1985)
J. Cell Biol.
101,
1903-1912[Abstract/Free Full Text]
|
| 59.
|
Linck, R. W.,
Amos, L. A.,
and Amos, W. B.
(1985)
J. Cell Biol.
100,
126-135[Abstract/Free Full Text]
|
| 60.
|
Johnson, K. A.
(1995)
Methods Cell Biol.
47,
153-162[Medline]
[Order article via Infotrieve]
|
| 61.
|
Cibert, C.
(2001)
Cell Motil. Cytoskeleton
49,
161-175[CrossRef][Medline]
[Order article via Infotrieve]
|
| 62.
|
Schloss, J. A.,
Silflow, C. D.,
and Rosenbaum, J.
(1984)
Mol. Cell. Biol.
4,
424-434[Abstract/Free Full Text]
|
| 63.
|
Warner, F. D.,
and Zanetti, N. C.
(1980)
J. Cell Biol.
86,
436-445[Abstract/Free Full Text]
|
| 64.
|
Stephens, R. E.
(1970)
J. Mol. Biol.
47,
353-363[CrossRef][Medline]
[Order article via Infotrieve]
|
| 65.
|
Woolley, D. M.
(1997)
J. Cell Sci.
110,
85-94[Abstract]
|
| 66.
|
Brokaw, C. J.
(1980)
Science
207,
1365-1367[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. M. Baron, K. S. Ralston, Z. P. Kabututu, and K. L. Hill
Functional genomics in Trypanosoma brucei identifies evolutionarily conserved components of motile flagella
J. Cell Sci.,
February 1, 2007;
120(3):
478 - 491.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Patel-King, O. Gorbatyuk, S. Takebe, and S. M. King
Flagellar Radial Spokes Contain a Ca2+-stimulated Nucleoside Diphosphate Kinase
Mol. Biol. Cell,
August 1, 2004;
15(8):
3891 - 3902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-a. Yanagisawa and R. Kamiya
A Tektin Homologue Is Decreased in Chlamydomonas Mutants Lacking an Axonemal Inner-Arm Dynein
Mol. Biol. Cell,
May 1, 2004;
15(5):
2105 - 2115.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|