Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M306195200 on October 16, 2003

J. Biol. Chem., Vol. 279, Issue 1, 692-703, January 2, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/1/692    most recent
M306195200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bailey, D.
Right arrow Articles by O'Hare, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bailey, D.
Right arrow Articles by O'Hare, P.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Characterization of the Localization and Proteolytic Activity of the SUMO-specific Protease, SENP1*

Daniel Bailey and Peter O'Hare{ddagger}

From the Marie Curie Research Institute, The Chart, Oxted, Surrey RH8 OTL, United Kingdom

Received for publication, June 12, 2003 , and in revised form, October 7, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Modification of proteins by small ubiquitin-like modifier (SUMO) plays an important role in the function, compartmentalization, and stability of target proteins, contributing to the regulation of diverse processes. SUMO-1 modification can be regulated not only at the level of conjugation; it may also be reversed by a class of proteases known as the SUMO-specific proteases. However, current understanding of the regulation, specificity, and function of these proteases remains limited. In this study, we characterize aspects of the compartmentalization and proteolytic activity of the mammalian SUMO-specific protease, SENP1, providing insight into its function and regulation. We demonstrate the presence of a single nonconsensus nuclear localization signal within the N terminus of the protein, the mutation of which results in pronounced cytoplasmic accumulation in contrast to the nuclear accumulation of the parental protein. In addition, we observe that the N terminus of the protein may be essential for the correct regulation of the protease, since expression of the core domain alone results in limited expression and loss of SUMO-1, indicative of constitutive catalytic activity. Consistent with the prediction that the protease is a member of the cysteine family of proteases, we mutated a key cysteine residue and observed that expression of this catalytic mutant had a dominant negative phenotype, resulting in the accumulation of high molecular weight SUMO-1 conjugates. Furthermore, we demonstrate that SENP1 may itself be a target for SUMO-1 modification occurring at a nonconsensus site. Finally, we demonstrate that SENP1 localization is influenced by expression and localization of SUMO-1-conjugated target proteins within the cell.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Post-translation modification of proteins plays a crucial role in altering protein function, localization, and turnover. Modification includes not only chemical modifications such as acetylation and phosphorylation but also the conjugation of proteins to target substrates. Ubiquitination is a well studied example whereby ubiquitin is covalently coupled to the {epsilon}-amino group of lysine residues on particular target proteins. Although ubiquitination is generally regarded to target a protein for degradation, it is now clear that certain types of ubiquitin modifications may have other regulatory effects (for a review, see Ref. 1). A further class of post-translational modification that has attracted considerable attention is the covalent attachment of the ubiquitin-like proteins. Small ubiquitin-like modifier (SUMO-1)1 modification, unlike ubiquitination, does not target a protein for degradation and in some circumstances may function to antagonize protein degradation. Moreover, SUMO-1 modification has itself been shown to be an important strategy for the regulation of protein function, with many key proteins, including PML, p53, Ik-B{alpha}, and c-Jun, now shown to be targets for SUMO-1 regulation (2-5).

SUMO-1 is conjugated to proteins through a pathway that shares many similarities to that of ubiquitin (for a review, see Ref. 6). Significant progress on understanding the SUMO-1 conjugation system has been made during the past few years, and several key proteins involved in the pathway have been identified (7-9). SUMO-1 conjugation involves the utilization of ATP to adenylate the carboxyl terminus of a processed form of SUMO-1, which is then transferred to a cysteine residue in the E1 enzyme complex (SAE1-SAE2) and then to a cysteine residue in the E2 enzyme Ubch9 (7). In addition, although SUMO proteins can be transferred from the Ubch9 complex directly to some target proteins in vitro, a number of SUMO E3 enzymes such as Ran-BP2 and the PIAS family of proteins have recently been identified (10-14). These components enhance the conjugation reaction and are likely to provide substrate specificity in the transfer of the SUMO-1 moiety to the {epsilon}-lysine group of specific target proteins.

The covalent modification of proteins by SUMO-1 is reversible and is mediated by SUMO-specific proteases. These proteases are thought to have dual roles. They are responsible first for the initial processing of SUMO-1 by cleavage of the precursor peptide at the carboxyl terminus of the protein, generating a C-terminal diglycine motif, and second for the subsequent processing and cleavage of high molecular weight SUMO-1 conjugates, releasing SUMO-1 and reducing the conjugation status of the target proteins.

A number of SUMO-specific proteases have been predicted based on homology to the first identified protease yeast Ulp1, the Smt3 (SUMO-1 homologue) deconjugating enzyme (15), and are thought to be members of the general family of cysteine proteases. Those that have been studied to date include two proteases in yeast, Ulp1 and Ulp2 (15, 16), and a number in mammalian cells (17-22). A number of other proteins predicted to be SUMO-specific proteases have been proposed based on homology within of a core domain (15, 23), but functional activity in SUMO-1 processing has not been shown. The proteases identified thus far possess some interesting features. They all contain a core domain within which are the conserved amino acids (cysteine, histidine, and aspartic acid) that make up the catalytic triad. In addition, the proteases possess a large N-terminal domain, with little conservation between the members. It is noteworthy that the subcellular localization of a number of the proteases has been reported to be different, suggesting that this may be an important factor in the regulation and specificity of the proteases. Despite this progress, however, our understanding of the proteases and their regulation remains limited.

We have previously reported that a SUMO-1-specific protease, SENP1, co-localizes with a herpesvirus protein ICP0 during early infection and proposed that this colocalization may be involved in the ICP0-induced loss of SUMO-1-modified PML in infected cells (24). Here we report further characterization of the localization and regulation of SENP1. We map a basic motif within the N terminus of the protein that is critical for efficient nuclear localization of SENP1 and show that the N-terminal region may also be important in modulating SENP1 activity. We show that alteration of a single cysteine residue within the predicted catalytic core inactivates SENP1, resulting in a dominant negative effect and accumulation of SUMO-1-conjugated species tightly associated with the inactive SENP1. Interestingly, our results also indicate that the protease may itself be a target for SUMO-1 modification. We further demonstrate that SENP1 localization may also be influenced by the expression of proteins that are targets of SUMO-1 modification, such as HDAC4 and PML, which affect the relative levels and localization of SUMO-1 conjugates within the cell.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cells—HEp2 and COS-1 cells were grown in Dulbecco's modified Eagle's medium, supplemented with 10% fetal calf serum. Construction and selection of HEp2-SUMO and HeLa-SUMO cell lines has been recently described (24). Cell lines expressing SUMO-1 were selected and passaged in medium containing 2 µg/ml puromycin.

Construction of Plasmids—The construction of the FLAG epitope-tagged wild type (WT) SENP1 construct and the epitope-tagged SUMO-1 expression vector have been previously described (24). Additional mutants and deletion variants of SENP1 were constructed using PCR mutagenesis, by overlapping PCR, or by the QuikChange site-directed mutagenesis procedure (Stratagene). The SENP1 NLS1 mutant containing the additional SV40 nuclear localization signal (NLS) (PKKKRK) was constructed by annealing two oligonucleotides (ctagcccaaagaaaaagagaaaggtcggatccg and ctagcggatccgacctttctctttttctttggg) and inserted into the NheI site of the SENP1 NLS1 mutant, to generate an in-frame SV40 NLS in the N terminus of SENP1, downstream of the FLAG epitope tag. This construct is referred to as SV40 SENP1 NLS1.M1. The plasmid expressing PML {Delta}SUMO was created by PCR mutagenesis and was derived from a construct expressing PML560 (25). This construct contains lysine to arginine substitutions at positions 160 and 490, which are the main sites for SUMO-1 modification. As a result, PML{Delta} SUMO is not subject to SUMO-1 modification in vivo. The construct expressing HDAC4-GFP was created from a full-length cDNA clone (ha061161) for HDAC4, provided by Osamu Ohara and Takahiro Nagase of the Kazusa DNA Research Institute (26). Note that the clone contained a known point mutation, which was corrected by PCR mutagenesis, and the coding region was then inserted in-frame into pEGFP-N1, to create plasmid pHDAC4-EGFP. Constructs were verified by restriction digestion and by DNA sequencing.

Transfections—Transfections were performed using the calcium phosphate precipitation procedure modified by the use of BES-buffered saline (pH 7.06) as previously described (27). The total amount of DNA was equalized to 2 µg with pUC19 DNA.

Immunofluorescence Studies—Approximately 40 h after transfection, cells, plated on glass coverslips, were washed in PBS and fixed with ice-cold methanol. Primary antibodies, diluted in PBS containing 10% fetal calf serum, were anti-c-Myc 9E10 (1:400; Roche Applied Science) for the Myc tag; anti-GMP-1 (1:1000, Zymed Laboratories Inc.) or anti-sentrin (1:200; Chemicon) for SUMO-1, and anti-FLAG M2 (1:2000; Stratagene) for the FLAG tag. The anti-PML DB75 rabbit polyclonal antibody has been previously described (24). Secondary antibodies conjugated to fluorochrome Alexa 488 or Alexa 543 dyes (Molecular Probes, Inc., Eugene, OR) were diluted 1:200 in PBS containing 10% fetal calf serum. Following washing in PBS, cells were visualized using a Zeiss LSM 410 confocal microscope. Images for each channel were captured sequentially with 8-fold averaging. Composite illustrations, representative of many images gathered for each test construct and condition, were prepared using Adobe software.

Western Blot Analysis—After separation by SDS-PAGE, proteins were transferred to nitrocellulose membranes, which were blocked with PBS containing 0.05% Tween 20 (PBST) and 5% dried nonmilk fat. The membranes were incubated (1 h) with primary antibody in PBST plus 5% dried milk, washed three times in PBS containing 1% Triton X-100, and incubated for a further 1 h in PBST plus 5% dried milk containing the appropriate horseradish peroxidase-conjugated secondary antibody. Following further washing in PBS containing 1% Triton X-100, membranes were processed with chemiluminescence detection reagents (Pierce). Primary antibodies used for immunoblot were anti-c-Myc 9E10 (1:1000; Roche Applied Science), anti-GMP-1 (1:1000), and anti-FLAG M5 (1:5000; Sigma).

Immunoprecipitations—Immunoprecipitation of epitope-tagged SENP1 from whole cell extracts was performed as follows. A dish (35 mm) of COS-1 cells were transfected with the appropriate construct, and the monolayer was harvested by lysis with IP buffer (50 mM Tris, pH 7.5, 1% Triton X-100, 150 mM NaCl, 10 mM N-ethylmaleimide supplemented with protease inhibitor mixture; Roche Applied Science). Extracts were bound to FLAG-M2 affinity resin for 3 h and then washed thoroughly with TBS (50 mM Tris, pH 7.5, 150 mM NaCl). Bound protein was eluted from the beads using 0.1 M glycine, pH 3.0, and the sample was neutralized with one-tenth volume of 1 M Tris, pH 7.5, prior to analysis by SDS-PAGE.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Mapping of a Determinant Required for SENP1 Nuclear Localization—To facilitate our understanding of the regulation and dynamics of SUMO-1 modification, we have been characterizing the mammalian SUMO-1-specific protease, SENP1, an enzyme about which we currently have relatively little information. We previously reported on the construction of a cDNA expression vector for human SENP1 (24), isolated from a human testis cDNA library. Enzymic activity was demonstrated, showing removal of SUMO-1 from the nucleus of target cells and loss of high molecular weight SUMO-1 conjugates. We and others also reported that SENP1 itself displays a mainly nuclear staining pattern, with accumulation in punctate or speckled foci (18, 24). Since compartmentalization of the protease is likely to play a major role in its regulation and substrate specificity, we wished to pursue determinants involved in its localization. A related SUMO-specific protease, SENP2, has recently been reported to exhibit nuclear localization (22) with a nuclear localization signal identified close to the extreme N terminus between residues 1 and 63. However, sequence alignment analysis of SENP1 and SENP2 indicates that this region is not conserved between the two proteases, prompting us to investigate the sequences of SENP1 that are required for nuclear localization.

The schematic in Fig. 1a illustrates certain features of SENP1. The protein possesses a long N-terminal region that is poorly conserved among the SUMO-specific proteases, whereas the more highly conserved core domain (shaded) is located close to the C terminus. The core domain contains the residues HDQC that are predicted to be essential for the formation of the catalytic site (18). SENP1 does not appear to contain any consensus mono- or bipartite NLS. However, the locations of three regions that from computer analysis of signature motifs show a relationship to potential NLSs are indicated. NLS2 (aa 574-577, KKRK) and NLS3 (aa 628-634, PYFRKRM) are putative NLSs that were identified from the Swiss-Prot annotation of the SENP1 sequence. From additional computational analysis based on an algorithm utilizing theoretical NLS prediction (28), we identified a third putative site, NLS1 (aa 171-177, PKKTQRR). While not formally identified as NLSs, these putative sites have been labeled NLS on the schematic for clarity.



View larger version (64K):
[in this window]
[in a new window]
  		FIG. 1.
Mapping of determinants for SENP1 nuclear localization. a, schematic of SENP1 construct, highlighting the positions of the FLAG-HA epitope tag, predicted NLS sites, the conserved core domain, and HDQC residues corresponding to the presumptive catalytic active site. b, localization of epitope-tagged SENP1 constructs; WT SENP1, SENP1 1-440, and SENP1 NLS.M1 mutant were transfected into HEp2 cells and subsequently fixed and stained for SENP1 using anti-FLAG M2 antibody to the epitope tag. WT SENP1 was localized to the nucleus, as was SENP1 1-440. SENP1 NLS.M1 mutant was predominantly cytoplasmic. c, localization of SENP1 aa 171-177 or SENP1 1-440 fused to CMPK. SENP aa 171-177 and SENP1 1-440 were fused to CMPK, transfected into COS-1 cells, and fixed and stained for CMPK with anti-CMPK antibody. d, HEp2 cells were transfected with SV40 SENP1 NLS1.M1, and immunofluorescence analysis was performed for SENP1 expression with FLAG antibody or for SUMO-1 with anti-sentrin antibody. The arrows indicate cells expressing SV40 SENP1 NLS.M1, which is now nuclear by virtue of the SV40 NLS, and the corresponding loss of SUMO-1 from the nucleus.

 
We constructed a deletion mutant of SENP1 containing the N-terminal 440 residues and lacking the core domain. This construct contains NLS1 but lacks NLS2 and NLS3 and was almost exclusively nuclear, indicating that an NLS was likely to reside within the N terminus of the protein, (or that this smaller variant passively localized to the nucleus, but see below). Attempts at expressing the C terminus of SENP1 in order to examine localization of the isolated core domain and the presence of an NLS within this region were relatively unsuccessful. Possible reasons for the inefficient expression of the C-terminal domain in isolation are discussed in more detail below.

We next performed site-directed mutagenesis of the predicted N-terminal NLS (NLS1) in the context of full-length SENP1 by substituting the basic amino acids for glycine residues (PKKQTRR to PGGQTGG). The results indicated a very clear phenotype with the variant (SENP1.NLS1.M1) now accumulating predominantly in the cytoplasm, although minor and variable amounts of the protein could be observed in the nucleus (Fig. 1b). These results indicate that residues within the predicted NLS1 region around positions 170-180 are critical for the nuclear localization of SENP1 and that there appears to be no other independent functional NLS, including those predicted within the C terminus.

In an attempt to confirm that this region was the critical NLS responsible for nuclear localization, we fused residues 171-177 to the N terminus of pyruvate kinase, a reporter construct that is usually restricted to the cytoplasm (29). However, by this analysis, neither the short motif nor the complete N terminus of SENP1 (aa 1-440) was able to redirect pyruvate kinase to the nucleus (Fig. 1c). These results indicate that whereas the residues around NLS1 are important, they may not be sufficient and that there may be some context sensitivity in the ability of this nonconventional sequence to independently direct a protein to the nucleus.

One explanation for the lack of nuclear localization of SENP1.NLS1.M1 was that the mutation affected some global aspect of, for example, protein folding and that this was indirectly responsible for the failure to accumulate in the nucleus. To address this, we constructed a version of SENP1.NLS1.M1, in which we attached a conventional NLS (from SV40 T-antigen) to the N terminus of the protein. We anticipated that this version should now locate to the nucleus and, if active, promote the loss of SUMO-1. This is exactly what was observed. As previously shown for WT SENP1 (24) (this paper; e.g. see Fig. 4), the SV40 NLS-containing variant of SENP1.NLS1.M1 located to the nucleus and promoted the loss of SUMO-1 (Fig. 1d). This result provides robust evidence that the lack of nuclear localization of SENP1.NLS1.M1 was not due to some indirect effect affecting overall folding and function of the protein. Thus, both from the observation that this region is identified from homology searching as a putative, although nonclassical NLS, and from the unambiguous results of the effects of substitution of the basic residues, we believe that the NLS1 region is the major determinant for nuclear localization of SENP1.



View larger version (64K):
[in this window]
[in a new window]
  		FIG. 4.
Analysis of the effect of SENP1 C603S expression upon SUMO-1. a, Hep2 cells were transfected with SENP1 or SENP1 C603S and then fixed and stained for epitope-tagged SENP1 with anti-FLAG M2 antibody or SUMO-1 with anti-sentrin antibody. WT SENP1 promoted the loss of SUMO-1 (upper panels, arrowed cell), whereas the SENP1 C603S catalytic mutant failed to promote the loss of SUMO-1 (lower panels, arrowed cell). b, HEp2 cells were co-transfected with hmSUMO-1 and either SENP1 or SENP1 C603S. Cell extracts were subjected to SDS-PAGE and Western blotting and then probed with anti-SUMO-1 to reflect total SUMO-1 (left panel; 10% SDS-PAGE) or anti-c-Myc antibody for the epitope-tagged SUMO-1 (right panel; 3-8% SDS-PAGE gradient gel showing high molecular weight conjugates only). WT SENP1 promoted the loss of SUMO-1 conjugates (compare lanes 1 and 2), whereas increased SUMO-1 conjugates are observed with SENP1 C603 (compare lanes 1 and 3). The asterisk indicates the Ran-GAP1 conjugate, which is the major endogenous SUMO-1 conjugate detected in cell extracts.

 
Expression of the SENP1 Core Domain—In an attempt to examine the expression and localization of the C-terminal core domain, we constructed a variant comprising residues 436-644 of SENP1 but found it extremely difficult to detect the protein both by Western blot and immunofluorescence analysis. Whereas other explanations were possible, one explanation for the poor expression was the possible hyperactivity of the catalytic core of the protease. By analogy with other cysteine proteases, it is generally accepted that the default state of the proteases is one of low activity and that their conversion into the active form is highly regulated. The SUMO-specific proteases possess a well conserved core domain, whereas their N-terminal domains are highly varied in primary sequence and size (23, 30, 31). One role of the N-terminal regions of these proteases (in addition to the proposed role above in nuclear localization) could be in regulating activity and substrate selectivity. The interpretation of the result for SENP1 lacking the N terminus is that the core domain may be constitutively active and lack specificity. Constitutive activity may then have had either an intrinsic cytotoxicity or, since many SUMO-1 modified proteins are involved in transcriptional regulation (32), may have affected expression within the transfected cells.

In a further attempt to demonstrate catalytic activity of the core domain in mammalian cells, we expressed the SENP1 436-644 construct in cells constitutively expressing higher levels of SUMO-1 (24), in which SUMO-1 is more readily assayable. Hep2-SUMO cells were transiently transfected with the SENP1 436-644 construct, fixed, and stained for SENP1 or SUMO-1. Again, consistent with our initial attempts, SENP1 436-644 expression proved difficult to detect, although expression was observed in a minority of cells (less than 1 in 200 cells). However, whereas only low levels of SENP1 436-644 expression could be detected, it was clear that in the cells expressing the SENP1 436-644 core domain, SUMO-1 was significantly reduced (Fig. 2; two representative panels are shown). Although these results do not necessarily indicate that constitutive activity of the core domain accounted for low numbers of positive cells, they do indicate that the core domain was able to promote the loss of SUMO-1. Results below, using a mutant core domain, demonstrate that loss of SUMO-1 was not a nonspecific event and required an intact catalytically active core domain.



View larger version (60K):
[in this window]
[in a new window]
  		FIG. 2.
Analysis of SENP1 core domain expression. The epitope-tagged core SENP1 (aa 436-644) was expressed in HEp2-SUMO cells. Immunofluorescence analysis was performed for SENP1 expression with FLAG antibody or for SUMO-1 with anti-sentrin antibody. The arrows indicate cells expressing low levels of SENP1 436-644 and a corresponding loss of SUMO-1 from the nucleus.

 
Localization of a Catalytic Site Mutant of SENP1—A number of residues within the core domain show complete conservation and are predicted to form part of the catalytic site of the enzyme and be involved in isopeptide bond cleavage (Fig. 1a). The cysteine residue at position 603 is predicted to be a part of this catalytic site, and we next examined localization and activity of a mutant (cysteine 603 to serine) that, from known information on the cysteine protease family, would be predicted to be catalytically inactive (Fig. 3a).



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 3.
Comparison of SENP1 and SENP1 C603S localization. a, schematic indicates the position of the cysteine to serine mutation within the catalytic site of SENP1. b, epitope-tagged WT SENP1 and SENP1 C603S were expressed in HEp2 cells and fixed and stained for SENP1 with anti-FLAG M2 antibody. At higher levels of expression, SENP1 was largely nuclear, with some cytoplasmic staining (long arrows). SENP1 C603S was exclusively nuclear, with no cytoplasmic staining (short arrows).

 
A variant containing the single cysteine to serine substitution at position 603 was transfected, and localization was examined in parallel with that of the parental WT protein. The results demonstrated that localization of SENP1 C603S was largely similar to the WT SENP1, with both proteins present in a nuclear diffuse pattern together with punctate staining. However, we noted a reproducible difference between the proteins in that whereas WT SENP1 could be readily observed in the cytoplasm, particularly when expressed at higher levels (Fig. 3b, SENP1, long arrows), SENP1 C603S was exclusively nuclear (Fig. 3b, short arrows). This effect was not due to overall difference in expression between the proteins. Both the WT SENP1 and C603S mutant were expressed at similar levels as judged by Western blot (see below). Particularly when analyzing the highest expressing cells on an individual basis, it was clear that WT SENP1 could be detected in the cytoplasm, whereas the C603S mutant was always exclusively nuclear. Although not further investigated here, this difference may be significant, since it has been suggested that SUMO-1 may be involved in nuclear import processes (14, 33, 34). This raises the possibility that SENP1 may also be involved in this process and/or may be shuttling between the nucleus and cytoplasm. An explanation for the exclusively nuclear accumulation of the catalytically inactive mutant arises from the results below.

Analysis of SENP1 C603S Mutant upon the SUMO-1 Profile—To demonstrate that the Cys603 residue was indeed critical for formation of the catalytic site, we next analyzed the effect of the C603S mutant on the ability to promote the loss of SUMO-1 by Western blot and immunofluorescence analysis. Consistent with previous results (18, 24), WT SENP1 promoted loss of SUMO-1 from the nucleus of HEp2 cells (Fig. 4a, upper panel, SENP1, arrowed cell). In contrast, however, the SENP1 C603S mutant generally failed to promote the loss of SUMO-1, and instead a subset of the protein showed co-localization with punctate SUMO-1 domains (Fig. 4a, SENP1 C603S, arrowed cell). We occasionally observed SENP1 C603S-induced loss of the punctate SUMO-1 domains but not any generalized loss of SUMO-1.

In a separate assay to compare activity of the WT and mutant proteins, we performed Western blot analysis of the profile of high molecular weight conjugated SUMO-1 species in cells co-transfected with either SENP1 or SENP1 C603S, together with a c-Myc epitope-tagged version of SUMO-1 (hmSUMO-1). Approximately 40 h after transfection, proteins were prepared, separated by SDS-PAGE, and transferred to nitrocellulose, and the SUMO-1 profile was analyzed using antibodies either to the total SUMO-1 species (detecting endogenous and transfected SUMO-1) or to the transfected species alone (note that in this example a lower percentage acrylamide gel was used for the blot employing the anti-Myc antibody). Consistent with our previous observations (24), SENP1 expression induced a loss of high molecular weight SUMO-1 conjugates, detected using both the anti-SUMO-1 antibody showing total SUMO-1 (Fig. 4b, left panel, compare lanes 1 and 2) and, even more pronounced, using the c-Myc epitope tag (Fig. 4b, compare lanes 1 and 2 right panel). In contrast, the SENP1 C603S mutant completely failed to promote the loss of SUMO-1 (Fig. 4b, compare lanes 1 and 3, left and right panels). Moreover, the amount of high molecular weight SUMO-1 species detected in the presence of the mutant SENP1 was significantly higher than in control cells. One interpretation consistent with these results is that the SENP1 C603S mutant was acting in a dominant negative manner, blocking activity of the endogenous SENP1. Similar mutations within the active site of other cysteine proteases have also been reported to have a dominant negative effect (e.g. see Refs. 34 and 35). We further noted that the unconjugated SUMO-1 migrating at about 23 kDa was almost completely lost in the presence of the SENP1 C603S mutant (Fig. 4b, compare lanes 1 and 2 versus lane 3, left panel). This result suggests that the free SUMO-1 may be the result of turnover of SUMO-1 conjugates by the endogenous protease(s) and that the dominant negative effect of SENP1 C603S mutant prevents or substantially reduces this, resulting both in trapping of SUMO-1 in the high molecular weight conjugates and reduction of free SUMO-1.

Examination of SENP1 C603S Mutant by Western Blot—As controls for studies of both localization and activity, we examined the relative levels of expression of the SENP1 C603S mutant compared with WT SENP1. Expression levels were assessed both in the absence and presence of exogenously transfected hmSUMO-1, with the results identifying a potentially important characteristic of SENP1.

SENP1 C603S was expressed at the correct size of ~76 kDa and at similar levels to the WT SENP1 (Fig. 5a, compare lanes 2 and 4, short arrows). In addition, for the SENP1 C603S mutant, an additional higher molecular weight form was detected migrating as a doublet of between 90 and 100 kDa (Fig. 5a, lane 4, long arrow). This doublet was not observed with the WT SENP1, and the shift in size from the main form was consistent with similar shifts we have observed for SUMO-1-modified proteins. One proposal to explain these results, therefore, was that SENP1 was itself a target for SUMO-1 modification but that this modification was normally rapidly reversed by an autocatalytic activity removing the SUMO-1, with little of the modified form accumulating. In the mutant SENP1, the absence of proteolytic activity resulted in the detection of the conjugated form.



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 5.
Western blot analysis of SENP1 C603S expression in COS-1 cells. a, cell extracts from COS-1 cells transfected with SENP1 or SENP1 C603S, alone or in conjunction with hmSUMO-1, were subjected to SDS-PAGE and Western blotting. Extracts were probed for the FLAG epitope tag. Equal levels of unmodified SENP1 expression were observed (lanes 2-4, short arrows), whereas SENP1 C603S was detected as an additional high molecular weight doublet (lane 4, long arrow), whose mobility was shifted in the presence of exogenous tagged SUMO-1 (lane 5, long arrow). b, schematic illustrating the positions of the putative SUMO-1 modification (LKQE) site at lysine 568, within the SENP1 core domain (shaded). Similar experiments to those of above was performed, with the K568R substitution in either SENP1 or SENP1 C603S backbones. The SENP1 C603S/K568R construct was modified as efficiently as WT SENP1 (compare lanes 3 and 5 or lanes 9 and 11, long arrows). A low abundance, modified form of potentially phosphorylated SENP1 is also indicated (P?). c, similar Western blot analysis as above, confirming modification of both the C603S and C603A SENP1 mutants by endogenous and exogenous SUMO-1.

 
To examine whether the modification was indeed due to SUMO-1, we co-transfected the protease with the epitope-tagged SUMO-1 with the expectation that modification of SENP1 C603S by exogenous SUMO-1 would lead to a slightly increased shift due to the presence of the epitope tag. A clear shift was observed when exogenous hmSUMO-1 was transfected with SENP1 C603S (Fig. 5b, compare lane 4 and lane 5, upper long arrow). Again we did not detect any modification of the WT SENP1, even in the presence of exogenous SUMO-1, presumably because the WT protease was catalytically active, removing the SUMO-1, either by acting in cis or in trans. The size of the doublet compared with the unmodified protein, was consistent with modification of SENP1 with a single molecule of SUMO-1, and therefore most likely represented a modification at a single site. The nature of the doublet in the shift remains uncertain; however, it should be noted that unmodified WT SENP1 was frequently observed to migrate as a doublet (e.g. due to other alterations such as phosphorylation), so the high molecular weight doublet isoforms of the Cys603 mutant probably represent corresponding shifts of both unmodified fractions. We note that migration as a doublet has also been reported with a yeast SUMO-specific protease, Ulp1 (31).

The sites for SUMO-1 modification of several SUMO-1 target proteins have been mapped (for reviews, see Refs. 23 and 32). Although there are several exceptions, a consensus site for SUMO-1 modification has been proposed, consisting of {psi}KXE, where {psi} is a hydrophobic amino acid, K is the lysine that is targeted for conjugation, X is any amino acid, and E is glutamic acid (36-38). Analysis of the SENP1 amino acid sequence demonstrated the presence of a sequence, LKQE, that matches the SUMO-1 consensus motif starting at residue 567. Interestingly, this sequence (conserved within murine SENP1) is present within the core domain, between the sequences of the catalytic site (Fig. 5b, schematic), suggesting a potential autoregulatory role of SUMO-1 modification in the activity of the protease.

To determine whether the lysine at residue 568 was a SUMO-1 modification site, we mutated the lysine residue to an arginine residue in the context of both WT SENP1 and SENP1 C603S. Each of the constructs (SENP1 K568R and SENP1 C603S/K568R, respectively) was then expressed in the absence or presence of exogenous epitope-tagged SUMO-1, and modification was assessed by Western blotting. The results demonstrated that the SENP1 C603S/K568R double mutant was modified by both endogenous and exogenous SUMO-1, and modification was indistinguishable from the C603S single mutant (Fig. 5b, compare lanes 3 and 5 for endogenous SUMO-1 or lanes 9 and 11 for exogenous SUMO-1). We did not detect any differences in the localization profile of the K568R mutant, either in the WT or C603S backbone (data not shown). These data indicate that the potential site at Lys568 does not account for SENP1 C603S modification.

We considered an alternative explanation, that it was possible that the modified C603S species represented not a conventional SUMO-1 modification on a target lysine group but rather an intermediate in the cleavage process. The reaction pathway predicts that during the cleavage reaction catalyzed by SENP1, the SUMO-1 moiety becomes transiently linked to the catalytic cysteine residue. We mutated the cysteine to a serine, and there are similarities in the detailed mechanism of action and coordination intermediates of cysteine and serine proteases. To rule out the possibility of an intermediate, we therefore additionally mutated the cysteine to an alanine. We observed the same modified form in the C603A mutant (Fig. 5c, compare lanes 3-5 for endogenous SUMO-1 or lanes 6-8 for exogenous SUMO-1), indicating that this was not due a trapped intermediate and reinforcing the result with a second independent variant that loss of the active cysteine resulted in a modified form of the inactive enzyme.

Together with the results above, the data strongly indicate that the high molecular weight form of SENP1 C603S was due to modification by SUMO-1 at a nonconsensus site.

Association of High Molecular Weight SUMO-1 Species with SENP1 C603S—To further examine the SUMO-1 moiety conjugated to the SENP1 C603S inactive protease, we next examined whether any SUMO-1-modified species co-precipitated with the SENP1 species following immunoprecipitation from extracts of cells expressing the proteins. Cells were transfected as before with the WT or Cys603 variant, with or without tagged SUMO-1. Extracts were prepared in a lysis buffer (see "Experimental Procedures"), containing N-ethylmaleimide and protease inhibitors, and the SENP1 species were precipitated using FLAG M2-coupled affinity resin. After washing, bound protein was eluted from the resin and subjected to Western blot, detecting the protease with anti-FLAG M2 antibody (Fig. 6a) and any co-precipitating SUMO-1-conjugated species with an antibody to the epitope-tagged SUMO-1 (Fig. 6b). SENP1 and the SENP1 C603S mutant were precipitated in approximately equal quantities from the extracts (Fig. 6a, lanes 1 and 2, short arrow). Consistent with our earlier observations, the slower migrating doublet species of the SENP1 C603S was observed, and this was shifted to a slightly higher migration in the presence of exogenous SUMO-1 (Fig. 6a, lanes 2 and 4, long arrows). The modification appeared relatively stable, even under these different extraction conditions. When analyzing the immunoprecipitates using the anti-SUMO-1 antibody (Fig. 6b), the SENP1 C603S doublet observed with co-expressed hmSUMO-1 (Fig. 6a, lane 4) was readily detected with the anti-SUMO-1 antibody (Fig. 6b, lane 4, arrows). Note that the failure to detect the modification to the SENP1 Cys603 mutant by the endogenous SUMO-1 (Fig. 6b, lane 2) is because this antibody does not detect the primate SUMO-1 in COS-1 cells (data not shown).



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 6.
Affinity precipitation of SENP1 constructs. a, cell extracts from COS-1 cells transfected with SENP1 or SENP1 C603S, alone or in conjunction with hmSUMO-1, were subjected to affinity precipitation with FLAG M2-coupled resin. Eluted proteins were subjected to electrophoresis and Western blotting. Shown is probing for SENP1 with antibody (FLAG M2) to the epitope tag (a) or with an antibody to SUMO-1 (b). The arrows indicate the migration of the unmodified SENP1 (a, short arrow) and the SUMO-1-modified form of SENP1 with its corresponding SUMO-1-reactive bands (a and b, long arrows). Additional high molecular conjugates of SUMO-1 are also observed co-precipitating with SENP1 C603S (b, lane 4) The asterisk indicates residual heavy chain antibody, eluted from the affinity resin.

 
Surprisingly, however, in addition to the lower conjugates co-migrating at the position of the modified form of the SENP1 C603S doublet, we also observed a ladder of high molecular weight SUMO-1 conjugates (Fig. 6b, lane 4). The ladder of SUMO-1 was intriguing, since it may represent SUMO-1 conjugates attached to target proteins, which interacted with the protease but were not cleaved. SUMO-1 was not precipitated with the WT SENP1 (Fig. 6b, lane 3), which was active in cleavage of SUMO-1 conjugates. The analysis of SUMO-1 conjugates precipitated by the catalytically inactive mutant may prove to be a useful tool in identifying targets of SUMO-specific proteases. It is also interesting to note that the high molecular weight ladder, in addition to broadly migrating species, had an underlying regular appearance, suggesting that these could include chains of SUMO-1. Although further work is required to characterize the nature of the SUMO-1 modifications, if this were the case, one function of the SENP1 protease may be in cleavage (or prevention of the formation) of SUMO-1 chains. We are currently investigating this hypothesis.

Analysis of the C603S Mutation within the Context of the Core Domain Alone—As indicated above, our attempts at expression of SENP1 436-644 (core domain alone) were largely unsuccessful, with poor expression but detectable catalytic activity (Fig. 2). In addition, we also demonstrated that the cysteine 603 residue of SENP1 was critical for activity of the protease (Fig. 3). To examine our proposal that the low level of expression of the SENP1 core domain was due to the catalytic activity of the core domain, we next introduced the C603S mutation into the SENP1 436-644 core domain construct. We analyzed the expression of SENP1 436-644 C603S by Western blot and immunofluorescence analysis. As before, expression of the catalytically intact SENP1 436-644 core domain was barely detectable by Western blot analysis (Fig. 7a, lane 2). In marked contrast, the SENP1 core domain construct containing the single C603S mutation was now readily detectable, migrating at the expected size of approximately 28 kDa, and with significant levels of expression (Fig. 7a, lane 3). Although other interpretations are possible, this result is consistent with the interpretation that the low levels of expression of the core domain may indeed be due to unrestrained activity (rather than being an indirect effect of, for example, altered protein folding), since the single substitution that results in lack of catalytic activity in the same core domain background resulted in significant levels of expression. Interestingly, however, this truncated C603S construct did not show the shift in modification by SUMO-1 seen in the full-length version of the mutant. This may indicate that the SUMO-1 modification of SENP1 C603S occurs within (or may require) the N-terminal region.



View larger version (53K):
[in this window]
[in a new window]
  		FIG. 7.
Expression of SENP1 core domain containing the C603S mutation. a, cell extracts from COS-1 cells transfected with SENP1 436-644 (core domain) or SENP1 436-644 C603S were subjected to electrophoresis and Western blotting. a, probing for SENP1 expression with anti-FLAG M2 antibody; b, low magnification image of HEp2-SUMO cells transfected with SENP1 436-644 (left panel, arrow indicates expressing cells) or SENP1 436-644 C603S, stained for SENP1 (green), or SUMO-1 (red). SENP1 436-644 expression was largely undetectable (a, lane 2, and b, left panel), whereas SENP1 436-644 C603S expression was readily detected (a, lane 3, and b, right panel). c, higher magnification image of HEp2-SUMO cells expressing SENP1 436-644 C603S, showing co-localization with SUMO-1 (arrowed cells).

 
Immunofluorescence analysis of HEp2-SUMO cells transfected with the SENP1 436-644 construct were consistent with the Western blot results. Very few cells expressed the exogenous SENP1 436-644 core domain, and in any positive cells expression was at extremely low levels (Fig. 7b, left panel, arrowed cells). The SENP1 436-644 C603S construct, however, was readily detected, often with very high levels of expression (Fig. 7b, right panel). The mutant protease was nuclear, with significant accumulation in punctate dots that co-localized with SUMO-1 (Fig. 7c). As anticipated, the SENP1 436-644 C603S core domain mutant did not promote the loss of SUMO-1 from the nucleus, even at high levels of expression (Fig. 7c), unlike expression of the WT SENP1 core domain (Fig. 2).

Recruitment of Mutant SENP1 to Domains Containing SUMO-1 Substrates—We interpreted the co-precipitation results (Fig. 6) to indicate a very tight association between the mutant SENP1- and SUMO-1-modified substrates. We wished to confirm this proposal independently by comparing localization of the wild type and mutant SENP1 when co-expressed with other protein targets for SUMO-1 modification. We focused our analysis on two SUMO-1 protein targets that are themselves able to form discrete domains within the nucleus, namely PML (2, 39, 40) and HDAC4 (13, 41).

Co-transfection experiments were therefore performed with SENP1 constructs and exogenous PML560 or HDAC4. SENP1 was detected with antibody to the epitope tag. Co-expression of exogenous PML was detected with anti-PML antibody, and cells were readily identified due to enlarged PML domains, relative to the endogenous PML domains. The results are shown in Fig. 8a (two panels for each construct, with SENP1 species in the green channel and PML in the red channel in merged images). There was no significant alteration in localization of WT SENP1 due to co-expression of PML (Fig. 8a, left panels). SENP1 was found in a nuclear diffuse appearance, with some punctate speckling and with some limited co-localization with PML domains, consistent with our previous observations (24). In contrast, localization of the mutant SENP1 C603S protein was profoundly affected by co-expression of PML. SENP1 C603S was virtually quantitatively retained within the PML domains, sometimes leading to a distorted irregular domain structure (Fig. 8a, center panels). These results are consistent with the interpretation that SENP1 C603S was being relocalized due to its retained interaction with SUMO-1-modified PML.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 8.
Relocation of SENP1 C603S to foci of SUMO-1-modified target proteins. a, PML560 or PML K160R/K490R (PML {Delta}SUMO) were co-transfected with WT SENP1 or SENP1 C603S into HEp2 cells. Cells were subsequently fixed and stained with anti-FLAG M2 to detect SENP1 (green) or anti-PML polyclonal to detect PML (red). WT SENP1 was not recruited by exogenous PML (left panels), whereas SENP1 C603S was relocalized by PML into punctate domains, sometimes at the periphery of the nucleus (center panels). PML {Delta}SUMO was unable to relocalize SENP1 C603S (right panels). b, GFP-HDAC4 was co-transfected with PML, WT SENP1, or SENP1 C603S. Cells were stained for SENP1 or PML (red) and HDAC4 was detected by virtue of the GFP tag (green). HDAC4 localized to domains that were distinct from PML domains (upper two panels) did not relocalize WT SENP1 (center panels) but did relocalize SENP1 C603S (lower panels).

 
It was possible that SENP1 C603S was being retained through interaction either with SUMO-1-modified PML or through interactions with other SUMO-1-modified proteins that had themselves been recruited to the domains. If our interpretation was correct that SENP1 C603S was retained directly through interaction with SUMO-1 modified PML, we predicted that we should not observe relocalization of SENP1 C603S when expressed together with a PML variant that was not subject to SUMO-1 modification. To address this, we employed a form of PML (PML {Delta}SUMO) in which the major lysine SUMO-1 modification sites (Lys160 and Lys490) had been substituted to arginine residues. It has been previously shown that this variant is not subject to SUMO-1 modification (42).2 It should be noted that the minor SUMO-1 modification site at Lys65 remained in this PML mutant, and whereas this site can be a target for SUMO-1 modification, it is only modified by SUMO-1 in the presence of existing SUMO-1 modification at Lys160 (42).2 The results (Fig. 8a, right panels) show that although PML {Delta}SUMO was found in large punctate domains in a pattern indistinguishable from the WT PML, no recruitment of SENP1 C603S to these domains was observed, since the mutant SENP1 remained in an unaltered diffuse nuclear pattern.

To examine whether similar results would be obtained with an independent protein that was also a substrate for SUMO-1 modification, we examined localization with HDAC4, a protein previously shown to be a target for SUMO-1 modification (13). HDAC4 localized to distinctly different domains compared with PML (Fig. 8b, top panels) and was also unable to recruit WT SENP1 (Fig. 8b, middle panels). However, HDAC4 expression did result in very efficient recruitment of the SENP1 C603S mutant (Fig. 8c, bottom panels) to the HDAC4 domains. Although HDAC4 is a target for SUMO-1 modification (13), it is still unclear whether the SUMO-1 moiety is removed from HDAC4 by specific proteases. Our data indicate that HDAC4 is a potential target for SENP1 regulation.

Taken together with the co-precipitation results (Fig. 6b) these data provide strong evidence that the SENP1 C603S relocalization was induced by direct interaction with the exogenously expressed PML, which accumulated in a SUMO-1-modified form, with the mutant SENP1 being trapped in an inactive form with its substrate.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
It is becoming increasingly clear that modification of target proteins by SUMO-1 plays a major role in diverse pathways and activities including protein targeting, transcriptional regulation, modulation of enzyme activity, and protein turnover (for reviews, see Refs. 32, 43, and 44). One major aspect of SUMO modification and metabolism, is deconjugation from its substrate catalyzed by SUMO-specific proteases. Based on the original identification of SUMO-specific proteases in yeast (15), several mammalian SUMO-specific proteases have been proposed or confirmed (15-23). However, our current understanding of the function and regulation of these enzymes remains limited.

We have focused on the characterization of the SUMO-specific protease, SENP1. Consistent with the original identification of SENP1 (18), we demonstrate that SENP1 normally accumulates in the nucleus with a minor but consistent population in the cytoplasm. Residues 171-177, within the poorly conserved N-terminal region, are critical for nuclear targeting. Substitution of the basic residues within this short motif abrogated nuclear accumulation. The addition of an NLS to the N terminus of this mutant restored nuclear accumulation of a functional protein. Together, the results provide strong evidence that the basic region around 171 is an NLS, required for nuclear import of SENP1. We note that whereas this motif does not fit the conventional definition of an NLS, since the identified residues are not readily transferable, the possibility remains that SENP1 piggybacks into the nucleus on another cellular protein and that this region is important for the interaction with other as yet unidentified cellular proteins involved in import. In yeast, the N terminus appears to be important in localization of Ulp1 to the nuclear envelope, and localization correlates in part with the ability to efficiently cleave substrates (45). Of two other SUMO-specific proteases, SENP2 appears to localize specifically to nuclear pores (34), whereas a protease termed SMT3IPI has been reported to accumulate in the nucleolus (46). It appears that differences within the N-terminal regions direct specific targeting of the proteases to different compartments, and this, in addition to obvious discrimination in substrate binding, is likely to be a major factor in substrate selection. In this regard, in demonstrating that the cysteine 603 SENP1 is critical for activity of the SENP1 protease (see below), we also observed that localization of SENP1 C603S was exclusively nuclear in comparison with the WT SENP1, which was consistently present in the cytoplasm, albeit at low steady state levels. Since one of the proposed roles of SUMO-1 is in the regulation of the nuclear import/export pathway (13, 14), one function of SENP1 may be in this transport pathway, perhaps involving shuttling between the nucleus and cytoplasm. Analysis of changes to the substrate spectrum of SENP1 that has been redirected to the cytoplasm and the potential shuttling of the WT SENP1 is now in progress.

Our results demonstrate that not only was the C603S mutant unable to promote loss of SUMO-1 from high molecular weight conjugates; on the contrary, it exhibited a dominant negative phenotype, promoting the accumulation of SUMO-1 conjugates in the cell, with a concomitant loss of free SUMO-1. These results are consistent with other studies using similar mutations in the catalytically active cysteine within the yeast Ulp1 or the mammalian SENP2 core domain (34, 35). In both cases, accumulation of high molecular weight conjugate species could be observed. Although the mechanism is not clear, sequestration by the inactive mutant of an important co-factor for the WT enzyme or of the SUMO-1 conjugates themselves provides possible explanations. The results discussed below are of relevance in this context.

We provide convincing evidence that a novel doublet observed for the SENP1 C603S mutant indicates that SENP1 C603S was itself a target for SUMO-1 modification. Although analysis of the protease sequence intriguingly suggested the presence of a consensus SUMO-1 modification site within the actual catalytic core domain, additional mutational analysis indicated that the SUMO-1 conjugation site resided elsewhere in the protein on a non-consensus lysine group. It is of interest to note that SUMO-1 modification on a nonconsensus site within another substrate, proliferating cell nuclear antigen, has recently been reported (47). Whereas reports of SUMO-1 modification on nonconsensus sites are rare, it should be noted that the majority of SUMO-1 modifications detected to date have been identified on the basis of searching known proteins for the consensus motif, thus skewing the detection of SUMO-1 conjugates in that direction. It is also possible that modifications on at least some nonconsensus sites are potentially disruptive errors and that at least one function of SENP1 may be to remove aberrant SUMO-1 modifications fulfilling a housekeeping or protective function. We did not detect modification of the WT SENP1 by SUMO-1, presumably due to the cleavage of SUMO-1 from SENP1 either in cis or in trans by the catalytically active SENP1. It is therefore also possible that the rapid autocatalytic turnover of SUMO-1 on SENP1 is involved in regulating its activity within the cell.

In further analysis, we also observed that high molecular weight conjugates of SUMO-1 co-precipitated with the C603S mutant SENP1. Whereas there were many diffusely migrating species within these co-precipitated components, there were also species migrating at regular intervals in the gels, potentially indicative of SUMO-1 chains. We note that we did not detect the presence of ubiquitin in the precipitated fraction (data not shown). Chain formation has been reported for SUMO-2/3 due to the presence of the consensus modification site within the N terminus of the proteins (38). However, this is not thought to be the case for SUMO-1, since the corresponding motif is absent. We are currently investigating whether the high molecular weight conjugates observed in the precipitated fraction contain SUMO-1 chains and/or are SUMO-1 conjugates linked to target proteins. We also observed that expression of the mutant SENP1 resulted in loss of the free SUMO-1 within cells (Fig. 4), coincident with the appearance of the SUMO-1 higher molecular weight conjugates. The simplest explanation for these results is that there is a dynamic flux of modification and deconjugation and that free SUMO-1 pools, which provide the substrate for subsequent conjugation, are mostly derived from deconjugation rather than de novo synthesis.

We observed poor expression of the isolated C-terminal core of SENP1, comprising the predicted catalytic domain. Given the observation that in the context of the core domain, a single substitution of Cys603 to Ser now resulted in very efficient expression and abundant nuclear accumulation, we suggest that the poor expression of an active core may due to toxicity or down-regulation. These observations are reminiscent of results observed in yeast where expression of the core domain of a yeast Smt3 (SUMO-1 homologue)-specific protease, Ulp1, had a dominant lethal phenotype, associated with cell cytotoxicity (48). In the study, sequences in the N terminus of Ulp1 were required to suppress the dominant negative phenotype. Similar observations have been made recently by Li and Hochstrasser (45). It is possible that there is a common cellular factor in yeast and mammalian cells that is SUMO-1-modified and whose modification is essential for cell viability or that unrestrained SENP1 activity on diverse targets affects cell cycle progression and viability. Investigation of which regions within the N terminus of SENP1 are required for its regulation and whether expression of the core SENP1 alone results in constitutive activity will be the subject of further analysis both in vitro and in vivo.

Finally, our findings on the localization of SENP1 demonstrate that expression of protein substrates for SUMO-1 modification (e.g. PML and HDAC4) can influence the localization of the catalytically inactive SENP1 C603S protease. The results suggest that the catalytically inactive C603S SENP1 mutant was being sequestered or relocalized into domains that had accumulated relatively high levels of SUMO-1-modified target proteins. It is likely, therefore, and consistent with the results from the co-precipitation assays, that the mutant SENP1 stably interacts with SUMO-1 and target proteins but fails to be released from the complex. This interpretation is consistent with structural data based on the studies on yeast Ulp1 core domain in complex with Smt3, whereby extensive surface contacts between Ulp1 and SUMO-1 occur outside of the catalytic residues and serve to stabilize the interaction (48). The subsequent result is trapping of SENP1 in subcellular domains corresponding to the site of accumulation of the target protein. We and others have previously shown that SENP1 can deconjugate SUMO-1 from PML (18, 24). It is not currently known whether HDAC4 is also a target for SENP1, although our relocalization data suggest this may be the case.

We previously observed that WT SENP1 was recruited by the herpesvirus immediately early protein, ICP0 (24). This situation differs from that with HDAC4 or PML, which do not affect WT SENP1 (but as indicated above do sequester the mutant SENP1). The recruitment by ICP0 could represent a distinct mechanism for SENP1 relocalization or, potentially, an alteration in the catalytic state of SENP1. In conclusion, our results reveal some important features affecting the regulation and activity of the SUMO-specific protease, SENP1, certain of which may also apply to other SUMO-specific proteases. Together with regulation of the conjugation pathways and SUMO ligases, the SUMO-specific proteases are likely to play key regulatory roles in controlling diverse aspects of modification and function of target proteins.


   FOOTNOTES
 
* This work is supported by Marie Curie Cancer Care. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed. Tel.: 44-1883-722306; Fax: 44-1883-714375; E-mail: P.OHare{at}mcri.ac.uk.

1 The abbreviations used are: SUMO, small ubiquitin-like modifier; NLS, nuclear localization signal; WT, wild type; HDAC, histone deacetylase; BES, N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid; PBS, phosphate-buffered saline; aa, amino acids; E1, ubiquitin-activating enzyme; E2, ubiquitin carrier protein; E3, ubiquitin-protein isopeptide ligase. Back

2 D. Bailey and P. O'Hare, unpublished results. Back


   ACKNOWLEDGMENTS
 
We thank Osamu Ohara and Takahiro Nagase (Kazusa DNA Research Institute) for providing the HDAC4 cDNA clone.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Pickart, C. M. (2001) Mol. Cell 8, 499-504[CrossRef][Medline] [Order article via Infotrieve]
  2. Müller, S., Matunis, M. J., and Dejean, A. (1998) EMBO J. 17, 61-70[CrossRef][Medline] [Order article via Infotrieve]
  3. Gostissa, M., Hengstermann, A., Fogal, V., Sandy, P., Schwarz, S. E., Scheffner, M., and Del Sal, G. (1999) EMBO J. 18, 6462-6471[CrossRef][Medline] [Order article via Infotrieve]
  4. Muller, S., Berger, M., Lehembre, F., Seeler, J. S., Haupt, Y., and Dejean, A. (2000) J. Biol. Chem. 275, 13321-13329[Abstract/Free Full Text]
  5. Hay, R. T., Vuillard, L., Desterro, J. M., and Rodriguez, M. S. (1999) Philos. Trans. R. Soc. Lond-Biol. Sci. 354, 1601-1609[Abstract/Free Full Text]
  6. Hochstrasser, M. (2000) Nat. Cell Biol. 2, E153-E157[CrossRef][Medline] [Order article via Infotrieve]
  7. Desterro, J. M., Thomson, J., and Hay, R. T. (1997) FEBS Lett. 417, 297-300[CrossRef][Medline] [Order article via Infotrieve]
  8. Schwarz, S. E., Matuschewski, K., Liakopoulos, D., Scheffner, M., and Jentsch, S. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 560-564[Abstract/Free Full Text]
  9. Desterro, J. M., Rodriguez, M. S., Kemp, G. D., and Hay, R. T. (1999) J. Biol. Chem. 274, 10618-10624[Abstract/Free Full Text]
  10. Johnson, E. S., and Gupta, A. A. (2001) Cell 106, 735-744[CrossRef][Medline] [Order article via Infotrieve]
  11. Sachdev, S., Bruhn, L., Sieber, H., Pichler, A., Melchior, F., and Grosschedl, R. (2001) Genes Dev. 15, 3088-3103[Abstract/Free Full Text]
  12. Kahyo, T., Nishida, T., and Yasuda, H. (2001) Mol. Cell 8, 713-718[CrossRef][Medline] [Order article via Infotrieve]
  13. Kirsh, O., Seeler, J. S., Pichler, A., Gast, A., Muller, S., Miska, E., Mathieu, M., Harel-Bellan, A., Kouzarides, T., Melchior, F., and Dejean, A. (2002) EMBO J. 21, 2682-2691[CrossRef][Medline] [Order article via Infotrieve]
  14. Pichler, A., Gast, A., Seeler, J. S., Dejean, A., and Melchior, F. (2002) Cell 108, 109-120[CrossRef][Medline] [Order article via Infotrieve]
  15. Li, S. J., and Hochstrasser, M. (1999) Nature 398, 246-251[CrossRef][Medline] [Order article via Infotrieve]
  16. Li, S. J., and Hochstrasser, M. (2000) Mol. Cell Biol. 20, 2367-2377[Abstract/Free Full Text]
  17. Suzuki, T., Ichiyama, A., Saitoh, H., Kawakami, T., Omata, M., Chung, C. H., Kimura, M., Shimbara, N., and Tanaka, K. (1999) J. Biol. Chem. 274, 31131-31134[Abstract/Free Full Text]
  18. Gong, L., Millas, S., Maul, G. G., and Yeh, E. T. (2000) J. Biol. Chem. 275, 3355-3359[Abstract/Free Full Text]
  19. Kim, K. I., Baek, S. H., Jeon, Y. J., Nishimori, S., Suzuki, T., Uchida, S., Shimbara, N., Saitoh, H., Tanaka, K., and Chung, C. H. (2000) J. Biol. Chem. 275, 14102-14106[Abstract/Free Full Text]
  20. Kadoya, T., Yamamoto, H., Suzuki, T., Yukita, A., Fukui, A., Michiue, T., Asahara, T., Tanaka, K., Asashima, M., and Kikuchi, A. (2002) Mol. Cell Biol. 22, 3803-3819[Abstract/Free Full Text]
  21. Best, J. L., Ganiatsas, S., Agarwal, S., Changou, A., Salomoni, P., Shirihai, O., Meluh, P. B., Pandolfi, P. P., and Zon, L. I. (2002) Mol. Cell 10, 843-855[CrossRef][Medline] [Order article via Infotrieve]
  22. Zhang, H., Saitoh, H., and Matunis, M. J. (2002) Mol. Cell Biol. 22, 6498-6508[Abstract/Free Full Text]
  23. Yeh, E. T., Gong, L., and Kamitani, T. (2000) Gene (Amst.) 248, 1-14[CrossRef][Medline] [Order article via Infotrieve]
  24. Bailey, D., and O'Hare, P. (2002) J. Gen. Virol. 83, 2951-2964[Abstract/Free Full Text]
  25. O'Rourke, D., Elliott, G., Papworth, M., Everett, R., and O'Hare, P. (1998) J. Gen. Virol. 79, 537-548[Abstract]
  26. Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1998) DNA Res. 5, 277-286[Abstract]
  27. Batchelor, A. H., and O'Hare, P. (1992) J. Virol. 66, 3573-3582[Abstract/Free Full Text]
  28. Cokol, M., Nair, R., and Rost, B. (2000) EMBO Rep. 1, 411-415[CrossRef][Medline] [Order article via Infotrieve]
  29. Frangioni, J. V., and Neel, B. G. (1993) J. Cell Sci. 105, 481-488[Abstract]
  30. Schwienhorst, I., Johnson, E. S., and Dohmen, R. J. (2000) Mol. Gen. Genet. 263, 771-786[CrossRef][Medline] [Order article via Infotrieve]
  31. Taylor, D. L., Ho, J. C., Oliver, A., and Watts, F. Z. (2002) J. Cell Sci. 115, 1113-1122[Abstract/Free Full Text]
  32. Verger, A., Perdomo, J., and Crossley, M. (2003) EMBO Rep. 4, 137-142[CrossRef][Medline] [Order article via Infotrieve]
  33. Stade, K., Vogel, F., Schwienhorst, I., Meusser, B., Volkwein, C., Nentwig, B., Dohmen, R. J., and Sommer, T. (2002) J. Biol. Chem. 277, 49554-49561[Abstract/Free Full Text]
  34. Hang, J., and Dasso, M. (2002) J. Biol. Chem. 277, 19961-19966[Abstract/Free Full Text]
  35. Li, M., Chen, D., Shiloh, A., Luo, J., Nikolaev, A. Y., Qin, J., and Gu, W. (2002) Nature 416, 648-653[CrossRef][Medline] [Order article via Infotrieve]
  36. Sampson, D. A., Wang, M., and Matunis, M. J. (2001) J. Biol. Chem. 276, 21664-21669[Abstract/Free Full Text]
  37. Rodriguez, M. S., Dargemont, C., and Hay, R. T. (2001) J. Biol. Chem. 276, 12654-12659[Abstract/Free Full Text]
  38. Tatham, M. H., Jaffray, E., Vaughan, O. A., Desterro, J. M., Botting, C. H., Naismith, J. H., and Hay, R. T. (2001) J. Biol. Chem. 276, 35368-35374[Abstract/Free Full Text]
  39. Maul, G. G., and Everett, R. D. (1994) J. Gen. Virol. 75, 1223-1233[Abstract/Free Full Text]
  40. Kamitani, T., Nguyen, H. P., Kito, K., Fukuda-Kamitani, T., and Yeh, E. T. (1998) J. Biol. Chem. 273, 3117-3120[Abstract/Free Full Text]
  41. Wu, X., Li, H., Park, E. J., and Chen, J. D. (2001) J. Biol. Chem. 276, 24177-24185[Abstract/Free Full Text]
  42. Kamitani, T., Kito, K., Nguyen, H. P., Wada, H., Fukuda-Kamitani, T., and Yeh, E. T. (1998) J. Biol. Chem. 273, 26675-26682[Abstract/Free Full Text]
  43. Matunis, M. J. (2002) Mol. Cell 10, 441-442[CrossRef][Medline] [Order article via Infotrieve]
  44. Hochstrasser, M. (2001) Cell 107, 5-8[CrossRef][Medline] [Order article via Infotrieve]
  45. Li, S. J., and Hochstrasser, M. (2003) J. Cell Biol. 160, 1069-1081[Abstract/Free Full Text]
  46. Nishida, T., Tanaka, H., and Yasuda, H. (2000) Eur. J. Biochem. 267, 6423-6427[Medline] [Order article via Infotrieve]
  47. Hoege, C., Pfander, B., Moldovan, G. L., Pyrowolakis, G., and Jentsch, S. (2002) Nature 419, 135-141[CrossRef][Medline] [Order article via Infotrieve]
  48. Mossessova, E., and Lima, C. D. (2000) Mol. Cell 5, 865-876[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
E. T. H. Yeh
SUMOylation and De-SUMOylation: Wrestling with Life's Processes
J. Biol. Chem., March 27, 2009; 284(13): 8223 - 8227.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
S. Kaikkonen, T. Jaaskelainen, U. Karvonen, M. M. Rytinki, H. Makkonen, D. Gioeli, B. M. Paschal, and J. J. Palvimo
SUMO-Specific Protease 1 (SENP1) Reverses the Hormone-Augmented SUMOylation of Androgen Receptor and Modulates Gene Responses in Prostate Cancer Cells
Mol. Endocrinol., March 1, 2009; 23(3): 292 - 307.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. D. Lima and D. Reverter
Structure of the Human SENP7 Catalytic Domain and Poly-SUMO Deconjugation Activities for SENP6 and SENP7
J. Biol. Chem., November 14, 2008; 283(46): 32045 - 32055.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. M. Rytinki and J. J. Palvimo
SUMOylation Modulates the Transcription Repressor Function of RIP140
J. Biol. Chem., April 25, 2008; 283(17): 11586 - 11595.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. Bawa-Khalfe, J. Cheng, Z. Wang, and E. T. H. Yeh
Induction of the SUMO-specific Protease 1 Transcription by the Androgen Receptor in Prostate Cancer Cells
J. Biol. Chem., December 28, 2007; 282(52): 37341 - 37349.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Mikolajczyk, M. Drag, M. Bekes, J. T. Cao, Z. Ronai, and G. S. Salvesen
Small Ubiquitin-related Modifier (SUMO)-specific Proteases: PROFILING THE SPECIFICITIES AND ACTIVITIES OF HUMAN SENPs
J. Biol. Chem., September 7, 2007; 282(36): 26217 - 26224.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
J. Herrmann, L. O. Lerman, and A. Lerman
Ubiquitin and Ubiquitin-Like Proteins in Protein Regulation
Circ. Res., May 11, 2007; 100(9): 1276 - 1291.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. H. Mascle, D. Germain-Desprez, P. Huynh, P. Estephan, and M. Aubry
Sumoylation of the Transcriptional Intermediary Factor 1beta (TIF1beta), the Co-repressor of the KRAB Multifinger Proteins, Is Required for Its Transcriptional Activity and Is Modulated by the KRAB Domain
J. Biol. Chem., April 6, 2007; 282(14): 10190 - 10202.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
R. Zunino, A. Schauss, P. Rippstein, M. Andrade-Navarro, and H. M. McBride
The SUMO protease SENP5 is required to maintain mitochondrial morphology and function
J. Cell Sci., April 1, 2007; 120(7): 1178 - 1188.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
I. Meinecke, A. Cinski, A. Baier, M. A. Peters, B. Dankbar, A. Wille, A. Drynda, H. Mendoza, R. E. Gay, R. T. Hay, et al.
Modification of nuclear PML protein by SUMO-1 regulates Fas-induced apoptosis in rheumatoid arthritis synovial fibroblasts
PNAS, March 20, 2007; 104(12): 5073 - 5078.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. C. Jones, L. Fusi, J. H. Higham, H. Abdel-Hafiz, K. B. Horwitz, E. W.-F. Lam, and J. J. Brosens
Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone
PNAS, October 31, 2006; 103(44): 16272 - 16277.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. J. Choi, S. S. Chung, E. J. Rho, H. W. Lee, M. H. Lee, H.-S. Choi, J. H. Seol, S. H. Baek, O. S. Bang, and C. H. Chung
Negative Modulation of RXR{alpha} Transcriptional Activity by Small Ubiquitin-related Modifier (SUMO) Modification and Its Reversal by SUMO-specific Protease SUSP1
J. Biol. Chem., October 13, 2006; 281(41): 30669 - 30677.
[Abstract] [Full Text] [PDF]

Home page
 J. Gen. Virol.Home page
H. Kang, E. T. Kim, H.-R. Lee, J.-J. Park, Y. Y. Go, C. Y. Choi, and J.-H. Ahn
Inhibition of SUMO-independent PML oligomerization by the human cytomegalovirus IE1 protein.
J. Gen. Virol., August 1, 2006; 87(Pt 8): 2181 - 2190.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. Di Bacco, J. Ouyang, H.-Y. Lee, A. Catic, H. Ploegh, and G. Gill
The SUMO-Specific Protease SENP5 Is Required for Cell Division
Mol. Cell. Biol., June 15, 2006; 26(12): 4489 - 4498.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
Y. Itahana, E. T. H. Yeh, and Y. Zhang
Nucleocytoplasmic Shuttling Modulates Activity and Ubiquitination-Dependent Turnover of SUMO-Specific Protease 2
Mol. Cell. Biol., June 15, 2006; 26(12): 4675 - 4689.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
V. Hietakangas, J. Anckar, H. A. Blomster, M. Fujimoto, J. J. Palvimo, A. Nakai, and L. Sistonen
PDSM, a motif for phosphorylation-dependent SUMO modification
PNAS, January 3, 2006; 103(1): 45 - 50.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
I. M. Veltman, L. A. Vreede, J. Cheng, L. H.J. Looijenga, B. Janssen, E. F.P.M. Schoenmakers, E. T.H. Yeh, and A. G. van Kessel
Fusion of the SUMO/Sentrin-specific protease 1 gene SENP1 and the embryonic polarity-related mesoderm development gene MESDC2 in a patient with an infantile teratoma and a constitutional t(12;15)(q13;q25)
Hum. Mol. Genet., July 15, 2005; 14(14): 1955 - 1963.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
T. Yamaguchi, P. Sharma, M. Athanasiou, A. Kumar, S. Yamada, and M. R. Kuehn
Mutation of SENP1/SuPr-2 Reveals an Essential Role for Desumoylation in Mouse Development
Mol. Cell. Biol., June 15, 2005; 25(12): 5171 - 5182.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S. Chupreta, S. Holmstrom, L. Subramanian, and J. A. Iniguez-Lluhi
A Small Conserved Surface in SUMO Is the Critical Structural Determinant of Its Transcriptional Inhibitory Properties
Mol. Cell. Biol., May 15, 2005; 25(10): 4272 - 4282.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. Li, R. Zhang, D. Luo, S.-J. Park, Q. Wang, Y. Kim, and W. Min
Tumor Necrosis Factor {alpha}-induced Desumoylation and Cytoplasmic Translocation of Homeodomain-interacting Protein Kinase 1 Are Critical for Apoptosis Signal-regulating Kinase 1-JNK/p38 Activation
J. Biol. Chem., April 15, 2005; 280(15): 15061 - 15070.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/1/692    most recent
M306195200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bailey, D.
Right arrow Articles by O'Hare, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bailey, D.
Right arrow Articles by O'Hare, P.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement