Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M309758200 on December 11, 2003

J. Biol. Chem., Vol. 279, Issue 10, 8547-8557, March 5, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/10/8547    most recent
M309758200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Golden, J. W.
Right arrow Articles by Schiff, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Golden, J. W.
Right arrow Articles by Schiff, L. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cathepsin S Supports Acid-independent Infection by Some Reoviruses*

Joseph W. Golden{ddagger}§, Jessica A. Bahe{ddagger}§, William T. Lucas||**, Max L. Nibert||, and Leslie A. Schiff{ddagger}{ddagger}{ddagger}

From the {ddagger}Department of Microbiology, University of Minnesota, Minneapolis, Minnesota 55455 and the ||Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, Massachusetts 02115

Received for publication, September 3, 2003 , and in revised form, December 9, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In murine fibroblasts, efficient proteolysis of reovirus outer capsid protein {sigma}3 during cell entry by virions requires the acid-dependent lysosomal cysteine protease cathepsin L. The importance of cathepsin L for infection of other cell types is unknown. Here we report that the acid-independent lysosomal cysteine protease cathepsin S mediates outer capsid processing in macrophage-like P388D cells. P388D cells supported infection by virions of strain Lang, but not strain c43. Genetic studies revealed that this difference is determined by S4, the viral gene segment that encodes {sigma}3. c43-derived subvirion particles that lack {sigma}3 replicated normally in P388D cells, suggesting that the difference in infectivity of Lang and c43 virions is at the level of {sigma}3 processing. Infection of P388D cells with Lang virions was inhibited by the broad spectrum cysteine protease inhibitor trans-epoxysuccinyl-L-leucylamido-(4-guanidino)butane but not by NH4Cl, which raises the endocytic pH and thereby inhibits acid-dependent proteases such as cathepsins L and B. Outer capsid processing and infection of P388D cells with Lang virions were also inhibited by a cathepsin S-specific inhibitor. Furthermore, in the presence of NH4Cl, cell lines engineered to express cathepsin S supported infection by Lang, but not c43, virions. Our results thus indicate that differences in susceptibility to cathepsin S-mediated {sigma}3 processing are responsible for strain differences in reovirus infection of macrophage-like P388D cells and other cathepsin S-expressing cells. Additionally, our data suggest that the acid dependence of reovirus infections of most other cell types may reflect the low pH requirement for the activities of most other lysosomal proteases rather, than some other acid-dependent aspect of cell entry.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Mammalian orthoreoviruses (reoviruses) are nonenveloped viruses whose genomes each comprise 10 segments of dsRNA1 (1). They are prototypical members of the Reoviridae family, which also includes the pathogenic rotaviruses, coltiviruses, and orbiviruses. Although reoviruses infect humans, typically by the enteric or respiratory route, they are generally not associated with serious disease. In contrast, infections in animal models can result in severe diseases of the enteric, respiratory, and central nervous systems (2). Reovirus virions are composed of two concentric icosahedral protein capsids that surround the genome (3). The outer capsid includes 600 copies each of the proteins {sigma}3 and µ1 (4, 5). The {sigma}3 protein provides environmental stability to the virion (6), whereas the µ1 protein has been implicated in membrane penetration during cell entry (7–13). The {sigma}1 protein is a structurally minor component of the outer capsid but functions critically as the attachment protein (14, 15).

Reovirus infection of target cells in culture begins with attachment of {sigma}1 to one or more cellular receptors (14–18). Receptor-bound virions are then internalized, in at least some cases by clathrin-mediated endocytosis2 (17, 19–21). Within the endocytic pathway, the outer capsid undergoes partial proteolytic degradation, which converts the virion into a distinct particle form, the intermediate subvirion particle (ISVP) (19, 21–23). ISVPs are characterized by loss of the {sigma}3 protein and exposure of the underlying µ1 protein (5, 24–26). The µ1 protein is also cleaved in this conversion, but at least one of these cleavages, at the junction between fragments {delta} and {phi}, may not be required for infection (27, 28). Proteolytic removal of {sigma}3 is thought to allow µ1 the conformational mobility it needs to perform its roles in membrane penetration, transcriptase activation, and entry into the cytoplasm. The removal of {sigma}3 is an essential step in the reovirus life cycle (21, 29–31).

During natural infections by the enteric route, ISVPs are generated extracellularly in the lumen of the small intestine by pancreatic serine proteases such as trypsin and chymotrypsin (32, 33). This process appears critical for the capacity of viral particles to adhere to the apical surfaces of intestinal M cells (34, 35). ISVPs are subsequently moved to the M cell basolateral surfaces by transcytosis and deposited into the underlying Peyer's patches, from which they gain access to the lymphatics and bloodstream of the host (36–38). When reovirus infects target tissues outside the intestinal tract, uncoating is thought to occur within endosomal or lysosomal compartments after endocytosis of virions (19, 21–23, 39).

The cellular requirements for conversion of virions to ISVPs during cell entry have been best characterized in murine fibroblasts. In these cells, the conversion requires cysteine protease activity as well as low pH3 (21, 29, 40). It is not yet clear whether low pH is required only to activate an essential acid-dependent protease, or whether it is also required for some other aspect of cell entry by reovirus, such as an essential conformational change in {sigma}3 or {sigma}1 (21, 29, 41–43). Recently, the acid-dependent lysosomal cysteine protease Cat L has been shown to be necessary for efficient processing of the outer capsid in murine fibroblasts3 (40, 43). A role has also been suggested for Cat B3 (43). It is not known whether Cats L and/or B mediate outer capsid processing in all permissive cells or whether other proteases may be involved. Although a wide variety of proteases have been shown to mediate outer capsid processing in vitro (11, 25, 30, 32, 44, 45), data suggest that a degree of specificity exists as to the proteases that can mediate these cleavages in cells. For example, aspartic proteases such as Cat D appear to be negligibly involved in removing {sigma}3 from the virions of wild-type reovirus strains in L929 and Madin-Darby canine kidney cells (39).

We began to investigate reovirus infection in a macrophage-like cell line, P388D, because during natural infections by the enteric route, primary replication of some reoviruses is thought to occur in mononuclear cells within Peyer's patches (46). Macrophages may also represent important early targets during natural infections by the respiratory route (47). In this study, we demonstrated that {sigma}3 processing in P388D cells is mediated by Cat S. Cat S is a lysosomal cysteine protease that shares closest amino acid homology with Cats L and K (48). It is expressed predominantly in antigen-presenting cells, including B cells, dendritic cells, and macrophages (49–51). Unusual for a lysosomal cysteine protease, Cat S maintains substantial activity at neutral and mildly alkaline pH (52). Several physiological roles have been ascribed to Cat S. Recent studies indicate that it is essential for peptide loading onto major MHC class II molecules, in that it mediates proteolytic removal of invariant chain from the immature MHC assembly (53). Additionally, Cat S may play a role in the generation of antigenic peptides for display by MHC class II molecules (54). Other investigations have suggested that it functions in angiogenesis and remodeling of extracellular matrices (55, 56). Aberrant Cat S expression has been observed in some diseased tissues including those from Alzheimer's and Creutzfeldt-Jakob disease patients (57–60).

Other new results in this study demonstrated that reovirus virions that can productively infect Cat S-expressing cells, such as those of strain Lang, and can do so equally well in the absence or presence of agents that raise endocytic pH. These findings suggest that the acid dependence of reovirus infections in most other cell types may reflect the low pH requirement for the activities of most other lysosomal proteases, rather than some other acid-dependent feature of cell entry. Our results also demonstrate that virions of some reovirus strains, exemplified by c43, do not infect P388D cells efficiently because their {sigma}3 proteins are poorly susceptible to Cat S-mediated cleavage. Thus, our findings indicate that lysosomal proteases can represent important cell type-specific host factors for reovirus infection and support the hypothesis that lysosomal protease expression is a determinant of reovirus tropism and pathogenesis in infected hosts.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cells and Viruses—Murine L929 cells were maintained as suspension cultures as described previously (61). P388D cells were maintained in RPMI medium (Invitrogen) supplemented to contain 15% fetal calf serum (Invitrogen) and 4.5 g/liter glucose as well as 1 mM sodium pyruvate, 2 mM glutamine, 50 units/ml penicillin, and 50 µg/ml streptomycin (Invitrogen). Raw 264.7 cells were maintained as monolayer cultures in RPMI medium supplemented to contain 10% fetal calf serum, 2 mM glutamine, 50 units/ml penicillin, and 50 µg/ml streptomycin. Immortalized MEFs lacking the Cat L gene (MEF9.C2 Cat L–/–) and the same cells expressing either Cat L or Cat S (MEF:CatL or MEF:CatS, respectively), were a gift from Dr. Alexander Rudensky (54) and were maintained as monolayer cultures in RPMI medium supplemented to contain 10% fetal calf serum, 1 mM sodium pyruvate, 2 mM glutamine, 50 units/ml penicillin, and 50 µg/ml streptomycin. NIH3T3 and 293 cells were maintained in Dulbecco's minimal essential medium (Invitrogen) supplemented to contain 10% fetal calf serum, 2 mM glutamine, 50 units/ml penicillin, and 50 µg/ml streptomycin. 293 cells stably expressing Cat S (293:CatS) were a gift from Dr. Bernd Wiederanders (62) and were maintained in the same manner as the parental 293 cells except that 500 µg/ml G418 (Calbiochem) was included in the medium.

Reoviruses serotype 1 Lang, serotype 3 Dearing, and serotype 3 clone 87 (c87) (also called Abney) are prototypical laboratory strains. Reoviruses serotype 3 c43, serotype 3 clone 100 (c100), and serotype 3 clone 31 (c31) were originally isolated by Rosen et al. (63, 64) and have been utilized in a number of previous studies (61, 65). Third passage cell lysate stocks of reovirus were prepared in L929 cells. Purified virions were prepared by CsCl density gradient centrifugation of extracts from cells infected with third passage stocks (66). Purified virions containing 35S-labeled proteins were prepared by adding 5 mCi of [35S]methionine/cysteine in the form of EasyTag express protein labeling mix (PerkinElmer Life Sciences) to cell suspensions (2 x 108 cells at 5 x 105 cells/ml) at 17 h postinfection ISVPs were prepared by treating purified virions with chymotrypsin as described elsewhere (11).

Analysis of Viral Growth—Cells were infected at the indicated multiplicities of infection, and adsorption was allowed to proceed for 1 h on ice at 4 °C. A multiplicity of 0.1 pfu/cell was used for growth curve experiments because we found that it maximized the strain-dependent replication differences in P388D cells. After adsorption, cells were concentrated by low speed centrifugation and resuspended in fresh medium. Virus and cells were then added to 3-dram vials (2 x 105 cells/vial) containing 1 ml of cold medium. Triplicate samples were prepared for each time point. One set of samples (time zero) was frozen immediately at –20 °C. The remaining samples were placed in a humidified 37 °C CO2 incubator until the desired time point was reached. Harvested samples were subjected to three cycles of freezing and thawing and titrated by plaque assay on L929 cells as described elsewhere (67). Viral yields were calculated according to the following equation.

(Eq. 1)
Some cells were treated with 300 µM E-64 (Sigma), 100 nM bafilomycin A1 (Sigma), 5 µM CA-074 (Calbiochem), or 20 mM NH4Cl with or without 10 nM LHVS, an irreversible inhibitor specific for Cat S (53, 68, 69). LHVS was a generous gift from Dr. Hidde Ploegh (Harvard Medical School). Cells were treated with inhibitors for 3 h before and then throughout the infection.

Generation of Viral Reassortants—Reassortant viruses were generated by coinfecting L929 cells with strains Lang and c43 over a range of relative multiplicities. Plaques were amplified on L929 cells, and genotypes of the first passage stocks were determined by using a combination of methods. The parental origins of 8 of the 10 dsRNA segments were determined easily by characterizing electrophoretic mobility of dsRNA on 10% SDS-polyacrylamide gels as described previously (70, 71). The parental origins of the remaining two segments, L1 and M3, were determined by using restriction fragment length polymorphisms. Viral RNA was isolated from infected cells by phenol/chloroform extraction. Recovered RNA served as a template for cDNA synthesis by reverse transcription-PCR. Primers corresponding to the first 15 plus strand nucleotides of the L1 segment (GCTACACGTTCCACG) (72) or the first 21 nucleotides of the M3 segment (GCTAAAGTCACCGTGGTCATG) (73) were used in the reverse transcription reaction. The products of this reaction were amplified by PCR using the following primer sets. For the L1 segments, we used ATGTCATCCATGATACTG, corresponding to plus strand nucleotides 19–36, and TGGTGACATTAACC, complementary to plus strand nucleotides 665–677. For the M3 segments, we used CGTTCACAATCCTTCACT, corresponding to plus strand nucleotides 109–126, and TTACAACTCATCAGTTGG, complementary to plus strand nucleotides 2161–2178. The products of these reactions were phenol/chloroform extracted, precipitated in ethanol, and digested with DdeI. These digestions produced unique patterns of restriction fragments for Lang and c43 L1 and M3 cDNAs, which could be resolved on 1% agarose TAE (40 mM Tris, 0.1% acetic acid, 1 mM EDTA) gels.

Analysis of Intracellular Proteolysis of Reovirus Virions—Prior to infection, some cells were pretreated overnight with 5 nM LHVS. 1 x 106 cells/sample were incubated with [35S]methionine/cysteine-labeled Lang virions (5 x 105 cpm/sample) or c43 virions (1 x 106 cpm/sample) in 0.5 ml of culture medium for 1 h at 4 °C. After adsorption, cells were washed twice with ice-cold phosphate-buffered saline to remove unbound virions, plated in 35-mm culture dishes, and covered with fresh medium containing 5% fetal calf serum. For samples pretreated with LHVS, the inhibitor was included in the fresh culture medium. Time zero samples were collected immediately, and remaining samples were transferred to a humidified 37 °CCO2 incubator. At the indicated times postinfection, cells were removed from culture dishes and concentrated by low speed centrifugation for 10 min. Cell pellets were resuspended in immunoprecipitation buffer (10 mM Tris (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40) and incubated for 10 min on ice. Lysates were centrifuged at 716 x g to pellet nuclei. Proteins were precipitated from the supernatants using acetone (21), collected by centrifugation at 12,000 x g for 10 min, solubilized in protein sample buffer (0.125 M Tris (pH 8.0), 1% SDS, 0.01% bromphenol blue, 10% sucrose, and 5% {beta}-mercaptoethanol), and resolved on 5–20% SDS-polyacrylamide gradient gels. Gels were fixed, treated with Amplify (Amersham Biosciences), dried under vacuum, and placed on PhosphorImager screens. Radiolabeled viral protein bands were analyzed using a Storm 840 PhosphorImager and quantified using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). Relative PhosphorImager signal intensities were determined for bands corresponding to the {sigma}3, {sigma}2, and {lambda} proteins. The {sigma}2 and {lambda} core proteins are not degraded during the in vivo conversion of virions to ISVPs (19, 21–23). To determine the relative amount of {sigma}3 cleavage at various times postinfection, we calculated either the {sigma}3:{sigma}2 ratio or the {sigma}3:{lambda} ratio, as indicated.

Analysis of Cat L and S Expression—Cells were collected by centrifugation and lysed in Tris lysis buffer (10 mM Tris (pH 7.5), 100 mM NaCl, 2.5 mM MgCl2, 0.5% Triton X-100, 5 µg/ml leupeptin (Sigma), 1 mM phenylmethylsulfonyl fluoride). After 30 min on ice, samples were pelleted by centrifugation at 90 x g for 10 min to remove cellular debris. Cell lysates were normalized for protein content using the DC protein assay kit (Bio-Rad) and solubilized in protein sample buffer. Proteins were resolved by electrophoresis on 15% SDS-polyacrylamide gels and then transferred to nitrocellulose membranes (Bio-Rad) by electroblotting for 1.5 h at 100 V in transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol). Nitrocellulose membranes were blocked overnight in TBS (10 mM Tris (pH 8.0), 150 mM NaCl, 0.05% Tween 20) containing 10% nonfat dry milk and were washed with TBS prior to incubation with primary antibody. To detect Cat L, membranes were incubated subsequently with antiserum raised against murine Cat L (1:1,000 in TBS containing 5% nonfat dry milk) (74). Cat S was detected using Cat S-specific polyclonal antiserum (1:5,000 in TBS containing 5% nonfat dry milk) (Santa Cruz Biotechnology, Santa Cruz, CA). After incubation with either primary antibody, membranes were washed with TBS and incubated with horseradish peroxidase-conjugated anti-rabbit IgG (Cat L) (Amersham Biosciences) (1:7,500 in TBS) or anti-goat IgG (Cat S) (Santa Cruz Biotechnology) (1:5,000 in TBS). Bound antibodies were detected by treating the membranes with ECL detection reagents (Amersham Biosciences) and exposing them to Full Speed Blue x-ray film (Henry Schein, Melville, NY).

Measurement of Cat B Activity—Cat B activity was assessed as described previously with minor modifications (43). Briefly, P388D and L929 cells (2 x 106 each) were incubated for either 3 or 12 h in the presence or absence of 300 µM E-64, 5 nM LHVS, or 5 µM CA-074. After incubation, cells were trypsinized and collected by centrifugation at 179 x g for 10 min at 4 °C. Cells were resuspended in phosphate-buffered saline, transferred to 1.5-ml Eppendorf tubes, and centrifuged at 89 x g for 10 min at 4 °C. Cell pellets were resuspended in 100 µl of lysis buffer (100 mM sodium acetate (pH 5.5), 1 mM EDTA, and 0.5% Triton X-100), incubated on ice for 30 min, and cell debris was pelleted by centrifugation at 89 x g for 10 min at 4 °C. For each sample, 20 µl of clarified cell lysate was added to 80 µl of reaction buffer (100 mM sodium acetate (pH 5.5), 1 mM EDTA, 4 mM dithiothreitol, and 100 µM Z-Arg-Arg-7-amido-4-methylcoumarin (Z-Arg-Arg-MCA) (Calbiochem) in a well of a black 96-well plate. Reactions were incubated for 30 min at room temperature with gentle tapping every 10 min. Fluorescence was measured using an FL600 microplate reader (Bio-Tek Instruments, Inc., Winooski, VT) with an excitation of 390 nm and emission at 460 nm. Each sample was measured in triplicate.

In Vitro Analysis of Cat S-mediated Uncoating—Cat S digestions were performed as follows. Purified virions (2.5 x 1012/ml) were incubated with 100 µg/ml purified Cat S (Calbiochem) in digestion buffer (50 mM sodium acetate (pH 6.0), 100 mM NaCl, 15 mM MgCl2) at 37 °C for the indicated times. Mock-treated samples were incubated for 22 h in digestion buffer. Reactions were terminated by adding E-64 to a concentration of 500 µM. Protein sample buffer was added to each reaction mixture, and aliquots were analyzed on 15% SDS-polyacrylamide gels. Protein bands were visualized by staining gels with Coomassie Brilliant Blue R-250 (Invitrogen).

Analysis of Viral Protein Expression in Infected Cells—293 or 293: CatS cells were infected at 10 pfu/cell. Virus was allowed to adsorb to cells for 1.5 h at 4 °C. After adsorption, the cultures were incubated at 37 °C in fresh medium. Prior to some infections, cells were pretreated for 3 h with 100 nM bafilomycin A1, 25 µM monensin (Sigma), or 20 mM NH4Cl with or without 10 nM LHVS. In those instances inhibitors were also included in the postadsorption culture medium. At the indicated times postinfection, cells were collected by centrifugation and lysed in Tris lysis buffer as described above. After centrifugation to remove cellular debris, samples were resuspended in protein sample buffer. Protein samples (representing 1 x 105 cells) were resolved by electrophoresis on 12% SDS-polyacrylamide gels and analyzed by immunoblotting as described above using rabbit anti-µNS polyclonal antiserum (75) (1:12,500 in TBS) as the primary antibody.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Analysis of Reovirus Growth in a Macrophage-like Cell Line—We infected P388D cells with reovirus serotype 1 strain Lang and a panel of reovirus serotype 3 strains (Dearing, c31, c43, c87, and c100) and measured viral growth at 2 and 5 days postinfection. The results of a typical experiment (Fig. 1) revealed that these strains vary in their capacities to replicate in P388D cells. Infection with Lang, Dearing, c31, or c87 yielded between one and two logs of growth at 5 days postinfection. In contrast, there was little growth by 5 days postinfection with c43 or c100.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 1.
Analysis of reovirus growth in P388D cells. P388D cells were infected with the indicated reovirus strains at a multiplicity of 0.1 pfu/cell, and infectious virus present at 0, 2, or 5 days postinfection (p.i.) was measured by plaque assay. Each time point represents the mean ± S.D. derived from three independent samples.

 
To determine the genetic basis of one of these strain differences in viral growth, we generated a panel of reassortant viruses using Lang and c43 and ranked them according to their capacities to replicate in P388D cells (Table I). Statistical analysis demonstrated a significant association between the level of replication in these cells and the parental origin of the S4 gene segment (Wilcoxon-Mann-Whitney test, p = 0.002) (76–78). No other gene segment was significantly associated with the phenotype (p > 0.1). Notably, the panel includes a "monoreassortant" virus, WL43, that contains nine segments from c43 and only the S4 segment from Lang. After infection of P388D cells, this isolate reached yields nearly as high as those reached by Lang and almost two logs higher than those reached by c43. These results clearly demonstrate that the major determinant of the Lang/c43 strain difference in growth in P388D cells is the S4 gene segment.


View this table:
[in this window]
[in a new window]
  		TABLE I
Replication of Lang x c43 reassortant viruses in P388D cells

 
How Does S4 Affect Reovirus Growth in P388D Cells?—The S4 translation product, {sigma}3, functions at several stages in the reovirus life cycle. As a capsid protein, it influences environmental stability, entry into cells, and virion assembly (6, 21, 29, 79–81). It also has the capacity to bind dsRNA and prevent activation of interferon-induced dsRNA-activated antiviral enzymes, including protein kinase R (82–84). To understand the mechanism by which {sigma}3 influences viral replication in macrophage-like cells, we first asked whether removal of virion {sigma}3 enabled c43 particles to infect P388D cells. We infected P388D cells with virions or ISVPs of strain Lang or c43 and measured viral growth at 1, 3, and 5 days postinfection. The results of a representative experiment (Fig. 2) revealed that ISVPs of each strain replicated efficiently in P388D cells. At 5 days postinfection, c43 ISVPs reached yields similar to those reached by Lang virions or ISVPs. Control infections demonstrated that virions and ISVPs of the two strains are similarly infectious in L929 cells (Fig. 2). These findings suggested that the S4-determined Lang/c43 strain difference in infectivity in P388D cells is related to {sigma}3 cleavage during virion uncoating and that P388D and L929 cells exhibit differences at this step in infection.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 2.
Reovirus growth in P388D or L929 cells infected with Lang or c43 virions or ISVPs. P338D or L929 cells (as labeled) were infected at a multiplicity of 0.1 pfu/cell with virions (solid lines) or ISVPs (broken lines) of reovirus strain Lang (black squares) or c43 (white circles). Infectious virus present at 0, 1, 3, or 5 days postinfection (p.i.) was measured and displayed as described for Fig. 1.

 
Strain Difference in {sigma}3 Cleavage in P388D Cells—We examined {sigma}3 cleavage directly by infecting P388D or L929 cells with [35S]methionine/cysteine-labeled Lang or c43 virions and preparing cell lysates at various times postinfection. Samples were subjected to SDS-PAGE, and levels of virion-derived {sigma}3 were quantified by PhosphorImager analysis. Results of a typical experiment are shown in Fig. 3. When P388D cells were infected with radiolabeled Lang virions, {sigma}3 processing was detected as early as 3 h postinfection, and only 39% of virion {sigma}3 remained intact at 8 h postinfection. In contrast, radiolabeled c43 virions were not uncoated efficiently in P388D cells; at 8 h postinfection, 83% of virion {sigma}3 remained intact. To ensure that the preparation of radiolabeled c43 virions was competent for uncoating, we used it to infect L929 cells. As expected, based on the capacity of L929 cells to support viral growth by either c43 or Lang (see Fig. 2), the {sigma}3 proteins of both c43 and Lang virions were cleaved efficiently by 8 h postinfection (although the kinetics of c43 cleavage appeared to be somewhat slower in this experiment). These results support the hypothesis that the infectivity of different reovirus strains can be influenced by the capacity of a particular cell type to mediate {sigma}3 cleavage during cell entry.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 3.
Examination of Lang and c43 virion uncoating in P388D or L929 cells. P388D cells or L929 cells were infected with purified [35S]methionine/cysteine-labeled Lang or c43 virions (as labeled). At the indicated times (in h) postinfection, samples were prepared for gel electrophoresis and PhosphorImager analysis. Positions of capsid proteins are labeled. Virion uncoating is characterized by reduced intensities of the {sigma}3, µ1, and µ1C bands and increased intensities of the respective µ1 and µ1C cleavage fragments, µ1{delta} and {delta}. Amounts of {sigma}3 and {sigma}2 within each set of samples were determined by PhosphorImager analysis. The {sigma}3:{sigma}2 ratio at time zero was considered 100%. The relative ratios at other time points are indicated as the percent {sigma}3 remaining.

 
Reovirus Replication in P388D Cells Is Facilitated by One or ore Cysteine Proteases That Are Not Acid-dependent—P388D cells do not express mRNA for Cat L (74), the acid-dependent cysteine protease that is required for efficient {sigma}3 processing during uncoating of reovirus virions in murine fibroblasts3 (40, 43). Fig. 4A demonstrates that, unlike L929 cells or another macrophage-like cell line, Raw 264.7, our stock of P388D cells indeed does not express detectable Cat L protein. Despite the absence of Cat L, P388D cells were still capable of facilitating removal of {sigma}3 from Lang virions (see Fig. 3) and being productively infected by Lang, Dearing, c31, or c87 virions (see Figs. 1 and 2). Reovirus infection of P388D cells must therefore involve one or more proteases that can function in the absence of detectable Cat L. These cells have been shown to express Cat B (85), another acid-dependent cysteine protease that has been shown to participate in reovirus uncoating in some cells3 (43).



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 4.
Characterization of protease(s) involved in Lang virion infection of P388D cells. A, cell lysates were normalized for protein content and then analyzed for Cat L by gel electrophoresis and immunoblotting. Cat L can be present in three forms. The 38-kDa proenzyme (Pro) is either secreted from cells or transported to endosomal or lysosomal compartments where it is cleaved into a transient 30-kDa intermediate (Int) form. The intermediate is processed further into a mature Cat L 23-kDa heavy chain (HC) and 5-kDa light chain (not resolved on this gel). B, P388D or L929 cells (as labeled) were pretreated with E-64, NH4Cl, or no inhibitors and then infected at a multiplicity of 3 pfu/cell with strain Lang under the same respective conditions. Inhibitors were included in the medium throughout the infection. Infectious virus present at 3 (gray) or 5 (black) days postinfection was measured and displayed as described for Fig. 1. C, lysates of the indicated cells were normalized for protein content and then analyzed for Cat S by gel electrophoresis and immunoblotting.

 
We assessed the role of Cat B in reovirus infection of P388D cells by measuring viral yield in cells that were pretreated with a Cat B-specific inhibitor, CA-074 (86, 87). We chose to use CA-074 rather than its methyl ester derivative, CA-074Me, because, although the latter is more cell-permeable, recent studies indicate that it is less specific for Cat B (88). P388D and L929 cells were treated with 5 µM CA-074 or 300 µM E-64, and viral growth was assessed at 2 days postinfection (L929) or 3 days postinfection (P388D). As shown in Table II, treatment of cells with CA-074 did not decrease viral yield in either P388D or L929 cells, although it severely reduced protease activity as measured by cleavage of the Cat B-specific fluorogenic substrate Z-Arg-Arg-MCA (89). Treatment of either cell type with E-64, a broad spectrum inhibitor of papain-like cysteine proteases, completely inhibited reovirus infection.


View this table:
[in this window]
[in a new window]
  		TABLE II
Infection of L929 and P388D cells in the presence of E-64 or CA-074

L929 and P388D cells were infected at a multiplicity of 3, and viral yield was determined at 2 or 3 days postinfection, respectively.

 
To characterize further the protease(s) required for infection of P388D cells, we infected cells with Lang virions in the presence of E-64 or NH4Cl, an agent known to raise the pH of acidic compartments. Viral growth was analyzed at 3 and 5 days postinfection. L929 cells were tested as controls because in these cells both E-64 and NH4Cl have been shown to block {sigma}3 processing and reovirus infection, consistent with the importance of Cats L and/or B in those cells3 (21, 29, 40, 43). Results of a representative experiment are shown in Fig. 4B. In the absence of inhibitors, Lang productively infected P388D cells, and this growth was largely inhibited by the addition of E-64. Interestingly, however, addition of NH4Cl had little if any effect on Lang growth in P388D cells. In contrast and as expected, both E-64 and NH4Cl abolished viral replication in L929 cells.

These results suggested the involvement of an acid-independent cysteine protease in reovirus infection of P388D cells. Whereas Cats L and B are acid-dependent, with pH optima of 4.5–6.0 and 5.0–6.5, respectively (90), Cat S is a lysosomal cysteine protease known to retain its activity to higher pH values (pH 5.0–7.5) (90–92). Expression of Cat S is largely restricted to antigen-presenting cells, including B cells, dendritic cells, and macrophages (49–51). To determine whether P388D cells express Cat S, we generated cell lysates and probed immunoblots with a Cat S-specific polyclonal anti-serum. We included as controls Raw 264.7 cells, which are known to express Cat S (93), and 3T3 cells, which do not (94). As shown in Fig. 4C, we detected Cat S in both macrophage-like cell lines, P388D and Raw 264.7, but not in L929 or 3T3 fibroblasts.

Role of Cat S in Reovirus Uncoating—We next asked whether Cat S plays a role in {sigma}3 cleavage during reovirus infection of P388D cells. To do this, we monitored the uncoating of [35S]methionine/cysteine-labeled Lang virions in cells infected in the presence or absence of the inhibitor LHVS (Fig. 5A). At a concentration of 5 nM, LHVS is more specific for Cat S than other lysosomal cysteine proteases, and it has been used to investigate the function of Cat S in antigen-presenting cells (53, 68, 95). As expected, {sigma}3 was cleaved efficiently from Lang virions in untreated P388D cells: in this experiment only 17% of {sigma}3 remained intact at 8 h postinfection. In contrast, addition of 5 nM LHVS abolished {sigma}3 cleavage, consistent with a role for Cat S in this process. LHVS had no effect on {sigma}3 cleavage in L929 cells.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 5.
Role of Cat S in virion uncoating. A, P388D cells (top) or L929 cells (bottom) were pretreated for 12 h with 5 nM LHVS and then infected with purified [35S]methionine/cysteine-labeled Lang virions. LHVS was included in the medium throughout the infection. At the indicated times (in h) postinfection, samples were processed, and results are displayed as described for Fig. 3 except that the percent {sigma}3 remaining was determined using values for the {lambda} core proteins as internal loading standards. Uncoating in untreated L929 cells is shown in Fig. 3. B, purified Lang or c43 virions (as labeled) were incubated with purified Cat S for the indicated times (in h), and the reactions were then terminated. Aliquots of each sample (representing 5 x 1010 particles) were analyzed by gel electrophoresis and Coomassie staining. The mock sample (M) consisted of virions held in Cat S reaction buffer in the absence of protease for 22 h. Purified virions (V) were also included on the gel. Positions of capsid proteins are indicated. C, purified Lang or c43 virions (as labeled) were incubated with chymotrypsin (CHT) for the indicated times (in min), and the reactions were then terminated. Samples were analyzed and displayed as described for B.

 
At higher concentrations LHVS can inhibit Cat B activity (68). Because we were concerned that the same might be true after longer incubation times, we assessed Cat B activity in treated cells as a measure of LHVS specificity under our experimental conditions. P388D and L929 cells were treated with 5 nM LHVS for 12 h, and Cat B activity was then measured using the Cat B-specific fluorogenic substrate Z-Arg-Arg-MCA. As shown in Table III, after a 12-h incubation, LHVS treatment led to only modest inhibition (~10%) of Cat B activity in P388D cells. This result is consistent with a published report that prolonged incubation of dendritic cells with 5 nM LHVS resulted in only a modest inhibition of Cat B activity but complete inhibition of Cat S activity (96). Because 12-h treatment with 5 nM LHVS completely inhibited viral uncoating, our results are most consistent with a role for Cat S in reovirus uncoating in P388D cells.


View this table:
[in this window]
[in a new window]
  		TABLE III
Cathepsin B activity in L929 and P388D cells treated with E-64 or LHVS

Activity was measured using Z-Arg-Arg-MCA and calculated relative to untreated samples.

 
Cathepsins, like many other proteases, are expressed as proenzymes, and the pro region must be proteolytically removed before the enzyme is active (97). Removal of pro regions is facilitated either by an autoproteolytic event or by the action of other proteases such as pepsin, cathepsin D, or elastase. Thus, we entertained two different hypotheses for the role of Cat S in reovirus infection of P388D cells. In the first hypothesis, Cat S would function directly to convert incoming virions to ISVPs, in which case (based on preceding results) it should be more efficient at in vitro uncoating of Lang than of c43 virions. In the second hypothesis, Cat S would function indirectly in P388D cells to mediate removal of {sigma}3 from Lang virions by activating one or more other proteases required for disassembly, in which case Lang and c43 virions might not differ in their in vitro susceptibilities to Cat S.

To investigate the two hypotheses for the role of Cat S in reovirus uncoating, we treated virions with purified Cat S in vitro and analyzed the digestion results by SDS-PAGE. Treatment with Cat S (Fig. 5B) resulted in conversion of Lang virions to ISVP-like particles. By 3 h postinfection, we could detect some proteolysis of both {sigma}3 and µ1/µ1C. After 6 h, nearly all of {sigma}3 had been cleaved, and the particles were capable of infecting E-64-treated L929 cells (data not shown), demonstrating that they were functionally similar to ISVPs. Consistent with the relative inefficiency of {sigma}3 cleavage in c43-infected P388D cells (Fig. 3), c43 virions were refractory to in vitro proteolysis by Cat S. Whereas {sigma}3 appeared to be almost completely cleaved from Lang virions after 6 h with Cat S, even after 22 h with Cat S, a substantial amount of {sigma}3 remained intact in c43 virions. As a positive control for in vitro disassembly, we treated Lang and c43 virions with chymotrypsin, which resulted in the rapid conversion of both types of virions into ISVPs (Fig. 5C). Thus, although c43 virions were refractory to uncoating by Cat S, they were as susceptible to chymotrypsin-mediated uncoating as Lang virions. These results support the hypothesis that Cat S has the capacity to convert susceptible virions to ISVPs directly.

Is Reovirus Infection Acid-independent in Other Cat S-expressing Cells?—Because the acid independence of reovirus infection in P388D cells was an unexpected finding, we addressed whether it is also acid-independent in other types of cells that express Cat S. First, we analyzed infection in 293 cells or 293 cells that have been engineered to express Cat S (293:CatS) (62) (Fig. 6A). We infected 293 cells and their Cat S-expressing derivatives with Lang or c43 virions in the presence or absence of NH4Cl or NH4Cl plus LHVS. Viral yield was assessed at 3 days postinfection. As shown in Fig. 6B, both Lang and c43 replicated in both 293 and 293:CatS cells. Viral growth in 293 cells was acid-dependent, as evidenced by the inhibitory effect of NH4Cl. Infection of the wild-type 293 cells was also inhibited by E-64 (data not shown), consistent with a role for Cat L, Cat B, or some other papain-like cysteine protease in infection of this cell type.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 6.
Analysis of reovirus infection in 293 cells and 293 cells expressing Cat S. A, lysates of the indicated cells were normalized for protein content and then analyzed for Cat S by gel electrophoresis and immunoblotting. B, 293 or 293:CatS cells were pretreated with NH4Cl, NH4Cl + LHVS, or no inhibitors and then infected with strain Lang (black) or c43 (white) at an multiplicity of 3 pfu/cell. Inhibitors were included in the medium throughout the infection. Infectious virus present at 3 days postinfection was measured and displayed as described for Fig. 1. C, 293 and 293:CatS cells were pretreated with NH4Cl, bafilomycin A1, or monensin and then infected with Lang. Inhibitors were included in the medium throughout the infection. Cell extracts prepared at 2 days postinfection were analyzed for µNS expression by gel electrophoresis and immunoblotting.

 
The phenotype in the Cat S-expressing 293 cells was distinct. As expected, based on our preceding results in P388D cells, viral replication was not acid-dependent, and the efficiency of infection depended on the infecting strain. Lang reached equivalent yields in NH4Cl-treated and untreated 293:CatS cells, whereas c43 did not efficiently replicate in these cells in the presence of NH4Cl. The addition of LHVS abrogated Lang growth in NH4Cl-treated 293:CatS cells, demonstrating the importance of Cat S for their acid-independent infection. LHVS treatment also inhibited the small amount of replication by c43 in NH4Cl-treated 293:CatS cells, suggesting that, although c43 cannot efficiently utilize Cat S for infection, the restriction is not absolute. Using expression of a viral nonstructural protein as a marker for reovirus infection, we also analyzed Lang infection in cells treated with bafilomycin A1 or monensin. These agents and NH4Cl raise intracellular vesicular pH by distinct mechanisms. Although these agents, like NH4Cl, inhibited viral protein synthesis in 293 cells, they had minimal effects on viral protein synthesis in 293:CatS cells (Fig. 6C).

We confirmed that Cat S facilitates reovirus infection in a strain-sensitive but acid-independent manner by using derivatives of a MEF cell line with homozygous deletion of the Cat L gene (MEF Cat L–/–). These cells were subsequently engineered to express either Cat L or Cat S (Fig. 7A) (54). We infected each of these three cell types with Lang or c43 virions or ISVPs and analyzed yields at 24 h postinfection (Fig. 7B). We saw no viral growth after infection of the parental Cat L-deficient MEFs with either Lang or c43 virions. Consistent with our results in 293 and 293:CatS cells, virions of both strains replicated in the Cat L-expressing MEFs, whereas only Lang virions replicated in the Cat S-expressing MEFs. ISVPs of both strains replicated efficiently in each of the three cell types. As shown in Fig 7C, neither NH4Cl nor bafilomycin A1 inhibited Lang infection of the Cat S-expressing MEFs, whereas infection in the Cat L-expressing MEFs was largely inhibited by treatment with these agents that raise vesicular pH.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 7.
Evaluation of reovirus growth in Cat L–/– cells and Cat L–/– cells expressing Cat L or Cat S. A, lysates of the indicated cells were normalized for protein content and then analyzed for Cat L and Cat S by gel electrophoresis and immunoblotting. B, the indicated cells were infected with virions or ISVPs of strains Lang (black) or c43 (white) at a multiplicity of 3 pfu/cell. Infectious virus present at 24 h postinfection was measured and displayed as described for Fig. 1. C, MEF:CatL (white) or MEF:CatS (gray) cells were pretreated with NH4Cl, bafilomycin A1, or no inhibitor and then infected with Lang virions at a multiplicity of 3 pfu/cell. Inhibitors were included in the medium throughout the infection. Infectious virus present at 24 h postinfection was measured as described for Fig. 1. Results are presented as the percentage of viral yield relative to untreated samples.

 
Can Other Reovirus Strains Infect Cat S-expressing Cells in an Acid-independent Manner?—The results of preceding experiments with strains Lang and c43 indicated that their different capacities to infect P388D cells is a consequence of their different susceptibilities to Cat S-mediated {sigma}3 processing during virion uncoating. Because the growth phenotypes of Lang and c43 in P388D cells were not unique (see Fig. 1), we asked whether those reovirus isolates that replicated efficiently in P388D cells could infect other Cat S-expressing cells in an acid-independent manner. We infected 293:CatS cells in the presence or absence of NH4Cl or NH4Cl plus LHVS and analyzed viral protein expression at 2 days postinfection. A representative experiment is shown in Fig. 8. We found that those viruses that replicated efficiently in P388D cells (Lang, Dearing, c31, and c87) showed evidence of greater acid-independent infection (as indicated by viral protein expression) in Cat S-expressing 293 cells. This infectivity was blocked by the addition of the Cat S-specific inhibitor LHVS. Conversely, there was much less evidence of replication in NH4Cl-treated 293: CatS cells that had been infected with strains that grew poorly in P388D cells (c100 and c43). These results are consistent with a model in which the capacity of Cat S to facilitate {sigma}3 cleavage during virion uncoating determines the infectivity of different reovirus isolates in P388D cells.



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 8.
Infection of 293:CatS cells by other reovirus strains. 293:CatS cells were pretreated with NH4Cl, NH4Cl + LHVS, or no inhibitors and then infected with the indicated strains. Inhibitors were included in the medium throughout the infection. Cell extracts prepared at 2 days postinfection were analyzed for µNS expression by gel electrophoresis and immunoblotting.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Cat S Plays the Predominant Role in {sigma}3 Processing in Some Cells—The cellular and viral determinants of {sigma}3 processing during cell entry by reovirus virions have been best characterized in two cell types: murine fibroblasts and Madin-Darby canine kidney cells3 (39, 40, 43). We therefore began this study by investigating {sigma}3 processing and reovirus infection in another type of cell, the macrophage-like cell line P388D. P388D cells do not express Cat L, the acid-dependent lysosomal cysteine protease that is important for efficient processing of virion-bound {sigma}3 in mouse fibroblasts3 (40, 43). We found that, despite their lack of Cat L, P388D cells mediate {sigma}3 processing and support infection by virions of many reovirus strains, including the prototypes Lang and Dearing. These findings indicate that one or more alternative protease, distinct from Cat L, must function in P388D cells to facilitate {sigma}3 processing. Our results with inhibitors and engineered cell lines expressing different lysosomal proteases provide strong evidence that Cat S, an acid-independent lysosomal cysteine protease that is expressed in antigen-presenting cells, plays the primary role in {sigma}3 processing in P388D cells.

In murine fibroblasts, {sigma}3 processing and infection by reovirus virions require either Cat L or Cat B, but Cat L appears normally to play the more important role3 (43). Although P388D cells express Cat B (data not shown and Ref. 85), our results indicate that it does not play a substantive role in {sigma}3 processing in these cells. First, we found that LHVS effectively blocked {sigma}3 processing and reovirus growth at inhibitory concentrations specific for Cat S (68, 69, 95). Second, we found that the Cat B-specific inhibitor CA-074 did not inhibit {sigma}3 processing or reovirus growth in P388D cells, even though Cat B activity was indeed blocked. Third, and most interestingly, we found that {sigma}3 processing and reovirus growth in P388D cells were not sensitive to agents such as NH4Cl that raise vesicular pH. Because Cat B, like Cat L, requires low pH for activity, we would have expected a decrease in viral yield in P388D cells treated with NH4Cl if Cat B were substantively involved in {sigma}3 processing in these cells.

Our data are most consistent with a direct role for Cat S in {sigma}3 processing in some cells. The alternative model is that Cat S functions indirectly to promote reovirus infection by activating one or more other proteases that mediate {sigma}3 processing in P388D cells. We favor the former possibility because purified Cat S can effectively convert Lang, but not c43, virions into ISVP-like particles in vitro. Thus, in vitro cleavage of virion-bound {sigma}3 by Cat S correlates with acid-independent infection of P388D and other Cat S-expressing cells. Furthermore, Cat S-digested particles are infectious in the presence of E-64 (data not shown), suggesting that they do not require the activity of additional cysteine proteases for any other uncoating steps during cell entry. Together, these findings strongly suggest that Cat S can directly mediate {sigma}3 processing in cells.

Role(s) of Low pH in Reovirus Entry—The fact that Cat S is acid-independent and can process virion-bound {sigma}3 in the presence of agents that raise vesicular pH provides new insight into the role of low pH in cell entry by reovirus. Low pH plays a critical role in many viral infections, for example, by facilitating conformational changes in and activation of the fusion potential of envelope proteins. In these instances, replication is inhibited by agents such as NH4Cl that raise vesicular pH (for review, see Ref. 98). Such agents also inhibit infection of most cell types by reovirus virions (21, 99, 100), suggesting that low pH is critical for cell entry by reovirus virions. The molecular basis of the low pH requirement of reovirus infection has been enigmatic in that it has not been clear whether low pH is required only for maximal activity of acid-dependent proteases involved in {sigma}3 processing or also for some other aspect of cell entry. An acid-dependent conformational change in one of the viral proteins, for example, could be required for promoting proteolysis. One genetic study has suggested the possibility of an acid-dependent step involving the attachment protein, {sigma}1 (41). In addition, based on structural studies and analysis of mutants, it has been postulated that the C-terminal region of {sigma}3 acts as a "safety latch" (43, 45, 101, 102) that might be induced to "unlatch" by low pH (43). Although an acid-induced conformational change in {sigma}3 might increase its sensitivity to proteolysis or might even be required to promote proteolysis by certain proteases such as Cat L, our results do not support a model in which there is a requisite acid-induced conformational change in {sigma}3, or any other reovirus protein, when processing is mediated by Cat S. Of course, neither are acid-induced conformational changes required for {sigma}3 processing by alkaline serine proteases such as chymotrypsin and trypsin in the alkaline environment of the mammalian intestine or at alkaline pH in vitro (11, 24, 32, 33).

Cellular Proteases as Determinants of Viral Tropism—Reovirus infection of P388D cells and other cells expressing Cat S is strain-dependent. For example, in this study, we showed that virions of reovirus isolates c43 and c100 replicate poorly in Cat S-expressing cells. The fact that in vitro conversion of virions to ISVPs allows these strains to bypass the block to infection in P388D cells suggests that {sigma}3 processing is the restrictive step in the life cycle. Using radiolabeled virions, we demonstrated directly that the {sigma}3 protein in c43 virions is not processed efficiently in P388D cells. These results contribute to an emerging model in which {sigma}3 proteolysis is an important determinant of viral tropism. Consistent with this is our recent observation that many cell types that are otherwise permissive to reovirus infection cannot efficiently mediate the virion -> ISVP conversion (31). Results presented in this report extend the model in that the capacity of reovirus virions to utilize specific proteases for {sigma}3 processing is shown to have a dramatic impact on the infectivity of particular strains in particular cell types. Future studies will address the molecular basis, in terms of {sigma}3 sequence/structure relationships, for the different capacities of {sigma}3 from different viral strains to be processed by Cat S.

Our choice of a macrophage-like cell line to begin this study was purposeful in that macrophages have been implicated as important sites of viral replication during reovirus infections in animals (46, 47). In addition, macrophages and other antigen-processing cells are known to express several proteases, including Cat S, that are not expressed widely in other cells and tissues (50, 51). Evidence from other systems suggests that tissue-specific distribution of proteases may play an important role in determining viral tropism in animals. For example, influenza virus is predominantly pneumotropic, although it uses sialic acid receptors that are distributed widely throughout the host. The serine protease tryptase Clara, which is localized predominantly to the respiratory tract, mediates activation of the influenza hemagglutinin for fusion, and the limited tissue distribution of this protease has been suggested to provide a mechanism for the normally restricted in vivo tropism of this virus (103, 104). Similarly, rotavirus replication is generally restricted to the small intestine, where the virus utilizes the serine protease trypsin for activating its attachment and fusion protein VP4 (105, 106). In contrast to the relatively restricted in vivo tropism of influenza virus and rotavirus, reoviruses exhibit a broad tropism during experimental infections of mice, infecting the respiratory and intestinal tracts, as well as the heart, brain, liver, and spleen (37, 47, 107–110). The capacity of reovirus to exploit multiple proteases, including chymotrypsin (11, 24, 32, 33, 111), trypsin (11, 32, 33), Cat L3 (40, 43), Cat B3 (43), and Cat S (this study), may provide an explanation for its broad tropism. Indeed, Cat S is expressed in the heart, lung, and central nervous system, and at especially high levels in the spleen (51, 52, 93, 94). Its expression is known to increase in interferon {gamma}-treated macrophages, whereas Cat L activity decreases under the same conditions (112).

Our results suggest that the capacity of reovirus virions to be uncoated by specific proteases could impact the dissemination and pathogenic potential of particular viral strains. Studies in mice have revealed that c43 and Lang share similar capacities to spread to either the liver or brain after oral inoculation (110). These results are consistent with our observation that both viruses are uncoated efficiently by the intestinal protease chymotrypsin. Strains such as c43 and c100 might be more impaired in their spread and/or virulence after respiratory infection. Additionally, replication in the spleen and heart may be less efficient with viruses more refractory to Cat S-mediated uncoating. Other future studies will seek to determine how the tissue-specific expression of Cat S impacts viral tropism in vivo.


   FOOTNOTES
 
* This work was supported in part by National Institutes of Health Grants AI-45990 (to L. A. S.) and AI-46440 (to M. L. N.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

This paper is dedicated to our mentor and friend Bernie Fields. Back

§ These authors contributed equally to this work. Back

Supported by National Institutes of Health Training Grant 2T32 AI-0742. Back

** Present address: Apptec, 1667 Davis St., Camden, NJ 08104. Back

{ddagger}{ddagger} To whom correspondence should be addressed: Dept. of Microbiology, University of Minnesota, Mayo Mail Code 196, 420 Delaware St., S.E., Minneapolis, MN 55455. Tel.: 612-624-9933; Fax: 612-626-0623. E-mail: schiff{at}lenti.med.umn.edu.

1 The abbreviations used are: dsRNA, double strand RNA; Cat, cathepsin; E-64, trans-epoxysuccinyl-L-leucylamido-(4-guanidino)butane; ISVP, intermediate subvirion particle; MEF, mouse embryo fibroblast; MHC, major histocompatibility complex; pfu, plaque-forming unit(s); LHVS, N-morpholinurea-leucine-homophenylalanine-vinylsulfone-phenyl; TBS, Tris-buffered saline; Z-Arg-Arg-MCA, Z-Arg-Arg-7-amido-4-methylcoumarin. Back

2 M. Ehrlich, R. Hariharan, K. Chandran, J. S. L. Parker, M. L. Nibert, and T. Kirchhausen, unpublished observations. Back

3 D. L. Jones, S. Kothandaraman, R. L. Margraf, and M. L. Nibert, unpublished observations. Back


   ACKNOWLEDGMENTS
 
Michael Chute determined the predicted {sigma}3 amino acid sequence of our laboratory isolates of Lang and Dearing. We thank Hidde Ploegh for providing the Cat S inhibitor LHVS, Bernd Weinderanders for providing the 293 cell line stably expressing Cat S, and Alexander Rudensky for providing the engineered Cat L-deficient MEF cell lines. We also express gratitude to Daniel Portnoy for his gift of Cat L-specific antiserum. We thank Jennifer Smith andStephen Rice for critically reviewing this manuscript. We also thank members of the Schiff and Rice laboratories for constructive input throughout these studies.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Nibert, M. L., and Schiff, L. A. (2001) in Fields Virology (Knipe, D. M., and Howley, P. M., eds) 4th Ed., pp. 1679–1728, Lippincott, Williams and Wilkins, Philadelphia
  2. Tyler, K. L. (2001) in Fields Virology (Knipe, D. M., and Howley, P. M., eds) 4th Ed., pp. 1729–1746, Lippincott, Williams and Wilkins, Philadelphia
  3. Nibert, M. L. (1998) Curr. Top. Microbiol. Immunol. 233, 1–30[Medline] [Order article via Infotrieve]
  4. Coombs, K. M. (1998) Virology 243, 218–228[CrossRef][Medline] [Order article via Infotrieve]
  5. Dryden, K. A., Wang, G., Yeager, M., Nibert, M. L., Coombs, K. M., Furlong, D. B., Fields, B. N., and Baker, T. S. (1993) J. Cell Biol. 122, 1023–1041[Abstract/Free Full Text]
  6. Nibert, M. L., Furlong, D. B., and Fields, B. N. (1991) J. Clin. Invest. 88, 727–734[Medline] [Order article via Infotrieve]
  7. Tosteson, M. T., Nibert, M. L., and Fields, B. N. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 10549–10552[Abstract/Free Full Text]
  8. Lucia-Jandris, P., Hooper, J. W., and Fields, B. N. (1993) J. Virol. 67, 5339–5345[Abstract/Free Full Text]
  9. Hooper, J. W., and Fields, B. N. (1996) J. Virol. 70, 459–467[Abstract]
  10. Hooper, J. W., and Fields, B. N. (1996) J. Virol. 70, 672–677[Abstract]
  11. Nibert, M. L., and Fields, B. N. (1992) J. Virol. 66, 6408–6418[Abstract/Free Full Text]
  12. Nibert, M. L., Schiff, L. A., and Fields, B. N. (1991) J. Virol. 65, 1960–1967[Abstract/Free Full Text]
  13. Hazelton, P. R., and Coombs, K. M. (1995) Virology 207, 46–58[CrossRef][Medline] [Order article via Infotrieve]
  14. Lee, P. W. K., Hayes, E. C., and Joklik, W. K. (1981) Virology 108, 156–163[CrossRef][Medline] [Order article via Infotrieve]
  15. Weiner, H. L., Powers, M. L., and Fields, B. N. (1980) J. Infect. Dis. 141, 609–616[Medline] [Order article via Infotrieve]
  16. Barton, E. S., Forrest, J. C., Connolly, J. L., Chappell, J. D., Liu, Y., Schnell, F. J., Nusrat, A., Parkos, C. A., and Dermody, T. S. (2001) Cell 104, 441–451[CrossRef][Medline] [Order article via Infotrieve]
  17. Chappell, J. D., Gunn, V. L., Wetzel, J. D., Baer, G. S., and Dermody, T. S. (1997) J. Virol. 71, 1834–1841[Abstract]
  18. Chappell, J. D., Duong, J. L., Wright, B. W., and Dermody, T. S. (2000) J. Virol. 74, 8472–8479[Abstract/Free Full Text]
  19. Borsa, J., Sargent, M. D., Lievaart, P. A., and Copps, T. P. (1981) Virology 111, 191–200[CrossRef][Medline] [Order article via Infotrieve]
  20. Borsa, J., Morash, B. D., Sargent, M. D., Copps, T. P., Lievaart, P. A., and Szekely, J. G. (1979) J. Gen. Virol. 45, 161–170[Abstract/Free Full Text]
  21. Sturzenbecker, L. J., Nibert, M., Furlong, D., and Fields, B. N. (1987) J. Virol. 61, 2351–2361[Abstract/Free Full Text]
  22. Chang, C.-T., and Zweerink, H. J. (1971) Virology 46, 544–555[CrossRef][Medline] [Order article via Infotrieve]
  23. Silverstein, S. C., Astell, C., Levin, D. H., Schonberg, M., and Acs, G. (1972) Virology 47, 797–806[CrossRef][Medline] [Order article via Infotrieve]
  24. Joklik, W. K. (1972) Virology 49, 700–715[CrossRef][Medline] [Order article via Infotrieve]
  25. Borsa, J., Copps, T. P., Sargent, M. D., Long, D. G., and Chapman, J. D. (1973) J. Virol. 11, 552–564[Abstract/Free Full Text]
  26. Shatkin, A. J., and LaFiandra, A. J. (1972) J. Virol. 10, 698–706[Abstract/Free Full Text]
  27. Chandran, K., and Nibert, M. L. (1998) J. Virol. 72, 467–475[Abstract/Free Full Text]
  28. Chandran, K., Walker, S. B., Chen, Y., Contreras, C. M., Schiff, L. A., Baker, T. S., and Nibert, M. L. (1999) J. Virol. 73, 3941–3950[Abstract/Free Full Text]
  29. Baer, G. S., and Dermody, T. S. (1997) J. Virol. 71, 4921–4928[Abstract]
  30. Jane-Valbuena, J., Nibert, M. L., Spencer, S. M., Walker, S. B., Baker, T. S., Chen, Y., Centonze, V. E., and Schiff, L. A. (1999) J. Virol. 73, 2963–2973[Abstract/Free Full Text]
  31. Golden, J. W., Linke, J., Schmechel, S., Thoemke, K., and Schiff, L. A. (2002) J. Virol. 76, 7430–7443[Abstract/Free Full Text]
  32. Bass, D. M., Bodkin, D., Dambrauskas, R., Trier, J. S., Fields, B. N., and Wolf, J. L. (1990) J. Virol. 64, 1830–1833[Abstract/Free Full Text]
  33. Bodkin, D. K., Nibert, M. L., and Fields, B. N. (1989) J. Virol. 63, 4676–4681[Abstract/Free Full Text]
  34. Amerongen, H. M., Wilson, G. A., Fields, B. N., and Neutra, M. R. (1994) J. Virol. 68, 8428–8432[Abstract/Free Full Text]
  35. Wolf, J. L., Rubin, D. H., Finberg, R., Kauffman, R. S., Sharpe, A. H., Trier, J. S., and Fields, B. N. (1981) Science 212, 471–472[Abstract/Free Full Text]
  36. Wolf, J. L., Kauffman, R. S., Finberg, R., Dambrauskas, R., Fields, B. N., and Trier, J. S. (1983) Gastroenterology 85, 291–300[Medline] [Order article via Infotrieve]
  37. Kauffman, R. S., Wolf, J. L., Finberg, R., Trier, J. S., and Fields, B. N. (1983) Virology 124, 403–410[CrossRef][Medline] [Order article via Infotrieve]
  38. Morrison, L. A., Sidman, R. L., and Fields, B. N. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3852–3856[Abstract/Free Full Text]
  39. Kothandaraman, S., Hebert, M. C., Raines, R. T., and Nibert, M. L. (1998) Virology 251, 264–272[CrossRef][Medline] [Order article via Infotrieve]
  40. Baer, G. S., Ebert, D. H., Chung, C. J., Erickson, A. H., and Dermody, T. S. (1999) J. Virol. 73, 9532–9543[Abstract/Free Full Text]
  41. Wetzel, J. D., Wilson, G. J., Baer, G. S., Dunnigan, L. R., Wright, J. P., Tang, D. S., and Dermody, T. S. (1997) J. Virol. 71, 1362–1369[Abstract]
  42. Wilson, G. J., Nason, E. L., Hardy, C. S., Ebert, D. H., Wetzel, J. D., Venkataram Prasad, B. V., and Dermody, T. S. (2002) J. Virol. 76, 9832–9843[Abstract/Free Full Text]
  43. Ebert, D. H., Deussing, J., Peters, C., and Dermody, T. S. (2002) J. Biol. Chem. 277, 24609–24617[Abstract/Free Full Text]
  44. Shepard, D. A., Ehnstrom, J. G., and Schiff, L. A. (1995) J. Virol. 69, 8180–8184[Abstract]
  45. Jane-Valbuena, J., Breun, L. A., Schiff, L. A., and Nibert, M. L. (2002) J. Virol. 76, 5184–5197[Abstract/Free Full Text]
  46. Bass, D. M., Trier, J. S., Dambrauskas, R., and Wolf, J. L. (1988) Lab. Invest. 58, 226–235[Medline] [Order article via Infotrieve]
  47. Morin, M. J., Warner, A., and Fields, B. N. (1996) J. Virol. 70, 541–548[Abstract]
  48. Buhling, F., Fengler, A., Brandt, W., Welte, T., Ansorge, S., and Nagler, D. K. (2000) Adv. Exp. Med. Biol. 477, 241–254[Medline] [Order article via Infotrieve]
  49. Morton, P. A., Zacheis, M. L., Giacoletto, K. S., Manning, J. A., and Schwartz, B. D. (1995) J. Immunol. 154, 137–150[Abstract]
  50. Shi, G. P., Munger, J. S., Meara, J. P., Rich, D. H., and Chapman, H. A. (1992) J. Biol. Chem. 267, 7258–7262[Abstract/Free Full Text]
  51. Shi, G. P., Webb, A. C., Foster, K. E., Knoll, J. H., Lemere, C. A., Munger, J. S., and Chapman, H. A. (1994) J. Biol. Chem. 269, 11530–11536[Abstract/Free Full Text]
  52. Kirschke, H., Wiederanders, B., Bromme, D., and Rinne, A. (1989) Biochem. J. 264, 467–473[Medline] [Order article via Infotrieve]
  53. Riese, R. J., Wolf, P. R., Bromme, D., Natkin, L. R., Villadangos, J. A., Ploegh, H. L., and Chapman, H. A. (1996) Immunity 4, 357–366[CrossRef][Medline] [Order article via Infotrieve]
  54. Hsieh, C. S., deRoos, P., Honey, K., Beers, C., and Rudensky, A. Y. (2002) J. Immunol. 168, 2618–2625[Abstract/Free Full Text]
  55. Reddy, V. Y., Zhang, Q. Y., and Weiss, S. J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 3849–3853[Abstract/Free Full Text]
  56. Shi, G. P., Sukhova, G. K., Kuzuya, M., Ye, Q., Du, J., Zhang, Y., Pan, J. H., Lu, M. L., Cheng, X. W., Iguchi, A., Perrey, S., Lee, A. M., Chapman, H. A., and Libby, P. (2003) Circ. Res. 92, 493–500[Abstract/Free Full Text]
  57. Munger, J. S., Haass, C., Lemere, C. A., Shi, G. P., Wong, W. S., Teplow, D. B., Selkoe, D. J., and Chapman, H. A. (1995) Biochem. J. 311, 299–305[Medline] [Order article via Infotrieve]
  58. Lemere, C. A., Munger, J. S., Shi, G. P., Natkin, L., Haass, C., Chapman, H. A., and Selkoe, D. J. (1995) Am. J. Pathol. 146, 848–860[Abstract]
  59. Baker, C. A., Lu, Z. Y., Zaitsev, I., and Manuelidis, L. (1999) J. Virol. 73, 5089–5097[Abstract/Free Full Text]
  60. Baker, C. A., Martin, D., and Manuelidis, L. (2002) J. Virol. 76, 10905–10913[Abstract/Free Full Text]
  61. Kedl, R., Schmechel, S., and Schiff, L. (1995) J. Virol. 69, 552–559[Abstract]
  62. Kreusch, S., Fehn, M., Maubach, G., Nissler, K., Rommerskirch, W., Schilling, K., Weber, E., Wenz, I., and Wiederanders, B. (2000) Eur. J. Biochem. 267, 2965–2972[Medline] [Order article via Infotrieve]
  63. Rosen, L., Hovis, J. F., Mastrota, F. M., Bell, J. A., and Huebner, R. J. (1960) Am. J. Hyg. 71, 258–265[Medline] [Order article via Infotrieve]
  64. Rosen, L. (1960) Am. J. Hyg. 71, 242–249[Medline] [Order article via Infotrieve]
  65. Dermody, T. S., Nibert, M. L., Bassel-Duby, R., and Fields, B. N. (1990) J. Virol. 64, 5173–5176[Abstract/Free Full Text]
  66. Furlong, D. B., Nibert, M. L., and Fields, B. N. (1988) J. Virol. 62, 246–256[Abstract/Free Full Text]
  67. Virgin, H. W., IV, Bassel-Duby, R., Fields, B. N., and Tyler, K. L. (1988) J. Virol. 62, 4594–4604[Abstract/Free Full Text]
  68. Villadangos, J. A., Riese, R. J., Peters, C., Chapman, H. A., and Ploegh, H. L. (1997) J. Exp. Med. 186, 549–560[Abstract/Free Full Text]
  69. Palmer, J. T., Rasnick, D., Klaus, J. L., and Bromme, D. (1995) J. Med. Chem. 38, 3193–3196[CrossRef][Medline] [Order article via Infotrieve]
  70. Ramig, R. F., White, R. M., and Fields, B. N. (1977) Science 195, 406–407[Abstract/Free Full Text]
  71. Sharpe, A. H., Ramig, R. F., Mustoe, T. A., and Fields, B. N. (1978) Virology 84, 63–74[CrossRef][Medline] [Order article via Infotrieve]
  72. Wiener, J. R., and Joklik, W. K. (1989) Virology 169, 194–203[CrossRef][Medline] [Order article via Infotrieve]
  73. Wiener, J. R., Bartlett, J. A., and Joklik, W. K. (1989) Virology 169, 293–304[CrossRef][Medline] [Order article via Infotrieve]
  74. Portnoy, D. A., Erickson, A. H., Kochan, J., Ravetch, J. V., and Unkeless, J. C. (1986) J. Biol. Chem. 261, 14697–14703[Abstract/Free Full Text]
  75. Broering, T. J., McCutcheon, A. M., Centonze, V. E., and Nibert, M. L. (2000) J. Virol. 74, 5516–5524[Abstract/Free Full Text]
  76. Zar, J. H. (1984) Biostatistical Analysis, 2nd Ed., pp. 138–145, Prentice-Hall, Englewood Cliffs, NJ
  77. Bodkin, D. K., and Fields, B. N. (1989) J. Virol. 63, 1188–1193[Abstract/Free Full Text]
  78. Sherry, B., and Fields, B. N. (1989) J. Virol. 63, 4850–4856[Abstract/Free Full Text]
  79. Danis, C., Garzon, S., and Lemay, G. (1992) Virology 190, 494–498[CrossRef][Medline] [Order article via Infotrieve]
  80. Morgan, E. M., and Zweerink, H. J. (1974) Virology 59, 556–565[CrossRef][Medline] [Order article via Infotrieve]
  81. Shing, M., and Coombs, K. M. (1996) Virus Res. 46, 19–29[CrossRef][Medline] [Order article via Infotrieve]
  82. Beattie, E., Denzler, K. L., Tartaglia, J., Perkus, M. E., Paoletti, E., and Jacobs, B. L. (1994) J. Virol. 69, 499–505
  83. Imani, F., and Jacobs, B. L. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7887–7891[Abstract/Free Full Text]
  84. Yue, Z., and Shatkin, A. J. (1997) Virology 234, 364–371[CrossRef][Medline] [Order article via Infotrieve]
  85. Kang, J. X., Bell, J., Leaf, A., Beard, R. L., and Chandraratna, R. A. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 13687–13691[Abstract/Free Full Text]
  86. Murata, M., Miyashita, S., Yokoo, C., Tamai, M., Hanada, K., Hatayama, K., Towatari, T., Nikawa, T., and Katunuma, N. (1991) FEBS Lett. 280, 307–310[CrossRef][Medline] [Order article via Infotrieve]
  87. Towatari, T., Nikawa, T., Murata, M., Yokoo, C., Tamai, M., Hanada, K., and Katunuma, N. (1991) FEBS Lett. 280, 311–315[CrossRef][Medline] [Order article via Infotrieve]
  88. Montaser, M., Lalmanach, G., and Mach, L. (2002) Biol. Chem. 383, 1305–1308[CrossRef][Medline] [Order article via Infotrieve]
  89. Barrett, A. J., and Kirschke, H. (1981) Methods Enzymol. 80, 535–561[Medline] [Order article via Infotrieve]
  90. Kirschke, H., Barrett, A. J., and Rawlings, N. D. (1998) Lysosomal Cysteine Proteases, 2nd Ed., Oxford University Press, Oxford, UK
  91. Chapman, H. A., Riese, R. J., and Shi, G. P. (1997) Annu. Rev. Physiol. 59, 63–88[CrossRef][Medline] [Order article via Infotrieve]
  92. McGrath, M. E. (1999) Annu. Rev. Biophys. Biomol. Struct. 28, 181–204[CrossRef][Medline] [Order article via Infotrieve]
  93. Liuzzo, J. P., Petanceska, S. S., Moscatelli, D., and Devi, L. A. (1999) Mol. Med. 5, 320–333[Medline] [Order article via Infotrieve]
  94. Petanceska, S., Canoll, P., and Devi, L. A. (1996) J. Biol. Chem. 271, 4403–4409[Abstract/Free Full Text]
  95. Pierre, P., and Mellman, I. (1998) Cell 93, 1135–1145[CrossRef][Medline] [Order article via Infotrieve]
  96. Fiebiger, E., Meraner, P., Weber, E., Fang, I. F., Stingl, G., Ploegh, H., and Maurer, D. (2001) J. Exp. Med. 193, 881–892[Abstract/Free Full Text]
  97. Lazure, C. (2002) Curr. Pharm. Des. 8, 511–531[CrossRef][Medline] [Order article via Infotrieve]
  98. Young, J. A. T. (2001) in Fields Virology (Knipe, D. M., and Howley, P. M., eds) 4th Ed., pp. 87–103, Lippincott, Williams and Wilkins, Philadelphia
  99. Canning, W. M., and Fields, B. N. (1983) Science 219, 987–988[Abstract/Free Full Text]
  100. Martinez, C. G., Guinea, R., Benavente, J., and Carrasco, L. (1996) J. Virol. 70, 576–579[Abstract]
  101. Ebert, D. H., Wetzel, J. D., Brumbaugh, D. E., Chance, S. R., Stobie, L. E., Baer, G. S., and Dermody, T. S. (2001) J. Virol. 75, 3197–3206[Abstract/Free Full Text]
  102. Olland, A. M., Jane-Valbuena, J., Schiff, L. A., Nibert, M. L., and Harrison, S. C. (2001) EMBO J. 20, 979–989[CrossRef][Medline] [Order article via Infotrieve]
  103. Kido, H., Towatari, T., Niwa, Y., Okumura, Y., and Beppu, Y. (1996) Adv. Exp. Med. Biol. 389, 233–240[Medline] [Order article via Infotrieve]
  104. Kido, H., Murakami, M., Oba, K., Chen, Y., and Towatari, T. (1999) Mol. Cell 9, 235–244
  105. Denisova, E., Dowling, W., LaMonica, R., Shaw, R., Scarlata, S., Ruggeri, F., and Mackow, E. R. (1999) J. Virol. 73, 3147–3153[Abstract/Free Full Text]
  106. Estes, M. K., Graham, D. Y., and Mason, B. B. (1981) J. Virol. 39, 879–888[Abstract/Free Full Text]
  107. Rubin, D. H., Kornstein, M. J., and Anderson, A. O. (1985) J. Virol. 53, 391–398[Abstract/Free Full Text]
  108. Sherry, B., Schoen, F. J., Wenske, E., and Fields, B. N. (1989) J. Virol. 63, 4840–4849[Abstract/Free Full Text]
  109. Tyler, K. L., Bronson, R. T., Byers, K. B., and Fields, B. (1985) Neurology 35, 88–92[Free Full Text]
  110. Wilson, G. A., Morrison, L. A., and Fields, B. N. (1994) J. Virol. 68, 6458–6465[Abstract/Free Full Text]
  111. Borsa, J., Sargent, M. D., Copps, T. P., Long, D. G., and Chapman, J. D. (1973) J. Virol. 11, 1017–1019[Abstract/Free Full Text]
  112. Beers, C., Honey, K., Fink, S., Forbush, K., and Rudensky, A. (2003) J. Exp. Med. 197, 169–179[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Virol.Home page
L. Zhang, M. A. Agosto, T. Ivanovic, D. S. King, M. L. Nibert, and S. C. Harrison
Requirements for the Formation of Membrane Pores by the Reovirus Myristoylated {micro}1N Peptide
J. Virol., July 15, 2009; 83(14): 7004 - 7014.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M. A. Agosto, J. K. Middleton, E. C. Freimont, J. Yin, and M. L. Nibert
Thermolabilizing Pseudoreversions in Reovirus Outer-Capsid Protein {micro}1 Rescue the Entry Defect Conferred by a Thermostabilizing Mutation
J. Virol., July 15, 2007; 81(14): 7400 - 7409.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
H. Hofmann, G. Simmons, A. J. Rennekamp, C. Chaipan, T. Gramberg, E. Heck, M. Geier, A. Wegele, A. Marzi, P. Bates, et al.
Highly Conserved Regions within the Spike Proteins of Human Coronaviruses 229E and NL63 Determine Recognition of Their Respective Cellular Receptors.
J. Virol., September 1, 2006; 80(17): 8639 - 8652.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
K. Schornberg, S. Matsuyama, K. Kabsch, S. Delos, A. Bouton, and J. White
Role of endosomal cathepsins in entry mediated by the ebola virus glycoprotein.
J. Virol., April 1, 2006; 80(8): 4174 - 4178.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
I-C. Huang, B. J. Bosch, F. Li, W. Li, K. H. Lee, S. Ghiran, N. Vasilieva, T. S. Dermody, S. C. Harrison, P. R. Dormitzer, et al.
SARS Coronavirus, but Not Human Coronavirus NL63, Utilizes Cathepsin L to Infect ACE2-expressing Cells
J. Biol. Chem., February 10, 2006; 281(6): 3198 - 3203.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
K. M. Clark, J. D. Wetzel, Y. Gu, D. H. Ebert, S. A. McAbee, E. K. Stoneman, G. S. Baer, Y. Zhu, G. J. Wilson, B. V. V. Prasad, et al.
Reovirus Variants Selected for Resistance to Ammonium Chloride Have Mutations in Viral Outer-Capsid Protein {sigma}3
J. Virol., January 15, 2006; 80(2): 671 - 681.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/10/8547    most recent
M309758200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Golden, J. W.
Right arrow Articles by Schiff, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Golden, J. W.
Right arrow Articles by Schiff, L. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement