JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M308083200 on November 26, 2003

J. Biol. Chem., Vol. 279, Issue 10, 9115-9124, March 5, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/10/9115    most recent
M308083200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prasad, A.
Right arrow Articles by Ganju, R. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prasad, A.
Right arrow Articles by Ganju, R. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Slit Protein-mediated Inhibition of CXCR4-induced Chemotactic and Chemoinvasive Signaling Pathways in Breast Cancer Cells*

Anil Prasad{ddagger}, Aaron Z. Fernandis{ddagger}, Yi Rao§, and Ramesh K. Ganju

From the {ddagger}Division of Experimental Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts 02115 and the §Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, Missouri 63110

Received for publication, July 24, 2003 , and in revised form, November 18, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Slit, which mediates its function by binding to the Roundabout (Robo) receptor, has been shown to regulate neuronal and CXCR4-mediated leukocyte migration. Slit-2 was shown to be frequently inactivated in lung and breast cancers because of hypermethylation of its promoter region. Furthermore, the CXCR4/CXCL12 axis has been reported recently to be actively involved in breast cancer metastasis to target organs such as lymph nodes, lung, and bone. In this study, we sought to characterize the effect of Slit (=Slit-2) on the CXCL12/CXCR4-mediated metastatic properties of breast cancer cells. We demonstrate here that breast cancer cells and tissues derived from breast cancer patients express Robo 1 and 2 receptors. We also show that Slit treatment inhibits CXCL12/CXCR4-induced breast cancer cell chemotaxis, chemoinvasion, and adhesion, the fundamental components that promote metastasis. Slit had no significant effect on the CXCL12-induced internalization process of CXCR4. In addition, characterization of signaling events revealed that Slit inhibits CXCL12-induced tyrosine phosphorylation of focal adhesion components such as RAFTK/Pyk2 at residues 580 and 881, focal adhesion kinase at residue 576, and paxillin. We found that Slit also inhibits CXCL12-induced phosphatidylinositol 3-kinase, p44/42 MAP kinase, and metalloproteinase 2 and 9 activities. However, it showed no effect on JNK and p38 MAP kinase activities. To our knowledge, this is the first report to analyze in detail the effect of Slit on breast cancer cell motility as well as its effect on the critical components of the cancer cell chemotactic machinery. Studies of the Slit-Robo complex may foster new anti-chemotactic approaches to block cancer cell metastasis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Breast cancer metastasis is the main cause of treatment failure and death in patients with breast cancer. Tumor cells migrate to other distant organs, invading blood and lymphatic vessels and leading to secondary tumor formation. A wide number of molecules, including various cytokines, chemokines, and growth hormones, have been implicated to be responsible for the metastatic property of breast cancer cells (17).

Chemokines have been shown recently (5) to play a key role in breast cancer metastasis. Moreover, breast cancer cells have been demonstrated to express the chemokine receptors, CXCR4 and CCR7, whereas organs such as the lymph nodes and lungs, which represent important sites of breast cancer metastasis, have been reported to express ligands of these receptors (5). Furthermore, in vitro neutralization of the CXCL12/CXCR4 interaction led to a marked inhibition of lymph node and lung metastasis. In other cancers, such as of the prostate and ovary, CXCL12 was shown to promote tumor cell transendothelial chemotaxis (8, 9). Human melanoma cells have also been shown to express functional CXCR4 receptors that may contribute to tumor cell invasion and the growth of these tumors (10). Besides CXCL12, other {alpha}-chemokines such as interleukin-8 and GRO{alpha} have also been reported (11) to stimulate the migration and adhesion of prostrate carcinoma cells.

CXCL12-induced leukocyte chemotaxis was shown recently to be inhibited by a secretory glycoprotein termed Slit (12). Slit was originally found to be expressed in neurons and glial cells in the neuronal system and was later shown to play the role of a multifunctional signaling molecule by acting as a silencer and a repellent, and perhaps as a branching and elongation factor (1319). Slit consists of a family of three genes, Slit-1, Slit-2, and Slit-3, that have been cloned from different model systems (2023). The roundabout (Robo)1 receptor is a molecular target for Slit (2225). Robo, which is highly conserved from fruit flies to mammals, consists of a novel subfamily of Ig superfamily proteins (19). Identification of Robo mutations in genetic screens for guidance defects has revealed the importance of Slit/Robo signaling in axon guidance and cell migration (24, 26, 27).

Recently, Slit was also shown to act as a tumor suppressor, since overexpression of Slit suppressed colony growth in breast tumor cell lines (28). Furthermore, the importance of the Slit-Robo complex in breast cancer has been confirmed by genetic studies showing that the SLIT and ROBO genes are frequently inactivated in breast cancer patients due to hypermethylation of the promoter region (28). Although Slit has been demonstrated to play an important role in regulating the movement of neurons and leukocytes, the signaling pathways that mediate these effects are not well known.

In this study, we present a novel observation that Slit inhibits breast cancer cell chemotaxis and chemoinvasion by downmodulating critical downstream molecules in the CXCR4-mediated signaling pathway, including components of focal adhesion kinase. It also inhibits MAP kinase and metalloproteinase 2 and 9 activities that may be involved in chemoinvasion. Thus Slit, by blocking breast cancer cell movement, may inhibit CXCL12-induced breast cancer metastasis.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines—DU4475 cells were obtained from ATCC. MDA-MB-231 cells were generously provided by Hava Avraham (Beth Israel Deaconess Medical Center, Boston). DU4475 cells were grown at 37 °C in 5% CO2 in RPMI 1640 containing 10% fetal bovine serum, according to the recommendations of the supplier. MDA-MB-231 cells were maintained in DMEM with 10% fetal bovine serum and 1% penicillin-streptomycin at 37 °C in 5% CO2.

RT-PCR Analysis—Total RNA was extracted from DU4475 and MDA-MB-231 breast cancer cells using a standard TRIzol extraction protocol. 0.5–1 µg of total RNA was reverse-transcribed with extended PCR using the TitaniumTM one-step RT-PCR kit according to the manufacturer's instructions (BD Biosciences). The primers used are as follows: Robo 1 forward, GCCGCCCCACACCCACTAT, and Robo 1 reverse, GGCCACACAGCTGAGGACGAAAG; Robo 2 forward, CCCCAGCAGCCCAACAGTAGA, and Robo 2 reverse, TGGGCCGCAGTCCTCTTACA. The PCR was carried out at the annealing temperature of 60 °C, and the PCR products were analyzed on 0.7% agarose gels.

Immunohistochemistry—The paraffin-mounted normal and malignant breast tissues slides obtained from the Co-operative Human Tissue Network (Philadelphia) were deparaffinized three times with xylene, followed by hydration with sequential treatment of the slides twice each to 100, 95, and 70% ethanol for 5 min per treatment. The DU4475 cells or the MDA-MB-231 cells were mounted and fixed on slides with paraformaldehyde for 15 min at room temperature, followed by washings with phosphate-buffered saline (PBS). The slides were subjected to immunohistochemistry by using the DAB staining kit (Vector Laboratories). Briefly, the slides were blocked for 10 min with 1.5% normal horse serum followed by incubation with either Robo 1 (1:20), Robo 2 (1:20), CXCR4 (1:100), or control IgG (1:20) for 1 h. The slides were then rinsed with PBS and incubated with pantothenate-specific universal secondary antibody for 10 min. Following a wash with PBS, the slides were further incubated with streptavidin-peroxidase complex reagent for 5 min. The slides were again washed and developed with 3,3'-diaminobenzidine (DAB) as substrate according to the manufacturer's instructions. The slides were mounted with aqua mount and photographed.

Preparation of Slit and Control Supernatant—Slit was obtained from the supernatants of Myc-tagged Slit transfected human embryonic kidney cells, according to published procedures (12, 16). Slit expression was monitored by anti-c-Myc or anti-Slit antibody. Control preparations obtained from the vector-transfected cell lines were prepared by using the same procedure as that employed for the Slit preparations. This partially purified Slit was further enriched on a Superdex 200 gel filtration column using the Amersham Biosciences FPLC system. The column was run on PBS containing 2 M NaCl. The fractions were analyzed on 8% SDS-PAGE gels stained with silver stain or on immunoblots probed with anti-Myc antibodies. The purified fractions, which were found to be homogenous by silver staining and Western blotting with c-Myc tag antibodies, were dialyzed with PBS, concentrated, and used for the chemotaxis assays.

Stimulation of Cells—Stimulation of cells was carried out as described earlier (2931). Briefly, DU4475 cells were washed twice with Hanks' buffered salt solution (Cellgro) and then resuspended in the Hanks' buffered salt solution with a density of 107 cells/ml. The cells were subsequently starved of serum for 3 h at 37 °C followed with either Slit supernatant or control supernatants for 1 h at 37 °C. The pretreated cells were stimulated with 100 ng/ml CXCL12 (10 nM) (PeproTech) at 37 °C for various times. At the end of the stimulation, cells were harvested by centrifugation and lysed in modified radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 10 µg/ml antipain, 10 µg/ml chymostatin, 100 µg/ml trypsin inhibitor, 10 µg/ml pepstatin, 10 mM sodium vanadate, 10 mM sodium fluoride, and 10 mM sodium pyrophosphate). The cell lysates were clarified by centrifugation at 10,000 x g for 10 min at 4 °C. Protein concentrations were determined by the Bio-Rad detergent-compatible protein assay.

Immunoprecipitation, Immunodepletion, and Western Blot Analysis—Equal amounts of protein from the stimulated time points were clarified by incubation with protein A-Sepharose CL-4B or GammaBindTM-Sepharose beads (both from Amersham Biosciences) for 1 h at 4 °C. The Sepharose beads were removed by brief centrifugation, and the supernatants were incubated with different primary antibodies for 2 h at 4 °C. Immunoprecipitation of the antibody-antigen complexes was performed by incubation at 4 °C overnight with 50 µl of protein A-Sepharose CL-4B or GammaBindTM-Sepharose (50% suspension). Nonspecific interacting proteins were removed by washing the beads three times with modified RIPA buffer and once with PBS. Immune complexes were solubilized in 50 µl of 2x Laemmli buffer, boiled, and subjected to SDS-PAGE. The proteins were transferred onto nitrocellulose membranes. The membranes were then blocked in 5% nonfat milk protein for 2 h at 37 °C or overnight at 4 °C and probed with primary antibody for 3 h at room temperature or at 4 °C overnight. Immunoreactive bands were visualized using horseradish peroxidase-conjugated secondary antibody and the enhanced chemiluminescence system (ECL, Amersham Biosciences). For the immunodepletion experiments, the Slit or control supernatant concentrates were incubated with anti-Myc antibodies for 1 h at 4 °C, followed by overnight incubation with protein A-Sepharose. The beads were removed by centrifugation, and the supernatant was used as the immunodepleted sample.

Flow Cytometry—For receptor expression, both DU4475 and MDA-MB-231 cells (1 x 106) were washed twice with PBS, resuspended in 100 µl of PBS with 5% fetal bovine serum (FBS) and Robo 1 or Robo 2 antibodies (Santa Cruz Biotechnologies) or with goat IgG antibodies as control, and then incubated at 4 °C. Cells were washed three times in PBS containing 5% FBS and incubated with anti-goat IgG labeled with fluorescein isothiocyanate for 2 h at 4 °C. The cells were next washed three times with ice-cold PBS, 5% FBS buffer, resuspended in 200 µl of PBS, and then analyzed by flow cytometry to determine the surface expression levels of these receptors.

For receptor down-modulation, DU4475 cells were pretreated with Slit or control supernatant and then stimulated with CXCL12 at different time points. The stimulation was terminated with ice-cold PBS, followed by 3 washes with PBS. The cells were fixed in 4% paraformaldehyde for 15 min at room temperature. The CXCR4 receptor on the cells was stained with phycoerythrin-coupled anti-CXCR4 antibody for 1 h at 4 °C. The cells were next washed with PBS, suspended in 1% formaldehyde in PBS, and subjected to flow cytometric analysis.

Chemotaxis and Chemoinvasion Assays—Migration and invasion were assayed in 24-well cell-culture chambers with 8-µm pore membranes, as described (5, 30). Membranes were pre-coated with either fibronectin (FN) (2.5 µg/ml) for chemotaxis studies or with Matrigel (BD Biosciences) for chemoinvasion studies of the MDA-MB-231 cells. Breast cancer cells were resuspended in chemotaxis buffer (DMEM, 0.1% bovine serum albumin, 12 mM HEPES for the MDA-MB-231 cells and RPMI 1640, 2.5% FBS for the DU4475 cells) at 2.5 x 106 cells/ml. Cells were pretreated with Slit or control preparation for 30 min. 150 µl of cells from each sample was loaded onto the upper chamber. 0.6 ml of medium containing CXCL12 (5 nM) with Slit or the control was then loaded onto the lower chamber. The plates were incubated for 24 h at 37 °C in 5% CO2. After incubation, the inserts were removed carefully, and the MDA-MB-231 cells were fixed, stained, and counted using standard procedures. For the DU4475 line, cells were counted directly by using a Neubar chamber. The results were expressed as the percent of migrated cells as compared with the control.

Adhesion Assay—The wells of a 96-well tissue culture plate, precoated with 10 µg/ml FN (BD Biosciences) or collagen IV (BD Biosciences) overnight at 4 °C, were washed with PBS and blocked with 0.5% bovine serum albumin in DMEM for 1 h at 37 °C. Plates were again rinsed with PBS and air-dried. Cells were seeded at 5 x 104 cells/well in 200 µl of serum-free medium and allowed to attach for 1 h at 37 °C in the presence or absence of Slit or the control. Non-adherent cells were removed by gentle washing with PBS. The adherent cells were quantified by using the Roche Applied Science MTT cell proliferation assay kit.

Receptor Binding Assay—Binding of CXCL12 to its receptor CXCR4 was assessed by using 1 ng/ml 125I-labeled CXCL12 (Amersham Biosciences) in the presence of various concentrations of purified Slit or unlabeled CXCL12 (PeproTech) (32). Briefly, DU4475 cells at 107/ml in RPMI 1640 containing 1% bovine serum albumin (w/v) and 25 mM/liter HEPES were incubated in the presence of various concentrations of purified Slit or unlabeled CXCL12 together with 1 ng/ml 125I-labeled CXCL12 for 1 h at room temperature and then washed three times with cold RPMI 1640 containing 25 mM/liter HEPES. Cell pellet-associated radioactivity was determined in a gamma counter.

JNK and p38 MAP Kinase Assays—The JNK and p38 MAP kinase assays were performed as described previously (33, 34). Briefly, cell lysates were immunoprecipitated with JNK antibody (Santa Cruz Biotechnology). The immune complexes were washed twice with RIPA buffer and once in kinase buffer (50 mM HEPES, pH 7.4, 10 mM MgCl2, 20 µM ATP). The complex was then incubated in kinase buffer containing recombinant glutathione S-transferase-c-Jun 0.2 µg/µl(1–79 amino acids) (Santa Cruz Biotechnology) and 5 µCi of [{gamma}-32P]ATP for 10 min at room temperature. The reaction was terminated by adding 2x SDS sample buffer and boiling the samples for 5 min. Proteins were separated on 12% SDS-PAGE and detected by autoradiography. For the p38 MAP kinase assays, cell lysates were immunoprecipitated with p38 MAP kinase antibody (Santa Cruz Biotechnology). The immune complexes were washed twice with RIPA buffer and once in kinase buffer and then incubated in kinase buffer containing 7 µg of myelin basic protein (Upstate Biotechnology Inc.) and 5 µCi of [{gamma}-32P]ATP for 20 min at 30 °C. Proteins were separated on 15% SDS-PAGE and detected by autoradiography.

c-Src Kinase Assay—The c-Src kinase assay was carried out as described previously (30, 34). Briefly, the cell lysates were immunoprecipitated with c-Src antiserum. The immune complexes were washed twice with RIPA buffer and once with kinase buffer (10 mM HEPES, pH 7.4, 5 mM MnCl2, 10 µM Na3VO4). For the in vitro kinase assays, the immune complexes were incubated for 30 min at 25 °C in kinase buffer containing acid-denatured rabbit muscle enolase (Sigma) and 5 µCi of [{gamma}-32P]ATP. The reaction was stopped by adding 2x SDS sample buffer and boiling the samples for 5 min. The samples were subjected to 10% SDS-PAGE and detected by autoradiography.

PI 3-Kinase Assay—The Slit and control pretreated DU4475 cells were stimulated with CXCL12 (100 ng/ml) at different time points and lysed in lysis buffer (25 mM HEPES, pH 7.4, 150 mM NaCl, 5 mM MgCl2, 0.2 mM EDTA, 0.1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml pepstatin, 10 µg/ml leupeptin, 10 µg/ml antipain, 10 µg/ml chymostatin, 100 µg/ml trypsin inhibitor, 10 mM sodium vanadate, 10 mM sodium fluoride, and 10 mM sodium pyrophosphate). PI 3-kinase activity was immunoprecipitated from 500 µg of lysates using anti-p85 antibody (Santa Cruz Biotechnology) and protein A-Sepharose CL-4B beads, as described above. The immunoprecipitates were washed once with lysis buffer followed by three washes with wash buffer containing 25 mM HEPES, pH 7.4, 150 mM NaCl, 5 mM MgCl2, and 0.2 mM EDTA. The beads were suspended in 35 µl of reaction buffer containing 25 mM HEPES, pH 7.4, 5 mM MgCl2, 0.2 mM EDTA and 5 µl of sonicated phosphatidylinositol (Sigma). The reaction was initiated with the addition of 50 µM ATP containing 5 µCi of [{gamma}-32P]ATP and, after 10 min, terminated with the addition of 300 µl of methanol, 1 N HCl (1:1). The lipids were extracted with 250 µl of CHCl3, and the organic phase containing the labeled lipids was separated and vacuumdried. The lipids were suspended in chloroform and spotted on tartrate-impregnated silica gel TLC plates (Whatman). The TLC was developed with CHCl3/CH3OH/H2O/NH4OH (90:90:20:7), and the labeled lipids were visualized by autoradiography. The labeled products were cut from the plates and measured for radioactivity.

Measurement of PTEN Activity—The Slit and control pretreated DU4475 cells were stimulated with CXCL12 (100 ng/ml) at different time points and lysed in lysis buffer without sodium vanadate. PTEN activities were measured using the PTEN Malachite Green Assay kit according to the manufacturer's protocol (Upstate Biotechnology, Inc.).

MMP Assay—MMPs were assayed either by gelatin zymography or by using MMP ELISA kits. The gelatin zymography was performed with slight modifications, as described (35). Briefly, the cell culture was maintained to 80% confluency in serum-supplemented media. The monolayer was rinsed two times with PBS. The cells were then pretreated with Slit or control preparation for 30 min and stimulated with CXCL12 under serum-free conditions. After 24 h incubation at 37 °C in 5% CO2, cell supernatants were collected and concentrated using Centricon units (Millipore). After standardization, samples were resolved on 10% SDS-PAGE containing 0.3% gelatin. Following electrophoresis, gels were washed twice in wash buffer containing 2.5% Triton X-100, 50 mM Tris-HCl, pH 7.0, 6.5 mM CaCl2, 5 µM ZnCl2, and 0.5 g per liter of NaN3. Gels were then rinsed briefly in the same buffer without Triton X-100. The gels were incubated for 24 h at 37 °C in the same buffer containing 1% Triton X-100. Subsequently, the gels were fixed and stained with Coomassie Brilliant Blue. The MMP-2 and -9 quantikine ELISAs were performed according to the manufacturer's instructions (R&D Systems).

Statistical Analysis—The results are expressed as the mean ± S.D. of data obtained from three or four experiments performed in duplicate or triplicate. Statistical significance was determined using the Student's t test.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of Robo Receptors in Breast Cancer Cells and in Normal and Malignant Breast Tissues—Slit mediates its effect by binding to Robo receptors, which are highly conserved from fruit flies to mammals (19). In mammals, four ROBO genes (ROBO 1, ROBO 2, ROBO 3, and ROBO 4) have been identified (16, 22, 23, 36). The extracellular domain of Robo 1 contains five Ig domains and three fibronectin type III repeats, whereas the intracellular region contains four identifiable conserved motifs designated CC0, CC1, CC2, and CC3. Robo 2 and Robo 3 lack the CC2 and CC3 motifs (25, 37). Total cellular RNA isolated from the DU4475 and MDA-MB-231 breast cancer cell lines was analyzed for the expression of Robo 1 and Robo 2 receptors by reverse transcriptase (RT)-PCR. As shown in Fig. 1A, both DU4475 cells and MDA-MB-231 cells expressed Robo receptors. The results were further confirmed by immunohistochemistry with Robo 1 and Robo 2 antibodies (data not shown). We further confirmed expression of the Robo receptors in breast cancer cell lines by fluorescence-activated cell sorter analysis. We found that 45% of DU4475 cells expressed Robo 2, whereas 20% of the cells expressed Robo 1. In contrast, 35% of MDA-MB-231 cells expressed Robo 1, whereas 21% of the cells expressed Robo 2 (Fig. 1B).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 1.
Expression of Robo mRNA in DU4475 and MDA-MB-231 cells. A, RNA isolated from breast cancer cells was subjected to RT-PCR analysis with primers amplifying human Robo 1 (R1) and Robo 2 (R2) using the TITANIUMTM one-step RT-PCR kit as described under "Experimental Procedures." The PCR was carried out with an annealing temperature of 60 °C. Mouse liver total RNA and control mouse {beta}-Actin Primer mix were used for the positive control, and PCR enzyme mix without reverse transcriptase was taken as the negative control. M, marker. B, DU4475 (i) or MDA-MB-231 (ii) cells (1 x 106) were treated with Robo 1, Robo 2 (solid lines), or normal goat IgG antibodies as a control (dotted lines) and stained with anti-goat antibody conjugated with fluorescein isothiocyanate. Cells were analyzed by flow cytometry.

 
We also examined the expression of Robo 1 and Robo 2 by immunohistochemistry of various breast cancer tissues obtained from the Co-operative Human Tissue Network (Philadelphia, PA). As shown in Fig. 2, Robo 1 and Robo 2 were expressed by the breast cancer tissues. We also observed Robo expression in several other breast cancer samples (data not shown). Some of these tissues showed a variation in the level of Robo 1 and Robo 2. For example, some sections showed more of Robo 2 than of Robo 1 and vice versa (data not shown).



View larger version (119K):
[in this window]
[in a new window]
 
FIG. 2.
Expression profile of Robo in breast cancer tissues. Paraffin-mounted slides of patient-derived breast cancer tissues were processed for immunohistochemistry analysis as described under "Experimental Procedures" using the DAB staining kit. The slides were stained for Robo 1, Robo 2, or control IgG (AbC) and then developed with DAB as substrate, mounted with aqua mount, and photographed. Breast cancer tissue slides were also stained for hematoxylin and eosin (H&E) to check the pathology of the tissue section.

 
Slit Inhibits CXCL12-induced Breast Cancer Cell Migration, Chemoinvasion, and Cell Adherence—Because CXCL12 has been shown to induce breast cancer cell chemotaxis, we analyzed whether Slit-mediated Robo receptor activation could modulate this CXCL12-induced chemotaxis. The breast cancer cells were preincubated with Slit or control preparation and then analyzed for chemotaxis toward CXCL12. As shown, the chemotactic response of the DU4475 (Fig. 3A) and MDA-MB-231 (Fig. 3B) breast cancer cells was inhibited significantly in the presence of Slit as compared with the control sample. Furthermore, Slit was also able to block the CXCL12-induced chemoinvasion of MDA-MB-231 cells (Fig. 3C). We also studied the effect of Slit on the CXCL12-induced adhesive property of breast cancer cells. As shown in Fig. 3D, Slit pretreatment significantly inhibited the CXCL12-mediated adhesion of breast cancer cells to fibronectin- and collagen-coated plates.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3.
Slit blocks CXCL12-induced chemotaxis, chemoinvasion, and cell adhesion. DU4475 (A) or MDA-MB-231 (B–D) breast cancer cells were pretreated with varying concentrations of Slit (µg/ml) or control (µg/ml), treated with CXCL12 (10 nM), and then subjected to chemotactic (A and B) or chemoinvasion (C) assays as described under "Experimental Procedures." D, MDA-MB-231 cells were grown on plastic or on plates precoated with either fibronectin (25 µg/ml) or collagen IV (Col IV, precast). The cells were then untreated or treated with CXCL12 alone or together with partially purified Slit or control preparation. Adherent cells were analyzed by using the Roche Applied Science MTT Cell Proliferation Assay kit. The experiments were done in triplicate and are represented as the mean ± S.E. The data are representative of four different experiments. The % chemoinvasion was calculated by using the following equation: ((mean number of cells invading through the membrane/mean number of cells migrating through the control membrane) x 100). The % cell adhesion was calculated by considering the optical density of the untreated control as 100%. *, p < 0.05 for all experiments.

 
To confirm further that Slit inhibits CXCL12-induced chemotaxis, Slit was immunodepleted from the concentrated Slit supernatants using anti-Myc antibody. As a control, the control supernatants were also immunodepleted. The immunodepleted supernatants were then analyzed for their inhibitory activities. We found that the Slit immunodepleted supernatants were not able to inhibit the chemotaxis of breast cancer cells in response to CXCL12 (Fig. 4A). We next determined the anti-chemotactic activity of highly purified Slit. Slit was purified using the Superdex 200 FPLC system, and the purity of the sample was determined by silver staining and immunoblotting with c-Myc antibody (data not shown). We observed that purified Slit was able to block CXCL12-induced chemotaxis in a dose-dependent manner, with maximum inhibition obtained at 250 ng/ml (1.3 nM) of Slit (Fig. 4B). Because Slit acts as a non-competitive antagonist to CXCL12-mediated chemotaxis, the Ki value is equal to the IC50 value, the concentration of antagonist that inhibits the response by 50% (38). The IC50 of Slit was found to be 111 ng/ml based on linear interpolation. Therefore, the Ki value of Slit is ~111 ng/ml. We also studied the effect of purified Slit on the chemotaxis induced by different concentrations of CXCL12. As shown in Fig. 4C, we observed that Slit blocks chemotaxis induced by higher CXCL12 concentrations (500 ng/ml). These results indicate that Slit could induce inhibition of chemotaxis, chemoinvasion, and adhesion through the down-regulation of the CXCR4 receptor or by inhibiting the binding of CXCL12 to the CXCR4 receptor.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4.
Effect of Slit immunodepleted supernatant and purified Slit on chemotaxis. A, the Slit or control supernatant concentrates were incubated with anti-Myc antibodies for 1 h at 4 °C, followed by overnight incubation with protein A-Sepharose. The beads were removed by centrifugation, and the supernatant was used as the immunodepleted sample (I.D.). DU4475 breast cancer cells were pretreated with the immunodepleted control (Control I.D., 100 µg/ml), immunodepleted Slit (Slit I.D., 100 µg/ml), or the undepleted concentrates (either Slit or control; 100 µg/ml). The cells were untreated (UN) or treated with CXCL12 as indicated and then subjected to chemotactic assays. B, the DU4475 breast cancer cells were pretreated with FPLC-purified Slit at varying concentrations as indicated and then subjected to chemotactic assays using CXCL12 (10 nM). The IC50 value (111 ng/ml) was determined by using linear interpolation. *, p < 0.05. C, shows a chemotactic assay in the presence of purified Slit using different concentrations of CXCL12. Experiments were repeated three times, and a representative experiment is shown.

 
We therefore next examined CXCR4 receptor expression on DU4475 breast cancer cells after exposure to CXCL12, Slit, or the combination of CXCL12 and Slit. As shown in Fig. 5A, Slit pretreatment had no effect on CXCR4 expression. Furthermore, Slit pretreatment did not alter the down-modulation of the CXCR4 receptor induced by CXCL12. These results suggest that Slit has no effect on CXCR4 receptor levels in DU4475 cells.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 5.
Role of Slit in CXCL12-mediated CXCR4 down-modulation and CXCL12 binding to CXCR4. A, DU4475 cells preincubated with Slit (100 µg/ml) were stimulated for different time points with or without CXCL12 (10 nM) or with CXCL12 alone, as indicated. The cells were collected and analyzed for CXCR4 surface expression by fluorescence-activated cell sorter, as described under "Experimental Procedures." The figure is representative of three different experiments. B, effect of Slit on CXCL12 binding to CXCR4. Binding of 125I-labeled CXCL12 in the presence of various concentrations of Slit or unlabeled CXCL12 (100 ng/ml) was performed in DU4475 cells as described under "Experimental Procedures." The data are shown as the mean ± S.E. of three independent experiments.

 
Moreover, we did not observe any significant change in 125I-CXCL12 binding to CXCR4 in DU4475 cells in the presence of different concentrations of Slit. However, unlabeled CXCL12 (100 ng/ml) did inhibit 125I-CXCL12 binding to CXCR4 (Fig. 5B). This suggests that Slit does not actively compete with CXCL12 for binding to the CXCR4 receptor.

Slit Inhibits the Phosphorylation of CXCL12/CXCR4-mediated Focal Adhesion Components—We next examined which signaling pathways might be inhibited following treatment with the Slit protein. Currently, the signaling pathways that modulate chemotactic pathways remain imprecisely defined. One possible mechanism whereby Slit could inhibit chemotaxis is through modulation of the components of focal adhesion complexes, which are involved in cell shape, movement, and invasion. The focal adhesion components, FAK and RAFTK/Pyk2, have been shown to interact with various signaling molecules such as Src kinases, adaptor molecules, PI 3-kinase, and Src homology 2-containing phosphatases through various tyrosine-containing motifs (3941). We determined the effect of Slit on the phosphorylation of various tyrosine motifs of these proteins using tyrosine site-specific antibodies. As shown, Slit treatment specifically blocks the tyrosine phosphorylation of RAFTK at residues 580 and 881 (Fig. 6A) and of FAK at residue 576 (Fig. 6B). Equal amounts of RAFTK and FAK proteins were present in each sample (Fig. 6, A and B, bottom panels). In addition, we observed that Slit treatment inhibits the CXCL12-induced tyrosine phosphorylation of paxillin, a major cytoskeletal component of focal adhesions (Fig. 6C).



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 6.
Effect of Slit on the CXCL12-induced tyrosine phosphorylation of focal adhesion molecules. Slit (100 µg/ml) or control (100 µg/ml) pretreated DU4475 cells were unstimulated (0) or stimulated with CXCL12 (10 nM) for the indicated time points. The cells were lysed, and the lysates were analyzed by serial immunoblotting with antibodies recognizing the site-specific tyrosine-phosphorylated residues of RAFTK (A) or FAK (B). The blots were stripped and probed with RAFTK (A, bottom panel) or FAK (B, bottom panel) antibodies. C, the stimulated cell lysates were immunoprecipitated (I.P.) with anti-paxillin antibodies. The immune complexes were resolved on SDS-PAGE and Western-blotted (W.B.) with anti-phosphotyrosine antibodies (pY99)(C, upper panel). The same blots were stripped and reprobed with anti-paxillin (C, bottom panel) antibody. Ab, antibody control; TCL, total cell lysates.

 
Effect of Slit on Src and PI 3-Kinase Activities—Src kinase and PI 3-kinase have been shown to associate with FAK and RAFTK/Pyk2 (39, 40). It is now well established that Src and PI 3-kinase play a crucial role in the signaling pathways implicated in cellular migration and adherence (4244). Src and PI 3-kinase have been shown to regulate the phosphorylation and activation of various signaling molecules including FAK and RAFTK/Pyk2. We observed that Slit pretreatment inhibits CXCL12-induced Src kinase (Fig. 7A) and PI 3-kinase activities (Fig. 7B). Because PI 3-kinase activity is regulated by PTEN (45, 46), we further analyzed whether Slit blocks PI 3-kinase by inhibiting the activity of PTEN. As shown in Fig. 7C, Slit treatment had no effect on PTEN activity. These data suggest that Slit does not regulate PI 3-kinase by modulating PTEN activity.



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 7.
Slit blocks CXCL12-induced Src kinase and PI 3-kinase activation. DU4475 cells were preincubated with Slit (100 µg/ml) or control (100 µg/ml) and stimulated with CXCL12 (10 nM) for the indicated time points. The stimulated cells were lysed, and equal amounts of protein lysates were immunoprecipitated with either Src kinase antibodies (A) or p85 antibodies (B). The immune complexes were subjected to in vitro kinase assays as described under "Experimental Procedures." For the Src kinase activity, enolase was used as a substrate (A). The p85 immunoprecipitates were assayed for PI 3-kinase activity with phosphatidylinositol and radiolabeled ATP as substrates. The radiolabeled lipids were then extracted and chromatographed on silica gel TLC plates. The labeled lipids were then visualized by autoradiography. The experiment was done three times, and a representative experiment is shown. C, the cell lysates were analyzed for PTEN activity by using the Malachite Green Assay kit with phosphatidylinositol 3,4,5-trisphosphate as substrate. The inorganic phosphate liberated was detected by following the procedures of the assay kit. Absorbance was measured at 650 nm. The activity of PTEN is represented as picomoles of phosphate/µg of protein. The values are shown as the mean ± S.E. of three independent experiments.

 
Slit Blocks p44/42 but Not p38 and JNK Kinase Activities— MAP kinases are known to play a pivotal role in regulating the proliferation and chemotaxis of many cells (47, 48). We investigated the effect of Slit on different MAPK pathways, namely p44/42 (ERKs), SAPK2/p38, and SAPK1/JNK. As shown in Fig. 8, Slit treatment abrogated the p44/42 activation induced by CXCL12, whereas under similar conditions, it had no noticeable effect on JNK or p38 kinase activities.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 8.
Slit specifically inhibits CXCL12-induced p44/42 MAP kinase activity. Cell lysates were obtained from Slit (100 µg/ml) or control (100 µg/ml) pretreated DU4475 cells after stimulation with CXCL12 (10 nM). The lysates were immunoprecipitated with p44/42 (A), p38 MAP kinase (B), or JNK kinase (C) antibodies. The immune complex for p44/42 was run on SDS-PAGE and immunoblotted with phospho-p44/42 antibody (p-p44/42) (A, upper panel). The protein levels were monitored by stripping the blot and reprobing with anti-p44/42 antibodies (A, lower panel). The p38 MAP kinase and JNK immunoprecipitates were subjected to in vitro kinase assay using myelin basic protein (MBP) and c-Jun, respectively, along with labeled ATP as substrates.

 
Slit Inhibits the Activities of Matrix Metalloproteinases-2 and -9 —Matrix metalloproteinases (MMPs) are a family of structurally related zinc-dependent neutral endopeptidases that are involved in the extracellular matrix degradation required for migration (49, 50). A recent investigation suggests that chemokine-mediated regulation of MMP activity plays an important role in transmigration (49). Moreover, MMPs have been shown to contribute actively toward cancer progression and metastasis. We observed an increase in the expression of MMP-2 upon stimulation of MDA-MB-231 cells with CXCL12. This increase in the level of MMP-2 expression was seen to be blocked by Slit in comparison to the control (Fig. 9A). CXCL12-induced MMP-2 and MMP-9 activities were also considerably inhibited in cells pretreated with Slit as compared with the control-treated cells (Fig. 9, B and C). The data were further confirmed by using the MMP quantikine ELISA kit. Fig. 9 (D and E) shows that the CXCL12-induced expression of MMP-9 and MMP-2 was inhibited by Slit pretreatment, whereas control pretreatment had no effect on MMP-9 or MMP-2 activity.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 9.
Slit blocks CXCL12-induced MMP activity. Conditioned media were concentrated from MDA-MB-231 cells pretreated with partially purified Slit (100 µg/ml) or control preparation (100 µg/ml) in the presence of CXCL12 (10 nM). Equal volumes of the concentrates were analyzed for the level of MMP-2 by using immunoblot analysis with anti-MMP-2 antibodies (A). For the gelatin zymography, similar volumes of concentrates were loaded with Laemmli buffer without boiling and run on 10% SDS-polyacrylamide gels containing 0.3% gelatin. The gel was then stained with Coomassie Blue (B). The activity of MMP was quantified by inverting the image and scanning for band intensity (C). The gelatin zymography was done four times, and the experiment is a representative one. The graph depicts the average negative band intensity based on four different experiments. Data are represented as the mean ± S.E. MDA-MB-231 cells were pretreated with partially purified Slit or control preparation as indicated, followed by stimulation with or without CXCL12 (100 ng/ml). The supernatant concentrates from these samples were then assayed for MMP-2 (D) and MMP-9 (E) expression using quantikine ELISA. *, p < 0.05 for all experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we demonstrate that the secreted protein Slit down-modulates the CXCL12/CXCR4-mediated chemotaxis, chemoinvasion, and adhesion of breast cancer cells. These processes are critical steps in the intricate process leading to metastasis. Previously, Slit was known to be involved in axon guidance decisions and to play a critical role in determining the pattern of commissural neurons (1319). However, evidence is growing that supports the involvement of Slit family members in carcinogenesis (28, 51). Recently, Slit-2 was shown to be frequently inactivated in lung and breast cancers due to hypermethylation of its promoter region (28, 52). Furthermore, Slit-2 was demonstrated to act as a tumor suppressor because the ectopic expression of Slit-2 protein in several breast cancer cell lines inhibited cell growth and reduced colony formation abilities (28).

Thus, inactivation of Slit could enhance the CXCL12/CXCR4-mediated chemotaxis of breast cancer cells. It has been reported that more motile tumor cells may have increased metastatic potential (53). Furthermore, the CXCL12/CXCR4 axis has been shown recently(5) to play an important role in the homing of breast cancer cells to sites of metastasis such as bone, lung, and lymph nodes. Moreover, a marked reduction of lymph node and lung metastasis was observed in mice injected with neutralizing antibody against CXCR4 (5). In addition, the CXCL12-CXCR4 complex has been shown to be involved in prostate and ovarian cancer metastasis (8, 9).

Slit mediates its function by binding to the Robo receptors. Robo defines a novel subfamily of immunoglobulin superfamily proteins and is highly conserved from fruit flies to mammals (19). Four different Robo family members have been reported (16, 22, 23, 36). In the present study, we observed differences in expression patterns between Robo receptor family members in breast cancer cells. MDA-MB-231 cells were shown to express more of the Robo 1 receptor, whereas DU4475 cells expressed more of the Robo 2 receptor. We also observed Robo 1 and Robo 2 expression in breast cancer tissues derived from cancer patients. ROBO gene inactivation due to hypermethylation of its promoter region has also been reported in breast cancer patients, suggesting the importance of Robo in the development of breast cancer (28).

Most of the work on Slit-mediated inhibition of chemotaxis has been done in the neuronal system. Furthermore, not much is known about Slit-induced signaling pathways that block chemotaxis. We entertained a different hypothesis, namely that Slit could abrogate CXCL12/CXCR4-induced chemotaxis, chemoinvasion, and adhesion mechanisms. Because down-modulation of the CXCR4 receptor could lead to inhibition of its activity, we considered whether CXCR4 receptor expression might be reduced by Slit treatment. We did not detect down-regulation of the CXCR4 receptor upon Slit treatment. This suggests that alteration in CXCR4 expression may not regulate Slit-mediated inhibition of chemotactic mechanisms in breast cancer cells.

Slit may regulate chemotaxis by modulating the proteintyrosine kinase pathway. The protein-tyrosine kinase pathway regulates cell motility by modulating focal adhesions, which consist of a complex assembly of cytoskeletal proteins (54). These structures are important for cell migration (54). We observed that Slit blocks the activity of Src kinases, which are known to be involved in focal adhesion dynamics. The Src substrates include FAK, RAFTK (Pyk2), and paxillin, which are components of focal adhesions (39, 40). In our study, Slit treatment inhibited the phosphorylation of RAFTK at residues 580 and 881, FAK at residue 576, as well as paxillin. Tyrosine residue 580 of RAFTK and 576 of FAK are present in the catalytic loop of these molecules and enhance their function. Src has been shown to phosphorylate the 576 site of FAK. This suggests that Src inhibition leads to decreased tyrosine phosphorylation of RAFTK and FAK at these residues. c-Src has been shown to play a key role in regulating focal adhesions (41). It has been reported that c-Src-transformed cells have morphologically abnormal focal adhesions and are defective in cell substrate adhesion (55). RAFTK, which is a novel member of the focal adhesion kinase family, acts as a "platform kinase" and links chemokine receptors to the nucleus via the MAP kinase pathway and cytoskeleton in blood cells (40). It has been shown that RAFTK mediated the activation of MAP kinase in PC12 cells (56). RAFTK and FAK have also been shown to associate with paxillin through their proline-rich C-terminal domains (40). In neuronal cells, Slit has been shown to affect actin cytoskeleton organization through the family of GTPase-activating proteins and N-cadherins (57, 58).

In our study, pretreatment with Slit inhibited CXCL12-induced PI 3-kinase activity. Accumulating data have shown that multiple signaling mechanisms exist to regulate cell migration. PI 3-kinase, the tyrosine phosphatase-SHP2, and adaptor protein Cbl have been shown to regulate CXCL12-induced chemotaxis in T-cells (29, 42, 5961). The role of PI 3-kinase in cell migration has been confirmed in studies of cells obtained from the knock-out mice of these proteins (59). Src kinases are known to activate PI 3-kinase, which has been shown to associate with many signaling molecules including RAFTK and FAK (62). Decreased Src kinase activation, followed by reduced phosphorylation of RAFTK and FAK, may be involved in the Slit-mediated inhibition of chemotaxis. Moreover, PI 3-kinase activity is regulated by PTEN (4546). However, Slit had no effect on PTEN activity. This suggests that Slit-mediated inhibition of PI 3-kinase is not regulated through the PTEN pathway.

We also investigated the effect of Slit on the downstream pathways that are known to mediate transcriptional activation. Slit was shown to inhibit selectively p44/42 MAP kinase but had no effect on p38 MAP kinase or JNK. Previous studies (63) have reported that CXCL12 selectively induces the activity of p44/42 MAP kinase in the pre-B-cell line, L1.2. Cell adhesion has been shown to activate p44/42 MAP kinase (64). The p44/42 MAP signaling pathway can inhibit cell motility either by regulating gene expression or by its inability to activate myosin light chain kinase (64). However, in the case of T-cells, the p44/42 MAP kinase does not regulate CXCL12-induced chemotaxis (29).

Slit was also seen to influence the interaction of breast cancer cells with the matrix environment by regulating the secretion of MMPs-2 and -9. These enzymes are known to play a pivotal role in tumor metastasis and invasion by the proteolytic degradation of extracellular matrix (49). Recently, CXCL12 was shown to increase MMP-2 and MMP-9 in normal hematopoietic CD34+ cells and MMP-2 activity in rhabdomyosarcoma cells (65, 66).

Taken together, our results provide new information regarding Slit-mediated reductions in CXCL12-induced processes, such as chemotaxis, adhesion, chemoinvasion, and MMP-2 and -9 secretion that are related to metastatic/invasive behaviors in breast cancer cells. Furthermore, our results also provide new information about how Slit may act at a molecular level to regulate CXCL12/CXCR4-mediated signaling pathways. These findings add a new dimension to our understanding of chemokine-mediated metastasis and also open up a new era of potential therapeutic interventions.


    FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence should be addressed: Harvard Institutes of Medicine, BIDMC, 4 Blackfan Circle, Room 343, Boston, MA 02115. Tel.: 617-667-0060; Fax: 617-975-5240; E-mail: rganju{at}bidmc.harvard.edu.

1 The abbreviations used are: Robo, Roundabout; FAK, focal adhesion kinase; FBS, fetal bovine serum; RIPA, radioimmunoprecipitation assay; PI, phosphatidylinositol; RAFTK, Related adhesion focal tyrosine kinase; MAP, mitogen-activated protein; RT, reverse transcriptase; JNK, c-Jun N-terminal kinase; PBS, phosphate-buffered saline; DAB, 3,3'-diaminobenzidine; DMEM, Dulbecco's modified Eagle's medium; FN, fibronectin; ELISA, enzyme-linked immunosorbent assay; MMPs, matrix metalloproteinases; FPLC, fast purified liquid chromatography phosphatase and tensin homologue deleted on chromosome ten. Back


    ACKNOWLEDGMENTS
 
We thank Janet Delahanty for editing the manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hyder, S. M., Chiappetta, C., and Stancel, G. M. (2001) Int. J. Cancer 92, 469-473[CrossRef][Medline] [Order article via Infotrieve]
  2. Kim, H., and Muller, W. J. (1999) Exp. Cell Res. 253, 78-87[CrossRef][Medline] [Order article via Infotrieve]
  3. McEarchern, J. A., Kobie, J. J., Mack, V., Wu, R. S., Meade-Tollin, L., Arteaga, C. L., Dumont, N., Besselsen, D., Seftor, E., Hendrix, M. J., Katsanis, E., and Akporiaye, E. T. (2001) Int. J. Cancer 91, 76-82[CrossRef][Medline] [Order article via Infotrieve]
  4. Verbeek, B. S., Adriaansen-Slot, S. S., Vroom, T. M., Beckers, T., and Rijksen, G. (1998) FEBS Lett. 425, 145-150[CrossRef][Medline] [Order article via Infotrieve]
  5. Muller, A., Homey, B., Soto, H., Ge, N., Catron, D., Buchanan, M. E., McClanahan, T., Murphy, E., Yuan, W., Wagner, S. N., Barrera, J. L., Mohar, A., Verastegui, E., and Zlotnik, A. (2001) Nature 410, 50-56[CrossRef][Medline] [Order article via Infotrieve]
  6. Youngs, S. J., Ali, S. A., Taub, D. D., and Rees, R. C. (1997) Int. J. Cancer 71, 257-266[CrossRef][Medline] [Order article via Infotrieve]
  7. Hilakivi-Clarke, L. (2000) Cancer Res. 60, 4993-5001[Abstract/Free Full Text]
  8. Taichman, R. S., Cooper, C., Keller, E. T., Pienta, K. J., Taichman, N. S., and McCauley, L. K. (2002) Cancer Res. 62, 1832-1837[Abstract/Free Full Text]
  9. Scotton, C. J., Wilson, J. L., Scott, K., Stamp, G., Wilbanks, G. D., Fricker, S., Bridger, G., and Balkwill, F. R. (2002) Cancer Res. 62, 5930-5938[Abstract/Free Full Text]
  10. Robledo, M. M., Bartolome, R. A., Longo, N., Rodriguez-Frade, J. M., Mellado, M., Longo, I., van Muijen, G. N., Sanchez-Mateos, P., and Teixido, J. (2001) J. Biol. Chem. 276, 45098-45105[Abstract/Free Full Text]
  11. Moore, B. B., Arenberg, D. A., Stoy, K., Morgan, T., Addison, C. L., Morris, S. B., Glass, M., Wilke, C., Xue, Y. Y., Sitterding, S., Kunkel, S. L., Burdick, M. D., and Strieter, R. M. (1999) Am. J. Pathol. 154, 1503-1512[Abstract/Free Full Text]
  12. Wu, J. Y., Feng, L., Park, H. T., Havlioglu, N., Wen, L., Tang, H., Bacon, K. B., Jiang, Z., Zhang, X., and Rao, Y. (2001) Nature 410, 948-952[CrossRef][Medline] [Order article via Infotrieve]
  13. Wong, K., Park, H. T., Wu, J. Y., and Rao, Y. (2002) Curr. Opin. Genet. Dev. 12, 583-591[CrossRef][Medline] [Order article via Infotrieve]
  14. Bashaw, G. J., and Goodman, C. S. (1999) Cell 97, 917-926[CrossRef][Medline] [Order article via Infotrieve]
  15. Wu, W., Wong, K., Chen, J., Jiang, Z., Dupuis, S., Wu, J. Y., and Rao, Y. (1999) Nature 400, 331-336[CrossRef][Medline] [Order article via Infotrieve]
  16. Li, H. S., Chen, J. H., Wu, W., Fagaly, T., Zhou, L., Yuan, W., Dupuis, S., Jiang, Z. H., Nash, W., Gick, C., Ornitz, D. M., Wu, J. Y., and Rao, Y. (1999) Cell 96, 807-818[CrossRef][Medline] [Order article via Infotrieve]
  17. Fernandis, A. Z., and Ganju, R. K. (2001) Science's STKE http:/www.stke.org/cgi/content/full/OC_sigtrans;2001/E1
  18. Chen, J. H., Wen, L., Dupuis, S., Wu, J. Y., and Rao, Y. (2001) J. Neurosci. 21, 1548-1556[Abstract/Free Full Text]
  19. Ghose, A., and Van Vactor, D. (2002) BioEssays 24, 401-404[CrossRef][Medline] [Order article via Infotrieve]
  20. Holmes, G. P., Negus, K., Burridge, L., Raman, S., Algar, E., Yamada, T., and Little, M. H. (1998) Mech. Dev. 79, 57-72[CrossRef][Medline] [Order article via Infotrieve]
  21. Itoh, A., Miyabayashi, T., Ohno, M., and Sakano, S. (1998) Brain Res. Mol. Brain Res. 62, 175-186[Medline] [Order article via Infotrieve]
  22. Brose, K., Bland, K. S., Wang, K. H., Arnott, D., Henzel, W., Goodman, C. S., Tessier-Lavigne, M., and Kidd, T. (1999) Cell 96, 795-806[CrossRef][Medline] [Order article via Infotrieve]
  23. Yuan, W., Zhou, L., Chen, J. H., Wu, J. Y., Rao, Y., and Ornitz, D. M. (1999) Dev. Biol. 212, 290-306[CrossRef][Medline] [Order article via Infotrieve]
  24. Kidd, T., Brose, K., Mitchell, K. J., Fetter, R. D., Tessier-Lavigne, M., Goodman, C. S., and Tear, G. (1998) Cell 92, 205-215[CrossRef][Medline] [Order article via Infotrieve]
  25. Stein, E., and Tessier-Lavigne, M. (2001) Science 291, 1928-1938[Abstract/Free Full Text]
  26. Bashaw, G. J., Kidd, T., Murray, D., Pawson, T., and Goodman, C. S. (2000) Cell 101, 703-715[CrossRef][Medline] [Order article via Infotrieve]
  27. Seeger, M., Tear, G., Ferres-Marco, D., and Goodman, C. S. (1993) Neuron 10, 409-426[CrossRef][Medline] [Order article via Infotrieve]
  28. Dallol, A., Da Silva, N. F., Viacava, P., Minna, J. D., Bieche, I., Maher, E. R., and Latif, F. (2002) Cancer Res. 62, 5874-5880[Abstract/Free Full Text]
  29. Cherla, R. P., and Ganju, R. K. (2001) J. Immunol. 166, 3067-3074[Abstract/Free Full Text]
  30. Fernandis, A. Z., Cherla, R. P., and Ganju, R. K. (2003) J. Biol. Chem. 278, 9536-9543[Abstract/Free Full Text]
  31. Fernandis, A. Z., Cherla, R. P., Chernock, R. D., and Ganju, R. K. (2002) J. Biol. Chem. 277, 18111-18117[Abstract/Free Full Text]
  32. Salcedo, R., Wasserman, K., Young, H. A., Grimm, M. C., Howard, O. M., Anver, M. R., Kleinman, H. K., Murphy, W. J., and Oppenheim, J. J. (1999) Am. J. Pathol. 154, 1125-1135[Abstract/Free Full Text]
  33. Ganju, R. K., Dutt, P., Wu, L., Newman, W., Avraham, H., Avraham, S., and Groopman, J. E. (1998) Blood 91, 791-797[Abstract/Free Full Text]
  34. Munshi, N., Ganju, R. K., Avraham, S., Mesri, E. A., and Groopman, J. E. (1999) J. Biol. Chem. 274, 31863-31867[Abstract/Free Full Text]
  35. Barrett, J. M., Puglia, M. A., Singh, G., and Tozer, R. G. (2002) Breast Cancer Res. Treat. 72, 227-232[CrossRef][Medline] [Order article via Infotrieve]
  36. Huminiecki, L., Gorn, M., Suchting, S., Poulsom, R., and Bicknell, R. (2002) Genomics 79, 547-552[CrossRef][Medline] [Order article via Infotrieve]
  37. Chisholm, A., and Tessier-Lavigne, M. (1999) Curr. Opin. Neurobiol. 9, 603-615[CrossRef][Medline] [Order article via Infotrieve]
  38. Taylor, P., and Insel, P. A. (1990) Principles of Drug Action (Pratt, W. B., and Taylor, P., eds) 3rd Ed., pp. 1-102, Churchill Livingstone, Inc., New York
  39. Park, S. Y., Avraham, H., and Avraham, S. (2000) J. Biol. Chem. 275, 19768-19777[Abstract/Free Full Text]
  40. Avraham, H., Park, S. Y., Schinkmann, K., and Avraham, S. (2000) Cell. Signal. 12, 123-133[CrossRef][Medline] [Order article via Infotrieve]
  41. Schlaepfer, D. D., Hauck, C. R., and Sieg, D. J. (1999) Prog. Biophys. Mol. Biol. 71, 435-478[CrossRef][Medline] [Order article via Infotrieve]
  42. Chernock, R. D., Cherla, R. P., and Ganju, R. K. (2001) Blood 97, 608-615[Abstract/Free Full Text]
  43. Woods, M. L., and Shimizu, Y. (2001) J. Leukocyte Biol. 69, 874-880[Abstract/Free Full Text]
  44. Gold, M. R., Ingham, R. J., McLeod, S. J., Christian, S. L., Scheid, M. P., Duronio, V., Santos, L., and Matsuuchi, L. (2000) Immunol. Rev. 176, 47-68[CrossRef][Medline] [Order article via Infotrieve]
  45. Sulis, M. L., and Parsons, R. (2003) Trends Cell Biol. 13, 478-483[CrossRef][Medline] [Order article via Infotrieve]
  46. Choi, Y., Zhang, J., Murga, C., Yu, H., Koller, E., Monia, B. P., Gutkind, J. S., and Li, W. (2002) Oncogene 21, 5289-5300[CrossRef][Medline] [Order article via Infotrieve]
  47. Kampen, G. T., Stafford, S., Adachi, T., Jinquan, T., Quan, S., Grant, J. A., Skov, P. S., Poulsen, L. K., and Alam, R. (2000) Blood 95, 1911-1917[Abstract/Free Full Text]
  48. Zhan, Y., Kim, S., Izumi, Y., Izumiya, Y., Nakao, T., Miyazaki, H., and Iwao, H. (2003) Arterioscler. Thromb. Vasc. Biol. 23, 795-801[Abstract/Free Full Text]
  49. Nabeshima, K., Inoue, T., Shimao, Y., and Sameshima, T. (2002) Pathol. Int. 52, 255-264[CrossRef][Medline] [Order article via Infotrieve]
  50. Itoh, Y., and Nagase, H. (2002) Essays Biochem. 38, 21-36[Medline] [Order article via Infotrieve]
  51. Latil, A., Chene, L., Cochant-Priollet, B., Mangin, P., Fournier, G., Berthon, P., and Cussenot, O. (2003) Int. J. Cancer 103, 306-315[CrossRef][Medline] [Order article via Infotrieve]
  52. Xian, J., Clark, K. J., Fordham, R., Pannell, R., Rabbitts, T. H., and Rabbitts, P. H. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 15062-15066[Abstract/Free Full Text]
  53. van Golen, K. L. (2003) Breast Cancer Res. 5, 174-179[Medline] [Order article via Infotrieve]
  54. Guan, J. L. (1997) Int. J. Biochem. Cell Biol. 29, 1085-1096[CrossRef][Medline] [Order article via Infotrieve]
  55. Verbeek, B. S., Vroom, T. M., and Rijksen, G. (1999) Exp. Cell Res. 248, 531-537[CrossRef][Medline] [Order article via Infotrieve]
  56. Soltoff, S. P., Avraham, H., Avraham, S., and Cantley, L. C. (1998) J. Biol. Chem. 273, 2653-2660[Abstract/Free Full Text]
  57. Wong, K., Ren, X. R., Huang, Y. Z., Xie, Y., Liu, G., Saito, H., Tang, H., Wen, L., Brady-Kalnay, S. M., Mei, L., Wu, J. Y., Xiong, W. C., and Rao, Y. (2001) Cell 107, 209-221[CrossRef][Medline] [Order article via Infotrieve]
  58. Rhee, J., Mahfooz, N. S., Arregui, C., Lilien, J., Balsamo, J., and VanBerkum, M. F. (2002) Nat. Cell Biol. 4, 798-805[CrossRef][Medline] [Order article via Infotrieve]
  59. Hirsch, E., Katanaev, V. L., Garlanda, C., Azzolino, O., Pirola, L., Silengo, L., Sozzani, S., Mantovani, A., Altruda, F., and Wymann, M. P. (2000) Science 287, 1049-1053[Abstract/Free Full Text]
  60. Saxton, T. M., and Pawson, T. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 379