JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M313507200 on December 29, 2003

J. Biol. Chem., Vol. 279, Issue 12, 11006-11015, March 19, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/12/11006    most recent
M313507200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hesselager, M.
Right arrow Articles by Ahring, P. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hesselager, M.
Right arrow Articles by Ahring, P. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

pH Dependency and Desensitization Kinetics of Heterologously Expressed Combinations of Acid-sensing Ion Channel Subunits*

Mette Hesselager, Daniel B. Timmermann, and Philip K. Ahring{ddagger}

From the NeuroSearch A/S, Pederstrupvej 93, DK-2750 Ballerup, Denmark

Received for publication, December 10, 2003 , and in revised form, December 26, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The exact subunit combinations of functional native acid-sensing ion channels (ASICs) have not been established yet, but both homomeric and heteromeric channels are likely to exist. To determine the ability of different subunits to assemble into heteromeric channels, a number of ASIC1a-, ASIC1b-, ASIC2a-, ASIC2b-, and ASIC3-containing homo- and heteromeric channels were studied by whole-cell patch clamp recordings with respect to pH sensitivity, desensitization kinetics, and level of sustained current normalized to peak current. Analyzing and comparing data for these three features demonstrated unique heteromeric channels in a number of co-expression experiments. Formation of heteromeric ASIC1a+2a and ASIC1b+2a channels was foremost supported by the desensitization characteristics that were independent of proton concentration, a feature none of the respective homomeric channels has. Several lines of evidence supported formation of ASIC1a+3, ASIC1b+3, and ASIC2a+3 heteromeric channels. The most compelling was the desensitization characteristics, which, besides being proton-independent, were faster than those of any of the respective homomeric channels. ASIC2b, which homomerically expressed is not activated by protons per se, did not appear to form unique heteromeric combinations with other subunits and in fact appeared to suppress the function of ASIC1b. Co-expression of three subunits such as ASIC1a+2a+3 and ASIC1b+2a+3 resulted in data that could best be explained by coexistence of multiple channel populations within the same cell. This observation seems to be in good agreement with the fact that ASIC-expressing sensory neurons display a variety of acid-evoked currents.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
It is well established that tissue acidification, which may be present in inflammatory and ischemic conditions, causes pain (13). In line with this, peripheral sensory neurons exhibit sensitivity toward acid by activating several types of depolarizing currents (46). Although the repertoire of ion channels responsible for these currents is not fully known, the family of acid-sensing ion channels (ASICs)1 is believed to be an important constituent. The ASIC family is a member of the ENaC/DEG superfamily, which also includes the amiloride-sensitive epithelial sodium channels (ENaCs), the mechanically gated degenerins of Caenorhabditis elegans (DEGs), and a neuropeptide-gated channel of Helix aspersa (FaNaC). The membrane topology of all channels within this superfamily comprises two transmembrane domains, intracellular N and C termini and a large extracellular loop with a number of conserved cysteine residues (7). Currently, four genes encoding six ASIC transcripts have been cloned and characterized from mammalian organisms. ASIC1a (BNaC2) and ASIC1b (ASIC1{beta}) are the products of alternatively spliced transcripts of the ASIC1 gene that differ in the N-terminal region, including the first transmembrane domain and the proximal part of the large extracellular domain (810). ASIC2a (BNaC1, MDEG) and ASIC2b (MDEG2) are alternatively spliced forms of the ASIC2 gene product. These, too, have unique N termini and share the C-terminal amino acids (11). Splice variants have not yet been identified for ASIC3 (DRASIC) (12, 13) and ASIC4 (SPASIC) (14, 15). Except for ASIC2b and ASIC4, all subunits have the ability to form functional homomeric channels when expressed in Xenopus laevis oocytes or mammalian cells. The functional and pharmacological properties of homomeric ASIC1a match one type of acid-evoked current described in peripheral sensory neurons (16, 17), and the properties of ASIC3-mediated currents mimic acid-evoked currents in cardiac sensory neurons, believed to mediate the pain of angina (18). Different ASIC subunits often co-localize within the same neurons (19), and heteromeric channels are likely to exist, as is the case for most ligand-gated ion channels. However, the exact composition of endogenous acid-sensitive channels is at present largely unknown.

To study heteromerization of ASICs, we examined co-expressions of different ASIC subunits in Chinese hamster ovary (CHO) cells. By analyzing currents obtained in whole-cell voltage clamp experiments using ultrafast solution exchange for providing acidification, data for all possible combinations of ASICs (except ASIC4) were obtained. These data reveal unique properties for several of the homomerically expressed ASIC subunits and clearly demonstrate the formation of heteromeric channels in a number of co-expression experiments. Interestingly, not all the tested co-expressions led to channels that could be identified as unique; in the case of experiments involving co-expression of three different subunits, the data suggested existence of multiple channel populations. To summarize, this is the first comprehensive study of ASICs co-expressed in a mammalian expression system.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of ASICs—Poly(A)+ mRNA was purified from fetal rat dorsal root ganglion (DRG) neurons using the Oligotex® direct mRNA mini kit (Qiagen) according to the manufacturer's protocol. ASIC1b, ASIC2b, and ASIC4 were cloned from fetal rat DRG poly(A)+ mRNA, whereas ASIC1a, ASIC2a, and ASIC3 were cloned from rat total brain poly(A)+ mRNA (Clontech) using reverse transcription PCR. First and second strand cDNA was obtained in a one-tube reverse transcriptase-PCR reaction using Avian myoblastosis virus reverse transcriptase, DYNazymeTM DNA polymerase (Finnzymes), and the following primer sets (MWG Biotech): ASIC1a –53s TGTGCCTGTGCCTGTTTGAGAG and ASIC1a 1678as ATGCAGTTAAGTCCACAGGGTAGC; ASIC1b –50s ATGCAGTTAAGTCCACAGGGTAGC and ASIC1b 960as CAGGGTGAGGGCAGGTAGATGA; ASIC2a –110s CACCGGCAGCAGCAGGAC and ASIC2a 1614as CTGCGCTTGCTGTCTCCTGTC; ASIC2b –14s CAGGGTGAGGGCAGGTAGATGA and ASIC2b 1787as CCCCCTTGACCGTGGTGA; ASIC3 –6s GCCGCCATGAAACCTCGCTCCGGACTGGAGGAGGCCC and ASIC3 744as GGGCTCATCCTGGCTGTGAAT; and ASIC3 515s GTGGGCCTGAGAACTTCACAGTG and ASIC3 1602as CTAGAGCCTTGTGACGAGGTAACAGGT. Subsequently, an aliquot of the reverse transcriptase-PCR reactions was used as template for nested PCR in reactions with the specific primer sets listed below and the ExpandTM high fidelity DNA polymerase (Roche Applied Science): ASIC1a –6s GCCGCCATGGAATTGAAGACCGAGGAGGA and ASIC1a 1581as TTAGCAGGTAAAGTCCTCAAACGTGCCTC; ASIC1b –6s GCCGCCATGCCCATCCAGATCTTTTGTTC and ASIC1b 870as AAAGGGGGTTCATCCTGACTGTG; ASIC2a –6s GCCGCCATGGACCTCAAGGAGAGCCCCAGT and ASIC2a 1539as TCAGCAGGCAATCTCCTCCAGGGT; ASIC2b –6s GCCGCCATGAGCCGGAGCGGCGGAGCC and ASIC2b 1692as TCAGCAGGCAATCTCCTCCAGGGT; ASIC3 –6s GCCGCCATGAAACCTCGCTCCGGACTGGAGGAGGCCC and ASIC3 719as ACTCGGATCCCCACCTCAAAC; and ASIC3 543s TACTCGAATGGGGCAATGCTACA and ASIC3 1602as CTAGAGCCTTGTGACGAGGTAACAGGT.

The cDNAs were cloned into pSwas, which is a custom-designed vector derived from pZeroTM (Invitrogen), and positive clones were sequenced bidirectionally. ASIC1a, ASIC2a, ASIC2b, and ASIC4 were subcloned directly into the pNS1z vector. The ASIC1b fragment, which encoded the N-terminal part of the channel, was subcloned into pNS1z-ASIC1a, substituting the corresponding part of ASIC1a. ASIC3 was cloned in two overlapping fragments and subcloned in pNS1z in a unique restriction site of ASIC3 (BsrGI) within the overlapping region. The pNS1z vector is a customized vector derived from pcDNA3 (Invitrogen) with expression of the insert under control of the cytomegalovirus promoter.

Expression of ASICs—All constructs were expressed in CHO-K1 cells (ATCC No. CCL61). CHO-K1 cells were cultured at 37 °C in a humidified atmosphere of 5% CO2 and 95% air and passaged twice/week. Cells were maintained in Dulbecco's modified Eagle's medium (10 mM HEPES, 2 mM GlutaMAX) supplemented with 10% fetal bovine serum and 2 mM L-proline (Invitrogen). CHO-K1 cells were co-transfected with the plasmids containing ASICs and a plasmid encoding enhanced green fluorescent protein using the LipofectAMINE PLUS kit (Invitrogen) according to the manufacturer's protocol. When more than one ASIC subunit was expressed, this was done in a 1:1 ratio. For each transfection we attempted to use an amount of DNA that would yield whole-cell currents within a reasonable range (0.5–10 nA) to avoid saturation of the patch clamp amplifier: ASIC1a and ASIC1b, 800 ng; ASIC2a and ASIC3, 400 ng; ASIC1a+1b, 2 x 250 ng; ASIC1a+2a, 2 x 100 ng; ASIC1a+2b and ASIC1b+2b, 2 x 400 ng; ASIC1a+3 and ASIC2a+3, 2 x 25 ng; ASIC1b+3, 2 x 75 ng; ASIC1b+2a and ASIC2a+2b, 2 x 200 ng; and ASIC1a+2a+3, ASIC1a+2b+3, and ASIC1b+2a+3, 3 x 75 ng. Electrophysiological measurements were performed 16–48 h after transfection.

Electrophysiology—All experiments were performed under voltage clamp using conventional whole-cell patch clamp methods (20) at 20–22 °C. A Macintosh G4 computer was used to control an EPC-9 amplifier (HEKA-electronics) via an ITC-16 interface. The experimental conditions were defined by the Pulse software accompanying the amplifier, and data were sampled at 2 kHz and low pass-filtered at 667 Hz.

Pipettes were pulled from borosilicate glass (Modulohm) using a horizontal electrode puller (Zeitz-Instrumente). The pipette was filled with an intracellular solution containing 120 mM KCl, 31 mM KOH, 2 mM MgCl2, 10 mM EGTA, and 10 mM HEPES adjusted to pH 7.2. The pipette electrode was a chloridized silver wire, and the reference electrode was a silver chloride pellet electrode (In Vivo Metric) fixed to the experimental chamber. The electrodes were zeroed with the open pipette in the bath just prior to sealing, and the pipette resistances were 1.5–3.0 megohms. Series resistance compensation was set at 80%.

Coverslips with cells were transferred to the recording chamber (RC-25F, Warner Instruments) mounted on the stage of an inverted microscope (Olympus). Transfected cells were identified by the emission of green fluorescence when exposed to UV light. After giga-seal formation, the whole-cell configuration was attained by suction.

Cells were continuously superfused at a rate of 2.5 ml/min with an extracellular solution (Na-R) containing 140 mM NaCl, 4 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 5 mM HEPES, and 5 mM MES adjusted to pH 7.4. Test solutions were made from standard Na-R, adjusting pH with HCl. Rapid pH changes were achieved by placing a piezo-driven double-barreled application pipette (theta tube) in front of the cell. Using this system, complete solution exchange can be achieved in <1 ms, as measured by the liquid junction potential shift (data not shown). Currents were measured at the peak of the response and normalized to the current evoked by a pH 4 stimulus.

Data Analysis—Using the software GraphPad Prism® 3.0, pH dose-response curves were fitted to the equation I/Imax = 1/(1+(EC50/[H+])n), where EC50 denotes the proton concentration [H+] yielding 50% activation and n is the Hill coefficient. In a few instances, the current was not fully saturated at pH 4 when fitting to this equation. In these cases, the current amplitudes were subsequently normalized to the value of I/Imax at saturation as estimated from the fit to obtain a maximal I/Imax of 1.0. Time constants of desensitization were calculated using IgorPro software (WaveMetrics) by fitting the falling phase of the evoked current to a single exponential function I(t) = K0 + K1exp(–K2t), where the time constant of desensitization, {tau}desens, equals 1/K2, K0 denotes the amplitude of the non-desensitizing current, and K0 + K1 is the peak current; i.e. all ASIC subunit combinations yielded currents that desensitized incompletely at pH 4.0. Results are presented as mean ± S.E., and comparisons were made using a two-tailed t test or one-way analysis of variance. A p value of less than 0.05 was considered to be significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
ASIC subunits were transiently expressed, either singly or as combinations, in CHO cells. All functional channels yielded transient acid-evoked whole-cell currents that displayed varying levels of sustained current. These whole-cell currents were characterized with respect to three different properties: 1) the pH sensitivity (pH50 and Hill slope); 2) the time constant of desensitization ({tau}desens), measured at various pH values; and 3) the amplitude of the residual non-desensitizing current at pH 4.0 (Table I). Some ASIC channels exhibited desensitization kinetics that were dependent on the applied proton concentration, whereas others had kinetics that were independent of proton concentration. When comparing channels with these different kinetic properties, values of {tau}desens determined at a proton concentration close to the pH50 values or in some cases pH100 values for activation were used.


View this table:
[in this window]
[in a new window]
 
TABLE I
Functional properties of CHO cells expressing indicated ASIC subunits individually or in combinations

pH50 values are derived from curve fits of the mean. {tau}desens is at pH50 or the data point closest to pH50. * denotes that {tau}desens is reduced when pH of the test solution is decreased. ND, not determined. Data are represented as mean ± S.E.

 
Homomeric Expression of ASIC Subunits—The expression of ASIC1a, ASIC1b, ASIC2a, or ASIC3 in CHO cells resulted in functional acid-sensitive channels (Fig. 1, A–E), but ASIC2b and ASIC4 could not be activated even at pH 4. Whereas ASIC1a, ASIC1b, and ASIC2a displayed transient activation characteristics, ASIC3 was found to have two different activation profiles. In some cells ASIC3 had a transient activation profile (Fig. 1D), but in other cells a slower activating current followed the transient current (Fig. 1E). The proton affinities for the various channels varied by two orders of magnitude (Fig. 2A and Table I), with ASIC3 being the most sensitive subunit (pH50 = 6.4) and ASIC2a the least sensitive (pH50 = 4.5). Although pH50 was similar for the two ASIC1 splice variants, activation of ASIC1a occurred across a larger pH range, whereas ASIC1b was activated and saturated within a narrow pH range (Fig. 2A). This is clearly reflected in the Hill coefficients, with ASIC1a and ASIC1b having Hill slopes of 0.75 and 4.8, respectively. The Hill coefficients for ASIC2a and ASIC3 were intermediate to those of the two ASIC1 splice variants (Table I).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1.
Acid-evoked currents of homo- and heteromeric ASICs. Shown are representative current traces that illustrate the responses of indicated ASIC subunits to low pH. Cells were bathed in extracellular Na-Ringer, and currents were evoked by rapid application of a test solution of pH 4.0 as indicated by the bar. Note the different current scale bars. A–E, traces recorded from cells expressing homomeric ASICs. F–I, traces from cells expressing ASIC1a in combination with one other subunit. J and K, traces from cells expressing ASIC1b in combination with one other subunit. L–O, traces obtained from dual expression of ASIC2a, ASIC2b, and ASIC3. P–R, traces from triple expression experiments: ASIC1a+2a+3, ASIC1a+2b+3, and ASIC1b+2a+3.

 



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 2.
Biophysical properties of homomeric ASICs. A, sensitivity of homomeric ASICs to lowering of extracellular pH from a holding of pH 7.4, showing that ASIC3 is most and ASIC2a least sensitive to low pH and that activation of ASIC1a and ASIC1b can be clearly separated. Currents are normalized to pH 4.0 currents (Imax), except ASIC2a currents, which are not fully saturated at pH 4 and therefore subsequently have been normalized to I/Imax at saturation as estimated from the initial pH dose-response fit. B and C, desensitization kinetics of homomeric ASICs indicated by mean time constants of desensitization ({tau}desens), revealing that desensitization of ASIC1a, ASIC1b, and ASIC2a is increased when pH is lowered, whereas the rate of desensitization of the transient ASIC3 current is constant despite changes in pH. n = at least four cells for each data point. Bars indicate mean ± S.E.

 
The values of {tau}desens were strongly dependent upon the proton concentration used for activation of ASIC1a, ASIC1b, and ASIC2a, as the rate of desensitization increased with increasing proton concentrations (Fig. 2, B and C). This is a feature commonly observed for ligand-gated ion channels. In contrast, the desensitization rate of the transient current of ASIC3 was independent of the applied pH (pH 6.5–4.0; p = 0.25) (Fig. 2B). Despite their different pH50 and Hill slopes, no significant differences in the desensitization rates of ASIC1a and ASIC1b were observed at pH50 (p > 0.14).

The sustained current remaining at pH 4.0 was in the range of 3–8%, relative to the peak current, for ASIC1a, -1b, and -2a (Table I). ASIC3 displayed a significantly larger sustained current of 26% (p < 0.001) (Table I).

ASIC1a Co-expressed with ASIC1b, ASIC2a, ASIC2b, or ASIC3—Co-expression of ASIC1a and one other ASIC subunit gave rise to functional acid-sensitive channels in all cases (Fig. 1, F–I). Proton sensitivities of the different subunit combinations fell into two categories. The ASIC1a+1b, ASIC1a+2a, and ASIC1a+2b combinations all showed proton sensitivities similar to ASIC1a (Fig. 3, A and B, respectively), whereas the sensitivity of the ASIC1a+3 combination was indistinguishable from that of ASIC3 homomeric channels (Fig. 3C).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3.
Proton sensitivity of double ASIC combinations. Shown is the sensitivity of indicated channels to lowering of pH from a holding of pH 7.4. Currents are normalized to pH 4.0 currents (Imax). A and B, proton sensitivities of ASIC1a+1b, ASIC1a+2a, and ASIC1a+2b closely resemble ASIC1a, whereas ASIC1a+3(C) is indistinguishable from ASIC3. D, ASIC1b+2a as well as ASIC2a+2b is similar to ASIC2a with respect to acid sensitivity. E, proton sensitivity of ASIC1b+3 is comparable with homomeric ASIC1b. F, ASIC2a+3 has acid sensitivity that is intermediate to either homomeric channel, whereas ASIC2b+3 closely resembles ASIC3. n = at least four cells for each data point. Bars indicate mean ± S.E.

 
For three of four of these combinations desensitization kinetics were affected in one way or another relative to the respective homomeric receptors; only ASIC1a+2b appeared unchanged compared with the ASIC1a homomeric receptor. The desensitization rate of the ASIC1a+1b combination was dependent on the proton concentration as was the case for the respective homomeric channels (Fig. 4A). Contrary to this, the rates for the ASIC1a+2a and ASIC1a+3 combinations were independent of the proton concentration (p > 0.98 and p > 0.48, respectively) (Fig. 4, B and C). Comparing desensitization rates at pH50, ASIC1a+1b was significantly slower than ASIC1a and ASIC1b (p < 0.001 and p < 0.05, respectively), whereas ASIC1a+3 was significantly faster than ASIC1a and ASIC3 (p < 0.001 and p < 0.05, respectively). Due to the pH dependence of ASIC1a desensitization, a comparison of the rates of ASIC1a+2a and ASIC1a was complex with significant differences at some proton occupancy levels but not at others. However, measured at pH = 4.0 (~pH100), ASIC1a+2a desensitization was significantly slower than that of ASIC1a (p < 0.05) but faster than that of ASIC2a (p < 0.001).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 4.
Desensitization kinetics of double ASIC combinations. The rate of desensitization is indicated by mean time constants of desensitization ({tau}desens). A, ASIC1a+1b desensitizes more slowly than either homomeric channel, reflected in higher {tau}desens, and as observed for both homomers, desensitization is increased at decreasing pH. B, desensitization of ASIC1a+2a is independent of proton concentration and shows no obvious resemblance to either homomeric channel. There are no significant differences between {tau}desens of ASIC1a and ASIC1a+2b. C, ASIC1a+3 desensitizes faster than both ASIC1a and ASIC3, reflected in lower {tau}desens, and the kinetics is independent of [H+]. D, ASIC1b+2a desensitizes slower than ASIC1b but faster than ASIC2a (not shown in this figure because of {tau}desens in the range of 1–5 s, Fig. 2C), and desensitization kinetics is constant across the applied pH range unlike ASIC1b and ASIC2a. E, ASIC1b+3 desensitizes faster than both ASIC1b and ASIC3, reflected in lower {tau}desens, and the kinetics is independent of [H+]. F, ASIC2b does not influence {tau}desens of ASIC2a significantly. G, desensitization of ASIC2a+3 is significantly faster than ASIC2a (compare with Fig. 2C) and ASIC3, whereas ASIC2b does not change desensitization kinetics of ASIC3 significantly.

 
The sustained current at pH 4.0 of all the combinations was in the range of 3–6% of peak currents, which is not significantly different from homomeric ASIC1a (Table I). Interestingly, when compared with homomeric ASIC3, the ASIC1a+3 combination displayed a major reduction of the level of sustained current (p < 0.001).

ASIC1b Co-expressed with ASIC2a, ASIC2b, or ASIC3— ASIC1b co-expressed with ASIC2a or ASIC3 in CHO cells yielded functional channels (Fig. 1, J–K); however, contrary to all other combinations of subunits, ASIC1b+2b did not exhibit proton-activated currents in 30 of 36 cells. In the transfection procedure for ASIC1b+2b, an increase of DNA levels to the highest level possible (before cellular death occurred) was tried, but still, in the few cells that did show a proton-evoked current, the amplitude was very low (<100 pA). For this reason it was concluded that ASIC1b+2b is a non-functional combination, and no data are presented. The proton sensitivity of the ASIC1b+2a combination (Fig. 3D) resembled that of ASIC2a, whereas the sensitivity of ASIC1b+3 (Fig. 3E) was almost identical to that of homomeric ASIC1b.

The values of {tau}desens of both ASIC1b+2a and ASIC1b+3 were independent of the proton concentration used for stimulation (p > 0.23 and p > 0.15, respectively) (Fig. 4, D and E). Again, comparing proton-independent with proton-dependent desensitization is problematic. In general, desensitization rates of ASIC1b+2a could be characterized as intermediate to the respective homomeric channels; ASIC1b+2a was significantly faster than ASIC2a at pH50 (p < 0.05) but significantly slower than ASIC1b at pH100 (p < 0.05). The general picture of ASIC1b+3 was one of a channel desensitizing faster than the respective homomeric channels (Fig. 4E). Indeed, it desensitized significantly faster than ASIC1b at pH50 (p < 0.001); however, despite the pH independence of both ASIC3 and ASIC1b+3 significant differences were not observed for all proton occupancy levels. Still, at pH100 (pH = 4.0) ASIC1b+3 clearly desensitized significantly faster than ASIC3 (p = 0.01).

For the ASIC1b+2a combination the level of sustained current at pH 4.0 relative to peak current was 14%, which represents a significant increase compared with either homomeric channel (p < 0.001). The level of sustained current for the ASIC1b+3 combination (15%) was intermediate to the levels determined for the respective homomeric channels (Table I).

Co-expression of ASIC2a+2b, ASIC2a+3, and ASIC2b+3— Acid-sensitive channels were formed from co-expressing dual combinations of ASIC2a, ASIC2b, and ASIC3 (Fig. 1, L–O). The activation characteristics of ASIC2a+3 resembled ASIC3 with two different profiles. In some cells ASIC2a+3 had an apparent simple transient activation profile (Fig. 1M), whereas in other cells a slower activating current followed the transient current (Fig. 1N). Despite functionality of all these subunit combinations, the acid sensitivity of ASIC2a and ASIC3 was largely unaffected by the presence of ASIC2b (Fig. 3, D and F, respectively), whereas the sensitivity of ASIC2a+3 was intermediate to either homomeric channel (Fig. 3F).

Overall, desensitization kinetics of ASIC2a+2b and ASIC2b+3 were identical to the kinetics of homomeric ASIC2a and ASIC3, respectively (p > 0.05) (Fig. 4, F and G). The {tau}desens values of ASIC2a+3 were independent on the proton concentration (p > 0.54) (Fig. 4G). At pH50 ASIC2a+3 desensitized significantly faster than ASIC2a (p < 0.01); however, although desensitization of ASIC2a+3 always appeared faster than ASIC3 (Fig. 4G), this difference did not reach significance. Interestingly, the desensitization phase of ASIC2a+3 was masked at pH <= 4.5 due to activation of a prominent sustained current (see below).

Whole-cell currents measured from cells co-expressing ASIC2a+2b maintained a level of sustained current of 17% at pH 4.0; this represents a significant increase relative to the 7.5% determined for homomeric ASIC2a (p < 0.0001) (Table I). Interestingly the ASIC2a+3 combination displayed a pronounced mean sustained current of 105% at pH 4. The reason for a measured sustained current larger than the peak current is the second slower activating current observed in some cells, which frequently exceeds the amplitude of the transient peak. The sustained current of 105% was significantly greater than the values corresponding to both homomeric ASIC2a and ASIC3 (p < 0.05). The level of sustained current determined for ASIC2b+3 was of a similar magnitude to that of ASIC3 homomers (p > 0.16) (Table I).

Co-expression of ASIC1a+2a+3—Co-expressing these three subunits gave rise to channels with peculiar characteristics (Fig. 1P). The proton sensitivity of acid-evoked currents in these cells was highly unusual (Fig. 5A), with activation starting at pH 6.5 and not fully saturating at pH 4, which is also clearly reflected in a low Hill slope of 0.65 (Table I).



View larger version (8K):
[in this window]
[in a new window]
 
FIG. 5.
Proton sensitivity of triple ASIC combinations. Shown is the sensitivity of indicated channels to lowering of pH from a holding of pH 7.4. Currents are not fully saturated at pH 4, and therefore these have subsequently been normalized to I/Imax at saturation as estimated from the initial pH dose-response fit. A, ASIC1a+2a+3 and ASIC1b+2a+3 both exhibit shallow activation curves with low pH50 values and low Hill slopes. B, the pH sensitivity of ASIC1a+2b+3 resembles that of ASIC1a+3 with similar pH50 and hill slope. n = at least four cells for each data point. Bars indicate mean ± S.E.

 
The {tau}desens values of ASIC1a+2a+3-mediated whole-cell currents displayed unusual pH dependence, in the range of pH 6–4.5, in that {tau}desens actually increased with increasing proton concentration (p < 0.01) (Fig. 6A). The desensitization rate at pH50 was similar to that of ASIC1a+2a (p > 0.05) but significantly slower when compared with the rates of ASIC1a+3 and ASIC2a+3 (p < 0.001).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 6.
Desensitization kinetics of triple ASIC combinations. The rate of desensitization is indicated by mean time constants of desensitization ({tau}desens). A, desensitization of both ASIC1a+2a+3 and ASIC1b+2a+3 is slowed with increasing proton concentration indicated by an increase in {tau}desens. B, desensitization kinetics of ASIC1a+2b+3 is constant across the applied pH range and does not differ from ASIC1a+3 at any pH value. n = at least four cells for each data point.

 
The level of sustained current at pH 4.0 did not differ significantly from that of ASIC1a+2a and ASIC1a+3 (p > 0.05) but was significantly lower than that of ASIC2a+3 (p < 0.01) (Table I).

Co-expression of ASIC1a+2b+3—Although this co-expression experiment yielded functional channels (Fig. 1Q) the channel characteristics were similar to those of ASIC1a+3. First, the proton sensitivity of acid-evoked currents was virtually identical to that of ASIC1a+3-mediated currents (Fig. 5B). Next, desensitization kinetics were not significantly different from those of ASIC1a+3 at any pH value (p > 0.05) (Fig. 6B). Finally, the level of sustained current normalized to peak current at pH 4.0 was not significantly different from that of ASIC1a+3 (p > 0.35) (Table I).

Co-expression of ASIC1b+2a+3—The last triple co-expression tested also yielded functional acid-sensitive channels (Fig. 1R) but again with peculiar characteristics. With respect to the proton sensitivity, the ASIC1b+2a+3 combination was reminiscent of ASIC1a+2a+3 (Fig. 5A) and was thus less acid-sensitive than any of the corresponding pairwise subunit combinations (Table I).

Time constants of desensitization for ASIC1b+2a+3-mediated currents were also unusual compared with other subunit combinations, as {tau}desens increased at increasing proton concentration (Fig. 6A). The desensitization rate at pH50 was significantly faster than that of ASIC1b+2a (p < 0.01) but significantly slower than those of ASIC1b+3 (p < 0.05) and ASIC2a+3 (p < 0.05).

The mean level of sustained current at pH 4.0 was not significantly different from that of ASIC1b+2a (p > 0.05) and ASIC1b+3 (p > 0.05), whereas it was significantly reduced compared with that of ASIC2a+3 (p < 0.05) (Table I).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Results from co-expressing subunits, such as the ASIC subunits, can potentially be quite complex. In the simplest system either homomeric or heteromeric channels are formed; however, besides the possibility of coexistence of homomeric and heteromeric channels, the heteromeric channels themselves could be a mixed population with different stoichiometries. Assuming a tetrameric assembly of the ASIC channel (21), co-expressing two subunits gives rise to the possibility of having two homomeric channels along with three different heteromeric channel assemblies. When co-expressing three subunits these numbers rise to a possibility of having three homomeric channels along with 12 heteromeric channels. The currents measured from co-expression experiments may therefore reflect the presence of homomeric and/or heteromeric channels, which may or may not have distinct characteristics. Thus, presence of heteromeric ASIC channels could only be identified to the extent that they displayed biophysical properties distinct from the homomeric channels. Generally, the features studied here (pH sensitivity, desensitization rate, and sustained current at pH 4) proved to be very informative in identifying the existence of heteromeric channels, and the present data demonstrate that a number of distinct heteromeric channels are formed.

Homomeric ASICs Show Variable Properties—Initially, the different homomeric channels were characterized to enable identification of channels formed from co-expression experiments. As described previously, ASIC1a, ASIC1b, ASIC2a, and ASIC3 all expressed well as homomeric channels (8, 1012), whereas ASIC2b and ASIC4 did not yield functional acid-sensitive channels (11).

Interestingly, the pH dose-response curves of ASIC1a and ASIC1b differed markedly despite similar pH50 values; activation and saturation of ASIC1a occurred over a range of three pH units, whereas ASIC1b activated and saturated within a single pH unit. Waldmann et al. (8) reported a much steeper pH dose-response curve for ASIC1a expressed in Xenopus oocytes, and Chen et al. (9) showed more gradual activation of ASIC1b expressed in COS-7 cells. Hence, this feature may be critically dependent upon cell type and/or the solution application system used for whole-cell recording. In agreement with previous findings, ASIC2a homomeric channels were the least acid-sensitive (i.e. displaying a low pH50) (11), whereas ASIC3 homomers were the most acid-sensitive (i.e. high pH50) (12).

The desensitization rate of ASIC1a, ASIC1b, and ASIC2a was clearly increased when the stimulation pH was lowered (i.e. proton concentration increased). Conversely, the time constant of desensitization for ASIC3 remained constant despite changes in pH.

Heteromeric ASIC Channels with Distinct Properties—A heteromeric ASIC1a+1b channel with functionally unique properties has not been reported previously; however, the present data support its existence. Currents from cells co-expressing ASIC1a+1b desensitized significantly slower at pH50 than currents corresponding to either homomeric channel. Moreover, the proton sensitivity and Hill slope of ASIC1a+1b were indistinguishable from those of homomeric ASIC1a, which would appear inconsistent with a mixture of homomeric channels. If only homomers were present, the very steep proton dose-response curve of ASIC1b would be expected to affect the shallow dose-response curve of homomeric ASIC1a.

Co-expression of either ASIC1 splice variant with ASIC2a resulted in heteromeric channels clearly identifiable from the respective homomeric channels. Contrary to the homomeric channels, the ASIC1a+2a and ASIC1b+2a combinations both displayed pH-independent rates of desensitization. Moreover, proton sensitivities of activation for both combinations were inconsistent with a predominance of homomeric channels. Considering the large separation of the pH dose-response curves and Hill slopes between the ASIC1 variants and ASIC2a, a mixture of independent homomeric channels would be anticipated to result in biphasic pH dose-response curves or curves with extremely low Hill slopes. However, this was not observed; ASIC1a+2a had a pH50 value similar to homomeric ASIC1a but an increased Hill slope, whereas ASIC1b+2a had a pH50 value similar to homomeric ASIC2a with an unaltered Hill slope.

As noted above, ASIC3 was characterized by displaying pH-independent desensitization kinetics. Interestingly, this phenotype was conferred to the channels resulting from the co-expressions of ASIC3 with ASIC1a, ASIC1b, or ASIC2a. Furthermore, these co-expressions all gave rise to channels with accelerated desensitization kinetics (~0.2 s) relative to any of the respective homomeric channels. However, this observation might in each case argue in favor of assembly of heteromeric channels. In agreement with this, it was reported previously that desensitization of acid-evoked currents from DRG neurons of ASIC3-null mice was slowed compared with wild type animals, suggesting that presence of ASIC3 might shorten the response to acid in vivo (22, 23). A striking observation in the co-expression experiments with ASIC3 was the large amplitude of sustained current evoked by stimulation of ASIC2a+3 at pH 4.0. The summed contributions of homomeric ASIC2a and ASIC3 channels cannot explain the magnitude of this current, strongly suggesting the assembly of functional ASIC2a+3 heteromeric channels. This was also noted by Babinski et al. (24), who co-expressed ASIC2a and ASIC3 in Xenopus oocytes.

Heteromerization of ASIC1a+3, ASIC1b+3, and ASIC2a+3 was supported by the fact that the DNA amounts used for these transient transfections were reduced considerably compared with expression of the same subunits singly. This could suggest very efficient assembly and/or transport of such heteromeric channel complexes to the cell membrane.

Interestingly, whenever co-expressing two subunit types, the pH dose-response curves usually ended up being very similar to one of the curves for the respective homomeric channels. Only in the case of ASIC2a+3 an easily identifiable "new" dose-response curve appeared, which was located between the curves for the respective homomers.

Does ASIC2b Constitute a Functional Subunit?—The present data do not provide convincing evidence that ASIC2b participates in any functional channel complex, although it previously has been suggested to constitute a modulatory subunit (11). When ASIC2b was co-expressed with ASIC1a or ASIC3 or both in combination, minor changes to features such as pH dose-response curves could be observed, but nothing significant. In accordance with this, Lingueglia et al. (11) reported that ASIC2b was devoid of effect on the identical set of properties of ASIC1a and ASIC3. However, these authors found that ASIC2b altered the permeation properties of ASIC3 from being Na+-selective to being non-selective for cations, suggesting that heteromultimerization of these subunits had occurred. With regards to ASIC2a+2b co-expression, the relative level of sustained current at pH 4.0 appeared increased by the presence of ASIC2b, an observation also reported by Lingueglia et al. (11). However, there were no other clear indications suggesting that ASIC2b influenced the properties of ASIC2a. Strangely, the most obvious "effect" of ASIC2b appeared to be suppression of ASIC1b function. Compared with homomeric expression of ASIC1b, the fraction of cells displaying acid-evoked currents was highly reduced by the presence of ASIC2b, and acid-evoked currents of the few responsive cells were of low amplitude. This might suggest a dominant negative effect of ASIC2b on ASIC1b.

Three Different Subunits Appear Not to Form a Distinct Channel—As described in the preceding sections, ASIC1a, ASIC2a, and ASIC3 are capable of assembling into heteromeric complexes when co-expressed pairwise. Therefore, we surmised that assembly of all three of these subunits into single ASIC channels could be a realistic possibility. However, experiments involving co-expression of the three subunits yielded no conclusive evidence in favor of such an interaction. Two lines of evidence rather point toward existence of multiple channel populations. The pH dose-response relationship was unusual with activation taking place over a broad pH range, thereby yielding a very low Hill coefficient; the desensitization rate for ASIC1a+2a+3 decreased with increasing proton concentration in a large part of the pH range examined, which is contrary to the properties of all other investigated combinations of subunits. These observations could be explained by assuming that multiple channel populations were present. Considering the very efficient assembly of in particular heteromeric ASIC1a+3 and ASIC2a+3 channels but also ASIC1a+2a, it might seem unlikely that homomeric channels contribute significantly. On the other hand, the most obvious way to create a shallow dose-response relation is by having a mixture of channels with dose-response relations widely separated over the pH range, which suggests a presence of ASIC2a homomeric channels. Thus, a mixture of ASIC1a+3 and ASIC2a channels could theoretically account for a large part of the unexpected observations. The difference in pH50 of these two channel types would result in a low Hill coefficient of the activation profile. Furthermore, at high pH values (pH 5.5–6.5), the rapid desensitization of ASIC1a+3 would be observed, whereas the slower desensitization of ASIC2a would dominate at lower pH values (pH 4.0–5.0). It is of course entirely possible that other combinations, such as ASIC1a homomers as well as ASIC1a+2a and ASIC2a+3 heteromers, also contribute to the data observed. It should be noted, however, that the relatively modest amplitude of sustained current at pH 4.0 determined for ASIC1a+2a+3 (14%; Table I) seems to argue against the presence of large amounts of ASIC2a+3 heteromers.

Co-expression of ASIC1b with ASIC2a and ASIC3 gave very similar results, suggesting that expression of either ASIC1a or ASIC1b with ASIC2a and ASIC3 resulted in channel populations that were alike. Again assuming a tetrameric assembly of the ASIC channel (21), the apparent inability of channel formation involving three different subunits combined with the highly efficient channel formation with two different subunits could perhaps suggest an assembly consisting of two dimers.

ASIC Channels in DRG Neurons—At least three different types of acid-evoked currents have been recorded from DRG neurons (46). Benson et al. (23) showed that co-expression of ASIC1a+2a+3 could reproduce the biophysical properties of a rapidly desensitizing acid-evoked current of mouse DRG neurons. Indeed, the fast desensitization at pH 6 observed by these authors was reproduced in the present study; however, as noted above, the rate of desensitization was reduced at lower pH values. In this context, it should be noted that the pH value giving half-maximal activation of current in the present study (pH50 = 5.1) was substantially less than the value (pH50 = 6.4) reported by Benson et al. (23), a fact which may relate to the use of different expression systems and/or other differences in experimental conditions.

Understanding the molecular composition of native ASIC channels is an important step in understanding their physiological role in sensory transduction and also has clinical implications, as these channels provide potential targets for the pharmacological modulation of sensory stimuli, including pain. However, identification of native ASICs is complicated by the lack of pharmacological tools, as only a single specific ASIC1a antagonist has been reported (16). By using a combination of non-steroidal anti-inflammatory drugs, which show different patterns of antagonism toward ASICs, Voilley et al. (17) showed that acid-evoked currents of DRG neurons are likely to reflect the presence of at least four different populations of ASIC channels. It may therefore very well be that the ASIC currents recorded from native DRG neurons reflect the concerted activity of multiple types of ASIC channels with distinct molecular compositions. This hypothesis seems to be compatible with the present ambiguous data obtained for cells co-expressing ASIC1a+2a+3, which also indicate that multiple channels form when these subunits are allowed to interact.


    FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed. Tel.: 45-44608223; Fax: 45-44608080; E-mail: pka{at}neurosearch.dk.

1 The abbreviations used are: ASIC, acid-sensing ion channel; ENaC, epithelial Na+ channel; DEG, degenerin; FaNaC, Phe-Met-Arg-Phe-amide-activated Na+ channel; CHO, Chinese hamster ovary; DRG, dorsal root ganglion; MES, 4-morpholineethanesulfonic acid. Back



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Steen, K. H., and Reeh, P. W. (1993) Neurosci. Lett. 154, 113–116[CrossRef][Medline] [Order article via Infotrieve]
  2. Steen, K. H., Issberner, U., and Reeh, P. W. (1995) Neurosci. Lett. 199, 29–32[CrossRef][Medline] [Order article via Infotrieve]
  3. Steen, K. H., Steen, A. E., Kreysel, H. W., and Reeh, P. W. (1996) Pain 66, 163–170[CrossRef][Medline] [Order article via Infotrieve]
  4. Bevan, S., and Yeats, J. (1991) J. Physiol. (Lond.) 433, 145–161[Abstract/Free Full Text]
  5. Krishtal, O. A., and Pidoplichko, V. I. (1981) Neuroscience 6, 2599–2601[CrossRef][Medline] [Order article via Infotrieve]
  6. Petruska, J. C., Napaporn, J., Johnson, R. D., Gu, J. G., and Cooper, B. Y. (2000) J. Neurophysiol. 84, 2365–2379[Abstract/Free Full Text]
  7. Kellenberger, S., and Schild, L. (2002) Physiol. Rev. 82, 735–767[Abstract/Free Full Text]
  8. Waldmann, R., Champigny, G., Bassilana, F., Heurteaux, C., and Lazdunski, M. (1997) Nature 386, 173–177[CrossRef][Medline] [Order article via Infotrieve]
  9. Chen, C. C., England, S., Akopian, A. N., and Wood, J. N. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 10240–10245[Abstract/Free Full Text]
  10. Bassler, E. L., Ngo-Anh, T. J., Geisler, H. S., Ruppersberg, J. P., and Grunder, S. (2001) J. Biol. Chem. 276, 33782–33787[Abstract/Free Full Text]
  11. Lingueglia, E., de Weille, J. R., Bassilana, F., Heurteaux, C., Sakai, H., Waldmann, R., and Lazdunski, M. (1997) J. Biol. Chem. 272, 29778–29783[Abstract/Free Full Text]
  12. Waldmann, R., Bassilana, F., de Weille, J., Champigny, G., Heurteaux, C., and Lazdunski, M. (1997) J. Biol. Chem. 272, 20975–20978[Abstract/Free Full Text]
  13. Babinski, K., Le, K. T., and Seguela, P. (1999) J. Neurochem. 72, 51–57[CrossRef][Medline] [Order article via Infotrieve]
  14. Akopian, A. N., Chen, C. C., Ding, Y., Cesare, P., and Wood, J. N. (2000) Neuroreport 11, 2217–2222[Medline] [Order article via Infotrieve]
  15. Grunder, S., Geissler, H. S., Bassler, E. L., and Ruppersberg, J. P. (2000) Neuroreport 11, 1607–1611[Medline] [Order article via Infotrieve]
  16. Escoubas, P., de Weille, J. R., Lecoq, A., Diochot, S., Waldmann, R., Champigny, G., Moinier, D., Menez, A., and Lazdunski, M. (2000) J. Biol. Chem. 275, 25116–25121[Abstract/Free Full Text]
  17. Voilley, N., de Weille, J., Mamet, J., and Lazdunski, M. (2001) J. Neurosci. 21, 8026–8033[Abstract/Free Full Text]
  18. Sutherland, S. P., Benson, C. J., Adelman, J. P., and McCleskey, E. W. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 711–716[Abstract/Free Full Text]
  19. Alvarez de la Rosa, D., Zhang, P., Shao, D., White, F., and Canessa, C. M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 2326–2331[Abstract/Free Full Text]
  20. Hamill, O. P., Marty, A., Neher, E., Sakmann, B., and Sigworth, F. J. (1981) Pfluegers Arch. Eur. J. Physiol. 391, 85–100[CrossRef][Medline] [Order article via Infotrieve]
  21. Coscoy, S., Lingueglia, E., Lazdunski, M., and Barbry, P. (1998) J. Biol. Chem. 273, 8317–8322[Abstract/Free Full Text]
  22. Xie, J., Price, M. P., Berger, A. L., and Welsh, M. J. (2002) J. Neurophysiol. 87, 2835–2843[Abstract/Free Full Text]
  23. Benson, C. J., Xie, J., Wemmie, J. A., Price, M. P., Henss, J. M., Welsh, M. J., and Snyder, P. M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 2338–2343[Abstract/Free Full Text]
  24. Babinski, K., Catarsi, S., Biagini, G., and Seguela, P. (2000) J. Biol. Chem. 275, 28519–28525[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Neurosci.Home page
A. Baron, N. Voilley, M. Lazdunski, and E. Lingueglia
Acid Sensing Ion Channels in Dorsal Spinal Cord Neurons
J. Neurosci., February 6, 2008; 28(6): 1498 - 1508.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
J.-H. Cho and C. C. Askwith
Presynaptic Release Probability Is Increased in Hippocampal Neurons From ASIC1 Knockout Mice
J Neurophysiol, February 1, 2008; 99(2): 426 - 441.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. W. Sherwood and C. C. Askwith
Endogenous Arginine-Phenylalanine-Amide-related Peptides Alter Steady-state Desensitization of ASIC1a
J. Biol. Chem., January 25, 2008; 283(4): 1818 - 1830.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z.-Y. Tan, Y. Lu, C. A. Whiteis, C. J. Benson, M. W. Chapleau, and F. M. Abboud
Acid-Sensing Ion Channels Contribute to Transduction of Extracellular Acidosis in Rat Carotid Body Glomus Cells
Circ. Res., November 9, 2007; 101(10): 1009 - 1019.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Chen, G. Polleichtner, I. Kadurin, and S. Grunder
Zebrafish Acid-sensing Ion Channel (ASIC) 4, Characterization of Homo- and Heteromeric Channels, and Identification of Regions Important for Activation by H+
J. Biol. Chem., October 19, 2007; 282(42): 30406 - 30413.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. H. Meltzer, N. Kapoor, Y. J. Qadri, S. J. Anderson, C. M. Fuller, and D. J. Benos
Heteromeric Assembly of Acid-sensitive Ion Channel and Epithelial Sodium Channel Subunits
J. Biol. Chem., August 31, 2007; 282(35): 25548 - 25559.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
M. P. Maher, N.-T. Wu, and H. Ao
pH-Insensitive FRET Voltage Dyes
J Biomol Screen, August 1, 2007; 12(5): 656 - 667.
[Abstract] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J.-H. Cho and C. C. Askwith
Potentiation of acid-sensing ion channels by sulfhydryl compounds
Am J Physiol Cell Physiol, June 1, 2007; 292(6): C2161 - C2174.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Physiol.Home page
K. A. Cushman, J. Marsh-Haffner, J. P. Adelman, and E. W. McCleskey
A Conformation Change in the Extracellular Domain that Accompanies Desensitization of Acid-sensing Ion Channel (ASIC) 3
J. Gen. Physiol., March 26, 2007; 129(4): 345 - 350.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Su, Q. Li, K. Shrestha, E. Cormet-Boyaka, L. Chen, P. R. Smith, E. J. Sorscher, D. J. Benos, S. Matalon, and H.-L. Ji
Interregulation of Proton-gated Na+ Channel 3 and Cystic Fibrosis Transmembrane Conductance Regulator
J. Biol. Chem., December 1, 2006; 281(48): 36960 - 36968.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
O. Poirot, T. Berta, I. Decosterd, and S. Kellenberger
Distinct ASIC currents are expressed in rat putative nociceptors and are modulated by nerve injury
J. Physiol., October 1, 2006; 576(1): 215 - 234.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
F. Mercado, I. A. Lopez, D. Acuna, R. Vega, and E. Soto
Acid-Sensing Ionic Channels in the Rat Vestibular Endorgans and Ganglia
J Neurophysiol, September 1, 2006; 96(3): 1615 - 1624.