Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M313385200 on January 13, 2004

J. Biol. Chem., Vol. 279, Issue 12, 11236-11243, March 19, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/12/11236    most recent
M313385200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, C.
Right arrow Articles by Kuo, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, C.
Right arrow Articles by Kuo, P. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

S-Nitrosylation of Heterogeneous Nuclear Ribonucleoprotein A/B Regulates Osteopontin Transcription in Endotoxin-stimulated Murine Macrophages*

Chengjiang Gao, Hongtao Guo, Junping Wei, Zhiyong Mi, Philip Wai, and Paul C. Kuo{ddagger}

From the Department of Surgery, Duke University Medical Center, Durham, North Carolina 27710

Received for publication, December 8, 2003 , and in revised form, January 8, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Osteopontin (OPN) is a highly hydrophilic and negatively charged sialoprotein of ~298 amino acids that contains a Gly-Arg-Gly-Asp-Ser sequence. It is a secreted protein with diverse regulatory functions, including cell adhesion and migration, tumor growth and metastasis, atherosclerosis, aortic valve calcification, and repair of myocardial injury. Despite the many recognized functions of OPN, very little is known of the transcriptional regulation of OPN. In this regard, we have previously demonstrated that OPN transcription and promoter activity are significantly up-regulated in response to NO in a system of endotoxin-stimulated murine macrophages. However, the specific cis- and trans-regulatory elements that determine the extent of endotoxin- and NO-mediated induction of OPN synthesis are unknown. In this follow-up study, we demonstrate that: 1) OPN gene transcription is regulated by a constitutive transcriptional repressor protein, heterogeneous nuclear ribonucleoprotein A/B (hnRNP A/B); 2) inhibition of in vivo hnRNP DNA binding activity is accompanied by increased S-nitrosylation of hnRNP A/B in the setting of lipopolysaccharide (LPS)-mediated NO synthesis; 3) inhibition of LPS mediated NO synthesis restores hnRNP DNA binding and decreases the extent of S-nitrosylation; and 4) S-nitrosylation of hnRNP at cysteine 104 inhibits in vitro DNA binding activity, which is reversed by dithiothreitol. Our findings suggest that LPS induced S-nitrosylation of hnRNP inhibits its activity as a constitutive repressor of the OPN promoter and results in enhanced OPN expression.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Osteopontin (OPN)1 is a highly hydrophilic and negatively charged sialoprotein of ~298 amino acids that contains a Gly-Arg-Gly-Asp-Ser sequence. It is a secreted protein with diverse regulatory functions, including cell adhesion and migration, tumor growth and metastasis, atherosclerosis, aortic valve calcification, and repair of myocardial injury. Despite the many recognized functions of OPN, very little is known of the transcriptional regulation of OPN. Studies indicate that the OPN promoter contains various motifs including a purine-rich sequence, an Ets-like sequence, glucocorticoid and vitamin D response elements, and interferon-inducible elements (1, 2). In this regard, we have previously demonstrated that OPN transcription and promoter activity are significantly up-regulated in response to NO in a system of endotoxin-stimulated murine macrophages (3). However, the specific cis- and trans-regulatory elements that determine the extent of endotoxin- and NO-mediated induction of OPN synthesis are unknown.

In RAW 264.7 and ANA-1 murine macrophages, we have demonstrated that LPS and/or pro-inflammatory cytokine induced NO synthesis is a potent mediator of OPN promoter activation, gene transcription, and protein expression (3). In this study, we demonstrate that: 1) OPN gene transcription is regulated by a constitutive transcriptional repressor protein, heterogeneous nuclear ribonucleoprotein A/B (hnRNP A/B); 2) in vivo hnRNP DNA binding activity is significantly inhibited in the setting of LPS-mediated NO synthesis; and 3) S-nitrosylation of hnRNP A/B at a cysteine residue in the DNA-binding region inhibits in vitro DNA binding activity. Our findings suggest that LPS-induced S-nitrosylation of hnRNP inhibits its activity as a constitutive repressor of the OPN promoter. These data represent a novel function for hnRNP proteins, which are better known as participants in telomere biogenesis, splicing, and mRNA transport.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and Induction of NO Synthesis in RAW 264.7 Macrophages—RAW 264.7 macrophages were maintained in Dulbecco's modified Eagle's medium with 10% heat-inactivated fetal calf serum, 100 units/ml penicillin, and 100 µg/ml streptomycin. LPS (100 ng/ml) was added in the absence of fetal calf serum (10%) to induce NO synthesis. In selected instances, the competitive substrate inhibitor of NO synthase, NG-nitro-L-arginine methyl ester (L-NAME, 250 ng/ml) or the NO donor, S-nitroso-N-acetyl-penicillamine (SNAP, 100 µM), or a combination of these compounds was added. After incubation for 12 h at 37 °C in 5% CO2, the supernatants and cells were harvested for assays.

Western Blot Analysis—RAW 264.7 cells were lysed in buffer (0.8% NaCl, 0.02 KCl, 1% SDS, 10% Triton X-100, 0.5% sodium deoxycholic acid, 0.144% Na2HPO4 and 0.024% KH2PO4, pH 7.4) and centrifuged at 12,000 x g for 10 min at 4 °C. The protein concentration was determined by absorbance at 650 nm using protein assay reagent (Bio-Rad). The cell lysates (35 µg/lane) were separated by 12% SDS-PAGE, and the products were electrotransferred to polyvinylidene difluoride membrane (Amersham Biosciences). The membrane was blocked with 5% skim milk, phosphate-buffered saline, 0.05% Tween for 1 h at room temperature. After being washed three times, blocked membranes were incubated with rat polyclonal antibody directed against mouse hnRNP A/B (a gift from Dr. Jonathan Dean, Imperial College of Science, Technology and Medicine, London, UK) or rabbit polyclonal antibody directed against S-nitroso-cysteine (Calbiochem) for 1 h at room temperature, washed three times in phosphate-buffered saline plus 0.05% Tween, and incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. After an additional three washes, bound peroxidase activity was detected by the ECL detection system (Amersham Biosciences).

Southwestern (DNA Protein) Blotting—Approximately 70 mg of total cell protein was electrophoresed in a sodium dodecyl sulfate-12% polyacrylamide gel, transferred to nitrocellulose, and renatured by using guanidine hydrochloride as described previously (18). The probes were labeled with [{alpha}-32P]dCTP, using a random primer kit (Roche Applied Science).

Plasmid Constructs—5'-Deletion fragments of the OPN promoter subcloned into pXP2 plasmid encoding luciferase were gifts from Dr. Denhardt (Rutgers University). The lengths of the osteopontin promoter fragments tested were OPN –69 (–69 to +79), OPN –258 (–258 to +79), OPN –472 (–472 to +79), OPN –600 (–600 to +79), OPN –777 (–777 to +79), and OPN –1467 (–1467 to +79). Further deletion constructs from –258 to –69 were constructed by PCR with the following primers, and then the fragments were cloned into pGL3-basic luciferase reporter plasmid (Promega): OPN-69 (–69 to +79), OPN-107 (–107 to +79), OPN-174 (–174 to +79), OPN-209 (–209 to +79), and OPN-258 (–258 to +79). Additional constructs were made with deletion of nt –174 to nt –209, OPN-full (del –174 to –209); nt –195 to nt –209, OPN-full (del –195 to –209); nt –183 to nt –196, OPN-full (del –183 to –196); and nt –174 to nt –184, OPN-full (del –174 to –184) from the full-length OPN promoter. Expression plasmids for heterogeneous nuclear ribonucleoprotein A/B proteins (hnRNP A/B isoform p37 and p40) were provided by Dr. Jonathan Dean (Imperial College of Science, Technology and Medicine, London, UK). The deletion and point mutants of the full-length OPN promoter were constructed by two-step PCR. In OPN-Point, the hnRNP-binding site AGTTATG identified by gel shift was mutated to CTGCCGT. In OPN-Deletion, the hnRNP site was simply deleted. The mutations were confirmed by DNA sequencing. The mutated PCR fragments were cloned into pGL3-basic luciferase reporter plasmid (Promega) and labeled OPN-Deletion and OPN-Point, respectively.

Transient Transfection and Activity Assay—DNA transfections of RAW 264.7 macrophages were carried out in 12-well plates using LipofectAMINE. Briefly, 1 x 106 cells were plated on a 12-well plate and allowed to grow for 24 h before the transfection. 2 µg of plasmid DNA and 2 µg of protamine sulfate diluted OPTI-DMEM and 24 µg of LipofectAMINE diluted in OPTI-DMEM were combined and incubated at room temperature for 20 min. The cells with transfection reagents were incubated for 4 h at 37 °C in a CO2 incubator. Transfection medium was then replaced with Eagle's minimal essential media containing 10% fetal bovine serum. At least 24 h later, the medium was changed, and LPS was added. To control transfection efficiency between groups, 0.1 µg of pRL-TK was added to each well. Twenty-four hours after transfection, the cells were harvested in 0.4 ml of reporter lysis buffer (Promega), and dual luciferase reporter assays were performed by following the protocol provided by the manufacturer. 40 µl of lysate was used for measurement in a luminometer (Turner Designs TD-20/20). Co-transfection studies were carried out by using 1 µg of expression plasmids for hnRNP A/B isoform p37 and p40 with 1 µg of OPN reporter plasmids. The three OPN reporter plasmids are OPN, OPN-Deletion, and OPN-Point. In selected instances, antisense or sense oligonucleotides to hnRNP were co-transfected with various OPN promoter constructs. The sense and antisense oligonucleotides (nt 954–974) were designed according to GenBankTM sequence NM 010448 to block the expression of hnRNP A/B (sense, 5'-GAGGAAATCGCAATCGAGG-3'; antisense, 5'-CCTCGATTGCGATTTCCTC-3').

Chromatin Immunoprecipitation (ChIP) Assay—Chromatin from macrophages was fixed and immunoprecipitated using the ChIP assay kit (Upstate Biotechnology, Inc.) as recommended by the manufacturer. The purified chromatin was immunoprecipitated using 10 µg of anti-hnRNP A/B or 5 µl of rabbit nonimmune serum. The input fraction corresponded to 0.1 and 0.05% of the chromatin solution before immunoprecipitation. After DNA purification, the presence of the selected DNA sequence was assessed by PCR. The PCR product was 338 bp in length. The PCR program was: 94 °Cx 4 min; followed by 94 °Cx 45 s, 55 °Cx 45 s, and 72 °Cx45 s for a total of 28 cycles; and then 72 °Cx 7 min. PCR products were resolved in 10% acrylamide gels. The average size of the sonicated DNA fragments subjected to immunoprecipitation was 500 bp as determined by ethidium bromide gel electrophoresis. The ChIP assay utilized PCR primers GTCTGAGAGAATCAAATTGT and AAAAACCTCATGACACATCA.

Nuclear Extract Preparation—Monolayers of RAW 264.7 cells were washed with phosphate-buffered saline and harvested by scraping into cold phosphate-buffered saline. The cell pellet obtained by centrifugation was resuspended in buffer containing 10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1.0 mM DTT and 0.5 mM phenylmethylsulfonyl fluoride; then 10% Nonidet P-40 was added and vortexed briefly; and the nuclei were pelleted by centrifugation. The nuclear proteins were extracted with buffer containing 20 mM HEPES, pH 7.9, 0.4 mM NaCl, 1.0 mM EDTA, 1.0 mM EGTA, 1.0 mM DTT, and 1.0 mM phenylmethylsulfonyl fluoride. Insoluble material was removed by centrifugation at 14000 rpm, and the supernatant containing the nuclear proteins was stored at –80 °C until use.

Gel Shift Assays—Gel shift assays were performed using nuclear cell extract fraction, as previously described. In competitive binding assays, unlabeled oligonucleotides were added at 200 M excess. In noncompetitive assays, unlabeled SP1 consensus oligonucleotides (Promega) were used. Supershift assays were performed by the addition of 1 µl of rat polyclonal antibody directed against mouse hnRNP A/B (a gift from Dr. Jonathan Dean, Imperial College of Science, Technology and Medicine, London, UK). The oligonucleotide (nt –174 to nt –202) used in gel shift were as follows: 5'-GAAAAGGGTAGTTATGACATCGTTCATC-3'. Probe was prepared by end labeling the wild-type 29-bp double-stranded oligonucleotides with [32P]ATP (2500 Ci/mmol) using T4 polynucleotide kinase, followed by G-50 column purification. The reactions were resolved on a 6% nondenaturing acrylamide gel in 1x TBE buffer. All of the oligonucleotides used in the gel shift are HPLC grade. 20-bp oligonucleotides used as competitors were synthesized to contain mutations in relation to the wild-type sequence.

Purification of Transcription Factor—The transcription factor was isolated by reacting the biotinylated DNA-protein complex with streptavidin paramagnetic particles (Dynal Biotech Inc.). Nuclear proteins were isolated from RAW 264.7 cells, as previously described. Protein concentration of the nuclear extract was determined using the Bio-Rad protein assay system. The nuclear protein was incubated for 15 min at 25 °C with reverse phase HPLC-purified biotinylated 29-mer oligonucleotide containing the identified binding site (5'-GAAAAGGGTAGTTATGACATCGTTCATC-3') bound to Dynabeads M280 streptavidin in protein binding buffer (50 mM Tris-HCl, pH 7.5, 2.5 mM EDTA, 20% (v/v) glycerol, 5 mM MgCl2, 250 mM NaCl, 0.25 mg/ml poly(dI-dC), and 2.5 mM DTT). The magnetic beads were then washed three times with protein binding buffer in 100 mM NaCl containing excess nonbinding poly(dI-dC) competitor DNA. Serial elutions were then performed using elution buffer (20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 10% (v/v) glycerol, 0.01% Triton X-100, 1 M NaCl, and 1 mM DTT). The fractions were typically stored at –80 °C prior to subsequent use.

Protein Sequencing—The protein was separated by SDS-PAGE and stained with silver. The individual protein band samples were excised and digested overnight with trypsin. The resulting digest was then injected onto a Microbore high performance liquid chromatography (Beckman 32 K Gold) system, and the fractions were collected. The 10 best fractions were selected for matrix-assisted laser desorption/ionization mass analysis of the intact protein (ABI/Perseptive Voyager DE-Pro); subsequently, the best fractions were selected for Edman sequencing (ABI Procise 470). The resulting data were manually interpreted and searched using Sequest against the NCBI nonredundant data base.

UV Cross-linking—DNA-protein cross-linking of the isolated nuclear protein complex was performed as previously described (4). Radiolabeled probe was prepared by annealing 1 pmol of an oligonucleotide encompassing the identified binding site GAAAAGGGTAGTTATGACATCGTTCATC with 100 pmol of a complementary oligonucleotide.

Statistical Analysis—The data are expressed as the means ± S.E. Analysis was performed using Student's t test. p values less than 0.05 were considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Transient Transfection Analysis of OPN Promoter Deletion Constructs—To localize a potential NO-sensitive cis-acting element in the OPN promoter, deletion constructs were transiently transfected in unstimulated control, LPS-treated, and LPS + L-NAME-treated RAW 264.7 cells (Fig. 1). Serial deletion constructs demonstrated a significant 9-fold increase in luciferase activity between nt –69 and nt –258 in the context of LPS stimulation. Inhibition of NO synthesis in the LPS + L-NAME group completely ablated this increase in luciferase activity. Sequences upstream of nt –258 did not contribute to LPS-associated OPN promoter activity (data not shown). Using further serial deletion constructs, this area of increased LPS- and NO-induced OPN promoter activity was further localized to the length of the promoter from nt –174 to nt –209 (Fig. 1A). Again, inhibition of NO synthesis in the LPS + L-NAME group ablated this increased promoter activity. Finally, deletions of segments nt –174 to –209, nt –195 to –209, nt –183 to –196, and nt –174 to –184 from the full-length 1467-nt OPN promoter (OPN-full) were analyzed (Fig. 1B). In the setting of transfection of the full-length wild-type OPN promoter, LPS treatment induced a 10–20-fold increase in OPN promoter activity; this was ablated when L-NAME was added with LPS. In contrast, deletion of nt –174 to –209 or deletion of nt –183 to –196 resulted in dramatic increases in OPN promoter activity in control and LPS + L-NAME groups such that the level of OPN activity was not different from that of the LPS group. In these experiments, SNAP (100 µM) was also added as an exogenous source of NO. In this instance, luciferase activity with SNAP treatment alone paralleled that of LPS treatment. These results suggest that an NO-sensitive constitutive repressor may reside in the nt –183 to –196 region of the OPN promoter.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 1.
Effect of LPS-mediated NO synthesis on OPN promoter deletion constructs in RAW 264.7 murine macrophages. A, the histograms are representations of luciferase activity normalized to {beta}-galactosidase activity from co-transfected pCMV.SPORT-{beta}-gal-induced activity. The lengths of the osteopontin promoter fragments tested were OPN-69 (–69 to +79), OPN-107 (–107 to +79), OPN-174 (–174 to +79), OPN-209 (–209 to +79), and OPN-258 (–258 to +79). The values are expressed as the means ± S.E. of three experiments. *, p < 0.01 versus control and LPS + L-NAME. B, the histograms are representations of luciferase activity normalized to {beta}-galactosidase activity from co-transfected pCMV.SPORT-{beta}-gal-induced activity. The constructs were made with deletion of nt –174 to –209, OPN-full (del –174 to –209); nt –195 to –209, OPN-full (del –195 to –209); nt –183 to –196, OPN-full (del –183 to –196); and nt –174 to –184, OPN-full (del –174 to –184) from the full-length OPN promoter. The values are expressed as the means ± S.E. of three experiments. *, p < 0.01 versus control and LPS + L-NAME; #, p < 0.01 versus OPN-full, OPN-full (del –195 to –209), and OPN-full (del-183 to –196).

 
Gel Shift Analysis—To determine whether a trans-activating factor may reside in the nt –183 to –196 region of the OPN promoter, gel shift analysis was performed using a labeled 29-nt fragment (nt –174 to –202) containing the area of interest (Fig. 2). Nuclear protein was isolated from control, LPS-treated, and LPS + L-NAME-treated cells. In control, LPS + L-NAME, and L-NAME cells, nuclear protein was bound to the labeled probe. In the presence of 40-fold excess unlabeled full-length probe, this binding was extinguished. The full-length probe was then truncated into three segments: nt –195 to –202, nt –174 to –183, and nt –183 to –196, and expressed as tandem triple repeats. When these were added as excess unlabeled competitors, nuclear binding was ablated in the presence of the unlabeled segment of OPN promoter from nt –183 to –196. These data suggest that nuclear protein is bound to the OPN promoter in the region of nt –183 to –196 in unstimulated control cells. In the presence of LPS and NO, binding is no longer present, and OPN promoter activity is increased, indicating that this protein may function as a constitutive repressor.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 2.
Mutational analysis of NO-sensitive binding site in OPN promoter. Gel shift competition studies were performed using nuclear extract prepared from unstimulated control RAW 264.7 macrophages and those stimulated with LPS (100 nM) and/or L-NAME (100 µM). Gel shift assays using a labeled 29-nt fragment (nt –174 to –202) containing the area of interest were performed for the identification of the a potential NO-sensitive transcription factor. In competitive binding assays, unlabeled mutant oligonucleotides were added at 200 M excess. Sequences of mutant competitor oligonucleotides are listed in Table I. The mutated sequences are expressed as tandem triple repeats and were used as excess unlabeled competitors. The blot is representative of three experiments.

 
The binding region was then further characterized by serial mutations of the OPN promoter between nt –183 and –196 (Table I). These mutated sequences were then expressed as tandem triple repeats and used as excess unlabeled competitors in gel shift assays. Mutant sequences 2 and 4 effectively competed for binding to the repressor protein, suggesting that the core binding sequence is AGTTATG. The sequence specificity for binding was confirmed with in vitro DNA footprinting (data not shown).


View this table:
[in this window]
[in a new window]
  		TABLE I
Sequences of mutated competitor DNA for gel shift analysis

 
Isolation and Characterization of Repressor Protein—Bound repressor protein complex previously resolved by gel shift analysis was UV cross-linked to a radiolabeled DNA probe containing nt –183 to –196. Subtracting the molecular mass of the DNA probe indicates that the molecular mass of the repressor transcription factor protein is ~40 kDa. Utilizing the biotin-streptavidin DNA affinity technique with the identified DNA-binding sequence, the repressor transcription factor was then purified and isolated from nuclear extract isolated from unstimulated control RAW 264.7 macrophages. A representative Western blot of purified extract is depicted in Fig. 3. One major band was identified. A Southwestern blot was performed using nuclear extract and radiolabeled tandem double repeat DNA probe (nt –183 to –196) containing the described binding sequence; this demonstrated binding to Band 1. Band 1 was therefore excised and subjected to protein sequencing. Analysis of two separate tryptic digests of Band 1 yielded identical matches with hnRNP A/B (GenBankTM accession number NM 010448).



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 3.
Isolation of NO-sensitive transcription factor. Western blot of crude nuclear extract and purified nuclear extract from unstimulated control RAW 264.7 macrophages was performed on 6% SDS-PAGE. Crude nuclear protein and nuclear protein purified utilizing the biotin-streptavidin DNA affinity technique with the identified putative DNA-binding sequence were electrophoresed on 8% SDS-PAGE and stained with Coomassie Brilliant Blue. The Southwestern blot was performed using radiolabeled tandem double repeat DNA probe (nt –183 to –196) containing the described binding sequence and the purified nuclear protein fraction. The blots are representative of four experiments. MW, molecular mass.

 
Confirmation of hnRNP A/B DNA Binding and Function—To confirm specificity of hnRNP A/B binding to the OPN promoter, supershift and ChIP assays were performed in unstimulated control, LPS-treated, and LPS + L-NAME-treated cells. Rat polyclonal antibody directed against mouse hnRNP A/B was a gift from Dr. Jonathan Dean (Imperial College of Science, Technology and Medicine, London, UK). Gel shift assays were repeated in the presence of hnRNP A/B antibody with the previously described DNA probe. Again, a band corresponding to binding of a nuclear protein was found in control and LPS + L-NAME cells. This band was supershifted in control and LPS + L-NAME cells by the addition of the hnRNP A/B antibody (Fig. 4A). No shift was noted with preimmune sera. ChIP assays were then performed to confirm the in vivo binding of hnRNP A/B to this portion of the OPN promoter (Fig. 4B). LPS- and SNAP-treated cells did not exhibit hnRNP A/B binding, whereas control and LPS + L-NAME cells demonstrated DNA binding. These data suggest that hnRNP A/B binds to this segment of the OPN promoter in unstimulated control cells. Conversely, the presence of NO, endogenously synthesized or exogenously delivered, inhibits hnRNP A/B binding.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 4.
Gel shift and ChIP assay confirmation of hnRNP A/B binding to OPN promoter. A, supershift analysis of hnRNP A/B binding. Gel shift competition studies were performed using nuclear extract prepared from unstimulated control RAW 264.7 macrophages and those stimulated with LPS (100 nM) and/or L-NAME (100 µM). Gel shift assays using a labeled 29-nt fragment (nt –174 to –202) containing the area of interest were performed for the identification of the a potential NO-sensitive transcription factor. In selected instances, polyclonal antibody to hnRNP A/B was preincubated with the nuclear proteins. The blot is representative of three experiments. B, ChIP analysis of hnRNP A/B binding. Chromatin from was fixed and immunoprecipitated using the ChIP assay kit as recommended by the manufacturer (Upstate Biotechnology, Inc.). The purified chromatin was immunoprecipitated using 10 µg of anti-hnRNP A/B or 5 µl of rabbit nonimmune serum. The input fraction corresponded to 0.1 and 0.05% of the chromatin solution before immunoprecipitation. After DNA purification, the presence of the selected DNA sequence was assessed by PCR. The blot is representative of three experiments. ab, antibody.

 
The full-length OPN, OPN-Point, and OPN-Deletion promoter constructs were then transfected into RAW 264.7 cells. In OPN-Point, the hnRNP-binding site AGTTATG was mutated to CTGCCGT in the full-length OPN promoter. In OPN-Deletion, the hnRNP site was simply deleted. These mutations were confirmed by DNA sequencing. The cells were again subjected to LPS or LPS + L-NAME treatment. In selected instances, antisense and sense oligonucleotides to hnRNP A/B were also added (Fig. 5A). When compared with the full-length OPN promoter, OPN-Point and OPN-Deletion constructs demonstrated significantly greater levels of luciferase activity in control and LPS + L-NAME settings. These levels were not different from that seen with LPS stimulation. In addition, when antisense oligonucleotides to hnRNP A/B were added with the wild-type full-length OPN promoter, promoter activity was also significantly augmented in control and LPS + L-NAME treatment settings. Co-transfection assays were then performed with the full-length OPN promoter and the expression vector for hnRNP A/B p37. In control and LPS + L-NAME cells, co-expression of hnRNP A/B p37 further depressed OPN promoter activity (Fig. 5B). In the setting of SNAP or LPS treatment, OPN promoter activity was quite elevated in comparison with that of control cells (Fig. 5C). This level of luciferase activity was not altered by co-expression of hnRNP A/B. These data suggest that hnRNP A/B functions as a constitutive repressor of OPN promoter activity, and in the presence of LPS-mediated NO production, hnRNP binding is no longer present, and OPN promoter activity increases.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 5.
Transient transfection analysis of hnRNP A/B interactions with the OPN promoter. A, the full-length OPN, OPN-Point and OPN-Deletion promoter constructs were transfected into RAW 264.7 cells. In OPN-Point, the hnRNP-binding site AGTTATG was mutated to CTGCCGT in the full-length OPN promoter. In OPN-Deletion, the hnRNP site was simply deleted. These mutations were confirmed by DNA sequencing. The cells were again subjected to LPS or LPS + L-NAME treatment. In selected instances, antisense and sense oligonucleotides to hnRNP A/B were also added. The histograms are representations of luciferase activity normalized to {beta}-galactosidase activity from co-transfected pCMV.SPORT-{beta}-gal-induced activity. The values are expressed as the means ± S.E. of three experiments. *, p < 0.01 versus control and LPS + L-NAME. B, co-transfection of hnRNP A/B p37 expression vector in control and LPS + L-NAME-treated cells. The full-length OPN promoter reporter construct was co-transfected with an hnRNP A/B expression vector. The cells were unstimulated controls or subjected to LPS + L-NAME treatment. The values are expressed as the means ± S.E. of three experiments. *, p < 0.01 versus OPN-1467). C, co-transfection of hnRNP A/B p37 expression vector in SNAP- and LPS-treated cells. The full-length OPN promoter reporter construct was co-transfected with an hnRNP A/B expression vector. The cells were subjected to LPS or SNAP treatment. The values are expressed as the means ± S.E. of three experiments.

 
S-Nitrosylation of hnRNP A/B Protein and DNA Binding— The levels of hnRNP A/B protein expression in the nuclear and cytoplasmic compartments were then determined with immunoblot analysis (data not shown). There was no difference in nuclear levels of hnRNP A/B protein among control, LPS, and LPS + L-NAME treatment groups. No hnRNP A/B was detectable in the respective cytoplasmic protein fractions. One well described route for NO-mediated regulation of protein function is via S-nitrosylation of protein thiols. hnRNP A/B has two cysteine residues (Cys229 and Cys104) that may serve as targets for S-nitrosylation. Co-immunoprecipitation experiments were then performed using Abs directed against S-nitroso-cysteine and hnRNP A/B (Fig. 6). In contrast to that noted in unstimulated control and LPS + L-NAME cells, these co-immunoprecipitation studies demonstrate significantly increased S-nitroso-cysteine content in hnRNP A/B from LPS-treated cells. This suggests that NO-mediated S-nitrosylation of relevant hnRNP A/B protein thiols in the context of LPS stimulation may alter the DNA binding activity of hnRNP.



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 6.
Co-immunoprecipitation of S-nitrosylated hnRNP A/B protein. Co-immunoprecipitation experiments were performed using nuclear protein from unstimulated control cells or cells treated with LPS (100 nM). The whole cell lysate was precleared, and the supernatant was incubated with primary polyclonal hnRNP A/B antibody. The protein concentration was determined and separated by 12% SDS-PAGE, and the products were electrotransferred to polyvinylidene difluoride membrane (Amersham Biosciences). The blocked membranes were then incubated with rabbit polyclonal S-nitrosocysteine antibody. Following incubation with horseradish peroxidase-conjugated secondary antibody, bound peroxidase activity were detected by the ECL detection system (Amersham Biosciences). The blot is representative of three experiments.

 
To determine the effect of S-nitrosylation on hnRNP A/B DNA binding, FLAG-tagged hnRNP A/B p37 and p40 isoforms were expressed in COS-1 cells. FLAG hnRNP A/B protein was then isolated and incubated with S-nitroso-glutathione (GSNO) in concentrations of 0, 0.1, 0.5, and 1.0 µM in the presence and absence of DTT (5 mM). Gel shift assays were then performed (Fig. 7). Nitrosylation of hnRNP A/B p37 with increasing concentrations of GSNO resulted in significantly diminished DNA binding. Further addition of DTT to inhibit S–NO bond formation resulted in hnRNP A/B DNA binding activity that was unaltered in the presence of GSNO. In contrast, when this experiment was repeated with the hnRNP p40 isoform, no change in DNA binding was found in the presence of GSNO. These data suggest that S-nitrosylation of hnRNP A/B p37 is significantly enhanced in the presence of LPS-mediated NO synthesis. In this ex vivo setting, this is associated with diminished DNA binding in gel shift assays.



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 7.
Gel shift analysis of ex vivo S-nitrosylated hnRNP A/B p37 and p40 proteins. FLAG-tagged hnRNP A/B 37-kDa and p40 isoforms were expressed in COS-1 cells. FLAG hnRNP A/B protein was then isolated and incubated with GSNO in concentrations of 0, 0.1, 0.5, and 1.0 µM in the presence and absence of DTT (5 mM). Gel shift assays using a labeled 29-nt fragment (nt –174 to –202) containing the hnRNP A/B-binding site. The blots are representative of three experiments. A, gel shift analysis of hnRNP A/B p37 protein. B, gel shift analysis of hnRNP A/B p40 protein.

 
The cysteine residues in FLAG-hnRNP A/B p37 were then individually mutated to serine, and the expression vectors, mC-229 and mC-104, were generated. Serine has a tertiary structure similar to cysteine but is not a target for S-nitrosylation. These mutant FLAG hnRNP A/B p37 proteins were then expressed, isolated, and incubated with GSNO (1.0 µM). The gel shift assays were then performed (Fig. 8). At base line, untreated control mC-104 and mC-229 DNA binding did not differ from that of wild-type hnRNP A/B p37, suggesting that serine substitution at these locations did not alter intrinsic DNA binding. In the presence of GSNO, p37 and mC-229 DNA binding were significantly decreased, whereas that of mC-104 was unaltered. When treated with both GSNO and DTT (5 mM), p37 and mC-229 DNA binding were restored to base-line levels that were not different from that of mC-104. These data indicate that S-nitrosylation of the hnRNP A/B p37 cysteine residue at position 104 is associated with inhibition of DNA binding.



View larger version (47K):
[in this window]
[in a new window]
  		FIG. 8.
Gel shift analysis of wild-type, mC-104,and mC-229 hnRNPA/B p37 protein. The hnRNP A/B cysteine residues at positions 104 (mC-104) and 229 (mC-229) were mutated to serine. Wild-type and mutated FLAG-tagged hnRNP A/B p37 were expressed in COS-1 cells. FLAG hnRNP A/B protein was then isolated and incubated with GSNO in concentrations of 0, 0.1, 0.5, and 1.0 µM in the presence and absence of DTT (5 mM). Gel shift assays used a labeled 29-nt fragment (nt –174 to –202) containing the hnRNP A/B binding site. The blots are representative of three experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In previous studies, we have demonstrated that endotoxin-induced expression of NO can up-regulate OPN gene transcription and promoter activity in a system of murine macrophages in cell culture. However, the responsible cis- and trans-regulatory factors have not been identified. In this follow-up study, we demonstrate that: 1) OPN gene transcription is regulated by a constitutive transcriptional repressor protein, hnRNP A/B; 2) inhibition of in vivo hnRNP DNA binding activity is accompanied by increased S-nitrosylation of hnRNP A/B in the setting of LPS-mediated NO synthesis; 3) inhibition of LPS-mediated NO synthesis restores hnRNP DNA binding and decreases the extent of S-nitrosylation; and 4) S-nitrosylation of hnRNP at cysteine 104 inhibits in vitro DNA binding activity, which is reversed by DTT. Our findings suggest that LPS induced S-nitrosylation of hnRNP inhibits its activity as a constitutive repressor of the OPN promoter and results in enhanced OPN expression.

OPN is a highly hydrophilic and negatively charged sialoprotein of ~298 amino acids that contains a Gly-Arg-Gly-Asp-Ser sequence. It is a secreted protein with diverse regulatory functions, including cell adhesion and migration, tumor growth and metastasis, atherosclerosis, aortic valve calcification, and repair of myocardial injury. Its expression is tissue-specific and subject to regulation by many factors (1, 2, 5, 6). Constitutive expression of OPN is found in bone, kidney, placenta, and nerve cells. Induced expression of OPN is found in T cells, epidermal and bone cells, and macrophages in response to phorbol 12-myristate 13-acetate, 1,25-dihydroxyvitamin D, basic fibroblast growth factor, tumor necrosis factor-{alpha}, interleukin-1, interferon-{gamma}, and endotoxin. Interestingly, OPN and iNOS are induced in response to the many of the same agents, such as tumor necrosis factor-{alpha}, interleukin-1{beta}, interferon-{gamma}, and LPS (7, 8).

Recently, the relationship between NO and OPN has been examined by a number of investigators. Rollo et al. (9) demonstrated that exogenous recombinant OPN protein was effective in blocking RAW264.7 murine macrophage NO production and cytotoxicity toward the NO-sensitive mastocytoma cells. Their work suggested that OPN in extracellular fluid may protect certain tumor cells from macrophage-mediated destruction by inhibiting the synthesis of NO. However, these authors did not attempt to localize a potential cellular source for OPN in this setting. Singh et al. (10, 11) reported that a synthetic 20-amino acid OPN peptide analogue decreased iNOS mRNA and protein levels in ventricular myocytes and cardiac microvascular endothelial cells. Transfection of cardiac microvascular endothelial cells with an antisense OPN cDNA increased iNOS mRNA in response to interleukin-1{beta} and interferon-{gamma}, suggesting that endogenous OPN inhibits NO production. Lastly, using an antibody directed against the OPN {alpha}V{beta}3 integrin receptor, Attur et al. (12) demonstrated that ligand binding results in a trans-dominant inhibition of NO production in human cartilage. Hwang et al. (13, 14) found that OPN suppressed NO synthesis induced by interferon and LPS in primary mouse kidney proximal tubule epithelial cells, suggesting a regulatory role for OPN in the NO signaling pathway. These studies clearly demonstrate that endogenous OPN can inhibit induction of iNOS and that OPN is an important regulator of the NO signaling pathway and NO-mediated cytoregulatory processes. However, the converse relationship, the role of NO in the induction of OPN synthesis, has not been well studied. We have previously found that LPS induced NO synthesis up-regulates OPN promoter activity and protein expression (3). In this study, we provide evidence that S-nitrosylation of hnRNP A/B inhibits DNA binding activity to the OPN promoter.

In part as a result of its participation in redox chemistry, NO is a pleuripotent regulator of multiple cellular functions (7, 16). The formation of S-nitrosothiols exemplifies those pathways of NO oxidation that lead to surrogate NO-like bioactivity and result in allosteric receptor modification, inhibition of sulfhydryl-enzyme activities, and down-regulation of transcriptional activators. The DNA binding activities of the transcription factors NF-{kappa}B, AP-1, hepatocyte nuclear factor-4{alpha}, p53, and hypoxia-inducible factor-1 are inhibited by S-nitrosylation of relevant protein thiols (17–24). With respect to NF-{kappa}B activity, studies utilizing exogenous NO donors have shown that NF-{kappa}B DNA binding is inhibited (25–27). Among others, we (25, 28) and the group of Marshall and Stamler (22, 23) have shown that S-nitrosylation of a critical thiol in NF-{kappa}B p50 inhibits DNA binding. Calmels et al. (29) also demonstrated NO-mediated inhibition of p53 DNA binding resulting from NO-induced conformational and functional modifications, suggesting S-nitrosylation, given the absence of an I{kappa}B correlate for p53. In addition, Schneiderhan et al. (17) found that NO induces phosphorylation of serine 15 to impair nuclear export. In a similar fashion, NO-dependent inhibition of AP-1 and hypoxia-inducible factor-1 DNA binding has also been documented (20, 21). In this regard, hnRNP A/B is another transcription factor whose DNA binding activity is similarly decreased by LPS-mediated S-nitrosylation of a key cysteine thiol. Most recently, Kuncewicz et al. (24) utilized a biotin switch technique for isolation of isolation of S-nitrosylated proteins coupled with two-dimensional PAGE separation/matrix-assisted laser desorption ionization/peptide mass fingerprinting to identify S-nitrosylated target proteins in murine mesangial cells treated with NO donors. They identified 31 unique S-nitrosylated proteins not previously identified, including signaling proteins, receptors and membrane proteins, cytoskeletal or cell matrix proteins, and cytoplasmic proteins. Prominent among these were peroxisome proliferator activated receptor {gamma}, uroguanylin, GTP-binding protein {alpha}, protein 14-3-3, NADPH-cytochrome P-450 oxidoreductase, transcription factor IIA, melusin, mitosin, phospholipase A2-activating protein, and protein-tyrosine phosphatase. These results indicate that S-nitrosylation is a generalized, pervasive regulatory pathway in cellular physiology with potential for modification of transcription factors, co-activators, and general transcription factors.

In our study, hnRNP A/B was identified as a transcription factor whose DNA binding activity is decreased by LPS-mediated S-nitrosylation of a key cysteine thiol. Heterogeneous nuclear ribonucleoproteins were originally described as a group of chromatin-associated RNA-binding proteins that form complexes with RNA polymerase II transcripts. The hnRNP family is a collection of more than 20 proteins that contribute to the complex around nascent pre-mRNA and are thus able to modulate RNA processing (30–32). Members of the group are characterized by their ability to bind to RNA with limited specificity, and they are among the most abundant of all of the nuclear proteins. Despite its function in RNA handling, the precise physiological role of hnRNPs has yet to be fully defined and may include transregulatory effects. Recent studies have shown that the hnRNPs D0B, E2BP, and K are able to bind to double-stranded DNA motifs within the complement receptor 2, hepatitis B virus, and c-myc promoters, respectively (33–35). hnRNPs can also repress viral DNA replication, repress estrogen- and vitamin D-induced transcription, and transcriptionally regulate various genes, including the rat spi2 gene (30, 36–38). A transcriptional regulatory role for hnRNPs was first determined for hnRNP K, which has both activator and repressor functions (39). Formation of a complex between hnRNP K and CCAAT/enhancer binding protein inhibited activation of the {alpha}-1-acid glycoprotein gene. Similarly, transcription of the Epstein-Barr virus EBNA-1 genes is activated by a heterodimer formed in part by hnRNP D (40).

hnRNP A/B is a unique member of the hnRNP family in that it possess a DNA-binding sequence domain that is separate from the repression domain. The p40 isoform contains 331 amino acid residues, whereas p37 contains 284. The amino acid sequences are identical with the exception of an additional 47 amino acids at the C-terminal region of p40. In this regard, Yabuki et al. (41) found that hnRNP A/B p40 binds to the rat aldolase B promoter to inhibit activity, whereas hnRNP A/B p37 had no effect. Further studies by this group found that the DNA-binding region for both isoforms reside with amino acids 67–159, 67–75, and 147–159 are absolute requirements for binding activity (15). This 67–159-amino acid region contains the S-nitrosylation target, Cys104, which was found to be responsible for NO-mediated inhibition of DNA binding in our experiments. Mutation of this Cys to Ser did not alter its in vitro DNA binding properties in the presence or absence of NO. Of interest, Smidt and colleagues (18) had previously demonstrated that hnRNP A/B p40 binds to single-stranded, but not double-stranded DNA, in the apoVLDL II site D recognizing the sequence TCCTAATTAGGTAA. In contrast, we have demonstrated binding to the double-stranded DNA sequence, AGTTATG, which differs from that of apoVLDL II site D by 2 nucleotides, as designated. Our current findings suggest that LPS-induced S-nitrosylation of hnRNP inhibits its activity as a constitutive repressor of the OPN promoter. This represents a novel target for S-nitrosylation regulatory functions as hnRNP proteins are better characterized as participants in telomere biogenesis, splicing, and mRNA transport. Further study to determine the potential role of S-nitrosylation in these other hnRNP-dependent functions may expand the known regulatory roles for NO and S-nitrosylation.


   FOOTNOTES
 
* This work was supported by the American College of Surgeons Clowes Faculty Development Award (to P. C. K.) and National Institutes of Health Grants R01 AI44629 (to P. C. K.) and R01 GM65113 (to P. C. K.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed: 110 Bell Bldg., Box 3522, DUMC, Durham, NC 27710. Tel.: 919-969-9810; Fax: 919-684-8716; E-mail: kuo00004{at}mc.duke.edu.

1 The abbreviations used are: OPN, osteopontin; LPS, lipopolysaccharide; hnRNP, heterogeneous nuclear ribonucleoprotein; L-NAME, NG-nitro-L-arginine methyl ester; SNAP, S-nitroso-N-acetyl-penicillamine; nt, nucleotide(s); ChIP, chromatin immunoprecipitation; DTT, dithiothreitol; HPLC, high pressure liquid chromatography; GSNO, S-nitroso-glutathione; iNOS, inducible nitric-oxide synthase. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hijiya, N., Setoguchi, M., Matsuura, K., Higuchi, Y., Akizuki, S., and Yamamoto, S. (1994) Biochem. J. 303, 255–262
  2. Guo, X., Zhang, Y. P., Mitchell, D. A., Denhardt, D. T., and Chambers, A. F. (1995) Mol. Cell. Biol. 15, 476–487[Abstract]
  3. Guo, H., Cai, C. Q., Schroeder, R. A., and Kuo, P. C. (2001) J. Immunol. 166, 1079–1086[Abstract/Free Full Text]
  4. Guo, H., Cai, C. Q., and Kuo, P. C. (2001) J. Biol. Chem. 277, 2054–5060
  5. Denhardt, D. T., and Guo, X. J. (1993) FASEB J. 7, 1475–1482[Abstract]
  6. Chellaiah, M., Fitzgerald, C., Filardo, E. J., Cheresh, D. A., and Hruska, K. A. (1996) Endocrinology 137, 2432–2440[Abstract]
  7. Nathan, C. (1992) FASEB 6, 1157–1175
  8. Nathan, C., and Xie, Q. W. (1994) J. Biol. Chem. 269, 13725–13728[Free Full Text]
  9. Rollo, E. E., Laskin, D. L., and Denhardt, D. T. (1996) J. Leukocyte Biol. 60, 397–404[Abstract]
  10. Singh, K., Sirokman, G., Communal, C., Robinson, K. G., Conrad, C. H., Brooks, W. W., Bing, O. H., and Colucci, W. S. (1999) Hypertension 33, 663–670[Abstract/Free Full Text]
  11. Singh, K., Balligand, J. L., Fischer, T. A., Smith, T. W., and Kelly, R. A. (1995) J. Biol. Chem. 270, 28471–28478[Abstract/Free Full Text]
  12. Attur, M. G., Dave, M. N., Stuchin, S., Kowalski, A. J., Steiner, G., Abramson, S. B., Denhardt, D. T., and Amin, A. R. (2001) Arthritis Rheum. 44, 578–584[CrossRef][Medline] [Order article via Infotrieve]
  13. Hwang, S. M., Wilson, P. D., Laskin, J. D., and Denhardt, D. T. (1994) J. Cell. Physiol. 160, 61–68[CrossRef][Medline] [Order article via Infotrieve]
  14. Hwang, S. M., Lopez, C. A., Heck, D. E., Gardner, C. R., Laskin, D. L., Laskin, J. D., and Denhardt, D. T. (1994) J. Biol. Chem. 269, 711–715[Abstract/Free Full Text]
  15. Saitoh, Y., Miyagi, S., Ariga, H., and Tsutsumi, K. (2002) Nucleic Acids Res. 30, 5205–5212[Abstract/Free Full Text]
  16. Wilson, A. B., Harris, J. M., and Coombs, R. R. A. (1988) Cell. Immunol. 113, 130–142[CrossRef][Medline] [Order article via Infotrieve]
  17. Schneiderhan, N., Budde, A., Zhang, Y., and Brune, B. (2003) Oncogene 22, 2857–2868[CrossRef][Medline] [Order article via Infotrieve]
  18. Smidt, M. P., Russchen, B., Snippe, L., Wijnholds, J., and Ab, G. (1995) Nucleic Acids Res. 23, 2389–2395[Abstract/Free Full Text]
  19. Vossen, C., and Erard, M. (2002) Med. Sci. Monit. 8, RA217–RA220[Medline] [Order article via Infotrieve]
  20. Tabuchi, A., Sano, K., Oh, E., Tsuchiya, T., and Tsuda, M. (1994) FEBS Lett. 351, 123–127[CrossRef][Medline] [Order article via Infotrieve]
  21. Palmer, L. A., Gaston, B., and Johns, R. A. (2000) Mol. Pharmacol. 58, 1197–1203[Abstract/Free Full Text]
  22. Marshall, H. E., and Stamler, J. S. (2002) J. Biol. Chem. 277, 34223–34228[Abstract/Free Full Text]
  23. Marshall, H. E., and Stamler, J. S. (2001) Biochemistry 40, 1688–1693[CrossRef][Medline] [Order article via Infotrieve]
  24. Kuncewicz, T., Sheta, E. A., Goldknopf, I. L., and Kone, B. C. (2003) Mol. Cell Proteomics. 2, 156–163[Abstract/Free Full Text]
  25. delaTorre, A., Schroeder, R. A., and Kuo, P. C. (1997) Biochem. Biophys. Res. Commun. 238, 703–706[CrossRef][Medline] [Order article via Infotrieve]
  26. Adcock, I. M., Brown, C. R., Kwon, O., and Barnes, P. J. (1995) Biochem. Biophys. Res. Commun. 199, 1518–1524
  27. Matthews, J. R., Botting, C. H., Panico, M., morris, H. R., and Hay, R. T. (1996) Nucleic Acids Res. 24, 2236–2242[Abstract/Free Full Text]
  28. delaTorre, A., Schroeder, R. A., Punzalan, C., and Kuo, P. C. (1999) J. Immunol. 162, 4101–4108[Abstract/Free Full Text]
  29. Calmels, S., Hainaut, P., and Ohshima, H. (1997) Cancer Res. 57, 3365–3369[Abstract/Free Full Text]
  30. Chen, H., Hewison, M., Hu, B., and Adams, J. S. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 6109–6114[Abstract/Free Full Text]
  31. Dreyfuss, G., Hentze, M., and Lamond, A. I. (1996) Cell 85, 963–972[CrossRef][Medline] [Order article via Infotrieve]
  32. Krecic, A. M., and Swanson, M. S. (1999) Curr. Opin. Cell Biol. 11, 363–371[CrossRef][Medline] [Order article via Infotrieve]
  33. Tolnay, M., Vereshchagina, L. A., and Tsokos, G. C. (1999) Biochem. J. 338, 417–425
  34. Tay, N., Chan, S. H., and Ren, E. C. (1992) J. Virol. 66, 6841–6848[Abstract/Free Full Text]
  35. Tomonaga, T., and Levens, D. (1995) J. Biol. Chem. 270, 4875–4881[Abstract/Free Full Text]
  36. Wang, D., and Parrish, C. R. (1999) J. Virol. 73, 7761–7768[Abstract/Free Full Text]
  37. Chen, H., Hu, B., Gacad, M. A., and Adams, J. S. (1998) J. Biol. Chem. 273, 31352–31357[Abstract/Free Full Text]
  38. Chen, H., Hu, B., Allegretto, E. A., and Adams, J. S. (2000) J. Biol. Chem. 275, 35557–35564[Abstract/Free Full Text]
  39. Michelotti, E. F., Michelotti, G. A., Aronsohn, A. I., and Levens, D. (1996) Mol. Cell. Biol. 16, 2350–2360[Abstract]
  40. Dempsey, L. A., Hanakahi, L. A., and Maizels, N. (1998) J. Biol. Chem. 273, 29224–29229[Abstract/Free Full Text]
  41. Yabuki, T., Miyagi, S., Ueda, H., Saitoh, Y., and Tsutsumi, K. (2001) Gene (Amst.) 264, 123–129[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
Z. T. Kelleher, A. Matsumoto, J. S. Stamler, and H. E. Marshall
NOS2 Regulation of NF-{kappa}B by S-Nitrosylation of p65
J. Biol. Chem., October 19, 2007; 282(42): 30667 - 30672.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Gao, H. Guo, Z. Mi, M. J. Grusby, and P. C. Kuo
Osteopontin Induces Ubiquitin-Dependent Degradation of STAT1 in RAW264.7 Murine Macrophages
J. Immunol., February 1, 2007; 178(3): 1870 - 1881.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. Y. Wai, Z. Mi, C. Gao, H. Guo, C. Marroquin, and P. C. Kuo
Ets-1 and Runx2 Regulate Transcription of a Metastatic Gene, Osteopontin, in Murine Colorectal Cancer Cells
J. Biol. Chem., July 14, 2006; 281(28): 18973 - 18982.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
Z. Mi, H. Guo, P. Y. Wai, C. Gao, and P. C. Kuo
Integrin-linked kinase regulates osteopontin-dependent MMP-2 and uPA expression to convey metastatic function in murine mammary epithelial cancer cells
Carcinogenesis, June 1, 2006; 27(6): 1134 - 1145.
[Abstract] [Full Text] [PDF]

Home page
 JDRHome page
J. Sodek, A. P. Batista Da Silva, and R. Zohar
Osteopontin and Mucosal Protection
Journal of Dental Research, May 1, 2006; 85(5): 404 - 415.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Z. Yu, T. Kuncewicz, W. P. Dubinsky, and B. C. Kone
Nitric Oxide-dependent Negative Feedback of PARP-1 trans-Activation of the Inducible Nitric-oxide Synthase Gene
J. Biol. Chem., April 7, 2006; 281(14): 9101 - 9109.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Gao, H. Guo, Z. Mi, P. Y. Wai, and P. C. Kuo
Transcriptional Regulatory Functions of Heterogeneous Nuclear Ribonucleoprotein-U and -A/B in Endotoxin-Mediated Macrophage Expression of Osteopontin
J. Immunol., July 1, 2005; 175(1): 523 - 530.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
P. Y. Wai, Z. Mi, H. Guo, S. Sarraf-Yazdi, C. Gao, J. Wei, C. E. Marroquin, B. Clary, and P. C. Kuo
Osteopontin silencing by small interfering RNA suppresses in vitro and in vivo CT26 murine colon adenocarcinoma metastasis
Carcinogenesis, April 1, 2005; 26(4): 741 - 751.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Z. Mi, H. Guo, P. Y. Wai, C. Gao, J. Wei, and P. C. Kuo
Differential Osteopontin Expression in Phenotypically Distinct Subclones of Murine Breast Cancer Cells Mediates Metastatic Behavior
J. Biol. Chem., November 5, 2004; 279(45): 46659 - 46667.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/12/11236    most recent
M313385200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, C.
Right arrow Articles by Kuo, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, C.
Right arrow Articles by Kuo, P. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement