HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 279, Issue 13, 12479-12483, March 26, 2004

This Article Abstract Full Text (PDF) All Versions of this Article: 279/13/12479    most recent M313271200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ghosh, A. Articles by Chou, J. Y. Search for Related Content PubMed PubMed Citation Articles by Ghosh, A. Articles by Chou, J. Y. Social Bookmarking                      What's this?

Histidine 167 Is the Phosphate Acceptor in Glucose-6-phosphatase- Forming a Phosphohistidine Enzyme Intermediate during Catalysis^*

Abhijit Ghosh, Jeng-Jer Shieh, Chi-Jiunn Pan, and Janice Yang Chou

From the Section on Cellular Differentiation, Heritable Disorders Branch, NICHD, National Institutes of Health, Bethesda, Maryland 20892

Received for publication, December 4, 2003 , and in revised form, January 12, 2004.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The glucose-6-phosphatase (Glc-6-Pase) family comprises two active endoplasmic reticulum (ER)-associated isozymes: the liver/kidney/intestine Glc-6-Pase- and the ubiquitous Glc-6-Pase-. Both share similar kinetic properties. Sequence alignments predict the two proteins are structurally similar. During glucose 6-phosphate (Glc-6-P) hydrolysis, Glc-6-Pase-, a nine-transmembrane domain protein, forms a covalently bound phosphoryl enzyme intermediate through His¹⁷⁶, which lies on the lumenal side of the ER membrane. We showed that Glc-6-Pase- is also a nine-transmembrane domain protein that forms a covalently bound phosphoryl enzyme intermediate during Glc-6-P hydrolysis. However, the intermediate was not detectable in Glc-6-Pase- active site mutants R79A, H114A, and H167A. Using [³²P]Glc-6-P coupled with cyanogen bromide mapping, we demonstrated that the phosphate acceptor in Glc-6-Pase- is His¹⁶⁷ and that it lies inside the ER lumen with the active site residues, Arg⁷⁹ and His¹¹⁴. Therefore Glc-6-Pase- and Glc-6-Pase- share a similar active site structure, topology, and mechanism of action.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The glucose-6-phosphatase (Glc-6-Pase)¹ family is composed of three proteins: Glc-6-Pase- (1–4), Glc-6-Pase- (5–7) (previously known as UGRP (ubiquitously expressed Glc-6-Pase related protein)), and islet-specific Glc-6-Pase-related protein (8, 9). Whereas Glc-6-Pase- and Glc-6-Pase- are functional phosphohydrolases, the islet-specific Glc-6-Pase-related protein lacks enzymatic activity.

The prototype of the family, Glc-6-Pase-, is a 357-amino acid, nine-transmembrane domain, endoplasmic reticulum (ER)-associated protein (10, 11), which is expressed primarily in the liver, kidney, and intestine (12, 13). Glc-6-Pase- catalyzes the hydrolysis of glucose 6-phosphate (Glc-6-P) to glucose in the terminal step of gluconeogenesis and glycogenolysis (13). Between meals, the resulting release of glucose to the blood maintains glucose homeostasis. Naturally occurring loss of function mutations in Glc-6-Pase- cause glycogen storage disease type Ia, a disorder that is characterized by loss of blood glucose homeostasis and disorders of glycogen and lipid metabolism (reviewed in Refs. 14 and 15).

Glc-6-Pase- is a ubiquitously expressed, 346-amino acid membrane protein that shares a 36% sequence identity to Glc-6-Pase- (5–7). Despite the absence of any apparent ER retention motif, Glc-6-Pase- is also localized in the ER membrane (6), although its orientation in the membrane is not known. The subcellular localization of the Glc-6-Pase- active site is not known, although it is assumed to be similar to Glc-6-Pase-. Both Glc-6-Pase- and Glc-6-Pase- couple with the Glc-6-P transporter to form an active Glc-6-Pase complex, and both share similar kinetic properties with respect to Glc-6-P hydrolysis (6).

The active site of Glc-6-Pase- was originally identified by the presence of a conserved phosphatase signature motif found in lipid phosphatases, acid phosphatases, and vanadium haloperoxidases (16, 17). This motif was shown to contribute to the active site of a vanadium chloroperoxidase by both x-ray crystal structure analysis (18) and mutational studies (19, 20) and has since been shown to have a similar role in Glc-6-Pase- (21, 22). Hydrolysis of Glc-6-P to glucose and phosphate via a covalent phosphohistidine-Glc-6-Pase- intermediate was first proposed by Nordlie and Lygre (23) based on pH kinetic studies of Glc-6-Pase- catalysis, which was confirmed by the identification of an enzyme-bound ³²P-labeled histidine after incubating rat liver microsomes with [³²P]Glc-6-P (24–26). Critical residues for Glc-6-Pase- catalysis in the active site motif include: Arg⁸³, which donates hydrogen ions to the phosphate and stabilizes the transition state; His¹¹⁹, which provides a proton to liberate the glucose moiety; and His¹⁷⁶, which undertakes a nucleophilic attack on the phosphate to form a covalently bound phosphoryl enzyme intermediate (21, 27). In Glc-6-Pase-, all of these residues lie together on the lumenal side of the ER membrane (10, 11).

Given the sequence similarity between Glc-6-Pase- and Glc-6-Pase-, a similar active site structure would be anticipated. Sequence alignments predict that His¹⁶⁷ is the residue that forms a covalent bond with phosphate to create a phosphoryl-Glc-6-Pase- intermediate, whereas Arg⁷⁹ and His¹¹⁴ are the hydrogen donors. These alignments also suggest that Glc-6-Pase- contains nine putative transmembrane helices and that Arg⁷⁹, His¹¹⁴, and His¹⁶⁷ lie inside the ER lumen.

In an effort to understand the role of this ubiquitous Glc-6-Pase activity, we have undertaken a study of the active site of Glc-6-Pase- and confirmed that it is similar to Glc-6-Pase-. This information can now be used to design experiments that disrupt the activity of Glc-6-Pase- and investigate the biological importance of a Glc-6-Pase activity that is not limited in expression to the liver, kidney, and intestine, the organs previously considered to be the only ones capable of contributing to interprandial glucose homeostasis (13).

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Construction of Glc-6-Pase- Mutants—Mutants were constructed using the same general strategy used for Glc-6-Pase- (22). Briefly, the human Glc-6-Pase- cDNA was engineered to remove the internal SfiI site (6) and then used as a template for PCR-based N-terminal epitope tagging using either the FLAG (DYKDDDDK) or His₁₀ epitopes. The resulting PCR products were cloned directionally into the pSVL vector to generate pSVL-Glc-6-Pase--5FLAG and pSVL-Glc-6-Pase--His₁₀. The human pSVL-Glc-6-Pase--3FLAG construct has been described by Shieh, et al. (6).

For the protease protection assays, Glc-6-Pase- constructs incorporating two cleavable factor Xa tetrapeptide (IEGR) (28) recognition motifs were constructed by PCR and cloned into the pSVL vector. To locate the factor Xa tetrapeptide recognition motifs between the N-terminal FLAG epitope and the Glc-6-Pase- coding sequence, a 5' primer containing an ATG initiation codon followed by the 24-bp FLAG coding sequence, two fXa recognition sequences (back to back) (ATCGAGGGTAGAATCGAGGGTAGA), and nucleotides 217–237 of Glc-6-Pase- (GenBank^TM accession number XM_045901) was used. The 3' primer represented nucleotides 1237–1257 of human Glc-6-Pase-. The resulting construct was named Glc-6-Pase--5fXaFLAG. To locate the factor Xa tetrapeptide recognition motifs between the Glc-6-Pase- coding sequence and the C-terminal FLAG epitope, the 5' primer represented nucleotides 217–237 of human Glc-6-Pase-, whereas the 3' primer contained human Glc-6-Pase- nucleotides 1237–1257 followed by the 24-bp fXa recognition sequence, the 24-bp FLAG coding sequence, and a termination codon. This construct was named Glc-6-Pase--3fXaFLAG. All constructs were verified by DNA sequencing.

Construction of Recombinant Adenoviral Glc-6-Pase- Mutants—The recombinant adenovirus containing Glc-6-Pase--His₁₀ was generated by the Cre-lox recombination system described by Hardy et al. (29). The Ad-Glc-6-Pase--His₁₀ virus was plaque-purified and amplified to produce viral stocks with titers of 5–10 x 10⁹ plaque-forming units/ml. The C-terminal FLAG-tagged constructs, Ad-Glc-6-Pase-, Ad-Glc-6-Pase--R79A, Ad-Glc-6-Pase--H114A, and Ad-Glc-6-Pase--H167A, were described previously (6).

Protease Protection Assays and Western Blot Analysis—COS-1 cells in 25-cm² flasks were transfected with 10 µg of Glc-6-Pase--5FLAG, Glc-6-Pase--3FLAG, Glc-6-Pase--5fXaFLAG, or Glc-6-Pase--3fX-aFLAG in the pSVL vector as described previously (10). After incubation at 37 °C for 2 days, cell homogenates in 100 µl of Buffer A (0.25 M sucrose and 5 mM HEPES, pH 7.4) were treated with 250 µg/ml DNase I for 30 min at 30 °C. The cell homogenates from Glc-6-Pase--5FLAG or Glc-6-Pase--3FLAG transfected cells were then treated with trypsin (Type XIII, 500 µg/mg protein) for 30 min at room temperature followed by 5 mM phenylmethylsulfonyl fluoride and trypsin inhibitor (6 mg/mg protein) to inactivate trypsin. The cell homogenates from Glc-6-Pase--5fXaFLAG or Glc-6-Pase--3fXaFLAG transfected cells were treated with 15 µg of factor Xa protease (New England Biolabs, Beverly, MA) for 2 h at room temperature in a 75-µl reaction mixture containing 25 mM Tris-HCl, pH 7.4, 100 mM NaCl, and 2.5 mM CaCl₂. The factor Xa was then inactivated by the addition of Dansyl-Glu-Gly-Arg-chloromethylketone (Calbiochem) to a final concentration of 10 µM. The resultant trypsin- or factor Xa-treated cell homogenates were diluted 100-fold to 10 ml with cold Buffer A and centrifuged at 100,000 x g for 1 h at 4 °C to pellet the microsomes. The microsomal pellets were resuspended in Buffer A and used for Western blot analysis. The cell homogenates treated with 0.5% deoxycholate to disrupt the microsomes, followed by trypsin or factor Xa treatment, were used as controls.

For Western blot analysis, COS-1 lysates were separated by electrophoresis through a 12% SDS-polyacrylamide gel blotted onto polyvinylidene fluoride membranes (Millipore Co.) and incubated first with a monoclonal antibody against the FLAG epitope (Scientific Imaging Systems, Eastman Kodak) and then with goat anti-mouse IgG antibody (Kirkegarrd & Perry Laboratories, Gaithersburg, MD). The immunocomplex was detected with the horseradish peroxidase-linked chemiluminescent system containing the SuperSignal West Pico chemiluminescent substrate obtained from Pierce.

Identification of the [³²P]Phosphoryl-Glc-6-Pase- Intermediate—³²P-Labeled Glc-6-P was synthesized from glucose and 5'-[-³²P]ATP by yeast hexokinase (Sigma) and partially purified by a Dowex Ag-1X-formate column as described previously (21). Microsomes were prepared from COS-1 cells infected with a recombinant adenovirus at a multiplicity of infection of 100 plaque-forming units/cell after incubation at 37 °C for 48 h as described previously (6). For active site labeling, microsomes (100 µg) were pre-incubated at 30 °C for 10 min in a reaction mixture (100 µl) containing 40 mM sodium cacodylate buffer, pH 6.5, 2 mM EDTA, and 100 µM glucose 1-phosphate and then radiolabeled by the addition of 8 x 10⁶ cpm of [³²P]Glc-6-P to a final volume of 130 µl. After incubation for 10 s at 37 °C, the reaction was terminated by the addition of an equal volume of ice-cold 20% trichloroacetic acid followed by incubation on ice for 30 min. The labeled proteins were then pelleted by centrifugation at 12,000 x g for 10 min at 4 °C and washed twice with 100 µl of ice-cold 0.5 M Tris-HCl, pH 8.0, and once with 100 µl of cold water. The pellet was then finally solubilized in a triple lysis buffer containing 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% SDS, 1% Nonidet P-40, 0.5% Na-deoxycholate, 0.02% NaN₃, and the complete EDTA-free protease inhibitor mixture (Roche Diagnostics). The [³²P]phosphoryl enzyme intermediate was isolated by immunoprecipitation using a monoclonal anti-FLAG antibody in conjunction with protein A-agarose (Sigma) and identified by 12% SDS-polyacrylamide gel electrophoresis and autoradiography.

Purification of [³²P]Phosphoryl-Glc-6-Pase- Intermediate—The ³²P-labeled phosphoryl microsomal proteins from Ad-Glc-6-Pase--His₁₀-infected cells were precipitated by trichloroacetic acid as described above. The pellet was washed twice with 100 µl of ice-cold 0.5 M Tris-HCl, pH 8.0, and once with 100 µl of cold water and finally dissolved in 400 µl of Solution A (25 mM Tris-HCl, pH 8.0, 1% Triton X-100, 150 mM NaCl) containing the complete EDTA-free protease inhibitor mixture. The solubilized proteins were bound to a nickel chelate resin (His MicroSpin Purification Module, Amersham Biosciences) pre-equilibrated with Solution A. The resin was washed according to the manufacturer's protocol, and the bound protein was eluted with 30 µl of SDS sample buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 5% 2-mercaptoethanol, and 10% glycerol) at 46 °C for 30 min. The resulting proteins were fractionated by electrophoresis through a 12% SDS-polyacrylamide gel and the [³²P]phosphoryl-Glc-6-Pase--His₁₀ intermediate visualized by autoradiography. A gel slice containing the radiolabeled protein was excised, eluted with water by incubating the mashed gel slice in water at 50 °C for 1 h, lyophilized, and used for cyanogen bromide digestion.

Cyanogen Bromide Cleavage of [³²P]Phosphoryl-Glc-6-Pase- and Analyses of the Glc-6-Pase- Peptides by Gel Electrophoresis and Isoelectric Focusing—The lyophilized [³²P]phosphoryl-Glc-6-Pase--His₁₀ intermediate was resuspended in 400 µl of a solution containing 32 mg of cyanogen bromide/ml of 70% formic acid (30, 31) and digested overnight in the dark at room temperature. Following digestion, the products were dialyzed against water at 4 °C using Slide-A-Lyzer 3.5K Dialysis Cassettes (Pierce), lyophilized, dissolved in SDS sample buffer, resolved by electrophoresis through a 10% NuPAGE bis-Tris gel, and visualized by autoradiography.

A gel slice containing the 4.4-kDa ³²P-labeled phosphoryl peptide was eluted with water, dialyzed against water at 4 °C overnight, and lyophilized. The resulting gel-purified ³²P-labeled phosphoryl-Glc-6-Pase- peptide was then characterized by electrophoresis through a 10% NuPAGE Bis-Tris gel (Invitrogen) and by isoelectric focusing through a Novex pre-cast isoelectric focusing gel, pH 3–10 (Invitrogen).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Membrane Topography of Glc-6-Pase- —Glc-6-Pase- is embedded in the ER membrane by nine-transmembrane domains (10, 11) oriented with the N terminus in the ER lumen and the C terminus in the cytoplasm. Hydropathy analysis of the Glc-6-Pase- amino acid sequence using the TMpred program (32) predicts that Glc-6-Pase- is also anchored in the ER by nine putative transmembrane helices (Fig. 1). If this is correct, the N and C termini of the protein will be on opposite sides of the ER membrane. To determine the subcellular localization of the termini of Glc-6-Pase-, we undertook protease protection assays using N- and C-terminal FLAG-tagged Glc-6-Pase- constructs. Intact microsomes from COS-1 cells transfected with Glc-6-Pase--5FLAG or Glc-6-Pase--3FLAG were digested with trypsin, and the protein fragments were analyzed by Western blot analysis (Fig. 2A). Microsomes expressing Glc-6-Pase--3FLAG yielded no FLAG-tagged peptides upon digestion consistent with an exposed cytoplasmic C terminus. In contrast, microsomes expressing Glc-6-Pase--5FLAG were more resistant to digestion. However, the trypsin-resistant FLAG-tagged product is not full-length (35 kDa) but a 14-kDa polypeptide (Fig. 2A). In control experiments using microsomes permeabilized by detergent, both N- and C-terminal FLAG tags are cleaved by trypsin (Fig. 2A).

View larger version (41K): [in this window] [in a new window]   FIG. 1. The nine-transmembrane domain model of human Glc-6-Pase-. The program TMpred, using the algorithm of Hoffman and Stoffel (32), was used to identify the transmembrane helices. Larger ovals outline the amino acid residues predicted to comprise the active center. The methionine (M) residues susceptible to cleavage by cyanogen bromide are denoted by black ovals, and the arginine/lysine residues susceptible to trypsin digestion are denoted by shaded ovals.

View larger version (19K): [in this window] [in a new window]   FIG. 2. Proteolytic digestion of N- and C-terminal epitope-tagged human Glc-6-Pase-. A, intact microsomes isolated from Glc-6-Pase--5FLAG- or Glc-6-Pase--3FLAG-transfected COS-1 cells were subjected to digestion by trypsin in the absence or presence of deoxycholate as described under "Experimental Procedures." B, intact microsomes isolated from Glc-6-Pase--5fXaFLAG- or Glc-6-Pase--3fX-aFLAG-transfected COS-1 cells were subjected to digestion by factor Xa protease in the absence or presence of deoxycholate as described under "Experimental Procedures." Following electrophoretic fractionation and blotting, Glc-6-Pase- polypeptides were visualized with an anti-FLAG monoclonal antibody. Each lane contained 20 µg of proteins.

Identification of the Phosphoryl-Glc-6-Pase- Intermediate—We have shown previously that during catalysis, His¹⁷⁶ in Glc-6-Pase- acts as a phosphate acceptor forming a covalently bound phosphoryl enzyme intermediate (21). The kinetic and topographical similarities between Glc-6-Pase- and Glc-6-Pase- suggest that a phosphoryl enzyme intermediate is also formed during Glc-6-Pase- catalysis. Microsomes isolated from C-terminal FLAG-tagged Ad-Glc-6-Pase--, Ad-Glc-6-Pase--R79A-, Ad-Glc-6-Pase--H114A-, or Ad-Glc-6-Pase--H167A-infected COS-1 cells were incubated with [³²P]Glc-6-P, and the resulting [³²P]phosphoryl-Glc-6-Pase- intermediate was isolated by immunoprecipitation and analyzed by gel electrophoresis and autoradiography. As expected, a 35-kDa [³²P]phosphoryl enzyme intermediate was identified in wild-type Glc-6-Pase--infected cells but not in R79A, H114A, or H167A active site mutant-infected cells (Fig. 3).

View larger version (25K): [in this window] [in a new window]   FIG. 3. Identification of the phosphoryl-Glc-6-Pase- intermediate by immunoprecipitation. COS-1 microsomes expressing wild-type, R79A, H114A, or H167A C-terminally FLAG-tagged Glc-6-Pase- were incubated with [32P]Glc-6-P. The resultant [32P]phosphoryl enzyme intermediate was isolated by immunoprecipitation using a monoclonal anti-FLAG antibody and identified following fractionation through a 12% SDS-polyacrylamide gel by autoradiography as described under "Experimental Procedures."

To purify the [³²P]phosphoryl-Glc-6-Pase- intermediate, we generated a Glc-6-Pase- construct carrying a His₁₀ tag at the N terminus (Ad-Glc-6-Pase--His₁₀). Microsomes from Ad-Glc-6-Pase--His₁₀-infected COS-1 cells were labeled with [³²P]Glc-6-P, and the [³²P]phosphoryl-Glc-6-Pase- intermediate was enriched by affinity chromatography and further purified by electrophoresis through a SDS-polyacrylamide gel. The gelpurified [³²P]phosphoryl-Glc-6-Pase- intermediate was then cleaved by cyanogen bromide, and the cleaved products were fractionated through a NuPAGE Bis-Tris gel. A major band with an apparent molecular mass of 4.4 kDa and minor bands with apparent molecular masses of 18, 16, and 10 kDa were identified (Fig. 4A). The 4.4-kDa peptide corresponds to the expected molecular weight of the His¹⁶⁷-containing peptide of 41 amino acids (residues 146–186).

View larger version (38K): [in this window] [in a new window]   FIG. 4. Cyanogen bromide mapping of the phosphoryl-Glc-6-Pase- intermediate. COS-1 microsomes expressing Glc-6-Pase--His10 were incubated with [32P]Glc-6-P to form the [32P]phosphoryl enzyme intermediate, which was then enriched on a nickel chelate column and further purified by gel electrophoresis as described under "Experimental Procedures." A, identification of the cyanogen bromide cleaved phosphoryl-Glc-6-Pase- peptides by SDS-polyacrylamide gel electrophoresis and autoradiography. The purified [32P]phosphoryl-Glc-6-Pase- intermediate was cleaved with cyanogen bromide as described under "Experimental Procedures," and the 4.4-kDa [32P]phosphoryl-Glc-6-Pase- peptide, indicated by an arrow, was identified by electrophoresis and autoradiography. B, enrichment of the 4.4-kDa [32P]phosphoryl-Glc-6-Pase- peptide by gel electrophoresis. The 4.4-kDa 32P-labeled phosphoryl-cyanogen bromide peptide was eluted from the SDS-polyacrylamide gel and its identity confirmed by NuPAGE Bis-Tris gel electrophoresis and autoradiography. C, identification of the 4.4-kDa [32P]phosphoryl-Glc-6-Pase- peptide by isoelectric focusing. The 4.4-kDa 32P-labeled phosphoryl-cyanogen bromide peptide eluted from the SDS-polyacrylamide gel was characterized by isoelectric focusing through a Novex Pre-Cast isoelectric focusing gel followed by autoradiography as described under "Experimental Procedures." Numbers on the left of the figures are molecular weight markers, and numbers on the right are pH markers.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Blood glucose homeostasis between meals depends on gluconeogenesis and glycogenolysis. In the terminal step common to both pathways, Glc-6-P is hydrolyzed to glucose by the Glc-6-Pase complex, which is composed of two functionally coupled proteins, the Glc-6-P transporter and a Glc-6-P phosphohydrolase (reviewed in Ref. 14). Until recently, only one functional Glc-6-Pase had been reported. This enzyme, previously called Glc-6-Pase, is expressed in the liver/kidney/intestine consistent with its role in glucose homeostasis (reviewed in Ref. 13). More recently, a ubiquitously expressed Glc-6-Pase-related protein, which was previously called UGRP and thought to be inactive (5), was demonstrated to be catalytically active (6, 7). As a result, the proteins have been renamed Glc-6-Pase- (liver/kidney/intestine Glc-6-Pase) and Glc-6-Pase- (UGRP). Glc-6-Pase- is well characterized, but little beyond the kinetic activity (6) and ER localization (6) of Glc-6-Pase- is known. As a first step to characterizing the biological relevance of Glc-6-Pase-, we have sought to examine whether it is structurally similar to Glc-6-Pase-, a hydrophobic protein embedded in the ER by nine-transmembrane helical domains (10, 11). The key active site residues in Glc-6-Pase- have been characterized (21, 22) and shown to lie facing into the lumen of the ER. During catalysis, Glc-6-Pase- forms a phosphoryl enzyme intermediate (23–26) by the formation of a covalent bond between the phosphoryl group of Glc-6-P and His¹⁷⁶ in Glc-6-Pase- (21).

Glc-6-Pase- lacks any apparent ER transmembrane protein retention motif, but double immunofluorescence microscopy studies have shown that it is localized in the ER (6). Theoretical modeling of the topography of Glc-6-Pase- using the TMpred program (32) predicts that Glc-6-Pase- is anchored in the membrane by nine helical domains. Using epitope-tagged Glc-6-Pase- constructs and a protease protection assay by limited trypsin digestion, we found that the C terminus of Glc-6-Pase- is exposed to the cellular cytoplasm but that the N terminus appears protected. Cleavage of the N-terminally FLAG-tagged protein yielded a 14-kDa peptide fragment that is consistent with a nine-transmembrane domain topography. A prediction of tryptic cleavage sites in the FLAG-tagged Glc-6-Pase- by the Ensembl (www.ensembl.org) Peptide Cutter server reveals 20 potential cleavage sites (Fig. 1). Cleavage between residues 136 and 137 (. .VAT(R/A)RSR..) would yield the closest theoretical fragment (15.5 kDa) to that observed. Given the increased electrophoretic mobility expected from the negatively charged FLAG epitope, this suggests that the FLAG epitope lies on a fragment representing the first 136 residues of Glc-6-Pase-. Sequence alignment to the nine-transmembrane domain model of Glc-6-Pase- (10, 11) corresponds to the first cytoplasmically exposed cleavage site that lies in the putative second cytoplasmic loop (Fig. 1). There are five other trypsin sites between residues 1 and 136 in Glc-6-Pase-, but by this model the first site is predicted to lie within the first transmembrane helix, the second site lies at the junction between cytoplasmic loop 1 and transmembrane helix 2, the next two sites lie within the second transmembrane helix, and the fifth site lies at the beginning of the first luminal loop. When the protease protection assays were repeated using constructs engineered to contain a unique protease cleavage site the results were consistent with a cytoplasmic C terminus and lumenal N terminus. Taken together, Glc-6-Pase- has been shown to have an odd number of transmembrane domains, and proteolytic digests are consistent with the nine-transmembrane topography predicted both by hydropathy analysis (32) and sequence alignment to Glc-6-Pase-. In an earlier study, we showed that Glc-6-Pase- couples with the Glc-6-P transporter to form an active Glc-6-Pase complex (6). This is also consistent with the nine-transmembrane domain model that puts the active site residues Arg⁷⁹, His¹¹⁴, and His¹⁶⁷ on the lumenal side of the membrane.

The kinetic and structural similarity between Glc-6-Pase- and Glc-6-Pase- catalysis suggests that the mechanism of action of the active site is also similar. In the hydrolysis of Glc-6-P, Glc-6-Pase- forms a covalently bound intermediate between His¹⁷⁶ and the phosphate moiety (21). The analogous residue in Glc-6-Pase- is His¹⁶⁷. Using ³²P-labeled Glc-6-P we detected the [³²P]phosphoryl-Glc-6-Pase- intermediate from microsomes expressing Glc-6-Pase-. However the intermediate is not detectable in microsomes expressing the Glc-6-Pase- active site mutants R79A, H114A, or H167A.

To further identify His¹⁶⁷ as the phosphate acceptor, we purified the [³²P]phosphoryl-Glc-6-Pase- intermediate by affinity chromatography and gel electrophoresis. Complete cleavage of the intermediate with cyanogen bromide is predicted to create 10 peptide fragments. The His¹⁶⁷ is predicted to lie on a 4.4-kDa peptide with a theoretical pI of 8.6. When cleaved, the intermediate yielded a predominant fragment of 4.4 kDa having a pI above 8.3, which is consistent with His¹⁶⁷ as the phosphate acceptor. In addition, several minor bands of 10, 16, and 18 kDa were also detected bound to the [³²P]phosphoryl moiety. Complete cyanogen bromide digestion yielded no fragment greater than 13.2 kDa, whereas the next largest peptides were 9.2 and 5.0 kDa. The minor bands are, however, consistent with partial digests that contain His¹⁶⁷. The 18-kDa band is consistent with the peptide containing amino acids 127–291, the 16-kDa band is consistent with the peptide containing amino acids 146–291, and the 10-kDa band is consistent with the peptide containing amino acids 127–192. Our results firmly established that His¹⁶⁷ acts as the nucleophile forming the phosphohistidine enzyme intermediate during Glc-6-Pase- catalysis.

In summary, we showed that the ubiquitous Glc-6-Pase- is anchored in the ER by nine-transmembrane helices oriented with its active site inside the lumen, like the liver/kidney/intestine Glc-6-Pase-. The similarity between Glc-6-Pase- and Glc-6-Pase- also extended to the nature of the active site residues Arg⁷⁹, His¹¹⁴, and His¹⁶⁷ and the formation of a covalently bound phosphoryl enzyme intermediate during catalysis. We are now in a position to study the effect of inactivation of Glc-6-Pase- and assess its importance to blood glucose homeostasis and metabolism in general.

	FOOTNOTES

 
^* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

These two authors contributed equally to this work.

To whom correspondence should be addressed: Bldg. 10, Rm. 9S241, National Institutes of Health, Bethesda, MD 20892-1830. Tel.: 301-496-1094; Fax: 301-402-6035; E-mail: chouja{at}mail.nih.gov.

¹ The abbreviations used are: Glc-6-Pase, glucose-6-phosphatase; Glc-6-P, glucose 6-phosphate; ER, endoplasmic reticulum; UGRP, ubiquitously expressed Glc-6-Pase-related protein; bis-Tris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol.

	ACKNOWLEDGMENTS

 
We thank Dr. Brian C. Mansfield for critical reading of the manuscript.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Lei, K.-J., Shelly, L. L., Pan, C.-J., Sidbury, J. B., and Chou, J. Y. (1993) Science 262, 580-583[Abstract/Free Full Text]
2. Shelly, L. L., Lei, K.-J., Pan, C.-J., Sakata, S. F., Ruppert, S., Schutz, G., and Chou, J. Y. (1993) J. Biol. Chem. 268, 21482-21485[Abstract/Free Full Text]
3. Lange, A. J., Argaud, D., El-Maghrabi, M. R., Pan, W., Maitra, S. R., and Pilkis, S. J. (1994) Biochem. Biophys. Res. Commun. 201, 302-309[CrossRef][Medline] [Order article via Infotrieve]
4. Kishnani, P. S., Bao, Y., Wu, J. Y., Brix, A. E., Lin, J. L., and Chen, Y. T. (1997) Biochem. Mol. Med. 61, 168-177[CrossRef][Medline] [Order article via Infotrieve]
5. Martin, C. C., Oeser, J. K., Svitek, C. A., Hunter, S. I., Hutton, J. C., and O'Brien, R. M. (2002) J. Mol. Endocrinol. 29, 205-222[Abstract]
6. Shieh, J.-J., Pan, C.-J., Mansfield, B. C., and Chou, J. Y. (2003) J. Biol. Chem. 278, 47098-47103[Abstract/Free Full Text]
7. Guionie, O., Clottes, E., Stafford, K., and Burchell, A. (2003) FEBS Lett. 551, 159-164[CrossRef][Medline] [Order article via Infotrieve]
8. Arden, S. D., Zahn, T., Steegers, S., Webb, S., Bergman, B., O'Brien, R. M., and Hutton, J. C. (1999) Diabetes 48, 531-542[Abstract]
9. Martin, C. C., Bischof, L. J., Bergman, B., Hornbuckle, L. A., Hilliker, C., Frigeri, C., Wahl, D., Svitek, C. A., Wong, R., Goldman, J. K., Oeser, J. K., Lepretre, F., Froguel, P., O'Brien, R. M., and Hutton, J. C. (2001) J. Biol. Chem. 276, 25197-25207[Abstract/Free Full Text]
10. Pan, C.-J., Lei, K.-J., Annabi, B., Hemrika, W., and Chou, J. Y. (1998) J. Biol. Chem. 273, 6144-6148[Abstract/Free Full Text]
11. Pan, C.-J., Lei, K.-J., and Chou, J. Y. (1998) J. Biol. Chem. 273, 21658-21662[Abstract/Free Full Text]
12. Pan, C.-J., Lei, K.-J., Chen, H., Ward, J. M., and Chou, J. Y. (1998) Arch. Biochem. Biophys. 358, 17-24[CrossRef][Medline] [Order article via Infotrieve]
13. Nordlie, R. C., and Sukalski, K. A. (1985) in The Enzymes of Biological Membranes (Martonosi, A. N., ed) 2nd Ed., pp. 349-398, Plenum Press, New York
14. Chou, J. Y., Matern, D., Mansfield, B. C., and Chen, Y.-T. (2002) Curr. Mol. Med. 2, 121-143[CrossRef][Medline] [Order article via Infotrieve]
15. Chen, Y.-T. (2001) in The Metabolic and Molecular Bases of Inherited Disease (Scriver, C. R., Beaudet, A. L., Sly, W. S., Valle, D., Childs, B., Kinzler, K. W., and Vogelstein, B., eds) 8th Ed., pp. 1521-1551, McGraw-Hill Inc., New York
16. Stukey, J., and Carman, G. M. (1997) Protein Sci. 6, 469-472[Abstract]
17. Hemrika, W., and Wever, R. (1997) FEBS Lett. 409, 317-319[CrossRef][Medline] [Order article via Infotrieve]
18. Hemrika, W., Renirie, R., Dekker, H. L., Barnett, P., and Wever, R. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 2145-2149[Abstract/Free Full Text]
19. Hemrika, W., Renirie, R., Macedo-Ribeiro, S., Messerschmidt, A., and Wever, R. (1999) J. Biol. Chem. 274, 23820-23827[Abstract/Free Full Text]
20. Renirie, R., Hemrika, W., and Wever, R. (2000) J. Biol. Chem. 275, 11650-11657[Abstract/Free Full Text]
21. Ghosh, A., Shieh, J.-J., Pan, C.-J., Sun, M.-S., and Chou, J. Y. (2002) J. Biol. Chem. 277, 32837-32842[Abstract/Free Full Text]
22. Shieh, J.-J., Terizioglu, M., Hiraiwa, H., Marsh, J., Pan, C.-J., Chen, L.-Y., and Chou, J. Y. (2002) J. Biol. Chem. 277, 5047-5053[Abstract/Free Full Text]
23. Nordlie, R. C., and Lygre, D. G. (1966) J. Biol. Chem. 241, 3136-3141[Abstract/Free Full Text]
24. Parvin, R., and Smith, R. A. (1969) Biochemistry 8, 1748-1755[CrossRef][Medline] [Order article via Infotrieve]
25. Feldman, F., and Butler, L. G. (1969) Biochem. Biophys. Res. Commun. 36, 119-125[CrossRef][Medline] [Order article via Infotrieve]
26. Feldman, F., and Butler, L. G. (1972) Biochim. Biophys. Acta 268, 698-710[Medline] [Order article via Infotrieve]
27. Chou, J. Y. (2001) Curr. Mol. Med. 1, 25-44[CrossRef][Medline] [Order article via Infotrieve]
28. Wilkinson, B. M., Critchley, A. J., and Stirling, C. J. (1996) J. Biol. Chem. 271, 25590-25597[Abstract/Free Full Text]
29. Hardy, S., Kitamura, M., Harris-Stansil, T., Dai, Y., and Phipps, M. L. (1997) J. Virol. 71, 1842-1849[Abstract]
30. Coligan, J. E., Dunn, B. M., Ploegh, H. L., Speicher, D. W., and Wingfield, P. T. (1996) Current Protocols in Protein Science, pp. 11.5.1-11.5.10, John Wiley & Sons, Inc., New York
31. Cordoba, O. L., Linskens, S. B., Dacci, E., and Santome, J. A. (1997) J. Biochem. Biophys. Methods 35, 1-10[CrossRef][Medline] [Order article via Infotrieve]
32. Hoffman, K., and Stoffel, W. (1993) Biol. Chem. Hoppe-Seyler 374, 166-170

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. Y. Kim, H. S. Jun, P. A. Mead, B. C. Mansfield, and J. Y. Chou Neutrophil stress and apoptosis underlie myeloid dysfunction in glycogen storage disease type Ib Blood, June 15, 2008; 111(12): 5704 - 5711. [Abstract] [Full Text] [PDF]

				Y. Wang, J. K. Oeser, C. Yang, S. Sarkar, S. I. Hackl, A. H. Hasty, O. P. McGuinness, W. Paradee, J. C. Hutton, D. R. Powell, et al. Deletion of the Gene Encoding the Ubiquitously Expressed Glucose-6-phosphatase Catalytic Subunit-related Protein (UGRP)/Glucose-6-phosphatase Catalytic Subunit-beta Results in Lowered Plasma Cholesterol and Elevated Glucagon J. Biol. Chem., December 29, 2006; 281(52): 39982 - 39989. [Abstract] [Full Text] [PDF]

				S. Y. Kim, A. D. Nguyen, J.-L. Gao, P. M. Murphy, B. C. Mansfield, and J. Y. Chou Bone Marrow-derived Cells Require a Functional Glucose 6-Phosphate Transporter for Normal Myeloid Functions J. Biol. Chem., September 29, 2006; 281(39): 28794 - 28801. [Abstract] [Full Text] [PDF]

				A. Ghosh, Y. Y. Cheung, B. C. Mansfield, and J. Y. Chou Brain Contains a Functional Glucose-6-Phosphatase Complex Capable of Endogenous Glucose Production J. Biol. Chem., March 25, 2005; 280(12): 11114 - 11119. [Abstract] [Full Text] [PDF]

				J.-J. Shieh, C.-J. Pan, B. C. Mansfield, and J. Y. Chou A Potential New Role for Muscle in Blood Glucose Homeostasis J. Biol. Chem., June 18, 2004; 279(25): 26215 - 26219. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 279/13/12479    most recent M313271200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ghosh, A. Articles by Chou, J. Y. Search for Related Content PubMed PubMed Citation Articles by Ghosh, A. Articles by Chou, J. Y. Social Bookmarking                      What's this?