Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M314014200 on January 21, 2004

J. Biol. Chem., Vol. 279, Issue 15, 15541-15549, April 9, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/15/15541    most recent
M314014200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hague, C.
Right arrow Articles by Minneman, K. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hague, C.
Right arrow Articles by Minneman, K. P.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cell Surface Expression of {alpha}1D-Adrenergic Receptors Is Controlled by Heterodimerization with {alpha}1B-Adrenergic Receptors*

Chris Hague{ddagger}, Michelle A. Uberti, Zhongjian Chen, Randy A. Hall§, and Kenneth P. Minneman

From the Department of Pharmacology, Emory University, Atlanta, Georgia 30322

Received for publication, December 22, 2003 , and in revised form, January 12, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
{alpha}1-Adrenergic receptors (ARs) belong to the large Class I G protein-coupled receptor superfamily and comprise three subtypes ({alpha}1A, {alpha}1B, and {alpha}1D). Previous work with heterologously expressed C-terminal green fluorescent protein (GFP)-tagged {alpha}1-ARs showed that {alpha}1A- and {alpha}1B-ARs localize to the plasma membrane, whereas {alpha}1D-ARs accumulate intracellularly. We recently showed that {alpha}1D- and {alpha}1B-ARs form heterodimers, whereas {alpha}1D- and {alpha}1A-ARs do not. Here, we examined the role of heterodimerization in regulating {alpha}1D-AR localization using both confocal imaging of GFP- or CFP-tagged {alpha}1-ARs and a luminometer-based surface expression assay in HEK293 cells. Co-expression with {alpha}1B-ARs caused {alpha}1D-ARs to quantitatively translocate to the cell surface, but co-expression with {alpha}1A-ARs did not. Truncation of the {alpha}1B-AR extracellular N terminus or intracellular C terminus had no effect on surface expression of {alpha}1D-ARs, suggesting primary involvement of the hydrophobic core. Co-transfection with an uncoupled mutant {alpha}1B-AR ({Delta}12{alpha}1B) increased both {alpha}1D-AR surface expression and coupling to norepinephrine-stimulated Ca2+ mobilization. Finally, GFP-tagged {alpha}1D-ARs were not detected on the cell surface when expressed in rat aortic smooth muscle cells that express no endogenous ARs, but were almost exclusively localized on the surface when expressed in DDT1MF-2 cells, which express endogenous {alpha}1B-ARs. These studies demonstrate that {alpha}1B/{alpha}1D-AR heterodimerization controls surface expression and functional coupling of {alpha}1D-ARs, the N- and C-terminal domains are not involved in this interaction, and that {alpha}1B-AR G protein coupling is not required. These observations may be relevant to many other Class I G protein-coupled receptors, where the functional consequences of heterodimerization are still poorly understood.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
{alpha}1-Adrenergic receptors (ARs)1 belong to the rhodopsin-like Class I G protein-coupled receptor (GPCR) family (1). There are three closely related {alpha}1-AR subtypes ({alpha}1A, {alpha}1B, and {alpha}1D) with similar pharmacological and signaling properties. Activation of each subtype stimulates phospholipase C, release of intracellular Ca2+, and activation of mitogenic pathways (2-4). Generation of both single (5-7) and double (8) {alpha}1-AR knock-out mice has shown that all three subtypes contribute to overall control of blood pressure. Although recent reports suggest that {alpha}1-ARs cause different transcriptional responses (9) or differentially interact with other proteins (10-12), functional differences between these closely related receptors remain unclear.

To date, the clearest differences between {alpha}1-AR subtypes are in their subcellular localizations. Confocal imaging of GFP-tagged {alpha}1-ARs has shown that heterologously expressed {alpha}1A- and {alpha}1B-ARs are found primarily at the plasma membrane, whereas {alpha}1D-ARs accumulate intracellularly in a variety of cell lines (13, 14). Similar conclusions were made for native receptors using fluorescent ligands for localization in animal tissues (15). Interestingly, membrane expression correlates with differences in coupling efficiencies for {alpha}1-AR subtypes ({alpha}1A > {alpha}1B >= {alpha}1D) in transfected cells (13-18) but does not predict responses in vivo. {alpha}1D-ARs mediate contractile responses to catecholamines in several blood vessels (19-21) with high potencies and intrinsic activities. We reported previously that N-terminal truncation increased {alpha}1D-AR binding, functional responses, and surface membrane expression (17, 18), but there is no evidence that {alpha}1D-ARs are N-truncated in vivo. It seems more likely that difficulties in heterologous expression of {alpha}1D-ARs relate to the lack of accessory trafficking proteins.

There are now many reports of homo- and hetero-dimerization of GPCRs (22-27). In fact, it now appears that the majority of GPCRs can form dimers, often with distantly related receptors (28-33). However, with the exception of Class III GABAB (34) and taste receptors (35), where hetero-oligomerization is required to form a single functional receptor, GPCR dimerization only rarely results in clearly observable changes in pharmacology or functional responses. Thus the functional significance of Class I GPCR dimerization remains a matter of active debate.

We previously reported that epitope-tagged {alpha}1-ARs exist as both monomers and dimers (36). Heterodimerization between these receptors has now been widely reported (37-39). We found in previous studies that {alpha}1-AR heterodimerization is subtype-specific, with {alpha}1B-ARs interacting with {alpha}1A- or {alpha}1D-ARs, but with no detectable interactions between {alpha}1A- and {alpha}1D-ARs (39). Interestingly, heterodimerization did not alter apparent ligand-binding properties but, rather, resulted in increased receptor expression (39). In particular, {alpha}1B/{alpha}1D-AR heterodimerization increased surface expression of {alpha}1D-ARs as monitored by a luminometer assay (39). From these data, we hypothesized that {alpha}1B/{alpha}1D-AR heterodimerization might help traffic {alpha}1D-ARs to the plasma membrane where they would be accessible to their hydrophilic ligands.

In this study, we used a combination of N- and C-terminally tagged {alpha}1-ARs to investigate the role of {alpha}1-AR dimerization in regulating receptor localization and function. We found that co-expression of {alpha}1B/{alpha}1D-AR heterodimers quantitatively promotes surface expression of {alpha}1D-ARs and also increases coupling to intracellular Ca2+ release. This interaction is subtype-specific, does not require the N- or C-terminal domains of the receptor, and is not dependent on {alpha}1B-AR G protein coupling. These data provide a clear example of the physiological importance of heterodimerization for a Class I GPCR subtype, the {alpha}1D-AR, which has been difficult to study functionally due to its predominantly intracellular localization when expressed alone in many cell types.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Materials were obtained from the following sources: cDNAs for the wild type human {alpha}1A-AR (40), and human {alpha}1A-, {alpha}1B-, and {alpha}1D-AR C-terminally tagged GFP constructs in pEGFP-N3 (12, 13) were generously provided by Dr. Gozoh Tsujimoto (National Children's Hospital, Tokyo, Japan), human {alpha}1B-AR cDNA (41) was a gift from Dr. Dianne Perez (Cleveland Clinic, Cleveland, OH), human {alpha}1D-AR cDNA was cloned in our laboratory (42); pECFP-N1 vector was a gift from Dr. John Hepler (Emory University, Atlanta, GA); hamster {alpha}1B-AR and {Delta}12{alpha}1B-AR in pCMV were a gift from Dr. Myron Toews (University of Nebraska Medical Center, Omaha, NE); rat aortic smooth muscle (RASM) cells were a gift from Dr. T. J. Murphy (Emory University, Atlanta, GA); fura-2/acetoxymethylester (fura-2/AM) and n-dodecyl-{beta}-D-maltoside were purchased from Calbiochem (La Jolla, CA); HEK293, DDT1MF-2, and Phoenix producer cells from ATCC (Manassas, VA); (-)-norepinephrine bitartrate, Dowex-1 resin, HRP-conjugated anti-FLAG M2 antibody, Dulbecco's modified Eagle's medium (DMEM), bovine serum albumin (BSA), penicillin, and streptomycin from Sigma Chemical Co. (St. Louis, MO); myo-[3H]inositol from American Radiolabeled Chemicals Inc. (St. Louis, MO); SuperFect transfection reagent from Qiagen (Valencia, CA); enzyme-linked immunosorbent assay ECL from Pierce (Rockford, IL); Vectashield mounting medium from Vector Laboratories (Burlingame, CA); and anti-HA polyclonal antibody and Texas Red conjugated anti-rabbit antibody from Clontech (Palo Alto, CA).

Construction of Tagged and Truncated {alpha}1-ARs—Human {alpha}1-AR cDNAs were subcloned into the mammalian expression vector pDT containing in-frame N-terminal hexahistidine and FLAG epitope tags as previously described (36, 39). After sequencing, unique restriction sites were used to replace the FLAG-hexahistidine tag in pDT with the HA-epitope tag using complementary annealed oligonucleotides with appropriate overhangs. N-terminally truncated human {alpha}1B-ARs ({Delta}1-38{alpha}1B) were generated by PCR using specific primers on human {alpha}1B-AR cDNA in pDT, subcloned, and sequenced. C-terminal truncated {alpha}1B-ARs ({Delta}366-519{alpha}1B) were generated using PCR to insert a stop codon ~20 amino acids after the predicted seventh transmembrane domain at the conserved glutamine at position 366. To create CFP-tagged {alpha}1A-AR, {alpha}1B-AR and {alpha}1D-ARs, the pECFP-N1 vector was modified by removing one nucleotide (C667). In brief, pECFP-N1 was digested with KpnI and AgeI, gel-extracted, and annealed to a double-stranded linker oligonucleotide with appropriate overhangs (forward: CGCCGGGCCGGGATCCA; reverse: CCGGTGGATCCCGGCCCGCGGTAC), minus the cytosine at position 667. The absence of C667 resulted in destruction of the ApaI restriction site, which was used as a diagnostic test. {alpha}1A-, {alpha}1B-, and {alpha}1D-AR coding sequences were then cut from pEGFP-N3 using EcoRI and KpnI, gel-extracted, and ligated into the modified pECFP-N1 vector in-frame with the CFP tag.

Cell Culture and Transfection—HEK293, DDT1MF-2, and RASM cells were propagated in DMEM with sodium pyruvate supplemented with 10% heat-inactivated fetal bovine serum, 100 µg/ml streptomycin, and 100 units/ml penicillin at 37 °C in a humidified atmosphere with 5% CO2. Confluent plates were subcultured at a ratio of 1:5 for transfection. HEK293 and DDT1MF-2 cells were transfected with 10 µg of DNA of each construct for 3 h using SuperFect® transfection reagent, and cells were used for experimentation 48-72 h after transfection. Because of the extremely low plasmid transfection efficiency, RASMs were transfected with infectious retroviral supernatants harvested from transfected Phoenix producer cells generated by a helper virus-free protocol as described previously (43).

Luminometer Based Surface Expression Assay—HEK293 cells were transiently transfected with FLAG- or HA-N-terminal-tagged human {alpha}1-AR subtypes with SuperFect® for 24 h. Cells were split into poly-D-lysine-coated 35-mm dishes and grown overnight at 37 °C. Cells were then rinsed 3x with phosphate-buffered saline (PBS), fixed with 2% paraformaldehyde in PBS for 30 min, and rinsed 3x with PBS. Cells were then incubated in blocking buffer (2% nonfat milk in PBS, pH 7.4) for 30 min, and then incubated with the appropriate concentrations of HRP-conjugated M2-anti-FLAG or HRP-conjugated anti-HA antibody in blocking buffer for 1 h at room temperature. Cells were washed 3x with blocking buffer, 1x with PBS, and then incubated with enzyme-linked immunosorbent assay ECL reagent (Pierce) for 15 s. Luminescence was determined using a TD20/20 luminometer (Turner Designs, Sunnyvale, CA). For internalization assays, cells were first rinsed and then stimulated with or without 100 µM norepinephrine (NE) in DMEM for 1 h before the above procedure. Mean values ± S.E. were calculated as percent absorbance in arbitrary units and statistically compared using the unpaired t test, with a p value less then 0.05 considered significant.

Laser Confocal Microscopy—Cells transiently transfected with HA-, CFP-, or GFP-tagged constructs were grown on sterile coverslips, fixed for 30 min with 2% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4, and rinsed 3x with PBS containing 0.5% normal horse serum (PBS+). For anti-HA immunostaining, fixed coverslips were blocked for 1 h in blocking buffer (PBS containing 1% BSA, 5% normal horse serum) containing 0.01% Triton X-100 to permeabilize cells. Anti-HA antibody was added to coverslips overnight at 4 °C at 1:500 dilution in blocking buffer, washed 3x with PBS+, and incubated with Texas Red-conjugated anti-rabbit IgG secondary antibody for 1 h at room temperature at 1:500 dilution in blocking buffer. Coverslips were washed 3x with PBS+ and mounted onto slides using Vectashield mounting medium. Cells were scanned with a Zeiss LSM 510 laser scanning confocal microscope (Heidelberg, Germany) as described previously (44). For detecting GFP and CFP, fluorescein isothiocyanate fluorescence was excited using an argon laser at a wavelength of 488 nm, and the absorbed wavelength was detected for 510-520 nm for GFP and 480-490 nm for CFP. For detecting Texas Red, rhodamine fluorescence was excited using a helium-neon laser at a wavelength of 522 nm. The pinhole size was maintained at 1 airy unit for all images.

Measurement of Ca2+ Mobilization—Intracellular Ca2+ mobilization was measured after preloading with fura-2 as described previously (16). In brief, confluent 150-mm plates of transiently transfected HEK293 cells were washed with biological salt solution (BSS) (in mM: NaCl, 130; KCl, 5; MgCl2, 1; CaCl2, 1.5; HEPES, 20; glucose, 10; with 0.1% BSA), gently detached using trypsin in Ca2+-free Hanks' solution, and centrifuged for 2 min at 1000 x g at 4 °C. Cells were resuspended in DMEM containing 0.05% BSA and incubated with 1 µM fura-2/AM for 15 min at 37 °C. Cells were then diluted, centrifuged, and resuspended into 3-ml aliquots (2.0 x 106 cells/ml) and placed on ice. Prior to use, cells were warmed to 37 °C, pelleted at 1000 x g for 2 min, resuspended in 3 ml of BSS, transferred to a cuvette, and placed in a PerkinElmer Life Sciences LS50 luminescence spectrofluorometer (Beaconsfield, Buckingshamshire, UK). Excitation wavelengths were 340 and 380 nm, and the emission wavelength was 510 nm. Calculation of [Ca2+]i was performed by equilibrating intra- and extracellular Ca2+ with 30 µM digitonin (Rmax) followed by addition of 9 mM EGTA, 1 M Tris, pH 9.0 (Rmin), and using a KD of 225 nM for fura-2. 100 µM NE was used to stimulate {alpha}1-AR-induced Ca2+ mobilization and was normalized to [Ca2+]i stimulated by 100 µM UTP. Mean values ± S.E. were calculated and were statistically compared using the unpaired t test, with a p value less then 0.05 considered significant.

Measurement of [3H]InsP Formation—Accumulation of [3H]inositol phosphates (InsPs) was determined in confluent 96-well plates. Transiently transfected HEK293 cells were prelabeled with myo-[3H]inositol for 48 h, and production of [3H]InsP was determined by modification of a protocol described previously (45). After prelabeling, medium containing myo-[3H]inositol was removed, and 100 µl of Krebs Ringer bicarbonate buffer (in mM: NaCl, 120; KCl, 5.5; CaCl2, 2.5; NaH2PO4, 1.2; MgCl2, 1.2; NaHCO3, 20; glucose, 11; Na2EDTA, 0.029) containing 10 mM LiCl was gently added to each well. Cells were incubated with or without 100 µM NE for 60 min. The reaction was stopped by addition of 100 µl of 20 mM formic acid, and samples were sonicated for 10 s. Samples were subjected to anion exchange chromatography to isolate [3H]InsPs, which were quantified by scintillation counting. Total [3H]inositol incorporation in each sample was determined by removing 5-µl aliquots prior to chromatography and counting. Percent hydrolysis of total myo-[3H]inositol into [3H]InsPs was calculated as cpm of [3H]InsP divided by total cpm of [3H]inositol incorporated, and expressed as mean ± S.E. Mean values were compared using the unpaired t test, with a p value less then 0.05 considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Cellular Localization of {alpha}1-AR Subtypes—To provide an overview of the subcellular localization patterns of individually expressed {alpha}1-AR subtypes, {alpha}1-ARs tagged at the C terminus with either GFP or CFP were transiently transfected into HEK293 cells, fixed on coverslips, and examined using confocal microscopy. As shown in Fig. 1 and Table I, both GFP- and CFP-tagged {alpha}1A- and {alpha}1B-ARs were primarily located at the plasma membrane, whereas {alpha}1D-ARs showed almost exclusively intracellular localization, as reported previously (13, 18).



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 1.
Cellular localization of {alpha}1-AR subtypes. HEK293 cells were transiently transfected with C-terminal GFP-tagged (upper) or C-terminal CFP-tagged (lower) {alpha}1-AR subtypes. Cells were visualized using laser confocal microscopy according to the protocol detailed under "Experimental Procedures." Each image is representative of the large majority of cells observed from several individual experiments (Table I).

 


View this table:
[in this window]
[in a new window]
  		TABLE I
Cellular localization of GFP-tagged {alpha} 1-ARs heterologously expressed in HEK293 cells

GFP-tagged {alpha} 1-AR subtypes were transiently transfected into HEK293 cells. Fields of cells were examined under a fluorescent microscope. Individual cells were classified as having fluorescence almost exclusively in a bright ring surrounding the cell (surface), or dense intracellular fluorescence (intracellular). Data are expressed as mean number of cells ± S.E. and represent results from multiple experiments.

 
{alpha}1B-/{alpha}1D-AR Heterodimerization Quantitatively Promotes Surface Expression of {alpha}1D-ARs—Previously, we found that epitope-tagged {alpha}1B- and {alpha}1D-ARs co-immunoprecipitate following co-expression in HEK293 cells (39). To examine the effect of {alpha}1B-/{alpha}1D-AR heterodimerization on cellular localization, HEK293 cells were co-transfected with GFP-tagged {alpha}1D-ARs and HA-tagged {alpha}1B-ARs, or with GFP-tagged {alpha}1B-ARs and CFP-tagged {alpha}1D-ARs. As shown in Fig. 2A, confocal imaging of fixed cells demonstrated that co-expression of {alpha}1B- and {alpha}1D-ARs resulted in complete translocation of {alpha}1D-ARs from intracellular sites to the plasma membrane. This was observed in all cells that expressed both constructs (data not shown). To study this using a different technique, HEK293 cells were co-transfected with FLAG-tagged {alpha}1D-ARs and HA-tagged {alpha}1B-ARs, and cell surface expression of FLAG-{alpha}1D-ARs was quantified using a luminometer-based assay (Fig. 2C). In comparison to transient expression of {alpha}1D-ARs alone, co-expression of {alpha}1B- with {alpha}1D-ARs resulted in a significant increase (6.7-fold) in {alpha}1D-AR cell surface expression, which is strikingly similar to the -fold increase (6.6-fold) in {alpha}1D-AR cell surface expression observed with cell counts (Table I). Because the cell counts were performed only with GFP fluorescence, we could not distinguish cells that expressed only one receptor subtype from those that expressed both, probably accounting for the only partial {alpha}1D-AR translocation. These data clearly demonstrate that {alpha}1B-AR/{alpha}1D-AR dimerization facilitates quantitative translocation of {alpha}1D-ARs to the cell surface.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 2.
Cellular localization of co-expressed {alpha}1-AR subtypes. HEK293 cells were transiently co-transfected with A, N-terminal HA-tagged {alpha}1B- and C-terminal GFP-tagged {alpha}1D-ARs (upper) or C-terminal GFP-tagged {alpha}1B- and C-terminal CFP-tagged {alpha}1D-ARs (lower) or B, N-terminal HA-tagged {alpha}1A-AR and C-terminal GFP-tagged {alpha}1D-ARs (upper) or C-terminal GFP-tagged {alpha}1A-AR and C-terminal CFP-tagged {alpha}1D-ARs (lower). Cells were visualized using laser confocal microscopy according to the protocol detailed under "Experimental Procedures." Each image is representative of many cells from two to three individual experiments. C, cell surface expression of FLAG-tagged {alpha}1D-ARs was detected using a luminometer-based assay after transient co-transfection with HA-tagged {alpha}1A- or {alpha}1B-ARs, as described under "Experimental Procedures." The values for each experiment are represented as percent absorbance, with 100% absorbance equal to the average observed with FLAG-tagged {alpha}1D-AR co-expressed with HA-tagged {alpha}1B-AR. The data are expressed as mean ± S.E. of four independent experiments (*, significantly different then FLAG-{alpha}1D-AR expressed alone, p < 0.05).

 
Co-expression of {alpha}1A-/{alpha}1D-ARs Does Not Result in Surface Localization of {alpha}1D-ARs—Our previous data showed that epitope-tagged {alpha}1A- and {alpha}1D-ARs do not form heterodimers (39). Therefore, we hypothesized that co-expression of {alpha}1A- and {alpha}1D-ARs would not result in differences in cellular localization of either {alpha}1-AR subtype. Using the same protocol used in {alpha}1B-/{alpha}1D-AR co-transfections, HEK293 cells were co-transfected with GFP-tagged {alpha}1D-ARs and HA-tagged {alpha}1A-ARs, or with GFP-tagged {alpha}1A-ARs and CFP-tagged {alpha}1D-ARs. As shown in Fig. 2B, confocal imaging revealed that co-transfection of {alpha}1A- and {alpha}1D-ARs resulted in a primarily intracellular localization of {alpha}1D-ARs, whereas {alpha}1A-ARs were almost exclusively found on the plasma membrane. These results were again supported using the luminometer-based cell surface assay to compare expression of FLAG-tagged {alpha}1D-ARs expressed alone or in combination with HA-tagged {alpha}1A-ARs (Fig. 2C). Unlike co-expression with {alpha}1B-ARs, co-expression with {alpha}1A-ARs resulted in no significant increase in surface expression of {alpha}1D-ARs, in comparison to transient expression of FLAG-{alpha}1D-ARs alone. Therefore, these data suggest that co-expression of {alpha}1A- and {alpha}1D-ARs does not alter the cellular localization of {alpha}1D-ARs.

Role of the {alpha}1B-AR N- and C-terminal Domains in Heterodimerization—Previous work using N- and C-terminal truncation constructs has indicated that {alpha}1B-AR homo- and heterodimerization does not involve either the N or C terminus (37, 39). To determine if these domains are necessary for the ability of {alpha}1B-ARs to promote {alpha}1D-AR trafficking to the plasma membrane, we co-transfected HEK293 cells with HA-tagged {alpha}1B-ARs truncated at either the N terminus ({Delta}1-38{alpha}1B) or C terminus ({Delta}366-519{alpha}1B) (Fig. 3A) in addition to GFP-tagged {alpha}1D-ARs. Confocal imaging of transfected cells revealed that both N- and C-truncated forms of the {alpha}1B-AR were fully capable of trafficking GFP-tagged {alpha}1D-ARs to the plasma membrane (Fig. 3B). Using the cell surface assay to confirm these results, we found that both truncated forms of the {alpha}1B-AR were not significantly different from wild-type {alpha}1B-ARs in their abilities to promote surface expression of FLAG-{alpha}1D-ARs (Fig. 3C). Therefore, these data show that the {alpha}1B-AR N- and C-terminal domains are not necessary for trafficking {alpha}1D-ARs to the plasma membrane and suggest that the {alpha}1B-AR hydrophobic core or intracellular/extracellular loops are primarily responsible.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 3.
Role of the N- and C-terminal domains of {alpha}1B-ARs in translocation of {alpha}1D-ARs to the cell surface. A, sequence comparison of human {alpha}1A- and {alpha}1B-ARs. The {alpha}1B-AR backbone is used for comparison. Amino acid residues identical in the two subtypes are shown as closed circles, whereas variable amino acids are shown as open circles. Arrows indicate N-terminal and C-terminal truncations. B, HEK293 cells were transiently co-transfected with C-terminal GFP-tagged {alpha}1D-ARs and HA-tagged {Delta}1-38{alpha}1B-ARs (upper) or HA-tagged {Delta}366-519{alpha}1B-ARs (lower). Cells were visualized using laser confocal microscopy as detailed under "Experimental Procedures." Each image is representative of many cells from two to three individual experiments. C, cell surface expression of N-terminal FLAG-tagged {alpha}1D-ARs was determined upon co-expression with either HA-tagged {Delta}1-38{alpha}1B- or {Delta}366-519{alpha}1B-ARs using a luminometer-based assay as described under "Experimental Procedures." The values for each experiment are represented as percent absorbance, with 100% absorbance equal to the average observed with FLAG-tagged {alpha}1D-ARs co-expressed with HA-tagged {Delta}366-519{alpha}1B-ARs. The data are expressed as mean ± S.E. of four independent experiments (*, significantly different than FLAG-{alpha}1D-ARs expressed alone, p < 0.05).

 
Role of {alpha}1B-/{alpha}1D-AR Heterodimerization in {alpha}1D-AR Coupling to Functional Responses—Of the three {alpha}1-AR subtypes, {alpha}1D-ARs are least efficiently coupled to functional responses in transfected cells (16). Because we found that {alpha}1B-/{alpha}1D-AR dimerization increases {alpha}1D-AR surface expression, we hypothesized that {alpha}1D-AR coupling to functional responses might be increased when co-transfected with {alpha}1B-ARs. However, because all three {alpha}1-ARs are Gq-coupled receptors and there are few selective antagonists that can effectively distinguish between {alpha}1B- and {alpha}1D-ARs, it is difficult to pharmacologically isolate the relative contributions of individual subtypes in stimulating functional responses when they are co-expressed. To address this problem, we used a hamster {alpha}1B-AR containing a 3-amino acid deletion at residues 227-229 ({Delta}12{alpha}1B-AR), which has previously been reported to be completely uncoupled from all functional responses (46-48). We found that both full-length and {Delta}12 hamster {alpha}1B-ARs were capable of promoting {alpha}1D-AR surface expression in HEK293 cells, as evidenced by confocal imaging of GFP-tagged {alpha}1D-ARs (Fig. 4, A and B) and luminometer cell surface detection of FLAG-{alpha}1D-ARs (Fig. 4C). This enabled us to drive {alpha}1D-AR surface expression using an uncoupled {alpha}1B-AR, while simultaneously allowing us to measure {alpha}1D-AR functional responsiveness in the absence of responses mediated by {alpha}1B-ARs. To determine the effect of {Delta}12{alpha}1B-AR co-transfection on {alpha}1D-AR coupling to functional responses, we measured NE-stimulated intracellular Ca2+ mobilization and [3H]InsP formation in transiently transfected HEK293 cells. As shown in Figs. 5 and 6, NE stimulation of FLAG-{alpha}1D-ARs resulted in only minor increases in [3H]InsP formation and intracellular Ca2+ mobilization in comparison to HA-{alpha}1B-ARs, which generated much larger increases in both responses upon NE stimulation. In agreement with previous studies suggesting hamster {Delta}12{alpha}1B-ARs are uncoupled to functional responses, NE was unable to stimulate [3H]InsP formation or mobilize intracellular Ca2+ in HEK293 cells expressing hamster {Delta}12{alpha}1B-ARs alone. Interestingly, co-transfection of FLAG-{alpha}1D- and hamster {Delta}12{alpha}1B-ARs increased the level of NE-stimulated Ca2+ mobilization to 41 ± 3.1% of the 100 µM UTP response (Fig. 5), similar to the level of Ca2+ mobilization induced by NE-stimulation of wild type {alpha}1B-ARs (42 ± 16.8%). In contrast, co-transfection of FLAG-{alpha}1D- and {Delta}12{alpha}1B-ARs resulted in no significant increase in NE-stimulated [3H]InsP formation (Fig. 6) relative to that observed in HEK293 cells expressing FLAG-tagged {alpha}1D-ARs alone. These data suggest that {alpha}1B-AR-induced translocation of {alpha}1D-ARs to the cell surface results in increased coupling to NE-stimulated Ca2+ mobilization but does not increase coupling to NE-stimulated [3H]InsP formation under the conditions of our assays.



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 4.
Hamster full-length and {Delta}12{alpha}1B-ARs traffic {alpha}1D-ARs to the cell surface. HEK293 cells were transiently co-transfected with C-terminal GFP-tagged {alpha}1D-ARs and A, full-length hamster {alpha}1B-ARs or B, untagged {Delta}12{alpha}1B-ARs. Cells were visualized using laser confocal microscopy as detailed under "Experimental Procedures." Each image is representative of many cells from two individual experiments. C, cell surface expression of N-terminal FLAG-tagged {alpha}1D-ARs was determined upon co-expression with full-length hamster {alpha}1B-or hamster {Delta}12{alpha}1B-ARs using a luminometer-based assay as described under "Experimental Procedures." The values for each experiment are represented as percent absorbance, with 100% absorbance equal to the average observed with FLAG-tagged {alpha}1D-ARs co-expressed with full-length hamster {alpha}1B-ARs. The data are expressed as mean ± S.E. of four independent experiments (*, significantly different then FLAG-{alpha}1D-ARs expressed alone, p < 0.05).

 



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 5.
Co-expression with hamster {Delta}12{alpha}1B-ARs enhances {alpha}1D-AR coupling to intracellular Ca2+ mobilization. HEK293 cells were transiently co-transfected with {alpha}1-ARs and loaded with fura-2. Cells were stimulated with 100 µM NE or 100 µM UTP as described under "Experimental Procedures," and [Ca2+]i was measured. The values for each experiment are represented as percent Ca2+ mobilization, with 100% mobilization equal to the average stimulated by 100 µM UTP in HEK293 cells expressing HA-tagged {alpha}1B-ARs. The data are expressed as mean ± S.E. of data from three to four separate experiments (*, significantly different then basal, p < 0.05).

 



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 6.
Co-expression with hamster {Delta}12{alpha}1B-ARs does not enhance {alpha}1D-AR coupling to inositol phosphate formation. HEK293 cells were transiently co-transfected with {alpha}1-ARs and prelabeled with 1 µCi myo-[3H]inositol for 24 h. Cells were stimulated with 100 µM NE for 1 h, and [3H]InsPs were isolated as described under "Experimental Procedures." The values for each experiment are represented as percent hydrolysis, with 100% hydrolysis equal to the level of NE-stimulated hydrolysis in HEK293 cells expressing HA-tagged {alpha}1B-ARs. The data are expressed as mean ± S.E. of data from three separate experiments performed in duplicate or triplicate (*, significantly different then basal, p < 0.05).

 
{alpha}1D-ARs Are Internalized upon Agonist Stimulation—One possible explanation of the differential effects of co-expression with {alpha}1B-ARs on {alpha}1D-AR-stimulated Ca2+ mobilization and [3H]InsP formation is the duration of agonist stimulation in the two assays. Intracellular Ca2+ mobilization is measured within seconds of adding agonist, whereas [3H]InsP formation assay is measured after 1 h of agonist stimulation. Therefore, we hypothesized that the lack of increase in NE-stimulated [3H]InsP formation in cells co-expressing {alpha}1B- and {alpha}1D-ARs might potentially be due to agonist-induced internalization of {alpha}1D-ARs. Previous reports have shown that {alpha}1B-ARs are rapidly internalized upon agonist stimulation (47). However, there are no previous reports investigating {alpha}1D-AR internalization, because this receptor is almost exclusively intracellular after heterologous expression. To measure {alpha}1D-AR internalization, HEK293 cells transiently expressing {alpha}1-ARs were stimulated for 1 h with 100 µM NE, and the amount of {alpha}1-AR surface expression was determined using the luminometer-based cell surface assay (Fig. 7). As reported in previous studies (49, 50), HA-tagged {alpha}1B-AR cell surface expression decreased (38 ± 11.4%) after treatment with 100 µM NE for 1 h, whereas surface expression of FLAG-tagged {alpha}1D-ARs expressed alone was low and unchanged by NE treatment. As described above, {alpha}1D-AR cell surface expression was robustly increased upon co-expression with either {alpha}1B- or hamster {Delta}12{alpha}1B-ARs. Interestingly, stimulation with 100 µM NE for 1 h decreased FLAG-tagged {alpha}1D-AR cell surface expression by 61 ± 3.1% when co-expressed with HA-tagged {alpha}1B-ARs and by 46 ± 17.1% when co-expressed with hamster {Delta}12{alpha}1B-ARs. Therefore, these data demonstrate that, when co-expressed with {alpha}1B-ARs, {alpha}1D-ARs are expressed at the cell surface and undergo profound internalization upon stimulation with agonist.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 7.
{alpha}1D-ARs are internalized upon agonist stimulation. HEK293 cells were transiently transfected with {alpha}1-ARs and cell surface expression of HA-tagged {alpha}1B-ARs (left bar) or FLAG-tagged {alpha}1D-ARs (right three bars) was determined using a luminometer-based assay as described under "Experimental Procedures." Cells treated with 100 µM NE were stimulated for 1 h. The values for each experiment are represented as percent internalization from the cell surface. The data are expressed as mean ± S.E. from data from three to four separate experiments (*, significantly different then basal, p < 0.05).

 
Cellular Localization of GFP-tagged {alpha}1D-ARs Differs between DDT1MF-2 and RASM Cells—The studies performed in HEK293 cells clearly demonstrate that co-expression of {alpha}1B-ARs promotes surface expression of {alpha}1D-ARs. We wanted to determine if transfecting {alpha}1D-ARs into a cell line that endogenously expresses {alpha}1B-ARs would result in surface expression of {alpha}1D-ARs. DDT1MF-2 cells, a smooth muscle derived cell line from which the hamster {alpha}1B-AR was originally cloned (51), express {alpha}1B-ARs at a density of ~400 fmol/mg of protein but do not express {alpha}1A- or {alpha}1D-ARs (52). As shown in Fig. 8A, transient transfection of GFP-tagged {alpha}1D-ARs into DDT1MF-2 cells resulted almost exclusively in surface localization of {alpha}1D-ARs in all cells observed, although slightly more diffuse intracellular signal was seen than was observed with co-transfection of both subtypes in HEK293 cells (Fig. 2). We also examined {alpha}1D-AR expression in RASM cells, another smooth muscle-derived cell line that, however, exhibits no endogenous {alpha}1-AR expression (18). Because RASMs are very difficult to transfect with plasmids, we used a retroviral transfection method. In striking contrast to DDT1MF-2 cells, retroviral transfection of GFP-tagged {alpha}1D-ARs into RASM cells resulted in an almost exclusive intracellular localization of the receptor (Fig. 8B), similar to that observed in HEK293 cells. These data support the idea that {alpha}1B-AR heterodimerization with {alpha}1D-ARs results in trafficking of {alpha}1D-ARs to the cell surface and suggest that endogenous levels of {alpha}1B-ARs in DDT1MF-2 cells are sufficient to mediate a strong cell type-dependent regulation of {alpha}1D-AR subcellular localization.



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 8.
GFP-tagged {alpha}1D-ARs are located on the cell surface in DDT1MF-2 cells but not in RASMs. A, DDT1MF-2 cells were transiently transfected with C-terminal GFP-tagged {alpha}1D-ARs. B, RASM cells were retrovirally transfected with C-terminal GFP-tagged {alpha}1D-ARs. Cells were visualized using laser confocal microscopy according to the protocol detailed under "Experimental Procedures." Each image is representative of all cells observed in two to three separate experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The data presented here show that {alpha}1D-AR co-expression with {alpha}1B-ARs, but not {alpha}1A-ARs, results in quantitative surface expression of {alpha}1D-ARs, which is almost exclusively intracellular when expressed alone. Since our previous data using co-immunoprecipitation has shown direct interactions of {alpha}1D- with {alpha}1B-, but not {alpha}1A-ARs (39), we believe that the effect of the {alpha}1B-AR on {alpha}1D-AR surface expression is likely to be due to direct heterodimerization of the two subtypes. This phenomenon appears to involve primarily the {alpha}1B-AR hydrophobic core or intracellular/extracellular loops, because N- and C-terminal truncation mutants are as effective as full-length receptors. It does not appear to require {alpha}1B-AR G protein coupling or second messenger responses, because it is also observed with functionally uncoupled {alpha}1B-ARs. In addition, promotion of surface expression of {alpha}1D-ARs by heterodimerization with {alpha}1B-ARs is associated with increased {alpha}1D-AR responsiveness and internalization. Finally, {alpha}1D-AR surface expression also appears to be strongly promoted by natively expressed {alpha}1B-ARs in DDT1MF-2 cells, suggesting that it is not an artifact of overexpressed recombinant proteins.

The results presented here are somewhat similar to what has been observed previously with the GABAB receptor, where GABAB-R1 expressed alone is retained in the endoplasmic reticulum, and co-expression of GABAB-R2 is necessary to transport GABABR1 to the cell surface and form a functional receptor (34). However, there are several striking differences between the GABABR findings and our results. First, GABAB receptors belong to the much smaller Class III family of receptors and exhibit very large extracellular N-terminal domains that contain the agonist binding sites and very large cytoplasmic C termini that contribute to receptor dimerization (22). Second, and more importantly, the individual GABAB subunits do not form functional receptors when expressed alone, and the heterodimer appears to form only a single receptor (34). In contrast, Class I GPCRs, including {alpha}1-ARs, have agonist binding sites at least partially within the hydrophilic pocket formed by the seven transmembrane domains and clearly form functional receptors with the expected pharmacology when expressed alone. Although we do not yet know whether {alpha}1B/{alpha}1D-AR heterodimers function as a single receptor, our previous data examining the pharmacology of co-expressed subtypes suggest that each retains its own unique pharmacological characteristics (39), suggesting that they remain independent receptor subtypes.

One of the most surprising findings of our previous work (39), and this study is the subtype selectivity observed. Because {alpha}1A- and {alpha}1B-ARs share a high degree of sequence homology (Fig. 3A), the dramatic differences between these two subtypes in their abilities to translocate {alpha}1D-ARs to the cell surface is quite unexpected. Because the domains of these receptors with the least sequence homology are the extracellular N terminus and intracellular C terminus, it was even more surprising to find that these domains are not required for heterodimerization and/or translocation. This is unlike the GABAB receptors (22, 53) and mGluR1 (54) receptors, which dimerize at least partially through interactions at their C- and N-terminal domains, respectively. Our data are consistent with the idea that {alpha}1B-/{alpha}1D-AR heterodimerization involves primarily the hydrophobic core of the {alpha}1B-AR, an idea that has previously been suggested for other Class I GPCRs, including {beta}2-ARs (55), dopamine D2 (56), and rhodopsin (57) receptors. Interestingly, the {alpha}1A-AR and {alpha}1B-AR transmembrane domains differ by only 35 amino acids, which should greatly facilitate identification of particular amino acids or domains involved in dimerization.

Using the uncoupled hamster {Delta}12{alpha}1B-AR mutant, we found that dimerization induced translocation of {alpha}1D-ARs to the cell surface, resulting in increased coupling of this receptor to Ca2+ mobilization. These results show that {alpha}1B-AR coupling is not required for {alpha}1D-AR translocation and rule out the role of downstream signaling. These findings may also shed light on differences between the coupling efficiency of heterologously expressed and in vivo {alpha}1D-ARs. Although heterologously expressed {alpha}1D-ARs weakly couple to second messenger responses (16-18), stimulation of {alpha}1D-ARs in intact blood vessels is very effective in causing contraction (19-21). Evidence from {alpha}1B-AR knockout mice supports the idea that the presence of {alpha}1B-AR is important for {alpha}1D-AR function in vivo, because phenylephrine-induced contraction of aortic rings occurred with lower potency and intrinsic activity in comparison to wild-type animals (7). However, a subsequent report did not confirm this observation (58). Also, phenylephrine stimulates decreases in left ventricular pressure and coronary blood flow in {alpha}1A-/{alpha}1B-AR double knockout mice (8), suggesting that heterodimerization with {alpha}1B-ARs cannot be the only mechanism involved in determining the surface expression of functional {alpha}1D-ARs. We are currently examining whether other GPCRs may also promote {alpha}1D-AR surface expression, which might explain why {alpha}1D-ARs can still function in {alpha}1B-AR knockout mice.

Heterodimerization of {alpha}1D-ARs with the inactive {Delta}12{alpha}1B-AR mutant resulted in striking increases in agonist-induced Ca2+ mobilization, but no significant increase in agonist-induced [3H]InsP formation. The main difference between these assays is the time of agonist exposure, being seconds for Ca2+ measurements and 1 h for [3H]InsPs measurements. Therefore, we determined whether the observed difference might be due to rapid {alpha}1D-AR desensitization and internalization. Although desensitization has been examined extensively for {alpha}1B-ARs (43), there are few reports on {alpha}1D-ARs, presumably because of difficulties in obtaining significant expression levels in heterologous systems. However, one report (59) has suggested that {alpha}1D-ARs are rapidly phosphorylated (~1 min) upon stimulation with NE or treatment with phorbol esters, resulting in rapid desensitization. We found that 1-h stimulation with NE reduced surface FLAG-{alpha}1D-AR expression (co-expressed with {alpha}1B-ARs) by >60%. These data support the idea that the lack of {alpha}1D-AR induced [3H]InsP formation may be a result of rapid {alpha}1D-AR desensitization/internalization.

Increasing interest in the cellular localization of GPCRs has been spurred by identification of diseases caused by protein mislocalization, including hypercholesterolemia, cystic fibrosis, and nephrogenic diabetes insipidus (60). Although GPCRs are usually assumed to be expressed primarily on the cell surface when heterologously expressed, this is not always the case. In fact, many GPCRs are found primarily in intracellular compartments after heterologous expression, including {alpha}1D-ARs (13, 18), {alpha}2C-ARs (61-63), GABABR1 (34), adenosine-2b (64), sweet taste (35), bitter taste (65), and the large family of odorant (66) receptors, as well as ion channel receptors, including the 5-HT3B subtype (67). These receptors are often found retained in the endoplasmic reticulum, where they are unlikely to respond to agonist stimulation. The mechanisms involved in intracellular retention of receptors remain unclear in most cases. Some GPCRs contain ER retention motifs that must be removed or masked before they can be exported, including the CB1 N terminus (68) and GABAB-R1 C terminus (34). Other GPCRs may be targeted by ER retention proteins such as HSP79 analogue BiP/GRP78 (69) or the lectin-like proteins calnexin and calreticulin (70, 71), preventing surface expression. We show here that {alpha}1B-ARs promote {alpha}1D-AR surface expression, presumably by direct heterodimerization. Previously, we showed that N-terminal truncation promotes surface expression of {alpha}1D-ARs through a transplantable sequence contained within the relatively long N terminus (17, 18). Thus, {alpha}1B-AR/{alpha}1D-AR heterodimerization may mask an ER retention signal in the {alpha}1D-AR N terminus, although this hypothesis remains to be tested.

Although these results suggest a clear functional role for {alpha}1-AR heterodimerization, there are a number of caveats. Because of the lack of specific antibodies, only recombinant tagged receptors were examined. However, many previous studies have shown that epitope-tagged {alpha}1-ARs are pharmacologically and functionally equivalent to wild type receptors, and we also minimized this issue with combinations of different C-terminal and N-terminal tags. Another potential limitation is our primary use of HEK293 cells as a convenient model, and possible receptor overexpression. However, we also transfected GFP-tagged {alpha}1D-ARs into a hamster smooth muscle cell line (DDT1MF-2), which endogenously expresses {alpha}1B-ARs, as well as a rat aorta smooth muscle cell line that expresses no detectable ARs. Because GFP-tagged {alpha}1D-ARs were expressed on the cell surface in DDT1MF-2 cells, this suggests that wild-type {alpha}1B-ARs can also promote {alpha}1D-AR surface expression at physiologically relevant levels. This is in direct contrast to RASMs, where GFP-tagged {alpha}1D-ARs are primarily intracellular, just as in HEK293 (13, 18), COS (14), and CHO (18) cells.

These data provide clear evidence for a dramatic functional role of subtype-specific heterodimerization of {alpha}1-ARs. Despite the growing list of receptors that undergo homo- and heterodimerization (22-34), dimerization of Class I GPCRs has usually been found to be associated with only small differences in receptor pharmacology, function, or agonist-induced internalization. This study expands this list to a major role in receptor trafficking to the plasma membrane, similar to that observed previously with the Class III GABAB receptors, where two subunits are required for surface expression. It will be interesting in future studies to determine whether heterodimers of Class I receptors, like the {alpha}1B/{alpha}1D-AR heterodimer described here, remain together on the cell surface, and if so, whether they function as one (like the GABAB) or two distinct receptors. In any case, these studies contribute to a growing recognition of the importance of dimerization in GPCR pharmacology and function.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Supported by grants from the National Institutes of Health (NIH) and by a Distinguished Young Scholar in Medical Research Award from the W.M. Keck Foundation. Back

Supported by grants from the NIH. Back

{ddagger} To whom correspondence should be addressed: Dept. of Pharmacology, Emory University, Atlanta, GA 30322. Tel.: 404-727-0363; Fax: 404-727-0365; E-mail: chague{at}emory.edu.

1 The abbreviations used are: AR, adrenergic receptor; GPCR, G protein-coupled receptor; GFP, green fluorescent protein; CFP, cyan fluorescent protein; NE, norepinephrine; RASM, rat aortic smooth muscle; HEK, human embryonic kidney; HA, hemagglutinin; PBS, phosphate-buffered saline; PBS+, PBS plus 0.5% horse serum; HRP, horseradish peroxidase; ECL, enhanced chemiluminescence; BSA, bovine serum albumin; DMEM, Dulbecco's modified Eagle's medium; InsP, inositol phosphate; BSS, biological salt solution; CMV, cytomegalovirus; GABAB, {gamma}-aminobutyric acid, type B; fura-2/AM, fura-2/acetoxymethylester; ER, endoplasmic reticulum. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Howard Rees and Dr. Alan Levey for help with confocal microscope experiments and Dr. Steven Prinster and Dr. Myron Toews for helpful discussions.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bockaert, J., and Pin, J.-P. (1999) EMBO J. 18, 1723-1729[CrossRef][Medline] [Order article via Infotrieve]
  2. Zhong, H., and Minneman, K. P. (1999) Eur. J. Pharmacol. 375, 261-276[CrossRef][Medline] [Order article via Infotrieve]
  3. Hague, C., Uberti, M., Chen, Z. J., and Minneman, K. P. (2003) Life Sci. 74, 411-418[CrossRef][Medline] [Order article via Infotrieve]
  4. Piascik, M. T., and Perez, D. M. (2001) J. Pharmacol. Exp. Ther. 298, 403-410[Abstract/Free Full Text]
  5. Rokosh, D. G., and Simpson P. C. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 9474-9479[Abstract/Free Full Text]
  6. Tanoue, A., Nasa, Y., Koshimizu, T., Shinoura, H., Oshikawa, S., Kawai, T., Sunada, S., Takeo, S., and Tsujimoto, G. (2002) J. Clin. Invest. 109, 765-775[CrossRef][Medline] [Order article via Infotrieve]
  7. Cavalli, A., Lattion, A. L., Hummler, E., Nenniger, M., Pedrazzini, T., Aubert, J. F., Michel, M. C., Yang, M., Lembo, G., Vecchione, C., Mostardini, M., Schmidt, A., Beermann, F., and Cotecchia S. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 11589-11594[Abstract/Free Full Text]
  8. Turnbull, L., McCloskey, D., O'Connell, T., Simpson, P., and Baker, A. (2003) Am. J. Physiol. 284, H1104-H1109
  9. Gonzalez-Cabrera, P. J., Gaivin, R. J., Yun, J., Ross, S. A., Papay, R. S., McCune, D. F., Rorabaugh, B. R., and Perez, D. M. (2003) Mol. Pharmacol. 63, 1104-1116[Abstract/Free Full Text]
  10. Chen, S., Lin, F., Iismaa, S., Lee, K. N., Birckbichler, P. J., and Graham, R. M. (1996) J. Biol. Chem. 271, 32385-32391[Abstract/Free Full Text]
  11. Diviani, D., Lattion, A. L., Abuin, L., Staub, O., and Cotecchia S. (2003) J. Biol. Chem. 278, 19331-19340[Abstract/Free Full Text]
  12. Xu, Z., Hirasawa, A., Shinoura, H., and Tsujimoto, G. (1999) J. Biol. Chem. 274, 21149-21154[Abstract/Free Full Text]
  13. Chalothorn, D., McCune, D. F., Edelmann, S. E., Garcia-Cazarin, M. L., Tsujimoto, G., and Piascik, M. T. (2002) Mol. Pharmacol. 61, 1008-1016[Abstract/Free Full Text]
  14. Hirasawa, A., Sugawara, T., Awaji, T., Tsumaya, K., Ito, H., and Tsujimoto, G. (1997) Mol. Pharmacol. 52, 764-770[Abstract/Free Full Text]
  15. Mackenzie, J. F., Daly, C. J., Pediani, J. D., and McGrath, J. C. (2000) J. Pharmacol. Exp. Ther. 294, 434-443[Abstract/Free Full Text]
  16. Theroux, T. L., Esbenshade, T. A., Peavy, R. D., and Minneman, K. P. (1996) Mol. Pharmacol. 50, 1376-1387[Abstract]
  17. Pupo, A. S., Uberti, M. A., and Minneman, K. P. (2003) Eur. J. Pharmacol. 462, 1-8[CrossRef][Medline] [Order article via Infotrieve]
  18. Hague, C., Chen, Z., Pupo, A. S., Schulte, N. A., Toews, M. L., and Minneman, K. P. (2004) J. Pharmacol. Exp. Ther. 309, 1-10[Abstract/Free Full Text]
  19. Piascik, M. T., Guarino, R. D., Smith, M. S., Soltis, E. E., Saussy, D. L., Jr., and Perez, D. M. (1995) J. Pharmacol. Exp. Ther. 275, 1583-1589[Abstract/Free Full Text]
  20. Hussain, M. B., and Marshall, I. (2000) Eur. J. Pharmacol. 395, 69-76[CrossRef][Medline] [Order article via Infotrieve]
  21. Hussain, M. B., and Marshall, I. (1997) Br. J. Pharmacol. 122, 849-858[CrossRef][Medline] [Order article via Infotrieve]
  22. Bouvier, M. (2001) Nat. Rev. Neurosci. 2, 274-286[CrossRef][Medline] [Order article via Infotrieve]
  23. Heldin, C. H., (1995) Cell 80, 213-223[CrossRef][Medline] [Order article via Infotrieve]
  24. Rios, C. D., Jordan, B. A., Gomes, I., and Devi, L. A. (2001) Pharmacol. Ther. 92, 71-87[CrossRef][Medline] [Order article via Infotrieve]
  25. Cvejic, S., and Devi, L. A. (1997) J. Biol. Chem. 272, 26959-26964[Abstract/Free Full Text]
  26. Karpa, K. D., Lin, R., Kabbani, N., and Levenson, R. (2000) Mol. Pharmacol. 58, 677-683[Abstract/Free Full Text]
  27. Bai, M., Trivedi, S., and Brown, E. M. (1998) J. Biol. Chem. 273, 23605-23610[Abstract/Free Full Text]
  28. Lavoie, C., Mercier, J. F., Salahpour, A., Umapathy, D., Breit, A., Villeneuve, L. R., Zhu, W. Z., Xiao, R. P., Lakatta, E. G., Bouvier, M., and Hebert, T. E. (2002) J. Biol. Chem. 277, 35402-35410[Abstract/Free Full Text]
  29. George, S. R., Fan, T., Xie, Z., Tse, R., Tam, V., Varghese, G., and O'Dowd, B. F. (2000) J. Biol. Chem. 275, 26128-26135[Abstract/Free Full Text]
  30. Jordan, B. A., and Devi, L. A., (1999) Nature 399, 697-700[CrossRef][Medline] [Order article via Infotrieve]
  31. Xie, Z., Lee, S. P., O'Dowd, B. F., and George, S. R. (1999) FEBS Lett. 456, 63-67[CrossRef][Medline] [Order article via Infotrieve]
  32. Xu, J., He, J., Castleberry, A. M., Balasubramanian, S., Lau, A. G., and Hall, R. A. (2003) J. Biol. Chem. 278, 10770-10770[Abstract/Free Full Text]
  33. Jordan, B. A., Trapaidze, N., Gomes, I., Nivarthi, R., and Devi, L. A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 343-348[Abstract/Free Full Text]
  34. Margeta-Mitrovic, M., Jan, Y. N., and Jan, L. Y. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 14649-14654[Abstract/Free Full Text]
  35. Nelson, G., Hoon, M. A., Chandrashekar, J., Zhang, Y., Ryba, N. J., and Zuker, C. S. (2001) Cell 106, 381-390[CrossRef][Medline] [Order article via Infotrieve]
  36. Vicentic, A., Robeva, A., Rogge, G., Uberti, M., and Minneman, K. P. (2002) J. Pharmacol. Exp. Ther. 302, 58-65[Abstract/Free Full Text]
  37. Stanasila, L., Perez, J. B., Vogel, H., and Cotecchia, S. (2003) J. Biol. Chem. 278, 40239-40251[Abstract/Free Full Text]
  38. Carrillo, J. J., Pediani, J., and Milligan, G. (2003) J. Biol. Chem. 278, 42578-42587[Abstract/Free Full Text]
  39. Uberti, M. A., Hall, R. A., and Minneman, K. P. (2003) Mol. Pharmacol. 64, 1379-1390[Abstract/Free Full Text]
  40. Hirasawa, A., Horie, K., Tanaka, T., Takagaki, K., Murai, M., Yano, J., and Tsujimoto, G. (1993) Biochem. Biophys. Res. Commun. 195, 902-909[CrossRef][Medline] [Order article via Infotrieve]
  41. Ramarao, C. S., Denker, J. M., Perez, D. M., Gaiven, R. J., Riek, R. P., and Graham, R. M. (1992) J. Biol. Chem. 267, 21936-21945[Abstract/Free Full Text]
  42. Esbenshade, T. A., Hirasawa, A., Tsujimoto, G., Tanaka, T., Yano, J., and Minneman, K. P. (1995) Mol. Pharmacol. 47, 977-985[Abstract]
  43. Abbott, K. L., Robida, A. M., Davis, M. E., Pavlath, G. K., Camden, J. M., Turner, J. T., and Murphy, T. J. (2000) J. Mol. Cell Cardiol. 32, 391-403[CrossRef][Medline] [Order article via Infotrieve]
  44. Volpicelli, L. A., Lah, J. J., and Levey, A. I. (2001) J. Biol. Chem. 276, 47590-47598[Abstract/Free Full Text]
  45. Wilson, K. M., Gilchrist, S., and Minneman, K. P. (1990) J. Neurochem. 55, 691-697[CrossRef][Medline] [Order article via Infotrieve]
  46. Wu, D., Jiang, H., and Simon, M. I. (1995) J. Biol. Chem. 270, 9828-9832[Abstract/Free Full Text]
  47. Toews, M. L., Prinster, S. C., and Schulte, N. A. (2003) Life Sci. 74, 379-389[CrossRef][Medline] [Order article via Infotrieve]
  48. Wang, J., Wang, L., Anderson, J. L., Schulte, N. A., and Toews, M. L. (2002) J. Pharmacol. Exp. Ther. 300, 134-141[Abstract/Free Full Text]
  49. Zhu, J., Cerutis, D. R., Anderson, J. L., and Toews, M. L. (1996) Eur. J. Pharmacol. 299, 205-212[CrossRef][Medline] [Order article via Infotrieve]
  50. Wang, J., Wang, L., Zheng, J., Anderson, J. L., and Toews, M. L. (2000) Mol. Pharmacol. 57, 687-694[Abstract/Free Full Text]
  51. Cotecchia, S., Schwinn, D. A., Randall, R. R., Lefkowitz, R. J., Caron, M. G., and Kobilka, B. K. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7159-7163[Abstract/Free Full Text]
  52. Han, C., Esbenshade, T. A., and Minneman, K. P. (1992) Eur. J. Pharmacol. 226, 141-148[CrossRef][Medline] [Order article via Infotrieve]
  53. Kuner, R., Kohr, G., Grunewald, S., Eisenhardt, G., Bach, A., and Kornau, H. C. (1999) Science 283, 74-77[Abstract/Free Full Text]
  54. Kunishima, N., Shimada, Y., Tsuji, Y., Sato, T., Yamamoto, M., Kumasaka, T., Nakanishi, S., Jingami, H., and Morikawa, K. (2000) Nature 407, 971-977[CrossRef][Medline] [Order article via Infotrieve]
  55. Hebert, T. E., Moffett, S., Morello, J. P., Loisel, T. P., Bichet, D. G., Barret, C., and Bouvier, M. (1996) J. Biol. Chem. 271, 16384-16392[Abstract/Free Full Text]
  56. Guo, W., Shi, L., and Javitch, J. A. (2003) J. Biol. Chem. 278, 4385-4388[Abstract/Free Full Text]
  57. Liang, Y., Fotiadis, D., Filipek, S., Saperstein, D. A., Palczewski, K., and Engel, A. (2003) J. Biol. Chem. 278, 21655-21662[Abstract/Free Full Text]
  58. Daly, C. J., Deighan, C., McGee, A., Mennie, D., Ali, Z., McBridge, M., and McGrath, J. C. (2002) Physiol. Genomics 9, 85-91[Abstract/Free Full Text]
  59. Garcia-Sainz, J. A., Cuevas-Vazquez, F. G., and Romero-Avila, M. T. (2001) Biochem. J. 353, 603-610[CrossRef][Medline] [Order article via Infotrieve]
  60. Edwards, S. W., Tan, C. M., and Limbird, L. E. (2000) Trends Pharmacol. Sci. 21, 304-308[CrossRef][Medline] [Order article via Infotrieve]
  61. Wozniak, M., and Limbird, L. E. (1996) J. Biol. Chem. 271, 5017-5024[Abstract/Free Full Text]
  62. Von Zastrow, M., Link, R., Daunt, D., Barsh, G., and Kobilka, B. (1993) J. Biol. Chem. 268, 763-766[Abstract/Free Full Text]
  63. Daunt, D. A., Hurt, C., Hein, L., Kallio, J., Feng, F., and Kobilka, B. (1997) Mol. Pharmacol. 51, 711-720[Abstract/Free Full Text]
  64. Sitaraman, S. V., Wang, L., Wong, M., Bruewer, M., Hobert, M., Yun, C. H., Merlin, D., and Madara J. L. (2002) J. Biol. Chem. 277, 33188-33195[Abstract/Free Full Text]
  65. Chandrashekra, J., Mueller, K., Moon, E., Adler, E., Feng, L., Guo, W., Zuker, C., and Ryba, N. (2000) Cell 100, 703-711[CrossRef][Medline] [Order article via Infotrieve]
  66. Buck, L. B. (2000) Cell 100, 611-618[CrossRef][Medline] [Order article via Infotrieve]
  67. Boyd, G. W., Doward, A. I., Kirkness, E. F., Millar, N. S., and Connolly, C. N. (2003) J. Biol. Chem. 278, 27681-27687[Abstract/Free Full Text]
  68. Andersson, H., D'Antona, A. M., Kendall, D. A., Von Heijne, G., and Chin, C. N. (2003) Mol. Pharmacol. 64, 570-577[Abstract/Free Full Text]
  69. Hurtley, S. M., Bole, D. G., Hoover-Litty, H., Helenius, A., and Copeland, C. S. (1989) J. Cell Biol. 108, 2117-2126[Abstract/Free Full Text]
  70. Kapoor, M., Srinivas, H., Eaazhisai, K., Gemma, E., Ellgaard, L., Oscarson, S., Helenius, A., and Surolia, A. (2003) J. Biol. Chem. 278, 6194-6200[Abstract/Free Full Text]
  71. Zhang, J. X., Braakman, I., Matlack, K. E., and Helenius, A. (1997) Mol. Biol. Cell 8, 1943-1954[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Pharmacol.Home page
W. Walwyn, S. John, M. Maga, C. J. Evans, and T. G. Hales
{delta} Receptors Are Required for Full Inhibitory Coupling of {micro} Receptors to Voltage-Dependent Ca2+ Channels in Dorsal Root Ganglion Neurons
Mol. Pharmacol., July 1, 2009; 76(1): 134 - 143.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
F. M. Decaillot, R. Rozenfeld, A. Gupta, and L. A. Devi
Cell surface targeting of {micro}-{delta} opioid receptor heterodimers by RTP4
PNAS, October 14, 2008; 105(41): 16045 - 16050.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. S. Lyssand, M. C. DeFino, X.-b. Tang, A. L. Hertz, D. B. Feller, J. L. Wacker, M. E. Adams, and C. Hague
Blood Pressure Is Regulated by an {alpha}1D-Adrenergic Receptor/Dystrophin Signalosome
J. Biol. Chem., July 4, 2008; 283(27): 18792 - 18800.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
L. Szidonya, M. Cserzo, and L. Hunyady
Dimerization and oligomerization of G-protein-coupled receptors: debated structures with established and emerging functions
J. Endocrinol., March 1, 2008; 196(3): 435 - 453.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. R. Whorton, B. Jastrzebska, P. S.-H. Park, D. Fotiadis, A. Engel, K. Palczewski, and R. K. Sunahara
Efficient Coupling of Transducin to Monomeric Rhodopsin in a Phospholipid Bilayer
J. Biol. Chem., February 15, 2008; 283(7): 4387 - 4394.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
N. Harada, Y. Yamada, K. Tsukiyama, C. Yamada, Y. Nakamura, E. Mukai, A. Hamasaki, X. Liu, K. Toyoda, Y. Seino, et al.
A novel GIP receptor splice variant influences GIP sensitivity of pancreatic {beta}-cells in obese mice
Am J Physiol Endocrinol Metab, January 1, 2008; 294(1): E61 - E68.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. R. Whorton, M. P. Bokoch, S. G. F. Rasmussen, B. Huang, R. N. Zare, B. Kobilka, and R. K. Sunahara
A monomeric G protein-coupled receptor isolated in a high-density lipoprotein particle efficiently activates its G protein
PNAS, May 1, 2007; 104(18): 7682 - 7687.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
J.-P. Pin, R. Neubig, M. Bouvier, L. Devi, M. Filizola, J. A. Javitch, M. J. Lohse, G. Milligan, K. Palczewski, M. Parmentier, et al.
International Union of Basic and Clinical Pharmacology. LXVII. Recommendations for the Recognition and Nomenclature of G Protein-Coupled Receptor Heteromultimers
Pharmacol. Rev., March 1, 2007; 59(1): 5 - 13.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Dong and G. Wu
Regulation of Anterograde Transport of {alpha}2-Adrenergic Receptors by the N Termini at Multiple Intracellular Compartments
J. Biol. Chem., December 15, 2006; 281(50): 38543 - 38554.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
L. Chen, R. R. Hodges, C. Funaki, D. Zoukhri, R. J. Gaivin, D. M. Perez, and D. A. Dartt
Effects of {alpha}1D-adrenergic receptors on shedding of biologically active EGF in freshly isolated lacrimal gland epithelial cells
Am J Physiol Cell Physiol, November 1, 2006; 291(5): C946 - C956.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
M. T. Drake, S. K. Shenoy, and R. J. Lefkowitz
Trafficking of G Protein-Coupled Receptors
Circ. Res., September 15, 2006; 99(6): 570 - 582.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
S. C. Prinster, T. G. Holmqvist, and R. A. Hall
{alpha}2C-Adrenergic Receptors Exhibit Enhanced Surface Expression and Signaling upon Association with beta2-Adrenergic Receptors
J. Pharmacol. Exp. Ther., September 1, 2006; 318(3): 974 - 981.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
P. M. Abadir, A. Periasamy, R. M. Carey, and H. M. Siragy
Angiotensin II Type 2 Receptor-Bradykinin B2 Receptor Functional Heterodimerization
Hypertension, August 1, 2006; 48(2): 316 - 322.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Z. Chen, C. Hague, R. A. Hall, and K. P. Minneman
Syntrophins Regulate {alpha}1D-Adrenergic Receptors through a PDZ Domain-mediated Interaction
J. Biol. Chem., May 5, 2006; 281(18): 12414 - 12420.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
C. M. Filipeanu, F. Zhou, E. K. Fugetta, and G. Wu
Differential Regulation of the Cell-Surface Targeting and Function of beta- and {alpha}1-Adrenergic Receptors by Rab1 GTPase in Cardiac Myocytes
Mol. Pharmacol., May 1, 2006; 69(5): 1571 - 1578.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
R. A. Bakker, A. F. Lozada, A. van Marle, F. C. Shenton, G. Drutel, K. Karlstedt, M. Hoffmann, M. Lintunen, Y. Yamamoto, R. M. van Rijn, et al.
Discovery of Naturally Occurring Splice Variants of the Rat Histamine H3 Receptor That Act as Dominant-Negative Isoforms
Mol. Pharmacol., April 1, 2006; 69(4): 1194 - 1206.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
A. M. Finch and R. M. Graham
The {alpha}1D-Adrenergic Receptor: Cinderella or Ugly Stepsister
Mol. Pharmacol., January 1, 2006; 69(1): 1 - 4.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
C. Hague, S. E. Lee, Z. Chen, S. C. Prinster, R. A. Hall, and K. P. Minneman
Heterodimers of {alpha}1B- and {alpha}1D-Adrenergic Receptors Form a Single Functional Entity
Mol. Pharmacol., January 1, 2006; 69(1): 45 - 55.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
C. Brock, L. Boudier, D. Maurel, J. Blahos, and J.-P. Pin
Assembly-dependent Surface Targeting of the Heterodimeric GABAB Receptor Is Controlled by COPI but Not 14-3-3
Mol. Biol. Cell, December 1, 2005; 16(12): 5572 - 5578.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
D. Marti, R. Miquel, K. Ziani, R. Gisbert, M. D. Ivorra, E. Anselmi, L. Moreno, V. Villagrasa, D. Barettino, and P. D'Ocon
Correlation between mRNA levels and functional role of {alpha}1-adrenoceptor subtypes in arteries: evidence of {alpha}1L as a functional isoform of the {alpha}1A-adrenoceptor
Am J Physiol Heart Circ Physiol, November 1, 2005; 289(5): H1923 - H1932.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
S. C. Prinster, C. Hague, and R. A. Hall
Heterodimerization of G Protein-Coupled Receptors: Specificity and Functional Significance
Pharmacol. Rev., September 1, 2005; 57(3): 289 - 298.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
M. A. Uberti, C. Hague, H. Oller, K. P. Minneman, and R. A. Hall
Heterodimerization with {beta}2-Adrenergic Receptors Promotes Surface Expression and Functional Activity of {alpha}1D-Adrenergic Receptors
J. Pharmacol. Exp. Ther., April 1, 2005; 313(1): 16 - 23.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Interv.Home page
C. Hague, R. A. Hall, and K. P. Minneman
Olfactory Receptor Localization and Function: An Emerging Role for GPCR Heterodimerization
Mol. Interv., December 1, 2004; 4(6): 321 - 322.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. Hague, M. A. Uberti, Z. Chen, C. F. Bush, S. V. Jones, K. J. Ressler, R. A. Hall, and K. P. Minneman
Olfactory receptor surface expression is driven by association with the {beta}2-adrenergic receptor
PNAS, September 14, 2004; 101(37): 13672 - 13676.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Z. Chen, G. Rogge, C. Hague, D. Alewood, B. Colless, R. J. Lewis, and K. P. Minneman
Subtype-selective Noncompetitive or Competitive Inhibition of Human {alpha}1-Adrenergic Receptors by {rho}-TIA
J. Biol. Chem., August 20, 2004; 279(34): 35326 - 35333.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Salahpour, S. Angers, J.-F. Mercier, M. Lagace, S. Marullo, and M. Bouvier
Homodimerization of the {beta}2-Adrenergic Receptor as a Prerequisite for Cell Surface Targeting
J. Biol. Chem., August 6, 2004; 279(32): 33390 - 33397.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
M. A. Ayoub, A. Levoye, P. Delagrange, and R. Jockers
Preferential Formation of MT1/MT2 Melatonin Receptor Heterodimers with Distinct Ligand Interaction Properties Compared with MT2 Homodimers
Mol. Pharmacol., August 1, 2004; 66(2): 312 - 321.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/15/15541    most recent
M314014200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hague, C.
Right arrow Articles by Minneman, K. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hague, C.
Right arrow Articles by Minneman, K. P.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement