Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M314162200 on January 29, 2004 Originally published In Press as doi:10.1074/jbc.M314162200 on January 23, 2004

J. Biol. Chem., Vol. 279, Issue 16, 15728-15733, April 16, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/16/15728    most recent
M314162200v2
M314162200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ellis, T. P.
Right arrow Articles by Dieckmann, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ellis, T. P.
Right arrow Articles by Dieckmann, C. L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Aep3p Stabilizes the Mitochondrial Bicistronic mRNA Encoding Subunits 6 and 8 of the H+-translocating ATP Synthase of Saccharomyces cerevisiae*

Timothy P. Ellis{ddagger}, Kevin G. Helfenbein§, Alexander Tzagoloff§, and Carol L. Dieckmann{ddagger}

From the {ddagger}Department of Biochemistry and Molecular Biophysics, University of Arizona, Tucson, Arizona 85721 and §Department of Biological Sciences, Columbia University, New York, New York 10027

Received for publication, December 24, 2003 , and in revised form, January 21, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Subunits 6 and 8 of the mitochondrial ATPase in Saccharomyces cerevisiae are encoded by the mitochondrial genome and translated from bicistronic mRNAs containing both reading frames. The stability of the two major species of ATP8/6 mRNA, which differ in the length of the 5'-untranslated region, depends on the expression of several nuclear-encoded factors. In the present study, the product of the gene designated AEP3 (open reading frame YPL005W) is shown to be required for stabilization and/or processing of both ATP8/6 mRNA species. In an aep3-disruptant strain, the shorter ATP8/6 mRNA was undetectable, and the level of the longer mRNA was reduced to ~35% that of wild type. Localization of a hemagglutinin-tagged version of Aep3p showed that the protein is an extrinsic constituent of the mitochondrial inner membrane facing the matrix.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The mitochondrial ATP synthase (ATPase)1 is a member of the F1/F0-ATPase family of enzymes that are composed of a proton-translocating domain (F0) coupled via a stalk structure to the globular F1-ATP synthetase/hydrolase headpiece. In Saccharomyces cerevisiae, subunits 6, 8, and 9 of the F0 domain are encoded by the mitochondrial genome. The genes for subunits 6 and 8 are transcribed on a polycistronic RNA (Fig. 1) (1, 2) that includes the COX1 reading frame coding for subunit 1 of cytochrome oxidase. In some strains, the initial transcript also includes ENS2, which encodes an optional DNA endonuclease (3). Processing of the initial transcript yields two major mRNAs containing both ATP8 and ATP6 (and ENS2, if present in the genome) (4). The 5'-end of the longer ATP8/6 mRNA is coincident with the 3'-end of the COX1 mRNA, whereas the 5'-end of the shorter mRNA maps to a site 600 nucleotides downstream from the 3'-end of the COX1 mRNA.



View larger version (6K):
[in this window]
[in a new window]
  		FIG. 1.
The mitochondrial COX1-ATP8/6 transcription unit (1, 2). The transcription start site is represented by the rightward arrow. Open reading frames essential for oxidative phosphorylation are represented by open boxes. The ENS2 open reading frame, encoding the optional Endo/SceI endonuclease (3), is represented by a gray box. Arrows with asterisks indicate 3' mRNA processing sites. The asterisk with a dashed arrow represents the 3' mRNA processing site when the ENS2 reading frame is absent. Arrows with L (long) and S (short) indicate the 5'-ends of major ATP8/6 mRNA transcripts (4).

 
The steady-state levels of ATP8/6 RNAs are affected by the products of three nuclear genes. Strains with mutations in both NCA2 and NCA3 have an aberrant stoichiometry of the F0 subunits (5), decreased levels of the longer ATP8/6 mRNA, and reduced amounts of Atp6p and Atp8p (6, 7). Mutations in the third gene, NAM1, result in greatly reduced amounts of both ATP8/6 mRNAs (8).

Here we describe the characterization of a fourth gene required for the stability of ATP8/6 mRNAs. This gene, which we have named AEP3, corresponds to ORF YPL005W in the Saccharomyces Genome Database (SGD). AEP3 was identified by a two-step analysis of unknown yeast proteins in the SGD designed to identify mitochondrial proteins involved in RNA metabolism. The same gene was also found in a previously described screen for respiratory-deficient pet mutants (9). The function of Aep3p has been deduced from an analysis of mitochondrial RNA and protein expression profiles. Additionally, we have used an HA-tagged version of Aep3p to localize the protein to the matrix side of the inner mitochondrial membrane.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Yeast Strains, Media, and Phenotypes—S. cerevisiae strains and their genotypes are listed in Table I. Strains with intronless mitochondrial DNA (designated with prefix "i") were constructed by crossing LL20 rhoo to a karyogamy-deficient strain (kar1) carrying the intronless mitochondrial genome of GF167-7B (12).


View this table:
[in this window]
[in a new window]
  		TABLE I
Names and genotypes of yeast strains used in this study

 
The media used for growth of yeast were: YEPD (1% (w/v) yeast extract, 2% (w/v) peptone, and 2% (w/v) glucose); YEPG (1% (w/v) yeast extract, 2% (w/v) peptone, 3% (v/v) glycerol); and WO (0.17% (w/v) yeast nitrogen base without amino acids or ammonium sulfate, 0.5% (w/v) ammonium sulfate, 2% (w/v) glucose, and other supplements depending on the auxotrophy of the strain). Solid media contained 2% (w/v) agar.

Identification and Disruption of AEP3—AEP3 (ORF YPL005W) was identified by first screening unknown proteins in the SGD for sequences likely to have an amino-terminal mitochondrial targeting sequences as predicted by the MitoProt algorithm (13). The protein sequences were then analyzed using the search algorithms BLAST and eMotif (14, 15), to detect similarities to proteins known to be involved in RNA metabolism. AEP3 was amplified from nucleotides –151 to +1853 on chromosome XVI using PCR with the oligonucleotides 5'-AGTATTATTGGTTTCGGGCG and 5'-GTCCAAATGCCAGGGCAC. Total yeast cellular DNA was isolated by a rapid glass bead-vortexing method as described previously (16). The amplified product was ligated into the plasmid pGEM-T Easy (Promega). The HIS3 gene from plasmid pUC18/HIS3 was digested with ApoI and ligated into the MfeI sites at +107 and +1487 of the AEP3 reading frame. Restriction analysis of the resultant plasmid indicated that the AEP3 and HIS3 reading frames had the same orientation. This aep3::HIS3 construct was digested with EcoRI, heat-inactivated at 65 °C for 30 min, and used to transform iLL20 (17).

In Vivo Labeling of Mitochondrial Translation Products—The wild type strain iLL20 and the aep3 deletion mutant iAP3H were grown to early stationary phase in liquid YEPD medium. The cells (A600 = 1.5) were harvested by centrifugation, washed three times with a buffer containing 2% glucose, 40 mM potassium phosphate buffer, pH 6, 25 µg/ml histidine and 25 µg/ml leucine. The washed cells were resuspended in 0.5 ml of the same buffer solution. After 10-min incubation at 23 °C, cycloheximide was added to a final concentration of 8 x 10–4 M. The cells were incubated for an additional 5 min at 24 °C before addition of 40 µCi of [35S]methionine (Amersham Biosciences, specific activity = 1000 Ci/mmol). After 40 min at 24 °C, cells were isolated by centrifugation, suspended in 75 µl of 0.33 M NaOH, 1 M {beta}-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride. The suspension was incubated on ice for 10 min and diluted with 500 µl of water and 575 µl of 50% trichloroacetic acid. The suspension was incubated on ice for 30 min, centrifuged at 15,000 rpm for 10 min, washed once with water, and dissolved in 30 µl of Laemmli sample buffer (18).

Construction of AEP3-HA—To express Aep3p with a hemagglutinin (HA) tag at the carboxyl terminus, the two primers 5'-GCGAGCTCGGGACGATTCCATCGAAGCAG and 5'-GGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTAAACCTCCCCAACTATTCTCCTCTTTAC were used to amplify the gene from wild type yeast nuclear DNA. The product was digested with a combination of SacI and XbaI and ligated to the compatible sites of YIp351 (19) yielding plasmid pG100/-ST8. This construct contained 372 nucleotides of 5' sequence plus the entire coding sequence of AEP3 fused to a short sequence coding for 7 amino acids constituting the HA tag. To integrate the fusion gene at the leu2 locus, iAP3H was transformed with pG100/ST8 linearized at the ClaI site of the LEU2 gene in YIp351. Respiratory competent and leucine prototrophic clones were checked for expression of the protein with an antibody against the HA epitope.

Miscellaneous Procedures—Mitochondria were isolated by the method of Glick and Pon (20) for the localization of Aep3p. Enzyme assays and RNA extractions were done on mitochondria prepared by the method of Faye et al. (21) except that Zymolyase 20T (Seikagaku) was used instead of Glusulase to produce spheroplasts. RNA was extracted from ~5 mg of isolated mitochondria using TRIzol reagent as described in the manufacturer's instructions (Invitrogen). Mitochondrial RNAs (10 µg) were separated on a horizontal 1.25% (w/v) agarose gel in 1x TB buffer (83 mM Tris base, 89 mM boric acid). The RNAs were transferred to a Nytran membrane (Schleicher & Schuell) and probed with the following end-labeled oligonucleotide probes: ATP6-dboII (5'-CCAAATAATAGTCTAATCTCAAATTGATCTAATGGTGATG), COB exon1-dbo (5'-CCCATATTTCATCAATAATTAATTGATGATGGTTGTGGTG), COX1-dboI (5'-AGTTGATGTAACTAAACATACTAACCCCATAGGTAATACT), and COX2-dbo (5'-TCAGGAATAACATATGATTCAAATTCAACAGTTTCACCAC). Hybridizations were carried out in 6x SSC, 10x Denhardt's solution, 0.1% SDS, 50 µg/ml carrier DNA at 50 °C. The labeled probes were in molar excess relative to the mRNAs on the blot to ensure quantitative representation of the mRNAs. Blots were analyzed with a PhosphorImager (Amersham Biosciences).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
aep3 Mutants Do Not Respire—Part of the ORF YPL005W (AEP3) reading frame was deleted and replaced with HIS3 in the wild type haploid strains LL20 and iLL20. The two strains have identical genotypes except that iLL20 has an intronless mitochondrial genome. The resultant mutants AP3H and iAP3H, with and without mitochondrial introns, respectively, were viable but unable to grow on the non-fermentable carbon source glycerol (data not shown). This growth phenotype, a hallmark of respiratory-deficient mutants, indicates a direct requirement of AEP3 for the support of respiration or a requirement of AEP3 for mtDNA stability. The retention of a wild type (rho+) mitochondrial genome in AP3H and iAP3H was tested by mating each strain to the rhoo tester aCB11rhoo. In these crosses, heterozygous diploid cells with a recessive nuclear aep3 mutation are respiratory competent if they contain a rho+ genome or are respiratory defective if they have mutations in or sustain a loss of mtDNA. The crosses indicated that ~50% of the input AP3H and iAP3H cells had normal mitochondrial genomes (data not shown). These results confirm a direct requirement of AEP3 for respiratory competence but also indicate that aep3 mutations elicit instability of the mitochondrial DNA.

The Intronless aep3 Mutant Has Reduced Levels of Cytochromes and Lacks Oligomycin-sensitive ATPase Activity—The failure of intronless mtDNA to suppress the aep3 null mutation strongly argues against a role of the encoded product in intron processing (8). To simplify interpretation, all the biochemical data reported here were obtained with the intronless iAP3H mutant. Spectra of mitochondrial cytochromes in the {Delta}aep3 mutant showed detectable cytochrome b and cytochrome a+a3 (Fig. 2). The wild type and mutant mitochondria were also assayed for NADH-cytochrome c reductase and cytochrome c oxidase (Table II). Both NADH-cytochrome c reductase and cytochrome c oxidase activities were reduced 7-fold in the mutant strain. The extent of reduction measured in the enzymatic assays mirrors the reduction seen in the cytochrome spectra and is partially attributable to the rho–/rhoo population (50–60%) in the culture used for the preparation of mitochondria. Although the aep3 mutant strain retained 15% of the enzyme activities, it did not respire at all, whereas leaky mitochondrial protein synthesis mutants, in which mitochondrial translation products and respiratory chain enzymes are down to less than 5% of wild type levels, grow slowly on rich glycerol/ethanol medium.2



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 2.
Spectra of mitochondrial cytochromes in the wild type and the aep3 mutant strains. Mitochondria were prepared from iLL20 (wild type) and iAP3H aep3 mutant grown to early stationary phase in YEPD. The percentage of rho+ cells in the culture of the mutant was 40%. Mitochondria were extracted with potassium deoxycholate at a final protein concentration of 5 mg/ml as described previously (23). Difference spectra of the reduced (sodium dithionite) versus oxidized (potassium ferricyanide) extracts were recorded at room temperature. The {alpha} absorption bands corresponding to cytochromes a and a3 have maxima at 603 nm (a), of cytochrome b (b) at 560 nm and of cytochrome c and c1 (c) at 550 nm.

 


View this table:
[in this window]
[in a new window]
  		TABLE II
Respiratory and ATPase activities of mitochondria from wild type and the aep3 null mutant strain

Mitochondria were prepared from purified rho+ cells grown in YEPD to early stationary phase. Samples of the cultures were used to test for the percentage of rho+ and rho–/o cells. NADH-cytochrome c reductase and cytochrome oxidase were measured at 23 °C. ATPase was assayed at 37 °C as described previously (23) in the absence or presence of 10 µg/ml oligomycin. The values reported are averages of duplicate assays.

 

The instability of mtDNA in aep3 mutants combined with their pleiotropic deficiency of respiratory chain components is characteristic of ATPase mutants (24–26). The requirement of AEP3 for expression of the proton translocating ATPase was confirmed by assay of oligomycin-sensitive ATPase in isolated mitochondria, which showed the aep3 mutant was completely deficient in this activity (Table II). The loss of oligomycin sensitivity suggested a defect in coupling of proton translocation by F0 to ATP synthesis/hydrolysis by F1. The defect may result from either the loss of subunits in the F0 unit necessary for binding to F1 and oligomycin-sensitivity, or the loss of a factor required for assembly of F0.

aep3 Mutant Lacks Atp6p and Atp8p—The nature of the biochemical lesion in the aep3 mutant was further analyzed by determining whether the lack of oligomycin-sensitive ATPase activity was the result of a loss of one or more of the mitochondrially encoded subunits of F0. Mitochondrial translation products were pulse-labeled in vivo in the presence of the cytoplasmic translational inhibitor cycloheximide, and total cellular proteins were separated by SDS-PAGE (Fig. 3). Subunit 9 (Atp9p) was unaffected in the mutant strain, but both subunits 6 (Atp6p) and 8 (Atp8p) were almost undetectable. The absence of these two F0 constituents explains the lack of inhibition of the ATPase by oligomcyin and the resultant respiratory deficiency of the mutant strain.



View larger version (64K):
[in this window]
[in a new window]
  		FIG. 3.
In vivo labeling of mitochondrial gene products. Mitochondrial translation products were labeled with [35S]methionine in the presence of the cytoplasmic translation inhibitor cycloheximide essentially as described under "Experimental Procedures." Proteins were separated on a 12% polyacrylamide gel containing 6 M urea and glycerol to maximize separation of the ATPase subunit 6 from Cox3p, and on a 17.5% gel to improve the separation of ATPase subunits 8 and 9. The proteins were transferred to a nitrocellulose membrane and exposed to x-ray film. The mitochondrial translation products are identified on the left of each gel. In this experiment, the percentage of rho+ cells was 48%.

 
ATP8/6 mRNA Is Destabilized in the aep3 Mutant—Since subunits 6 and 8 of F0 are translated from the same bicistronic mRNAs, the absence of both proteins in the aep3 mutant suggested that Aep3p may function in processing of the COX1/ATP8/6 precursor RNA or in stabilizing the processed ATP8/6 mRNAs. This was examined by Northern analysis of mitochondrial RNAs in the parental wild type and the aep3 mutant strain. The relative levels in the aep3 mutant strain of the ATP9, COX3, and VAR1 mRNAs normalized to COX2 mRNA were not significantly different from those of wild type, whereas the level of COB mRNA was reduced by ~30% in the mutant strain (Table III). However, a probe specific for ATP8/6 showed that the aep3 mutant lacked the shorter ATP8/6 mRNA and had only 34% of wild type levels of the longer ATP8/6 mRNA (Fig. 4). The much larger transcript detected in the aep3 null mutant by both the ATP8/6- and the COX1-specific probes corresponds to the unprocessed COX1/ATP8/6 precursor (Fig. 4). The COX1 probe also detected wild type levels of mature COX1 mRNA in the mutant (Fig. 4). These data suggest that the principal effect of the aep3 mutation is on the stability of the ATP8/6 mRNAs. The accumulation of some COX1/ATP8/6 precursor RNA in the mutant, however, indicates that absence of Aep3p also affects cleavage of this initial transcript.


View this table:
[in this window]
[in a new window]
  		TABLE III
Quantitation of mitochondrial mRNA levels in the aep3 mutant strain

mRNA levels in the aep3 mutant strain were standardized to the signal for COX2 mRNA.

 



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 4.
Northern blot analysis of mitochondrial transcripts in the aep3 mutant strain. Approximately 5 µg of mitochondrial RNA of the wild type strain iLL20 and the aep3 mutant iAP3H was separated by electrophoresis on a 1.25% agarose gel. The RNAs were blotted onto Nytran and hybridized separately to probes specific for individual mitochondrial transcripts. Blots were analyzed on a PhosphorImager. Although the levels of all aep3 mitochondrial RNAs were lower than wild type due to the presence of rho–/o cells in the culture, the relative levels of COX3, ATP9, and VAR1 mRNAs were not significantly different than those of wild type when normalized to the level of COX2 mRNA (Table III). The concentrations of the transcripts in the mutant relative to wild type were 34% for the long ATP8/6 mRNA, 0% for the short ATP8/6 mRNA, and 93% for COX1 mRNA.

 
Localization of Aep3p—iAP3H/ST8, an aep3 mutant expressing Aep3p-HA from a chromosomally integrated fusion gene, was fractionated into mitochondrial and post-mitochondrial supernatant fractions. A monoclonal antibody against the HA epitope detected a protein of ~66 kDa in mitochondria but not in the post-mitochondrial supernatant (Fig. 5A). The size of the protein measured by SDS-PAGE is consistent with the mass of Aep3p calculated from the gene sequence. The failure of the antibody to detect this protein in mitochondria of wild type yeast (not shown) confirms the identity of the protein detected by the HA antibody as Aep3p-HA. Aep3p-HA was recovered in the insoluble membrane fraction after sonic disruption of mitochondria. Cytochrome b2, a soluble component of the intermembrane space, was almost quantitatively released into the soluble fraction. These results indicate that Aep3p is associated with the membrane or is in a complex of a sufficiently large mass to co-sediment with the membrane fraction. The latter possibility was excluded by centrifugation of the membrane vesicles through a discontinuous sucrose gradient. Aep3p banded with Cox2p, a cytochrome oxidase marker for the mitochondrial inner membranes, at the 30/50% sucrose interface (Fig 5C). In this gradient, large protein complexes band at the higher density defined by the 60/80% sucrose interface (27).



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 5.
Solubility properties of Aep3p. A, the aep3 mutant iAP3H/ST8, with an integrated copy of the AEP3-HA fusion gene, was grown to early stationary phase in liquid YEPD and mitochondria (Mit), and postmitochondrial supernatant (PMS) were prepared (20). Mitochondria (1 ml of a suspension at a protein concentration of 10 mg/ml of 0.6 M sorbitol, 20 mM Tris-Cl, pH 7.5, 0.5 mM EDTA (STE) were disrupted by sonic irradiation for 10 s with a Branson microprobe at half-maximal intensity. The suspension was centrifuged at 100,000 x g for 15 min. The supernatant (Sup) was collected, and the pellet consisting of submitochondrial membrane vesicles (SMP) was suspended in the starting volume of STE. Samples corresponding to 50 µg of protein were separated on a 12% polyacrylamide gel, transferred to nitrocellulose, and probed with the mouse monoclonal antibody against the hemagglutinin antigen (Covance Research Products, Inc., Berkeley, CA) to detect HA-tagged Aep3p (Aep3p-HA). The blot was also probed with rabbit polyclonal antibodies against yeast cytochrome b2 (Cyt. b2). Antibody-antigen complexes were visualized with the Super Signal Kit (Pierce Chemical Co.) after a second reaction with peroxidase coupled to either anti-mouse or anti-rabbit {gamma}-globulin. The migration of molecular mass standards is marked in the left-hand margin. B, iAP3H/ST8 mitochondria (0.5 ml), at a protein concentration of 2 mg/ml, were mixed with an equal volume of 0.2 M sodium carbonate, 10 mM EDTA and incubated on ice for 30 min. Following centrifugation at 100,000 x g for 15 min, the membrane pellet (C-Pellet) was washed and dissolved in Laemmli sample buffer. The supernatant (C-Sup) was precipitated with trichloroacetic acid and centrifuged. The protein pellet was rinsed with water and dissolved in Laemmli sample buffer. Samples of each fraction, equivalent to 40 µg of starting mitochondrial protein, were separated by SDS-PAGE on a 12% polyacrylamide gel and transferred to nitrocellulose by electrophoresis. The blot was probed with antibodies against the hemagglutinin antigen (Aep3p-HA) and Mss51p as in part A. C, submitochondrial particles obtained in part A were layered on top of a discontinuous gradient built from equal volumes of 80%, 60%, 50%, 30%, and 20% sucrose. The gradient was centrifuged for 3 h at 65,000 rpm in a Beckman SW65 rotor, fractionated into 12 equal size fractions, and analyzed for the distribution of Aep3p-HA and subunit 2 of cytochrome oxidase as in part A.

 
To ascertain if Aep3p is an integral or extrinsic membrane protein, mitochondria were extracted with alkaline carbonate. Under the conditions used, 50% of Aep3p was solubilized, indicating that it is not an integral membrane protein (Fig. 5B). Mss51p and Cox4p (not shown), both extrinsic proteins of the inner membrane, were solubilized to approximately the same extent as Aep3p by the carbonate treatment.

The submitochondrial localization of Aep3p was examined by testing its susceptibility to proteinase K in mitochondria and mitoplasts. Aep3p was protected against protease digestion in both mitochondria and mitoplasts (Fig. 6). The substantial decrease of cytochrome b2 in the mitoplasts indicated that the hypotonic treatment resulted in efficient lysis of the outer membrane. This was also supported by the loss of Sco1p in the proteinase K-treated mitoplasts. Sco1p is an intrinsic constituent of the inner membrane facing the intermembrane space (28). The intactness of the inner membrane in the mitoplast preparation was confirmed by the resistance of the matrix protein {alpha}-ketoglutarate dehydrogenase to proteinase K digestion. These results together with the solubility properties of Aep3p indicate that it is an extrinsic inner membrane protein facing the matrix side of the membrane.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 6.
Localization of Aep3p. iAP3H/ST8 mitochondria were suspended in 0.6 M sorbitol, 10 mM Hepes, pH 7.5, and diluted with either four volumes of 0.6 M sorbitol, 10 mM Hepes, pH 7.5 (MT) or with 10 mM Hepes, pH 7.5 (MP) in the presence and absence of 100 µg proteinase K/ml (Prot. K). The samples were centrifuged, and the mitochondrial (MT) and mitoplast (MP) pellets were suspended in 1.2 M sorbitol, 10 mM Hepes and treated with 0.1 volume of 50% trichloroacetic acid. The samples were centrifuged, the pellets were rinsed with water and dissolved in Laemmli sample buffer, and the pH was adjusted prior to separation on a 15% polyacrylamide gel and transfer to nitrocellulose. The blot was probed as in Fig. 5 with antibodies against the hemagglutinin tag (Aep3p-HA), cytochrome b2 (Cyt. b2), {alpha}-ketoglutarate dehydrogenase ({alpha}-KGD), and Sco1p.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Several recent studies have used the EUROSCARF series of yeast deletion strains to screen for genes involved in mitochondrial biogenesis (29, 30). Analysis of these genomics data using sequential bioinformatics-screening procedures enables the identification of a subset of genes involved in a specific process. In the present study, a sequential screen of all yeast ORFs for those encoding mitochondrial proteins, followed by a search for sequence motifs commonly found in RNA-interacting proteins, led to the identification of AEP3 as a strong candidate for a mitochondrial protein involved in RNA metabolism.

The phenotypes of aep3 mutants suggest a role for Aep3p in ATP8/6 mRNA formation and stability. COX1, ATP8, and ATP6 are transcribed as a multigenic transcript, which is processed at the 3'-end of COX1 to release the COX1 mRNA from the downstream ATP8/6 mRNA. Further cleavage of the ATP8/6 mRNA results in a second, shorter ATP8/6 mRNA with a 5'-end that maps to a site 600 nucleotides downstream of the COX1 3'-end (31). Northern analysis of RNAs in the aep3 deletion strain suggests that Aep3p stabilizes both ATP8/6 mRNAs. In addition, the presence of unprocessed COX1-ATP8/6 precursor RNA in the aep3 mutant strain suggests Aep3p may have a role in processing the 3'-end of COX1 mRNA. Because this cleavage occurs at a dodecamer sequence common to 3' processing of all mitochondrial mRNAs (32), and only the COX1-ATP8/6 RNA processing event was affected in the aep3 mutant strain, a more likely hypothesis is that processing at the dodecamer sequence of the COX1-ATP8/6 transcript is stalled because of a feedback mechanism that senses problems in downstream events such as processing, stabilization, or translation of the bicistronic ATP8/6 mRNAs.

Aep3p could be required solely for processing of the longer ATP8/6 RNA to the shorter form. A mutation preventing this step could lead to degradation of the precursor RNAs. This possibility is also unlikely, because the longer transcripts are stable in a pet127 mutant in which processing of the longer to the shorter form is blocked (33). The effect of the aep3 mutation on ATP8/6 mRNAs is very similar to that of cbp1 mutations on mitochondrial COB transcripts. In both mutants there is a reduction in the longer mRNAs and absence of the shorter mRNAs (34–36). By analogy to Cbp1p, we propose that Aep3p functions primarily in stabilization and translation of the ATP8/6 mRNAs (37). This hypothesis does not, however, exclude a possible secondary role of Aep3p in processing of the ATP8/6 transcripts.

Alignment of Aep3p to the homologous proteins in the Saccharomyces strains S. paradoxus, S. bayanus, and S. mikatae (38, 39) disclosed two regions of high conservation between all four proteins. One region, from residues 221 to 256, is a degenerate PPR motif (Fig. 7), which has been implicated in protein-RNA interactions (41). Most characterized proteins containing PPR motifs are located in either mitochondria or chloroplasts. Other yeast proteins that contain PPR motifs are Pet309p, a mitochondrial protein required for stability and translation of COX1 mRNA (42), and ORF YGR150C, which when disrupted results in the complete loss of mitochondrial DNA.3 The second region of high identity is from residues 298 to 352. This conserved region may contain more highly degenerate PPR motifs specific for an interaction between Aep3p and the ATP8/6 mRNA, or this region may be important for some other conserved function of Aep3p.



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 7.
Sequence characteristics of Aep3p. A, hydropathy plot of the Aep3p amino acid sequence. Hydrophobicity has positive values. The bar under the plot represents the site of the PPR motif, which is shown below. B, Aep3p sequence from residues 221–256 is aligned to sequences in three other Saccharomyces species. The consensus PPR motif, PF01535, as described in the Pfam Protein Families Data base, is shown below the alignment (40). Graphical representation of the Profile Hidden Markov Model was done using LogoMat-M (available at logos.molgen.mpg.de; Schuster-Böckler, B., Schultz, J., and Rahmann, S. (2004) BMC Bioinformatics 5, 7).

 

Aep3p is the fourth gene product reported to be required for stabilization of the ATP8/6 mRNA. The other three proteins are Nca2p, Nca3p (5–7), and Nam1p (8). The combined loss of Nca2p and Nca3p affects stability of the longer ATP8/6 mRNA; levels of the shorter mRNAs are unaffected (6, 7, 43). In addition, Atp6p and Atp8p were reduced 70 and 33%, respectively, in the cold-sensitive nca2 nca3 double mutant strain (44). These data suggest that the longer ATP8/6 mRNA is translated to yield Atp6p and Atp8p and is not simply a precursor to the shorter ATP8/6 mRNA (44).

Disruption of NAM1 has effects on the ATP8/6 mRNAs (8) similar to those reported here for the aep3 mutant strain. A nam1 null mutation in the iLL20 background causes both long and short forms of the ATP8/6 mRNAs to be reduced to 15% of the levels in wild type and confers temperature-sensitive growth phenotype on respiratory substrates (data not shown). In other strain backgrounds, ATP8/6 mRNAs are at even lower levels and respiratory growth is more severely restricted (8). Nam1p has been suggested to have a role in mitochondrial translation (45) and has recently been shown to associate with the mitochondrial RNA polymerase. A model has been presented suggesting that transcription and translation of mitochondrial RNAs are coupled at the inner membrane (22).

Data presented here indicate that Aep3p is located on the matrix side of the inner mitochondrial membrane. The protein may interact with the ATP8/6 mRNA at the membrane to protect the RNA and facilitate insertion of newly translated Atp6p and Atp8p into the membrane for their subsequent assembly with other subunits of F0.


   FOOTNOTES
 
* This research was supported by NIH Research Grants GM34893 (to C. L. D.) and HL2274 (to A. T.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biophysics, University of Arizona, Tucson, AZ 85721. Tel.: 520-621-3569; Fax: 520-621-3709; E-mail: dieckman{at}u.arizona.edu.

1 The abbreviations used are: ATPase, ATP synthase; rho+, strain with a wild type mitochondrial genome; rho–, respiratory-deficient mutant with a partially deleted mitochondrial genome; rhoo, respiratory-deficient mutant completely lacking mitochondrial DNA; pet, respiratory-deficient mutant with a mutation in a nuclear gene; ORF, open reading frame; SGD, Saccharomyces Genome Database; HA, hemagglutinin. Back

2 A. Tzagoloff, unpublished observation. Back

3 T. P. Ellis and C. L. Dieckmann, unpublished observations. Back


   ACKNOWLEDGMENTS
 
We thank Benjamin Schuster-Böckler, Jörg Schultz, and Sven Rahmann for allowing the use of "HMM Logos for Visualization of Protein Families" before publication and Telsa Mittelmeier, Michael Rice, Renata Lopes de Souza, and Melissa Dellos for critical reading of the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. de Zamaroczy, M., and Bernardi, G. (1986) Gene (Amst.) 47, 155–177[CrossRef][Medline] [Order article via Infotrieve]
  2. Foury, F., Roganti, T., Lecrenier, N., and Purnelle, B. (1998) FEBS Lett. 440, 325–331[CrossRef][Medline] [Order article via Infotrieve]
  3. Nakagawa, K., Morishima, N., and Shibata, T. (1991) J. Biol. Chem. 266, 1977–1984[Abstract/Free Full Text]
  4. Simon, M., and Faye, G. (1984) Mol. Gen. Genet. 196, 266–274[CrossRef][Medline] [Order article via Infotrieve]
  5. Manon, S., and Guerin, M. (1989) Biochim. Biophys. Acta 985, 127–132[Medline] [Order article via Infotrieve]
  6. Camougrand, N., Pelissier, P., Velours, G., and Guerin, M. (1995) J. Mol. Biol. 247, 588–596[CrossRef][Medline] [Order article via Infotrieve]
  7. Pelissier, P., Camougrand, N., Velours, G., and Guerin, M. (1995) Curr. Genet. 27, 409–416[CrossRef][Medline] [Order article via Infotrieve]
  8. Groudinsky, O., Bousquet, I., Wallis, M. G., Slonimski, P. P., and Dujardin, (1993) Mol. Gen. Genet. 240, 419–427[CrossRef][Medline] [Order article via Infotrieve]
  9. Tzagoloff, A., and Dieckmann, C. L. (1990) Microbiol. Rev. 54, 211–225[Abstract/Free Full Text]
  10. Mayer, S. A., and Dieckmann, C. L. (1989) Mol. Cell. Biol. 9, 4161–4169[Abstract/Free Full Text]
  11. ten Berge, A. M. A., Zoutewelle, G., and Needleman, R. B. (1974) Mol. Gen. Genet. 131, 113–121[Medline] [Order article via Infotrieve]
  12. Séraphin, B., Boulet, A., Simon, M., and Faye, G. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 6810–6814[Abstract/Free Full Text]
  13. Claros, M. G., and Vincens, P. (1996) Eur. J. Biochem. 241, 779–786[Medline] [Order article via Infotrieve]
  14. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403–410[CrossRef][Medline] [Order article via Infotrieve]
  15. Nevill-Manning, C. G., Wu, T. D., and Brutlag, D. L. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 5865–5871[Abstract/Free Full Text]
  16. Hoffman, C. S., and Winston, F. (1987) Gene (Amst.) 57, 267–272[CrossRef][Medline] [Order article via Infotrieve]
  17. Elble, R. (1992) BioTechniques 13, 18–20[Medline] [Order article via Infotrieve]
  18. Laemmli, U. K. (1970) Nature 227, 680–685[CrossRef][Medline] [Order article via Infotrieve]
  19. Hill, J. E., Myers, A. M., Koerner, T. J., and Tzagoloff, A. (1986) Yeast 2, 163–167[CrossRef][Medline] [Order article via Infotrieve]
  20. Glick, B. S., and Pon, L. A. (1995) Methods Enzymol. 260, 213–223[Medline] [Order article via Infotrieve]
  21. Faye, G., Kujawa, C., and Fukuhara, H. (1974) J. Mol. Biol. 88, 185–203[CrossRef][Medline] [Order article via Infotrieve]
  22. Rodeheffer, M. S., Boone, B. E., Bryan, A. C., and Shadel, G. S. (2001) J. Biol. Chem. 276, 8616–8622[Abstract/Free Full Text]
  23. Tzagoloff, A., Akai, A., and Needleman, R. B. (1975) J. Biol. Chem. 250, 8228–8235[Abstract/Free Full Text]
  24. Ackerman, S., and Tzagoloff, A. (1990) J. Biol. Chem. 265, 9952–9959[Abstract/Free Full Text]
  25. Paul, M. F., Velours, J., Arselin de Chateaubodeau, G., Aigle, M., and Guerin, B. (1989) Eur. J. Biochem. 185, 163–171[Medline] [Order article via Infotrieve]
  26. Helfenbein, K., Ellis, T., Dieckmann, C., and Tzagoloff, A. (2003) J. Biol. Chem. 278, 19751–19756[Abstract/Free Full Text]
  27. Ackerman, S., and Tzagoloff, A. (1990) Proc. Natl. Acad. Sci. U. S. A. 187, 4986–4990
  28. Buchwald, P., Krummeck, G., and Rödel, G. (1991) Mol. Gen. Genet. 229, 413–420[CrossRef][Medline] [Order article via Infotrieve]
  29. Dimmer, K. S., Fritz, S., Fuchs, F., Messerschmitt, M., Weinbach, N., Neupert, W., and Westermann, B. (2002) Mol. Biol. Cell 13, 847–853[Abstract/Free Full Text]
  30. Steinmetz, L. M., Scharfe, C., Deutschbauer, A. M., Mokranjac, D., Herman, Z. S., Jones, T., Chu, A. M., Giaever, G., Prokisch, H., Oefner, P. J., and Davis, R. W. (2002) Nat. Genet. 31, 400–404[Medline] [Order article via Infotrieve]
  31. Simon, M., and Faye, G. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 8–12[Abstract/Free Full Text]
  32. Min, J., and Zassenhaus, H. P. (1993) Mol. Cell. Biol. 13, 4167–4173[Abstract/Free Full Text]
  33. Wiesenberger, G., and Fox, T. D. (1997) Mol. Cell. Biol. 17, 2816–2824[Abstract]
  34. Staples, R. R., and Dieckmann, C. L. (1993) Genetics 135, 981–991[Abstract]
  35. Chen, W., and Dieckmann, C. L. (1994) J. Biol. Chem. 269, 16574–16578[Abstract/Free Full Text]
  36. Mittelmeier, T. M., and Dieckmann, C. L. (1993) Mol. Cell. Biol. 13, 4203–4213[Abstract/Free Full Text]
  37. Islas-Osuna, M. A., Ellis, T. P., Marnell, L. L., Mittelmeier, T. M., and Dieckmann, C. L. (2002) J. Biol. Chem. 277, 37987–37990[Abstract/Free Full Text]
  38. Cliften, P., Sudarsanam, P., Desikan, A., Fulton, L., Fulton, B., Majors, J., Waterston, R., Cohen, B. A., and Johnston, M. (2003) Science 301, 71–76[Abstract/Free Full Text]
  39. Kellis, M., Patterson, N., Endrizzi, M., Birren, B., and Lander, E. S. (2003) Nature 423, 241–254[CrossRef][Medline] [Order article via Infotrieve]
  40. Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S. R., Griffiths-Jones, S., Howe, K. L., Marshall, M., and Sonnhammer, E. L. (2002) Nucleic Acids Res. 30, 276–280[Abstract/Free Full Text]
  41. Small, I. D., and Peeters, N. (2000) Trends Biochem. Sci. 25, 46–47[Medline] [Order article via Infotrieve]
  42. Manthey, G. M., and McEwen, J. E. (1995) EMBO J. 14, 4031–4043[Medline] [Order article via Infotrieve]
  43. Pelissier, P. P., Camougrand, N. M., Manon, S. T., Velours, G. M., and Guerin, M. G. (1992) J. Biol. Chem. 267, 2467–2473[Abstract/Free Full Text]
  44. Manon, S., Rakotomanana, F., and Guerin, M. (1988) Eur. J. Biochem. 174, 399–404[Medline] [Order article via Infotrieve]
  45. Ben Asher, E., Groudinsky, O., Dujardin, G., Altamura, N., Kermorgant, M., and Slonimski, P. P. (1989) Mol. Gen. Genet. 215, 517–528[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Biol. CellHome page
X. Zeng, M. H. Barros, T. Shulman, and A. Tzagoloff
ATP25, a New Nuclear Gene of Saccharomyces cerevisiae Required for Expression and Assembly of the Atp9p Subunit of Mitochondrial ATPase
Mol. Biol. Cell, April 1, 2008; 19(4): 1366 - 1377.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
C. Nouet, M. Bourens, O. Hlavacek, S. Marsy, C. Lemaire, and G. Dujardin
Rmd9p Controls the Processing/Stability of Mitochondrial mRNAs and Its Overexpression Compensates for a Partial Deficiency of Oxa1p in Saccharomyces cerevisiae
Genetics, March 1, 2007; 175(3): 1105 - 1115.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
X. Zeng, W. Neupert, and A. Tzagoloff
The Metalloprotease Encoded by ATP23 Has a Dual Function in Processing and Assembly of Subunit 6 of Mitochondrial ATPase
Mol. Biol. Cell, February 1, 2007; 18(2): 617 - 626.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
X. Zeng, A. Hourset, and A. Tzagoloff
The Saccharomyces cerevisiae ATP22 Gene Codes for the Mitochondrial ATPase Subunit 6-Specific Translation Factor
Genetics, January 1, 2007; 175(1): 55 - 63.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
M. J. Brauer, C. M. Christianson, D. A. Pai, and M. J. Dunham
Mapping Novel Traits by Array-Assisted Bulk Segregant Analysis in Saccharomyces cerevisiae
Genetics, July 1, 2006; 173(3): 1813 - 1816.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
D. Gresham, D. M. Ruderfer, S. C. Pratt, J. Schacherer, M. J. Dunham, D. Botstein, and L. Kruglyak
Genome-Wide Detection of Polymorphisms at Nucleotide Resolution with a Single DNA Microarray
Science, March 31, 2006; 311(5769): 1932 - 1936.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
T. P. Ellis, M. S. Schonauer, and C. L. Dieckmann
CBT1 Interacts Genetically With CBP1 and the Mitochondrially Encoded Cytochrome b Gene and Is Required to Stabilize the Mature Cytochrome b mRNA of Saccharomyces cerevisiae
Genetics, November 1, 2005; 171(3): 949 - 957.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. Nagaike, T. Suzuki, T. Katoh, and T. Ueda
Human Mitochondrial mRNAs Are Stabilized with Polyadenylation Regulated by Mitochondria-specific Poly(A) Polymerase and Polynucleotide Phosphorylase
J. Biol. Chem., May 20, 2005; 280(20): 19721 - 19727.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
C.-Y. Kao and L. K. Read
Opposing Effects of Polyadenylation on the Stability of Edited and Unedited Mitochondrial RNAs in Trypanosoma brucei
Mol. Cell. Biol., March 1, 2005; 25(5): 1634 - 1644.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
P. Cardol, D. Gonzalez-Halphen, A. Reyes-Prieto, D. Baurain, R. F. Matagne, and C. Remacle
The Mitochondrial Oxidative Phosphorylation Proteome of Chlamydomonas reinhardtii Deduced from the Genome Sequencing Project
Plant Physiology, February 1, 2005; 137(2): 447 - 459.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/16/15728    most recent
M314162200v2
M314162200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ellis, T. P.
Right arrow Articles by Dieckmann, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ellis, T. P.
Right arrow Articles by Dieckmann, C. L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement