Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M312304200 on February 5, 2004

J. Biol. Chem., Vol. 279, Issue 16, 16111-16120, April 16, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/16/16111    most recent
M312304200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chao, S.-H.
Right arrow Articles by Caldwell, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chao, S.-H.
Right arrow Articles by Caldwell, J. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter*

Sheng-Hao Chao, Josephine N. Harada, Francie Hyndman, Xiaoqi Gao, Christian G. Nelson, Sumit K. Chanda, and Jeremy S. Caldwell{ddagger}

From the Genomics Institute of the Novartis Research Foundation, San Diego, California 92121

Received for publication, November 10, 2003 , and in revised form, February 2, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cellular homeoproteins have been shown to regulate the transcription of several viruses, including herpes simplex viruses, human papillomaviruses, and mouse mammary tumor viruses. Previous studies investigating the anti-viral mechanisms of several cyclin-dependent kinase inhibitors showed that the homeoproteins, pre B-cell leukemia transcription factor 1 (PBX1) and PBX-regulating protein-1 (PREP1), function as transcriptional activators of Moloney murine leukemia virus. Here, we examined the involvement of cellular homeoproteins in regulating the activity of the human cytomegalovirus immediate early (CMV IE) promoter. We identified a 45-bp element located at position -593 to -549 upstream of the transcription start site of the CMV IE gene, which contains multiple putative homeoprotein binding motifs. Gel shift assays demonstrated the physical association between a homeodomain protein, pancreatic-duodenal homeobox factor-1 (PDX1) and the 45-bp cytomegalovirus (CMV) region. We further determined that PDX1 represses the CMV IE promoter activity in 293 cells. Overexpression of PDX1 resulted in a decrease in transcription of the CMV IE gene. Conversely, blocking PDX1 protein synthesis and mutating the PDX1 binding sites enhanced CMV IE-dependent transcription. Collectively, our results represent the first work demonstrating that a cellular homeoprotein, PDX1, may be a repressor involved in regulation of human CMV gene expression.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cyclin-dependent kinases (CDKs)1 are key regulators of cell cycle control and transcription, which represent attractive targets for cancer therapy. Two CDK inhibitors (CDKIs), flavopiridol and UCN-1, are currently in clinical trials as potential anti-cancer therapeutics (1, 2). Previous studies also have shown the viral inhibitory effects of several CDKIs, including flavopiridol, purvalanol A, roscovitine, olomoucine, and 5,6-dichloro-1-{beta}-D-ribofuranosylbenzimidazole, on human immunodeficiency virus, herpes simplex virus (HSV), and Moloney murine leukemia virus (MLV) infection (3-6). Interestingly, all of these anti-viral CDKIs target CDK7 or CDK9, which are required for cellular transcription (5, 7-9).

It has been hypothesized that the CDKIs block viral replication by inhibiting the transcription of specific cellular genes that are required for viral infection. Our previous work tested this hypothesis using microarray technology and identified a cellular homeoprotein, pre B-cell leukemia transcription factor 1 (PBX1), as a target of the CDKIs and a required cellular co-factor for Moloney MLV replication (3). PBX1 was shown to form a heterodimer with another homeodomain protein, PBX-regulating protein-1 (PREP1), and function as a transcriptional activator of Moloney MLV (3). The PBX1-PREP1 DNA binding motif, TGATTGAC, was further shown to be conserved in the long terminal repeats of 14 other murine retroviruses (3), suggesting the importance of homeoproteins in regulating retroviral transcription.

A number of cellular homeoproteins, including OCT-1, Brn-3a, and Brn-3b, as well as CCAAT displacement protein (CDP), have previously been shown to play a role in viral transcription ranging across several virus families. The HSV transcriptional activator VP16, for example, directs the formation of a multiprotein-DNA complex on a specific element found in the promoters of HSV immediate-early genes (10). This VP16-induced complex is composed of two cellular proteins, HCF-1 and a homeoprotein OCT-1 (11). OCT-1 contains a POU (Pit-Oct-Unc) DNA-binding domain, which is composed of an amino-terminal POU-specific domain and a carboxyl-terminal POU homeodomain (12, 13). The OCT-1 POU homeodomain plays an important role in directing the binding and formation of VP16-induced complexes (14, 15). Other POU family transcription factors, Brn-3a (also known as Brn-3.0) and Brn-3b (also known as Brn-3.2), originally identified in neuronal cells (16-18) and subsequently observed in cervical cells, have been shown to regulate viral transcription of human papillomavirus-16 (HPV-16) and HPV-18 (19, 20). Both factors were shown to directly bind to the upstream regulatory region of the virus genome, however the two factors exert opposing effects, with Brn-3a activating transcription directed by the HPV upstream regulatory region, and Brn-3b repressing E6 and E7 expression (20). Furthermore, a possible involvement of Brn-3a in the pathogenesis of HSV has also been suggested (21). The silencer CDP, the mammalian homolog of the Drosophila CUT protein and a homeoprotein, negatively regulates HPV-dependent transcription by binding to specific DNA elements located in the viral promoters and long control regions, thus repressing HPV replication (22-24). In addition, CDP has been shown to block the transcription of mouse mammary tumor viruses through binding to the negative regulatory regions located in the long terminal repeats of mouse mammary tumor virus (25-27).

Due to the emergence of a role for homeodomain proteins in regulation of viral transcriptional processes, we explored the possible involvement of these factors in regulating transcription of the {beta}-herpes virus group member, human cytomegalovirus (CMV). Expression of the human CMV immediate early (IE) gene is critical for productive viral replication (28, 29). It has been shown that the replication and transcription of human CMV depends on the cellular differentiation status of the host cell. For example, in undifferentiated monocytes, little or no human CMV IE gene products are expressed, and CMV remains latent. Abundant IE gene products are produced and infectious CMV is generated when the monocytes differentiate to macrophages (30). The molecular basis for the repression of CMV IE gene remains largely unknown. In this report, we test a panel of homeoproteins, including HOXA9, PBX1, PREP1, MEIS1, and pancreatic-duodenal homeobox factor-1 (PDX1), a protein previously shown to complex with PBX1 in the regulation of elastase and somatostatin gene expression (31-33), for their ability to modulate the activity of human CMV IE promoter. We identified a 45-bp element located within the promoter of the CMV IE gene, which contains 12 putative binding sites for these homeoproteins. Our results indicate that multiple cellular proteins bind to the 45-bp CMV element and that PDX1 is present in this specific protein-DNA complex. We further demonstrate the functional significance of this interaction in cell-based assays that measure CMV IE-dependent transcription. PDX1 was found to negatively regulate the activity of the CMV IE promoter in 293 cells, and mutations in the PDX1 binding motifs alleviated these repressive effects. From these experiments we conclude that PDX1 binds to a specific region of the human CMV IE promoter and represses the promoter activity.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cells and Reagents-293, 293T, HeLa, PANC-1, and THP-1 cells were obtained from American Type Culture Collection. Differentiation of THP-1 cells was achieved with supplementation of growth media with 10 nM phorbol 12-myristate 13-acetate (PMA, Sigma) for 2 days. 293 cells were transfected with a CMV-firefly luciferase plasmid, and stable integrants were selected using 5 mg/ml blasticidin (Invitrogen) to generate the CMV-Luc stable cell line, 293-CMV-Luc.

Plasmids and Plasmid Construction-The Pdx1 (accession number: X99894 [GenBank] ) complementary DNA (cDNA) was reverse-transcribed with gene-specific primers using the Qiagen OneStep RT-PCR (reverse transcription-PCR) kit as prescribed by the manufacturer. In brief, the cDNA product was synthesized and amplified from 1 µg of purified human pancreatic poly(A) mRNA (Clontech) using two primers (5'-AATAGGATCCGCCGCAGCCATGAACGGCGA and 5'-CTCCTCTAGACTCTCATCGTGGTTCCTGCG). The resultant product was inserted into the multiple cloning site of pUB6/V5-His B (Invitrogen) using the appended BamHI and XbaI (underlined) restriction sites to generate pUB-PDX1, in which the expression of Pdx1 was driven by the human ubiquitin C promoter. Two PDX1 mutants, pUB-PDX1H189F and pUB-PDX1I192Q, were created using the QuikChange site-directed mutagenesis kit (Stratagene) as described previously (34). A pUB-PREP1 plasmid was generated by cloning the coding sequences of Prep1 into the pUB6 vector using CMV-PREP1 as the DNA template (3). The pCITE-PBX1a, pCITE-MEIS1, and pCITE-PREP1 plasmids were constructed as described previously (3). The pCITE-PBX1b and pCITE-PDX1 plasmids (including wild-type and mutant Pdx1) were created by cloning the coding regions of Pbx1b and Pdx1 into pCITE vectors using CMV-PBX1b and pUB-PDX1 (wild-type or mutant Pdx1) as templates (3). The pCITE constructs were used to synthesize translated proteins in vitro using TNT Quick Coupled Transcription/Translation Systems (Promega). Three luciferase plasmids were used in this study: ubiquitin-firefly luciferase (pUB-F-Luc), CMV-firefly luciferase (CMV-F-Luc; containing the human CMV IE promoter-enhancer), and CMV-Renilla luciferase (CMV-R-Luc; containing the human CMV IE promoter-enhancer). The firefly luciferase sequences of pGL2 control (Promega) were subcloned into pUB6 or pcDNA6 (Invitrogen) to generate pUB-F-Luc or CMV-F-Luc. CMV-R-Luc was purchased from Promega (i.e. pRL-CMV). Mutations and deletions of the human CMV IE promoter were constructed using the QuikChange site-Directed mutagenesis kit (Stratagene). All CMV-Luc mutants were generated using CMV-R-Luc as template. To mutate the potential homeoprotein binding tetramers, the middle two nucleotides were changed to two cytosines (for example, TAAT to TCCT).

EMSAs-Three different DNA fragments of the 45-nucleotide CMV sequences were used as the DNA probes for EMSAs: CMV1 (5'-GGCATTGATTATTGACTAGTTATTAATAGTAA), CMV2 (5'-AATAGTAATCAATTACGGGGTCATTAGTTCA), and CMV12 (5'-GGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCA), which contain the first half, second half, and entire regions of the 45-bp region, respectively. Electrophoretic mobility shift assays (EMSAs) were performed as described previously (3) using CMV1, CMV2, or CMV12 as the DNA probes. Briefly, anti-PBX1, anti-MEIS1, anti-PREP1, anti-PDX1, anti-HOXA9, or anti-SP1 antibodies (Santa Cruz Biotechnology, Inc.) were incubated with nuclear extracts prepared from 293 or HeLa cells for 10 min at room temperature before the 32P-labeled probe was included. When in vitro translated proteins were used in EMSAs, DNA binding reactions were performed at 4 °C for 30 min. DNA and DNA-protein complexes were resolved on 5% non-denaturing polyacrylamide gels at room temperature in 0.3x TBE (27 mM Tris-borate, pH 8.3, 0.6 mM EDTA). Following electrophoresis, the gels were dried and exposed to x-ray film.

Transfection and Luciferase Assays-293 or 293T cells were grown to 50-80% confluence in 96-well plates. Transfections were performed using FuGENE 6 (Roche Applied Science) or LipofectAMINE 2000 reagent (Invitrogen) as described in the manufacturers' manuals. For the overexpression assays, 293 or 293T cells were co-transfected with CMV-R-Luc, the indicated expression vectors (i.e. pUB-PDX1, -PDX1H189F, -PDX1I192Q, or -PREP1) and a pUB-F-Luc internal control plasmid for 48 h. In the CMV mutant assays, 293 and 293T cells were co-transfected with pUB-F-Luc (as internal control) and a wild-type or mutant CMV-R-Luc. Firefly and Renilla luciferases were measured using the Dual-Glo assay system (Promega), and the activities were determined using an Acquest multimode reader (LJL Biosystems, Inc.).

Short interfering RNAs (siRNA) targeting positions 29-47 (Pdx1-1 siRNA) or 554-572 (Pdx1-2 siRNA) of the Pdx1 open reading frame and positions 20-38 of the Prep1 open reading frame (accession number: XM_033008) were purchased from Qiagen. A fluorescein-labeled luciferase GL2 duplex was obtained from Dharmacon and used to determine transfection efficiency. An siRNA targeting Renilla luciferase was used as a control (35). 293 and 293T cells were co-transfected with CMV-F-Luc and the appropriate siRNA (i.e. Pdx1, Prep1, or R-Luc siRNAs). The effects of the siRNAs on firefly luciferase expression and activity were measured using the Bright-Glo assay system (Promega) 48 h after transfection. The inhibitory effects of the Pdx1 and Prep1 siRNAs on cellular PDX1 and PREP1 protein synthesis were further examined by Western blot analysis using anti-PDX1 and anti-PREP1 antibodies (Santa Cruz Biotechnology, Inc.).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
PDX1 Associates with a Specific Region of the Human CMV IE Promoter-Our previous work identified two cellular homeodomain proteins, PBX1 and PREP1, as transcriptional activators of Moloney MLV (3). To further investigate a possible role for homeoproteins in the transcriptional regulation of other virus families, we examined the promoter-enhancer regions of the human CMV IE gene for consensus homeoprotein binding elements. A 45-nucleotide fragment located at position -593 to -549 upstream of the transcription start site of the CMV IE gene was found to contain numerous putative homeoprotein binding sites (Fig. 1). Including the reverse complementary sequences, 12 potential tetramer binding sites for homeoproteins were identified, including two PBX1 (i.e. TGAT) (36, 37), two PREP1 or MEIS1 (i.e. TGAC) (36-38), six PDX1 (i.e. TAAT) (39, 40), and eight HOX binding sites (i.e. TAAT or TTAT) (41-43) (Fig. 1). It has been shown that PDX1 associates with the B element of the transcriptional enhancer of the pancreatic elastase I gene by forming a trimeric complex with PBX1b and MEIS2 in pancreatic acinar cell lines, whereas PDX1 binds to the B element alone in {beta}-cell lines (32). It has additionally been observed that cooperative interactions occur between PBX1, PREP1, and PDX1 on the somatostatin mini-enhancer (31). Based on these observations, we performed EMSAs to examine the possible association between the 45-bp CMV element and homeodomain proteins, including PBX1, MEIS1, PREP1, and PDX1.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 1.
Diagram of the promoter-enhancer region of human CMV IE genes showing the 45-bp element that contains 12 putative homeoprotein binding sites. The locations of the transcription start sites (+1), enhancer (-118 to -524), as well as the 45-nucleotide region of interest (-549 to -593) are indicated. The putative binding motifs for homeoproteins are underlined.

 
The 45-bp region of interest was divided into two segments extending from position -593 to -571 (CMV1) and from position -570 to -549 (CMV2). Incubation of 32P-labeled CMV1 DNA with nuclear extracts prepared from 293 cells resulted in the formation of a major DNA-protein complex, complex C (Fig. 2A; indicated as "C"). The specificity of the complex for CMV1 binding was confirmed using unlabeled specific competitor oligonucleotides (i.e. unlabeled CMV1; Fig. 2A, lane 3). No effects on the complex were observed in the presence of an unlabeled nonspecific competitor (i.e. SP1 consensus oligonucleotide; Fig. 2A, lane 4).



View larger version (82K):
[in this window]
[in a new window]
  		FIG. 2.
Characterization of PDX1 binding to the 45-bp CMV element. A, EMSA was performed using nuclear extracts of 293 cells and radiolabeled CMV1 DNA probe containing the first 23 bases of the 45-bp region of interest (i.e. 5'-TGATTATTGACTAGTTATTAATA). Lanes 1 and 5 contained the DNA probe alone, whereas the probe and nuclear extracts were included in lanes 2 and 6. Lanes 3 and 4 contained either the specific (i.e. unlabeled CMV1 oligonucleotide; S.C.) or nonspecific (i.e. unlabeled SP1 consensus oligonucleotide; N.S.C.) competitor probes, respectively. "C" denotes the specific DNA-protein complex formed in the presence of CMV1 and 293 nuclear extracts. Nuclear extracts of 293 cells were incubated with antibodies against PBX1, MEIS1, PREP1, PDX1, and SP1 prior to addition of the CMV1 probe (lanes 7-10). Anti-SP1 antibodies were used as the negative control (lane 10). B, an identical set of EMSA was performed using radiolabeled CMV2 (containing the second half of the 45-bp CMV element, 5'-GTAATCAATTACGGGGTCATTA) as the DNA probe. The position of the supershifted complex C is indicated by an arrow. C, EMSA was carried out using the CMV1 probe and in vitro translated PBX1a, PBX1b, MEIS1, PREP1, and PDX1 proteins produced by a coupled reticulocyte lysate system. The first lane (indicated by an asterisk) contained lysates alone that did not include an expression construct and demonstrates the binding of endogenous complexes in lysates. The arrow indicates the binding of PDX1 proteins. Similar results were obtained when the CMV2 probe was used (data not shown).

 
The interaction between the CMV1-region and the associated protein complex was then examined using antibodies specific to the individual homeoproteins. Incubation of nuclear extracts with antibodies raised against PDX1 proteins resulted in the appearance of a supershifted complex (Fig. 2A, arrow). However, the incubation of nuclear extracts with antibodies against PBX1, MEIS1, or PREP1 proteins did not produce any significant new species (Fig. 2A). A parallel set of EMSAs performed using CMV2 as the DNA probe yielded the same complex C as indicated in Fig. 2A. The further addition of anti-PDX1 antibodies to the reaction mixture resulted in a supershift of complex C (Fig. 2B, arrow). No effects on the DNA-protein complex were seen using anti-PBX1, -MEIS1, or -PREP1 antibodies (data not shown). When the same EMSAs (CMV1 and CMV2 as DNA probes) were performed using nuclear extracts prepared from HeLa cells, instead of 293 cells, identical results were obtained. In agreement with our findings using 293 nuclear extracts, the supershifted C complex was observed only when anti-PDX1 antibodies were included in the reaction (data not shown).

It has been shown that HOXA9 can form a trimeric protein complex with PBX1-MEIS1 or PBX1-PREP1 (43, 44). Because there are eight potential HOX binding sites present in the 45-bp CMV region, we investigated the possible association between HOXA9 proteins and the CMV DNA element. EMSAs were thus performed, incubating anti-HOXA9 antibodies with nuclear extracts. The presence of HOXA9 antibodies did not, however, affect the formation of the CMV DNA-protein complex (data not shown).

To further validate the EMSA data using nuclear extracts and antibodies, we also performed EMSAs using in vitro translated PBX1a, PBX1b, MEIS1, PREP1, HOXA9, and PDX1 proteins. The results showed that only the PDX1 protein was able to bind to the CMV1 DNA probe (Fig. 2C). PDX1 further did not appear to cooperate with the other homeodomain proteins in associating with CMV1 (Fig. 2C). Furthermore, the complex of CMV1-PDX1 (Fig. 2C) was much smaller than that observed in the EMSAs using nuclear extracts (Fig. 2A), suggesting that other cellular proteins are also present in the CMV1-protein complexes. An identical set of results was obtained when CMV2 was used as the DNA probe (data not shown). Lastly, the in vitro synthesized HOXA9 protein did not appear to interact with the CMV DNA either as a monomer, or in combination with the other homeoproteins as a dimer (i.e. PBX1-HOXA9, MEIS1-HOXA9, or PREP1-HOXA9), or trimer (i.e. PBX1-MEIS1-HOXA9 or PBX1-PREP1-HOXA9) (data not shown). Collectively, these gel shift experiments indicate that PDX1 protein is a component of a multiprotein complex that binds a region of the CMV IE promoter.

The expression of Pdx1 was initially described to be restricted to the pancreas and duodenum (45, 46). It was later reported that Pdx1 is also expressed in the developing brain (47). However, the expression of PDX1 in 293 and HeLa cells is unknown. Western blot analysis was thus performed using nuclear extracts prepared from 293 and HeLa cells (Fig. 3). In vitro synthesized recombinant PDX1 protein, which contains additional amino acids at the N terminus of PDX1, was used as a positive control (Fig. 3). Nuclear extracts of the pancreatic cell line PANC-1 were also analyzed by Western blot. As shown in Fig. 3, the expression of PDX1 in 293 and HeLa cells was confirmed.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 3.
Expression of PDX1 proteins. Nuclear extracts (25 µg) prepared from PANC-1, 293, HeLa, THP-1 cells were analyzed by Western blot. THP-1 cells were treated with or without 10 nM PMA to induce differentiation. The recombinant PDX1 proteins, which contained a few extra amino acids on the N terminus, were synthesized in vitro using transcription/translation coupled reticulocyte lysate system and served as a control.

 
We next wished to examine the expression of PDX1 in the CMV host cells. It has been shown that the expression of human CMV IE gene does not occur in monocytes but is expressed in terminally differentiated macrophages (30). THP-1, a human monocytic cell line, can be induced to differentiate into macrophage-like cells through treatment with PMA (48). Nuclear extracts of untreated and PMA-treated THP-1 cells were analyzed by Western blot using anti-PDX1 antibodies. The results indicate that PDX1 is expressed in both undifferentiated and differentiated THP-1 cells (Fig. 3).

PDX1 Binds to Multiple Sites within the Human CMV IE Promoter-We next wished to determine the exact PDX1 binding site(s) within the 45-bp CMV region. There are six putative PDX1 binding tetramers, TAAT, present in this region (Fig. 1). Of note, there are also two TTAT and two TGAT tetramers that contain one mismatch at a single position and could therefore comprise PDX1 binding sites. To determine which tetramer conferred association with PDX1, point mutations at each of the ten potential PDX1 binding sites (i.e. TAAT, TTAT, and TGAT) were generated, by changing the central two nucleotides to two cytosines. Six possible PDX1 sites are present within CMV1 (tetramer 1-6; Fig. 4A) and four in CMV2 (tetramer 7-10; Fig. 4C). EMSAs were thus performed using in vitro synthesized PDX1 protein and a wild-type or site-mutated CMV1 DNA probe. As shown in Fig. 4B, although mild loss of binding effects were observed for mutations at each site, mutations at tetramers 4 and 6 (both are TAAT) and to a lesser extent, tetramer 3 (i.e. TTAT), prevented PDX1 binding, suggesting that PDX1 binds to these regions preferentially over sites 1, 2, and 5. A similar approach was utilized to examine the potential PDX1 binding motifs in the CMV2 nucleotides (Fig. 4C). Only slight effects on PDX1-CMV2 complexes were observed when sites 7-9 were changed (Fig. 4D). On the other hand, a significant reduction in PDX1 binding was detected when a mutation was introduced into site 10 (which was TAAT), suggesting that PDX1 binds to site 10 versus tetramers 7-9 (Fig. 4D). To further validate the interaction between PDX1 and the 45-bp region of the CMV IE promoter, two PDX1 mutant proteins (i.e. PDX1H189F and PDX1I192Q), which contain mutations within the homeodomain and fail to bind to the PDX1 DNA motif, were generated and analyzed by EMSAs (34). As shown in Fig. 4E, both PDX1 mutants did not associate with the 45-bp region, which reconfirmed the specific interaction between PDX1 protein and the 45-bp element. Collectively, these experiments identify three TAAT sites (sites 4, 6, and 10) as major PDX1 binding sites in the CMV IE promoter.



View larger version (86K):
[in this window]
[in a new window]
  		FIG. 4.
Identification of PDX1 binding sites in the 45-bp CMV region. A, potential PDX1 binding motifs present within CMV1 DNA are indicated, including three TAATs, two TTATs, and one TGAT. Six individual mutant CMV1 oligonucleotides were generated, each destroying a specific possible PDX1-binding tetramer (positions 1-6). For each mutant, the middle two nucleotides of the tetramers were changed to two cytosines (underlined). B, EMSA was carried out utilizing a wild-type (WT) or mutated oligonucleotide (mutations 1-6) combined with in vitro translated PDX1 proteins. The first lane contained the WT CMV1 DNA probe and lysates without the Pdx1 expression plasmid, whereas the PDX1 proteins were included in the remaining lanes. The complexes containing PDX1 proteins are indicated by an arrow. The signal intensities of the PDX1-CMV1 DNA complexes were quantitated using the NIH Java-based image-processing program (National Institutes of Health Image/J) as shown at the bottom of the gel. The quantitative data are presented as the percentage relative to the control, i.e. the PDX1-WT CMV1 complex. C, four potential PDX1 binding motifs are present within CMV2 DNA, including three TAAT and one TGAT tetramers. Four individual mutant CMV2 oligonucleotides were generated, each of which destroyed a specific possible PDX1 tetramer (positions 7-10). The middle two nucleotides of the tetramers were changed to two cytosines (underlined). D, EMSA was performed using a wild-type (WT) or mutated oligonucleotide (mutations 7-10) and the in vitro translated PDX1 proteins. The first lane contained the WT CMV2 DNA and lysates without the Pdx1 expression plasmid, whereas the PDX1 proteins were included in the remaining reactions. The binding of PDX1 protein is indicated by an arrow, and the quantitation of the PDX1-CMV2 DNA complexes are shown at the bottom of the gel. E, the CMV12 oligonucleotide and the wild-type or mutant in vitro synthesized PDX1 proteins were utilized in the gel shift assay. The first lane contained the CMV12 DNA and lysates without the Pdx1 expression plasmid. The binding of wild-type PDX1 proteins is indicated by an arrow.

 
The correlation between major PDX1 binding elements (i.e. sites 4, 6, and 10) and the formation of the CMV-protein complexes was also examined using 293 nuclear extracts instead of in vitro translated PDX1 protein in the assays. Mutations at sites 4 and 6 caused significant, but not complete, disruption of CMV1-PDX1 association, whereas mutation of site 10 completely abrogated CMV2-PDX1 complex formation (data not shown). These data using nuclear extracts suggested that PDX1 is likely not the only determinant in the formation of these CMV DNA-protein complexes. It is possible that other cellular factors present in the CMV-protein complexes may also participate in CMV DNA binding and the formation of these complexes.

PDX1 Negatively Regulates the Human CMV IE-dependent Transcription in 293 and 293T Cells-We further investigated the importance of PDX1 in the regulation of the human CMV IE promoter. 293T cells were thus co-transfected with a reporter vector (CMV-Renilla luciferase, or CMV-R-Luc) and an expression plasmid encoding PREP1, wild-type or mutant PDX1 (i.e. pUB-PREP1, pUB-PDX1WT, pUB-PDX1H189F, or pUB-PDX1I192Q). The ubiquitin-firefly luciferase plasmid (i.e. pUB-F-Luc) was utilized as an internal control for normalization of transfection efficiency. Overexpression of PDX1 resulted in a 33% decrease in CMV-dependent transcription, whereas no effects were detected when PDX1H189F or PDX1I192F were overexpressed in 293T cells (Fig. 5A). Furthermore, in agreement with the gel shift data (Fig. 2), no significant effects were observed when PREP1 was overexpressed (Fig. 5A). The cell-based assays were performed using 293 cells and a 52% decrease in CMV IE-dependent expression was detected when PDX1 was overexpressed (data not shown).



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 5.
PDX1 represses the transcription from the human CMV IE promoter in 293/293T cells. A, PDX1 overexpression assays. 293T cells were co-transfected with the human CMV-R-Luc reporter vector and an expression plasmid, pUB-Pdx1, pUB-Pdx1H189F, pUB-Pdx1I192Q, and pUB-Prep1. pUB (i.e. the mock plasmid) served as the negative control. pUB-F-Luc was used as an internal control to normalize for transfection efficiency. Renilla and firefly luciferase activities were measured as described under "Experimental Procedures." B, PDX1 knock-down assays. 293 cells were co-transfected with human CMV-Luc and a siRNA directed against Renilla luciferase, Prep1, or Pdx1 (i.e. Pdx1-2 siRNA). The siRNA of Renilla luciferase served as a control. Pdx1-1 siRNA did not have significant effects on luciferase activity (data not shown). C, the effects of Pdx1 siRNAs on PDX1 protein synthesis. 293 cells were transfected with a siRNA against firefly luciferase or Pdx1 (i.e. Pdx1-1 or Pdx1-2 siRNAs). The siRNA of firefly luciferase was used as a negative control. Cell lysates were harvested at 24-36 h and then analyzed by Western blot using anti-PDX1 antibodies. {gamma}-Tubulin was used as the loading control.

 
We also used the Pdx1-targeted siRNA to evaluate the effect of removing the PDX1 protein on CMV-mediated transcription. Two Pdx1 siRNAs (i.e. Pdx1-1 and Pdx1-2 siRNAs) were used in the assays. 293 cells were thus co-transfected with CMV-Luc and siRNAs directed against Pdx1 or Prep1. A 6-fold increase in CMV transcription was observed in the Pdx1-2 siRNA-transfected cells, whereas no effects were detected when treating with Prep1 or Pdx1-1 siRNA (Fig. 5B; data not shown). The identical experiments were carried out using 293T cells, and similar results were obtained (data not shown). The Pdx1-2 and Prep1 siRNAs did not cause any significant effects on cellular toxicity or proliferation as determined by Alamar Blue cell viability assays (data not shown). We also generated a stable 293 cell line expressing luciferase from the human CMV IE promoter (293-CMV-Luc cells) and performed a set of experiments identical to the ones described above. Overexpression of PDX1 caused a 30% decrease in CMV-dependent transcription (data not shown). In addition, a greater than 3-fold increase in luciferase activity was observed when 293-CMV-Luc cells were transfected with Pdx1-2 siRNA (data not shown).

The effects of Pdx1 siRNAs on endogenous PDX1 protein levels were determined by Western blot analysis (Fig. 5C). As shown in Fig. 5C, Pdx1-2 but not Pdx1-1 siRNA induced a significant reduction in steady-state PDX1 levels within the cell. A 40-50% reduction of cellular PREP1 protein was also observed when cells were treated with Prep1 siRNA (data not shown). These findings likely understate the effect of the siRNAs under these conditions, because the transfection efficiency of these siRNAs on 293 cells was determined to be around 50% using fluorescein-labeled luciferase GL2 siRNA (data not shown).

To further investigate the importance of PDX1 in regulating the activity of the CMV IE promoter, mutations in each identified or putative PDX1 binding site were generated using site-directed mutagenesis and tested for differences in expression (Fig. 6A). 293T cells were transiently transfected with a CMV-Luc plasmid, which contained either the wild-type CMV IE promoter or a mutation in the indicated PDX1 site. As shown in Fig. 6B, five mutations resulted in a greater than 2-fold induction in luciferase activity, including four TAAT tetramers (sites 5, 6, 9, and 10). A subset of these mutants (sites 6 and 10) was also identified as comprising major PDX1 binding sites in the EMSA experiments (Fig. 4, B and D). A CMV-Luc construct with double mutations at sites 6 and 10 was also generated and tested, however, no additive effects on luciferase activity were detected (Fig. 6B). Similar results were obtained when 293 cells were utilized in transfection assays (data not shown).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 6.
Effects of the mutant PDX1 sites on human CMV IE transcription. A, ten individual CMV-Luc mutant plasmids were generated that contained mutations in one of the ten confirmed or putative PDX1 binding sites within the 45-bp CMV element. 6-10mt contain the double mutations at sites 6 and 10. The individual mutated sites are underlined. B, 293T cells were transiently transfected with wild-type (WT) CMV-Luc or the indicated mutant plasmid. Luciferase activity was measured 24-30 h after transfection.

 
We next wished to determine the effects of deleting regions of the 45-bp element on repression of the CMV IE promoter. Three CMV-Luc deletion constructs, CMV-Luc-del-1, CMV-Luc-del-2, and CMV-Luc-del-3, which lack the first 11, first 33, or the entire 45 bp of the 45-bp region, were generated (Fig. 7A). CMV-Luc-del-1 retains all three major PDX1 binding sites, whereas CMV-Luc-del-2 and CMV-Luc-del-3 lack two or three of the identified PDX1 sites, respectively (Fig. 7A). 293 and 293T cells were transiently transfected with the indicated CMV-Luc deletion mutant or a wild-type CMV-Luc, which served as a control. No significant effects on the luciferase activity were detected on the CMV-Luc-del-1 construct, however, CMV-Luc-del-2 and CMV-Luc-del-3 resulted in up to 2.5-fold increase in CMV IE-dependent expression (Fig. 7B).



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 7.
Deletion analysis of the 45-bp region of the human CMV IE promoter. A, diagram of three CMV-Luc deletion constructs, CMV-Luc-del-1, CMV-Luc-del-2, and CMV-Luc-del-3, in which the first 11, first 33, or entire 45 bp are deleted. The three major PDX1 binding sites are underlined. B, 293 or 293T cells were transiently transfected with the indicated deletion CMV-Luc plasmids or wild-type (WT) CMV-Luc, which served as a control. Luciferase activity was measured 24-30 h after transfection. C, 293T cells were transiently transfected with pUB-PDX1 and a CMV-Luc reporter plasmid, WT, or del-3. Luciferase activity was measured 48 h after transfection.

 
We further wished to determine if the effects of PDX1 on the CMV IE promoter was restricted to the 45-bp region under study. 293T cells were transiently transfected with a PDX1 expression vector and the wild-type or del-3 CMV-Luc reporter constructs. As seen previously (Fig. 5A), the overexpression of PDX1 caused a 60% decrease in luciferase expression driven by the wild-type CMV IE promoter. When the CMV-Luc-del-3 plasmid was alternatively used in the assay, the repressive effect of PDX1 overexpression was found to be less modest, resulting in a 40% inhibition (Fig. 7C). Although these results confirm that the 45-bp region contains PDX1 binding sites that may partially account for the PDX1-mediated repression, they also suggest that there might be additional PDX1 binding motifs outside the 45-bp region. Indeed, in our more recent analyses of the CMV IE promoter, we have identified additional PDX1 binding sites upstream of the 45-bp element (data not shown). Taken together, our findings suggest that PDX1 represses the promoter activity of the human CMV IE gene in 293 and 293T cells.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The human CMV IE promoter, one of the most potent RNA polymerase II promoters identified thus far, is commonly used for overproduction of recombinant proteins in a wide range of mammalian cells. Here we demonstrate that a cellular homeodomain protein, PDX, binds to the CMV IE promoter and down-regulates its activity in 293 and 293T cells. The identification of a specific 45-bp element, which spans nucleotides -593 to -549 of the CMV IE promoter and contains multiple putative homeoprotein binding sites, led to the discovery of PDX1 involvement in CMV-dependent transcription. Sites within this 45-nucleotide region demonstrated varying degrees of PDX1 binding by EMSAs (Fig. 4). In cell-based reporter gene assays, ectopic expression of PDX1 resulted in significant reduction in CMV IE-dependent luciferase activity, whereas PDX1 knockdown by the siRNA caused a 6-fold increase in transcription (Fig. 5, A and B). Furthermore, an increase in CMV IE promoter activity was observed when the PDX1 DNA-binding motifs were mutated or the 45-bp region was deleted (Fig. 6 and 7). Collectively, these data imply a novel role for PDX1 as a cellular regulator of the human CMV IE promoter.

The region upstream of the CMV IE enhancer between -750 and -550 has previously been described as a unique region containing multiple NF-1 binding sites (30, 49, 50). All of the identified NF-1 binding sites are located upstream of position -602 (49, 50). Interactions between endogenous nuclear proteins and the nucleotide sequence between -660 and -540 revealed five specific nuclear protein binding regions, including sequences between -602 and -557, -563 and -540, and -602 and -582, by DNase I protection experiments (49). However, the identities of these cellular proteins have not been reported. The association between the cellular homeoprotein PDX1 and the CMV 45-bp region (between -593 and -549) demonstrated here presents a novel finding in understanding CMV biology.

The importance of this unique region in human CMV IE transcription and viral replication has been investigated previously. Recombinant CMV containing deletions from positions -640 to -583, which include the putative homeoprotein binding sites 1, 2, and 5 (Figs. 1 and 4A), did not result in any significant effects on IE transcription (51). However, a deletion of the sequence between -521 and -579, which spans tetramers 3, 4, 6, 7, 8, 9, and 10, including the preferred PDX1 binding sites (Figs. 1, 4A, and 4C) resulted in significant multiplicities of infection (m.o.i.)-dependent increases in recombinant CMV replication (28). In these experiments, viral replication was shown to be comparable to that of wild-type CMV at high m.o.i., however, the replication rates of the mutant viruses were significantly increased at low m.o.i. after 6 days post-infection (52). The IE gene products, IE1 and IE2, have been shown to be required for initiating viral replication (28, 29, 53, 54). The results from our study and the previous recombinant CMV assays (51, 52) suggest the possible involvement of PDX1 in human CMV replication through the transcriptional regulation of IE gene expression. Perhaps the inhibitory effects exerted by PDX1 on CMV IE transcription, and thus replication, are masked at high m.o.i. levels of wild-type CMV relative to PDX1, whereas at low m.o.i., PDX1 is not limiting, and the repression is manifest.

In the human CMV genome, the unique region is located between the IE enhancer and the UL127 open reading frame. It has been demonstrated that the unique region negatively regulates the expression from the UL127 promoter and may function as a boundary that efficiently blocks enhancer-promoter interactions (51, 55). Ghazal and co-workers showed that a boundary domain, which contains the nucleotides from -532 to -598 (including the entire 45-bp element investigated in our work), confers repression on a heterologous promoter when placed between the enhancer and promoter (55). These previous findings help to explain how the CMV IE enhancer could selectively activate the expression of CMV IE gene, instead of UL127 promoter. However, the repressive mechanism of the boundary domain on viral transcription still remains unknown. Our finding of association between the cellular protein PDX1 and the 45-bp region provides a novel insight to investigate the regulation of the boundary domain on CMV IE promoter activity.

To further investigate the importance of the PDX1 binding motifs, CMV-Luc constructs harboring mutations within individual PDX1 binding sites or deletions within the 45-bp element were generated and examined in a cellular context (Figs. 6 and 7). However, unlike the data obtained from Pdx1-2 siRNA-treated cells (Fig. 5B), no greater than a 3-fold increase in the activity of CMV IE promoter-enhancer was observed even with the double mutations at two major PDX1 binding sites (sites 6 and 10) (Fig. 6). It is likely that PDX1 could bind to other non-mutated PDX1 binding sites within the 45-bp region and still participate in complexes that partially repress CMV-dependent transcription. Alternatively, there might be other PDX1 binding sites located outside the 45-bp region. Indeed in our current study of the human CMV IE promoter, the additional PDX1 binding region was identified upstream of the 45-bp element (data not shown). A greater increase in CMV IE transcription may be expected if all PDX1 binding sites present in the promoter-enhancer region could be eliminated. Furthermore, our results also demonstrated that PDX1 might not be the only factor that determines the formation of the specific CMV-protein complexes (Fig. 2). It is possible that one or more other unknown proteins present in the CMV DNA-protein complex might contribute binding energy and partially compensate for losses in PDX1-DNA binding affinity.

PDX1 has been shown to function as a transcriptional activator of several genes, including insulin (56, 57), Glut2 (39), glucokinase (58), islet amyloid polypeptide (59, 60), and somatostatin (31). Our data demonstrate a unique function for PDX1 whereby PDX1 negatively regulates the activity of the CMV IE promoter. It is possible that the additional proteins present in the PDX1-CMV DNA complexes could contribute to the inhibitory function of the multiprotein complex on CMV IE transcription. Interestingly, Lundquist et al. (51) have identified a putative human papillomavirus (HPV) silencing motif at position -591 to -584 of the CMV IE promoter. It has been shown that the transcriptional repressor CDP binds to this silencing element and blocks transcription and replication of HPV (23). Future experiments will be carried out to examine the potential involvement of CDP in modulating the activity of the human CMV IE promoter. The identification of other unknown cellular proteins present in the CMV IE DNA-protein complexes could provide new insights into our understanding of the transcriptional regulation of the human CMV IE gene.

Although PDX1 functions as a transcription activator in pancreatic cells, its effects on other genes or in other cells/tissues remain largely unknown. Here we show that PDX1 is also expressed in kidney (293 cells), cervix (HeLa cells), and monocytes (THP-1 cells) (Fig. 3). It is possible that the effects of PDX1 on transcriptional regulation could be tissue-specific and PDX1 could negatively regulate certain specific genes, including viral genes. However, the regulatory mechanism of PDX1 on the activity of CMV IE promoters remains to be determined. PDX1 might directly affect CMV IE-dependent transcription through association with the CMV IE promoter and interfere with the interaction between the promoter and other transcription factors. Alternatively, PDX1 could also indirectly inhibit the CMV IE promoter by influencing the expression of the other cellular genes that are involved in the regulation of the CMV IE-dependent transcription.

We utilized 293 and 293T cells, which are non-permissive cell lines for human CMV but allow CMV IE-dependent transcription, in our study. Our data demonstrate that PDX1 is involved in the transcriptional repression of CMV IE-dependent transcription in 293 and 293T cells. It will be interesting to determine the effects of PDX1 on human CMV IE transcription in the CMV host cells, such as monocytes. Cells of the monocyte lineage serve as reservoirs of latent human CMV and as vehicles for disseminating viral infection (30). Here we showed that PDX1 is expressed in human monocytes raising the possibility that PDX1 could be involved in the regulation of human CMV transcription (Fig. 3). Future work will be performed to determine the functional role of PDX1 in human CMV transcription and replication.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed: Genomics Institute of the Novartis Research Foundation, 10675 John Jay Hopkins Dr., San Diego, CA 92121. Tel.: 858-812-1511; Fax: 858-812-1623; E-mail: caldwell{at}gnf.org.

1 The abbreviations used are: CDK, cyclin-dependent kinase; CDKI, CDK inhibitor; HSV, herpes simplex virus; MLV, Moloney murine leukemia virus; PBX1, pre-B-cell leukemia transcription factor 1; PREP1, PBX-regulating protein-1; CDP, CCAAT displacement protein; POU, Pit-Oct-Unc; HPV, human papillomavirus; CMV, cytomegalovirus; IE, immediate early; PDX1, pancreatic-duodenal homeobox factor-1; PMA, phorbol 12-myristate 13-acetate; EMSA, electrophoretic mobility shift assay; m.o.i., multiplicity of infection; siRNA, short interfering RNA. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Corey Largman for providing the HoxA9 expression vector.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sausville, E. A., Johnson, J., Alley, M., Zaharevitz, D., and Senderowicz, A. M. (2000) Ann. N. Y. Acad. Sci. 910, 207-221[Medline] [Order article via Infotrieve]
  2. Senderowicz, A. M., and Sausville, E. A. (2000) J. Natl. Cancer Inst. 92, 376-387[Abstract/Free Full Text]
  3. Chao, S. H., Walker, J. R., Chanda, S. K., Gray, N. S., and Caldwell, J. S. (2003) Mol. Cell Biol. 23, 831-841[Abstract/Free Full Text]
  4. Chao, S. H., Fujinaga, K., Marion, J. E., Taube, R., Sausville, E. A., Senderowicz, A. M., Peterlin, B. M., and Price, D. H. (2000) J. Biol. Chem. 275, 28345-28348[Abstract/Free Full Text]
  5. Mancebo, H. S., Lee, G., Flygare, J., Tomassini, J., Luu, P., Zhu, Y., Peng, J., Blau, C., Hazuda, D., Price, D., and Flores, O. (1997) Genes Dev. 11, 2633-2644[Abstract/Free Full Text]
  6. Schang, L. M., Phillips, J., and Schaffer, P. A. (1998) J. Virol. 72, 5626-5637[Abstract/Free Full Text]
  7. Chao, S. H., and Price, D. H. (2001) J. Biol. Chem. 276, 31793-31799[Abstract/Free Full Text]
  8. Hajduch, M., Havlieek, L., Vesely, J., Novotny, R., Mihal, V., and Strnad, M. (1999) Adv. Exp. Med. Biol. 457, 341-353[Medline] [Order article via Infotrieve]
  9. Wang, D., de la, F. C., Deng, L., Wang, L., Zilberman, I., Eadie, C., Healey, M., Stein, D., Denny, T., Harrison, L. E., Meijer, L., and Kashanchi, F. (2001) J. Virol. 75, 7266-7279[Abstract/Free Full Text]
  10. Preston, C. M., Frame, M. C., and Campbell, M. E. (1988) Cell 52, 425-434[CrossRef][Medline] [Order article via Infotrieve]
  11. Herr, W. (1998) Cold Spring Harbor Symp. Quant. Biol. 63, 599-607[CrossRef][Medline] [Order article via Infotrieve]
  12. Sturm, R. A., and Herr, W. (1988) Nature 336, 601-604[CrossRef][Medline] [Order article via Infotrieve]
  13. Klemm, J. D., Rould, M. A., Aurora, R., Herr, W., and Pabo, C. O. (1994) Cell 77, 21-32[CrossRef][Medline] [Order article via Infotrieve]
  14. Stern, S., Tanaka, M., and Herr, W. (1989) Nature 341, 624-630[CrossRef][Medline] [Order article via Infotrieve]
  15. Pomerantz, J. L., Kristie, T. M., and Sharp, P. A. (1992) Genes Dev. 6, 2047-2057[Abstract/Free Full Text]
  16. Lillycrop, K. A., Budrahan, V. S., Lakin, N. D., Terrenghi, G., Wood, J. N., Polak, J. M., and Latchman, D. S. (1992) Nucleic Acids Res. 20, 5093-5096[Abstract/Free Full Text]
  17. Gerrero, M. R., McEvilly, R. J., Turner, E., Lin, C. R., O'Connell, S., Jenne, K. J., Hobbs, M. V., and Rosenfeld, M. G. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 10841-10845[Abstract/Free Full Text]
  18. Turner, E. E., Jenne, K. J., and Rosenfeld, M. G. (1994) Neuron 12, 205-218[CrossRef][Medline] [Order article via Infotrieve]
  19. Ndisdang, D., Morris, P. J., Chapman, C., Ho, L., Singer, A., and Latchman, D. S. (1998) J. Clin. Invest. 101, 1687-1692[Medline] [Order article via Infotrieve]
  20. Morris, P. J., Theil, T., Ring, C. J., Lillycrop, K. A., Moroy, T., and Latchman, D. S. (1994) Mol. Cell Biol. 14, 6907-6914[Abstract/Free Full Text]
  21. Turner, E. E., Rhee, J. M., and Feldman, L. T. (1997) Nucleic Acids Res. 25, 2589-2594[Abstract/Free Full Text]
  22. Ai, W., Toussaint, E., and Roman, A. (1999) J. Virol. 73, 4220-4229[Abstract/Free Full Text]
  23. O'Connor, M. J., Stunkel, W., Koh, C. H., Zimmermann, H., and Bernard, H. U. (2000) J. Virol. 74, 401-410[Abstract/Free Full Text]
  24. Pattison, S., Skalnik, D. G., and Roman, A. (1997) J. Virol. 71, 2013-2022[Abstract]
  25. Liu, J., Bramblett, D., Zhu, Q., Lozano, M., Kobayashi, R., Ross, S. R., and Dudley, J. P. (1997) Mol. Cell Biol. 17, 5275-5287[Abstract]
  26. Zhu, Q., Gregg, K., Lozano, M., Liu, J., and Dudley, J. P. (2000) J. Virol. 74, 6348-6357[Abstract/Free Full Text]
  27. Zhu, Q., and Dudley, J. P. (2002) J. Virol. 76, 2168-2179[Abstract/Free Full Text]
  28. Mocarski, E. S., Kemble, G. W., Lyle, J. M., and Greaves, R. F. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 11321-11326[Abstract/Free Full Text]
  29. Iskenderian, A. C., Huang, L., Reilly, A., Stenberg, R. M., and Anders, D. G. (1996) J. Virol. 70, 383-392[Abstract]
  30. Meier, J. L., and Stinski, M. F. (1996) Intervirology 39, 331-342[Medline] [Order article via Infotrieve]
  31. Goudet, G., Delhalle, S., Biemar, F., Martial, J. A., and Peers, B. (1999) J. Biol. Chem. 274, 4067-4073[Abstract/Free Full Text]
  32. Swift, G. H., Liu, Y., Rose, S. D., Bischof, L. J., Steelman, S., Buchberg, A. M., Wright, C. V., and MacDonald, R. J. (1998) Mol. Cell Biol. 18, 5109-5120[Abstract/Free Full Text]
  33. Liu, Y., MacDonald, R. J., and Swift, G. H. (2001) J. Biol. Chem. 276, 17985-17993[Abstract/Free Full Text]
  34. Lu, M., Miller, C., and Habener, J. F. (1996) Endocrinology 137, 2959-2967[Abstract]
  35. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001) Nature 411, 494-498[CrossRef][Medline] [Order article via Infotrieve]
  36. Chang, C. P., Brocchieri, L., Shen, W. F., Largman, C., and Cleary, M. L. (1996) Mol. Cell Biol. 16, 1734-1745[Abstract]
  37. Knoepfler, P. S., and Kamps, M. P. (1997) Oncogene 14, 2521-2531[CrossRef][Medline] [Order article via Infotrieve]
  38. Knoepfler, P. S., Calvo, K. R., Chen, H., Antonarakis, S. E., and Kamps, M. P. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 14553-14558[Abstract/Free Full Text]
  39. Waeber, G., Thompson, N., Nicod, P., and Bonny, C. (1996) Mol. Endocrinol. 10, 1327-1334[Abstract/Free Full Text]
  40. Pedersen, A. A., Petersen, H. V., Videbaek, N., Skak, K., and Michelsen, B. K. (2002) Biochem. Biophys. Res. Commun. 295, 243-248[CrossRef][Medline] [Order article via Infotrieve]
  41. Zappavigna, V., Renucci, A., Izpisua-Belmonte, J. C., Urier, G., Peschle, C., and Duboule, D. (1991) EMBO J. 10, 4177-4187[Medline] [Order article via Infotrieve]
  42. Catron, K. M., Iler, N., and Abate, C. (1993) Mol. Cell Biol. 13, 2354-2365[Abstract/Free Full Text]
  43. Shen, W. F., Rozenfeld, S., Kwong, A., Kom ves, L. G., Lawrence, H. J., and Largman, C. (1999) Mol. Cell Biol. 19, 3051-3061[Abstract/Free Full Text]
  44. Berthelsen, J., Zappavigna, V., Ferretti, E., Mavilio, F., and Blasi, F. (1998) EMBO J. 17, 1434-1445[CrossRef][Medline] [Order article via Infotrieve]
  45. Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H. (1994) Nature 371, 606-609[CrossRef][Medline] [Order article via Infotrieve]
  46. Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein, R. W., Magnuson, M. A., Hogan, B. L., and Wright, C. V. (1996) Development 122, 983-995[Abstract]
  47. Perez-Villamil, B., Schwartz, P. T., and Vallejo, M. (1999) Endocrinology 140, 3857-3860[Abstract/Free Full Text]
  48. Schwende, H., Fitzke, E., Ambs, P., and Dieter, P. (1996) J. Leukoc. Biol. 59, 555-561[Abstract]
  49. Ghazal, P., Lubon, H., Reynolds-Kohler, C., Hennighausen, L., and Nelson, J. A. (1990) Virology 174, 18-25[CrossRef][Medline] [Order article via Infotrieve]
  50. Hennighausen, L., and Fleckenstein, B. (1986) EMBO J. 5, 1367-1371[Medline] [Order article via Infotrieve]
  51. Lundquist, C. A., Meier, J. L., and Stinski, M. F. (1999) J. Virol. 73, 9039-9052[Abstract/Free Full Text]
  52. Meier, J. L., Keller, M. J., and McCoy, J. J. (2002) J. Virol. 76, 313-326[Abstract/Free Full Text]
  53. Greaves, R. F., and Mocarski, E. S. (1998) J. Virol. 72, 366-379[Abstract/Free Full Text]
  54. Marchini, A., Liu, H., and Zhu, H. (2001) J. Virol. 75, 1870-1878[Abstract/Free Full Text]
  55. Angulo, A., Kerry, D., Huang, H., Borst, E. M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., and Ghazal, P. (2000) J. Virol. 74, 2826-2839[Abstract/Free Full Text]
  56. Ohlsson, H., Karlsson, K., and Edlund, T. (1993) EMBO J. 12, 4251-4259[Medline] [Order article via Infotrieve]
  57. Peers, B., Leonard, J., Sharma, S., Teitelman, G., and Montminy, M. R. (1994) Mol. Endocrinol. 8, 1798-1806[Abstract/Free Full Text]
  58. Watada, H., Kajimoto, Y., Miyagawa, J., Hanafusa, T., Hamaguchi, K., Matsuoka, T., Yamamoto, K., Matsuzawa, Y., Kawamori, R., and Yamasaki, Y. (1996) Diabetes 45, 1826-1831[Abstract]
  59. Serup, P., Jensen, J., Andersen, F. G., Jorgensen, M. C., Blume, N., Holst, J. J., and Madsen, O. D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9015-9020[Abstract/Free Full Text]
  60. Carty, M. D., Lillquist, J. S., Peshavaria, M., Stein, R., and Soeller, W. C. (1997) J. Biol. Chem. 272, 11986-11993[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Virol.Home page
S. C. Y. Ku, J. Lee, J. Lau, M. Gurumurthy, R. Ng, S. H. Lwa, J. Lee, Z. Klase, F. Kashanchi, and S.-H. Chao
XBP-1, a Novel Human T-Lymphotropic Virus Type 1 (HTLV-1) Tax Binding Protein, Activates HTLV-1 Basal and Tax-Activated Transcription
J. Virol., May 1, 2008; 82(9): 4343 - 4353.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
L. Chen, H.-X. Yan, J. Chen, W. Yang, Q. Liu, B. Zhai, H.-F. Cao, S.-Q. Liu, M.-C. Wu, and H.-Y. Wang
Negative Regulation of c-Myc Transcription by Pancreas Duodenum Homeobox-1
Endocrinology, May 1, 2007; 148(5): 2168 - 2180.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. B. Deramaudt, M. M. Sachdeva, M. P. Wescott, Y. Chen, D. A. Stoffers, and A. K. Rustgi
The PDX1 Homeodomain Transcription Factor Negatively Regulates the Pancreatic Ductal Cell-specific Keratin 19 Promoter
J. Biol. Chem., December 15, 2006; 281(50): 38385 - 38395.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/16/16111    most recent
M312304200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chao, S.-H.
Right arrow Articles by Caldwell, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chao, S.-H.
Right arrow Articles by Caldwell, J. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement