Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M400584200 on February 5, 2004

J. Biol. Chem., Vol. 279, Issue 16, 16638-16645, April 16, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/16/16638    most recent
M400584200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ng, K. K.-S.
Right arrow Articles by Parra, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ng, K. K.-S.
Right arrow Articles by Parra, F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Crystal Structure of Norwalk Virus Polymerase Reveals the Carboxyl Terminus in the Active Site Cleft*

Kenneth K.-S. Ng{ddagger}§, Natalia Pendás-Franco¶, Jorge Rojo¶, José A. Boga||, Àngeles Machín¶, José M. Martín Alonso¶, and Francisco Parra¶

From the {ddagger}Division of Biochemistry, Department of Biological Sciences, University of Calgary, Calgary, Alberta T2N 1N4, Canada and Departamento de Bioquímica y Biología Molecular, Instituto Universitario de Biotecnología de Asturias, Universidad de Oviedo and ||Servicio de Microbiología I, Hospital Universitario Central de Asturias, 33006 Oviedo, Spain

Received for publication, January 20, 2004 , and in revised form, February 2, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Norwalk virus is a major cause of acute gastroenteritis for which effective treatments are sorely lacking. To provide a basis for the rational design of novel antiviral agents, the main replication enzyme in Norwalk virus, the virally encoded RNA-dependent RNA polymerase (RdRP), has been expressed in an enzymatically active form, and its structure has been crystallographically determined both in the presence and absence of divalent metal cations. Although the overall fold of the enzyme is similar to that seen previously in the RdRP from rabbit hemorrhagic disease virus, the carboxyl terminus, surprisingly, is located in the active site cleft in five independent copies of the protein in three distinct crystal forms. The location of this carboxyl-terminal segment appears to interfere with the binding of double-stranded RNA in the active site cleft and may play a role in the initiation of RNA synthesis or mediate interactions with accessory replication proteins.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Recent studies have shown that members of the Norovirus genus within the Caliciviridae family are now considered one of the most common causes of outbreaks and sporadic cases of gastroenteritis in individuals of all ages worldwide (1). These pathogens have a positive-strand RNA genome and life cycle that are similar in many respects to a group of evolutionarily related viruses responsible for important human diseases such as polio, hepatitis C, dengue, yellow fever, viral encephalitis (West Nile virus and Japanese encephalitis virus), and severe acute respiratory syndrome. Many of these viruses are threats to public health, because they are highly infectious and can cause serious illnesses, in some cases leading to death. The limitations of vaccination and lack of effective antiviral chemotherapeutics for many of these diseases underline the urgency of understanding positive-stranded RNA viruses at a deeper, molecular level to allow for the development of novel treatments.

Replication of the genome in all positive-strand RNA viruses is critically dependent on the activity of a virally encoded RNA-dependent RNA polymerase (RdRP)1 (2). This enzyme is responsible for synthesizing negative-sense RNA, which is complementary to the positive-sense genomic RNA, as well as newly made positive-sense RNA genomes that can be used for the production of viral proteins or packaged into new viral particles. The three-dimensional structures of RdRPs from members of three families of positive-strand RNA viruses (poliovirus (PV) (3) from Picornaviridae, hepatitis C virus (HCV) (4-6) from Flaviviridae, and rabbit hemorrhagic disease virus (RHDV) (7) from Caliciviridae) have previously revealed a similar overall architecture as well as a range of specific adaptations (8).

Here, we report the novel structure of an RdRP from a genogroup II Norwalk virus (NV) isolate, Ast6139/01/Sp, in a metal-free form at 2.17 Å resolution, as well as in a metal-bound form at 2.95 Å resolution. Although the arrangement of secondary structural elements and key catalytic motifs is similar to those seen in the RHDV enzyme as well as other RdRPs from positive-strand RNA viruses, dramatic structural differences, especially in the carboxyl-terminal region, suggest novel functional adaptations important for viral replication. A small metal-dependent conformational change can also be seen when comparing the structure of the metal-free NV RdRP in two crystal forms with the structure of the metal-bound enzyme in a third crystal form. These structures represent the first three-dimensional structures of a Norovirus enzyme and provide the basis for the structure-based design of antiviral therapeutics against an important group of human pathogens.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Construction of the RdRP Expression Vector—The NV RdRP coding region was amplified by PCR using a cDNA clone (GenBankTM accession number AJ583672 [GenBank] ) from the Spanish NV isolate Ast6139/01/Sp and the specific primers NVpol5B ggatccgacagtaagggaacatactg and NVpol3E gaattctcattcgacgccatcttcattc, which also added BamHI and EcoRI restriction enzyme recognition sequences (underlined residues) at both ends of the amplified region. The resulting fragment was first ligated to pGEM-T vector (Promega), and then, after digestion with the restriction enzymes BamHI and EcoRI, the 1.5-kb fragment containing the RdRP gene was purified and inserted into BamHI-EcoRI-digested, alkaline phosphatase-treated pGEX-2T (Amersham Biosciences) to generate the recombinant expression vector pGEX-NV-3D. This recombinant plasmid was designed to produce the NV RdRP as a fusion protein with Schistosoma japonicum glutathione S-transferase at the amino terminus.

Protein Expression and Purification—Overnight cultures of Escherichia coli XL-1 Blue transformed with pGEX-NV-3D were diluted 1:250 in 500 ml of Luria-Bertani medium containing ampicillin (50 µg ml-1). The cultures were incubated at 37 °C to an A600 of 0.5, and isopropyl-thio-{beta}-D-galactopyranoside was added up to 200 µM. After 2 h of growth at 37 °C, the cells were harvested by centrifugation, and the pellet was suspended in 30 ml of 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.25 mM EDTA (Buffer 1). The suspension was sonicated, and the supernatant, recovered after centrifugation at 15,000 rpm for 30 min in a Sorvall SS-34 rotor, was loaded onto a 5-ml glutathione-Sepharose 4B column (Amersham Biosciences) equilibrated in Buffer 1. The eluate was retained and reapplied to the column. Following the absorption step, the column was washed five times with 5 ml of Buffer 1. After the final wash, the gel slurry was suspended in 400 µl of Buffer 1 containing 480 ng of thrombin (Amersham Biosciences) and incubated at room temperature for 3 h. NV RdRP was recovered from the eluate and further purified by ion exchange chromatography using a Vivapure Q Maxi H spin column (Vivascience). The purified protein was eluted with a step gradient of Buffer 1 containing 200, 250, and 300 mM NaCl. The salt and buffer concentration were lowered to 50 mM NaCl and 10 mM Tris-Cl, pH 8.0, by dilution, and the protein was concentrated to 7 mg/ml using an Ultrafree-15 BioMax 10-kDa centrifugal spin filter (Millipore). Approximately 3-4 mg of purified protein was obtained from 1 liter of bacterial cell culture.

Preparation of Synthetic NV Heteropolymeric RNA—A cDNA clone containing the NV Ast6139/01/Sp 3' sequence was PCR-amplified using oligonucleotide primers NV5 (taatacgactcactatagtagctcacactggcccg) and NVdT3 (tttttttttttttttttaaagacactaaag). The 1013-bp PCR product containing a minimal T7 RNA polymerase promoter (underlined residues) was phenol-chloroform-extracted, ethanol-precipitated, and dissolved in diethyl pyrocarbonate-treated water prior to its in vitro transcription using the large scale RNA production system Ribomax (Promega).

Enzymatic Assays—RdRP activity was assayed in 50-µl samples containing 4 µg of the purified enzyme, 50 mM HEPES (pH 8.0), 10 µM ATP, 10 µM GTP, 10 µM CTP, 5 µM UTP, 4 mM dithiothreitol, 50 units of ribonuclease inhibitor (Promega), 25 µmol (10 µCi) of [{alpha}32-P]UTP, 60 nM synthetic NV heteropolymeric RNA, and 0.1-5 mM magnesium acetate. After incubation at 30 °C for 60 min, the reaction mixture was phenol-chloroform-extracted and then ethanol-precipitated in the presence of 0.3 M sodium acetate (pH 6.0) and 20 µg of carrier tRNA. The sediments were dissolved in electrophoresis sample buffer, loaded onto 1.2% formaldehyde-agarose gels, and electrophoresed at 60-70 V. The gels were then dried and the in vitro 32P-labeled RNA products detected by autoradiography.

Crystallization—Crystals were grown at room temperature by the hanging drop vapor diffusion method by mixing 2 µl of NV polymerase (7 mg/ml) and 2 µl of 24% (w/v) polyethylene glycol 8000, 100-200 mM ammonium sulfate, 50 mM Tris-Cl, pH 7.5, 15% (w/v) glycerol, 0.2% (w/v) CHAPS, and 14 mM 2-mercaptoethanol. At least two different crystal forms (space groups C2221 and P1) with similar morphologies grew to a maximum size of ~0.2 x 0.1 x 0.1 mm after 2-3 weeks. Another crystal form (space group P212121) could be grown to a size of 0.15 x 0.075 x 0.05 mm under similar conditions, with the following modifications: 100 mM ammonium sulfate and 20 mM magnesium sulfate.

Data Collection, Structure Solution, and Refinement—Data were measured on flash-frozen crystals at 105 K by transferring crystals directly from the mother liquor into a nitrogen gas stream. Data were measured from a MAR 345 detector using radiation from a rotating anode generator (Rigaku RU-H3R and Osmic confocal optics). Data were indexed, integrated, and scaled using the HKL suite of programs (9). Intensities were converted to amplitudes using TRUNCATE (10).

The solvent content of the centered orthorhombic crystals was calculated to be 53% (Vm = 2.66) if one copy of NV polymerase was present in the asymmetric unit. The structure of RHDV polymerase (Protein Data Bank code 1KHV [PDB] ), with all side chains and temperature factors retained, was used as the search model for molecular replacement calculations. Molecular replacement calculations were carried out using BEAST (11). The cross-rotation and translation functions both gave a single prominent solution (log-likelihood scores of 15.8 and 25.6, respectively). The crystal packing seemed reasonable, but the R-factor following rigid-body refinement was poor (r = 0.53, resolution = 20-2.8 Å). Nevertheless, several rounds of simulated annealing refinement using the program CNS (12), density modification using RESOLVE (13), and manual model building using Xfit (14) allowed for the construction of a model with improved statistics (r = 0.38, Rfree = 0.43, resolution = 20-2.3 Å). At this point, the triclinic crystal form with two copies in the asymmetric unit was discovered. This crystal yielded a stronger and more isotropic diffraction pattern. Molecular replacement calculations were carried out using the model that had been partially refined in the centered orthorhombic crystal form. Two clear solutions appeared in both the rotation and translation functions, and the initial electron density map was significantly clearer than for the centered orthorhombic crystal form. Averaging and density modification using RESOLVE further improved electron density maps, and the structures of both copies in the asymmetric unit were built using Xfit and refined using REFMAC (15) (translation-libration-screw rotation parameters for rigid bodies, atomic positions, and temperature factors). Following the completion of refinement, the model of the protein was superimposed onto the partially refined model in the centered orthorhombic crystal form, and refinement was completed on this crystal form as well. Molecular replacement calculations using the fully refined model from the triclinic crystal form also gave two very clear solutions for the primitive orthorhombic crystal form grown in the presence of 20 mM magnesium sulfate. This structure was rebuilt and refined as described above. Because of the lower resolution limit of these data, however, loose restraints to maintain noncrystallographic symmetry were applied.

The final models in all three crystal forms include residues 6-507, with the five amino-terminal residues and three carboxyl-terminal residues apparently disordered in all five independent copies. 91.8% of the residues lie in the most favored regions of the Ramachandran plot, and no residues are in disallowed regions (regions defined by PROCHECK (16)). Additional checks on hydrogen bonding geometry were performed using WHATCHECK (17). Data quality and refinement statistics are given in Table I. Figures were prepared with Molscript (18), Bobscript (19), Raster3D (20), PyMOL (21), and LIGPLOT (22).


View this table:
[in this window]
[in a new window]
  		TABLE I
Crystallographic statistics

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Expression and Enzymatic Activity of NV RdRP—The recombinantly expressed form of NV RdRP used in this work is identical in sequence to the mature form of the enzyme, as expected from studies of proteolytic processing in other NV isolates (23-25), except that serine replaces glycine at the second residue from the amino terminus. The RNA-dependent RNA polymerase activity associated with the purified recombinant protein was assayed using a synthetic RNA template derived from a cDNA of the 3' region of the genome of the Ast6139/01/Sp isolate including a poly(A) tail of 17 residues. The major product was about 2 kb in size, roughly twice the size of the RNA template used. The doubling in size relative to the template suggests a fold-back synthesis reaction similar to that seen previously in RHDV (26) and PV (27-29). Also, as seen in RdRPs from RHDV (30), PV (31), and many other viruses, the polymerase activity was dependent on the presence of divalent cations (in this case Mg2+) in the incubation medium.

Overall Structure of NV RdRP—The crystal structure of NV RdRP has been determined in three different crystal forms using the molecular replacement method starting with RHDV RdRP (7) as the search model. Although all three crystal forms were grown under similar conditions with polyethylene glycol 8000 as the precipitant, the molecular packing and space group symmetry differ significantly in the three crystal forms (Table I). Two crystal forms were grown in the absence of divalent metal ions, and the third crystal form was grown in the presence of 20 mM magnesium sulfate.

The overall structure of NV RdRP can be described using an analogy to a right hand, which is commonly done for a wide range of nucleic acid polymerases (Fig. 1). In addition to the fingers, palm, and thumb domains common to all polymerases, NV RdRP has an additional amino-terminal domain bridging the fingers and thumb domains, as seen in all other RdRPs of known three-dimensional structure (8). All residues are defined by electron density with the exception of residues 1-5 at the amino terminus and residues 508-510 at the carboxyl terminus. The carboxyl-terminal region is of particular importance, as discussed below, and it is significant to note that the last three residues are disordered in all three crystal forms.



View larger version (50K):
[in this window]
[in a new window]
  		FIG. 1.
Overall structure. Ribbon diagram showing front (A) and top (B) views of NV RdRP. The amino-terminal region is colored red, the fingers domain magenta, palm domain green and cyan, thumb domain blue, and carboxyl-terminal region yellow. The amino (N) and carboxyl (C) termini are marked. C, stereoview of C{alpha}-trace. D, stereoview of a least-squares superposition of C{alpha}-traces from NV (red) and RHDV (blue) RdRPs.

 
The availability of three crystal forms of NV RdRP reveals five independent copies in distinct crystal packing environments. The largest crystal contact interface in each of the three crystal forms is formed between the "top" faces (when viewed in the standard orientation facing the active site cleft, as in Fig. 1A) of molecules related by a crystallographic (C2221 and P212121 crystal forms) or noncrystallographic (P1 crystal form) 2-fold rotation axis. The buried surface areas of these interfaces are 1525, 1863, and 2187 Å2 for the P1, C2221, and P212121 crystal forms, respectively, indicating an extensive contact surface similar in size to functionally important oligomerization surfaces (32). A common feature of all three interfaces is a patch of hydrophobic residues consisting of Trp-29, Pro-421, Met-430, and Ile-431, residues fairly well conserved in the noroviruses but not well conserved in other caliciviruses. It is important to note that this hydrophobic patch and interface is not found in the RHDV RdRP crystal structure, and this interface differs from the oligomerization interfaces proposed to be of functional importance in HCV (33, 34) and PV (3, 35, 36) RdRPs. Although the functional importance of the resulting NV RdRP dimers is not clear from the structure, the location of this hydrophobic patch near the top of the active site cleft suggests that protein-protein interactions important for RNA binding or RNA synthesis may be mediated by this contact surface.

Structural Comparisons with RHDV RdRP and Conformational Variability—The overall fold of the RdRP enzymes from RHDV and NV is quite similar, although there are many regions of local structural variation. 393 C{alpha} atoms can be superimposed (3.8 Å cutoff) with a root mean squared difference of 1.7 Å (Fig. 1D). A structure-based sequence alignment identifies 118 amino acid residue identities or an overall sequence identity of 24% between the two proteins. The key motifs identified by a combination of sequence and structural analysis in RdRPs are well conserved in both the RHDV and NV structures, which is consistent with the importance of these regions in the structural stability and function of RdRPs (8).

Three copies of metal-free NV RdRP have been modeled and refined to 2.17 and 2.3 Å resolution in two different crystal forms. The root mean squared difference of 502 C{alpha} pairs between any two of these structures lies between 0.46 and 0.64 Å. In comparison, the two copies of the magnesium-bound form of the enzyme refined to 2.95 Å resolution yield root mean squared differences of between 0.64 and 0.90 Å when compared with the structures of the metal-free enzyme. The central core of the enzyme, consisting of the central portion of the palm domain and adjacent regions of the fingers and thumb domains, displays the smallest degree of conformational variability. Peripheral regions including the amino-terminal region, several loops in the fingers and palm domains, and portions of the thumb domain show the largest amount of conformational variability. Particularly notable is the conformational variability seen in residues 371-378 of the loop adjacent to the divalent metal cation binding sites. This loop likely lies along the path taken by NTPs and pyrophosphate ions entering and leaving the active site, and conformational variability in this region may be of functional importance. Conformational flexibility appears to be a common feature of many polymerases, and a large body of evidence supports the presence of multiple conformational states in RHDV (7) and HCV RdRPs (37-39), as well as less closely related DNA-dependent polymerases (40-43).

In both copies of magnesium-bound NV RdRP found in the asymmetric unit, a single magnesium ion is coordinated to one of the carboxylate oxygen atoms of Asp-344 and is near but not coordinated to the carboxylate group of Asp-242. This weak coordination scheme appears similar to that seen in the "open" metal-bound form of RHDV RdRP (7), as well as in the Ca2+-bound PV RdRP (3). It should be noted that this form is more similar to metal-free NV RdRP than the "closed" metal-bound form of RHDV RdRP, which adopts the conformation likely appropriate for facilitating the phosphoryl transfer reaction during RNA synthesis (7, 31). It is likely that the open metal-bound forms of NV and RHDV RdRPs represent well populated states of the enzyme when neither NTP nor RNA is bound. The enzyme conformations adopted in the presence of NTP and RNA await determination, but the structures are likely to be similar to the closed metal-bound conformation seen in RHDV RdRP.

Structure and Function of the Carboxyl-terminal Region—A particularly striking feature of the NV RdRP structures is the location of the carboxyl terminus in the active site cleft near the catalytic aspartic acid residues. This segment interacts mainly with the wall of the active site cleft formed by the thumb domain, is well exposed to solvent, and likely possesses conformational flexibility (Fig. 2A). The segment, extending from residue 501 to 507, is well defined by electron density but has higher temperature factors than most of the rest of the protein (Fig. 2B; Table I). In particular, residues 508-510 are not sufficiently well ordered to be modeled, although they likely contribute to some of the uninterpreted electron density in the active site cleft near the active site residues (results not shown).



View larger version (44K):
[in this window]
[in a new window]
  		FIG. 2.
A, carboxyl-terminal segment of NV RdRP LIGPLOT (22) diagram of hydrogen bonding (dashed green lines) and van der Waals interactions between residues 501-507 and other residues in the polymerase. B, stereoview of a sigma-A-weighted 2|Fo| -|Fc| electron density map (contoured at 1{sigma}) in the region of the carboxyl-terminal segment and adjacent regions.

 
Although structurally very different, the location of this carboxyl-terminal fragment in the active site cleft is reminiscent of the carboxyl-terminal extension domain and "plough" loop in bacteriophage {varphi}6 RdRP (44), as well as the carboxyl-terminal segment and {beta}-loop insertion in the thumb domain of HCV RdRP (4-6, 45, 46) (Fig. 3). In both the bacteriophage {varphi}6 and HCV RdRPs, short polypeptide segments occlude portions of the active site cleft and appear to stabilize short primers for the initiation of RNA synthesis (37, 47-51). It should be noted that the C termini of all crystallized forms of HCV RdRP are artificial truncations terminating the protein at different distances from the transmembrane segment following the polymerase domain, whereas the carboxyl terminus in the NV RdRP structure is the natural terminus predicted from polyprotein processing studies (23-25). Nevertheless, the structural similarities shared among NV, HCV, and bacteriophage {varphi}6 RdRPs suggest that the carboxyl-terminal segment in NV RdRP may also play a role in initiating RNA replication.



View larger version (83K):
[in this window]
[in a new window]
  		FIG. 3.
Carboxyl-terminal segments (yellow) of RdRPs from NV (A), HCV (Protein Data Bank code 1C2P [PDB] ) (B), and bacteriophage {varphi}6 (code 1HHS [PDB] ) (C) relative to the rest of the polymerase structure (surface representation). Also drawn are the loop insertions of HCV and bacteriophage {varphi}6 RdRPs (green). Note that the carboxyl terminus of HCV RdRP results from an artificial truncation of the mature transmembrane protein.

 
The location of the carboxyl-terminal sequence in the active site of NV RdRP appears to block the entry of an RNA primer-template duplex (Fig. 4). If the carboxyl-terminal segment containing residues 501-507 is removed from the NV polymerase structure, a segment of A-form RNA duplex can be modeled to fit into the active site cleft by superimposing the core of the palm domain of the human immunodeficiency virus-1 reverse transcriptase·TTP·DNA complex (52) onto corresponding parts of the NV polymerase structure (as reported previously for RHDV polymerase (7)). The presence of the carboxyl-terminal segment primarily interferes with the entry of the primer strand of an RNA duplex into the active site cleft, but it is well positioned to interact with short di- or trinucleotide primers or possibly with hairpin structures forming near the active site (Fig. 4B).



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 4.
Model of metal ion, NTP and RNA binding to NV RdRP constructed by comparison with the structure of the human immunodeficiency virus-1 reverse transcriptase·TTP·DNA ternary complex (52). "Front" (A) and "top" (B) stereoviews of the modeled complex. The carboxyl-terminal segment (residues 503-507) is drawn as a space-filling and ball-and-stick representation, respectively, in the two panels.

 
An alignment of the carboxyl-terminal sequences from Norovirus polymerases reveals a high degree of sequence conservation in the carboxyl-terminal region, indicating that a similar structure is found in both genogroups of noroviruses. A lower degree of sequence similarity in this region of RdRPs from other calicivirus genera, as well as the lack of structural similarity between the last 25 residues of the NV and RHDV polymerases, suggests that the structure of the carboxyl terminus differs in polymerases from these viruses.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The three-dimensional structure of NV RdRP reveals an overall architecture common to a wide range of RdRPs, as well as a unique structure in which the carboxyl terminus of the protein lies in the active site cleft. Although the structure of NV RdRP is the first to show the natural carboxyl terminus of a polymerase lying directly in the active site cleft, it is notable that the carboxyl-terminal sequence in the RHDV and PV RdRP crystal structures, as well as the predicted structures of RdRPs from many related caliciviruses and picornaviruses, lies near the front of the active site cleft. The location of the carboxyl-terminal segment in this region of the enzyme may allow this segment of the protein to play a role in the initiation of RNA synthesis even if the structural details of this region may vary in different viruses. The presence of 3 and 15 disordered residues at the carboxyl termini of the NV and RHDV RdRP crystal structures indicates that these residues may adopt a range of conformations in solution. Perhaps these residues only become well ordered when interacting with other components of the replication complex such as NTPs, RNA, and protein cofactors like the VPg protein (53).

To understand the role of the carboxyl-terminal sequence in RdRPs from different viruses, it may also be important to consider that differences in the proteolytic processing of the viral polyprotein precursor are also known to give rise to different forms of polymerases at different stages of the viral life cycle. Most notably, a proteinase-polymerase fusion appears to be the main form of active polymerase in vesiviruses (54) and may also be an important form of the polymerase in noroviruses (25) and lagoviruses. A similar proteinase-polymerase fusion with enzymatic activities that are distinct from the free forms of both the proteinase and polymerase is also found in the picornaviruses (55). Although the structure of this proteinase-polymerase fusion is not known, the presence of the proteinase domain is known to affect the enzymatic activity of the polymerase domain, and the carboxyl-terminal segment may also play a role in mediating this interaction. In the vesivirus feline calicivirus, for example, the presence of the proteinase domain in the fusion protein dramatically increases the activity of the polymerase (56). It would be of interest to test whether modifications to the carboxyl-terminal sequence in the RdRPs from feline calicivirus and other viruses affect the enzymatic activity of the proteinase-polymerase fusion protein by disrupting interactions between the proteinase and polymerase domains.

Further studies are needed to clarify the roles of carboxyl-terminal segments in RdRPs from caliciviruses and other positive-strand RNA viruses. Understanding the role of this carboxyl-terminal segment in viral replication will likely be important for the design of structure-based therapeutics against noroviruses and other positive-strand RNA viruses involved in human disease. For example, drug compounds that specifically disrupt interactions between the carboxyl-terminal segment and the active site cleft may interfere with viral replication and act as effective antiviral agents.


   FOOTNOTES
 
The atomic coordinates and structure factors (codes 1SH0 [PDB] , 1SH2 [PDB] , and 1SH3 [PDB] ) for the two crystal forms of metal-free polymerase as well as for the Mg2+-bound form have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).

* This research was supported by a senior research fellowship from the Canadian Institutes for Health Research as well as a Medical Scholar Award and Establishment Grant for medical research from the Alberta Heritage Foundation (to K. K.-S. N.). This work was also supported in part by Grants 01/0976 (to F. P.) and 01/3139 (to J. A. B.) from Fondo de Investigacín Sanitaria, Ministerio de Sanidad y Consumo, Spain. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ To whom correspondence should be addressed. Tel.: 403-220-4320; Fax: 403-289-9311; E-mail: ngk{at}ucalgary.ca.

1 The abbreviations used are: RdRP, RNA-dependent RNA polymerase; HCV, hepatitis C virus; PV, polio virus; RHDV, rabbit hemorrhagic disease virus; NV, Norwalk virus; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid. Back


   ACKNOWLEDGMENTS
 
We thank Isabelle Barrette-Ng for helpful discussions on the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Koopmans, M., and Duizer, E. (2004) Int. J. Food Microbiol. 90, 23-41[CrossRef][Medline] [Order article via Infotrieve]
  2. O'Reilly, E. K., and Kao, C. C. (1998) Virology 252, 287-303[CrossRef][Medline] [Order article via Infotrieve]
  3. Hansen, J. L., Long, A. M., and Schultz, S. C. (1997) Structure 5, 1109-1122[Medline] [Order article via Infotrieve]
  4. Ago, H., Adachi, T., Yoshida, A., Yamamoto, M., Habuka, N., Yatsunami, K., and Miyano, M. (1999) Structure Fold. Des. 7, 1417-1426[Medline] [Order article via Infotrieve]
  5. Bressanelli, S., Tomei, L., Roussel, A., Incitti, I., Vitale, R. L., Mathieu, M., De Francesco, R., and Rey, F. A. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 13034-13039[Abstract/Free Full Text]
  6. Lesburg, C. A., Cable, M. B., Ferrari, E., Hong, Z., Mannarino, A. F., and Weber, P. C. (1999) Nat. Struct. Biol. 6, 937-943[CrossRef][Medline] [Order article via Infotrieve]
  7. Ng, K. K., Cherney, M. M., Vazquez, A. L., Machin, A., Alonso, J. M., Parra, F., and James, M. N. (2002) J. Biol. Chem. 277, 1381-1387[Abstract/Free Full Text]
  8. Bruenn, J. A. (2003) Nucleic Acids Res. 31, 1821-1829[Abstract/Free Full Text]
  9. Otwinowski, Z., and Minor, W. (1997) Methods Enzymol. 276, 307-326
  10. Collaborative Computing Project No. 4 (1994) Acta Crystallogr. Sect. D Biol. Crystallogr. 50, 760-763[CrossRef][Medline] [Order article via Infotrieve]
  11. Read, R. J. (2001) Acta Crystallogr. Sect. D Biol. Crystallogr. 57, 1373-1382[CrossRef][Medline] [Order article via Infotrieve]
  12. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998) Acta Crystallogr. Sect. D Biol. Crystallogr. 54, 905-921[CrossRef][Medline] [Order article via Infotrieve]
  13. Terwilliger, T. C. (2001) Acta Crystallogr. Sect. D Biol. Crystallogr. 57, 1755-1762[CrossRef][Medline] [Order article via Infotrieve]
  14. McRee, D. E. (1999) J. Struct. Biol. 125, 156-165[CrossRef][Medline] [Order article via Infotrieve]
  15. Winn, M. D., Isupov, M. N., and Murshudov, G. N. (2001) Acta Crystallogr. Sect. D Biol. Crystallogr. 57, 122-133[CrossRef][Medline] [Order article via Infotrieve]
  16. Morris, A. L., MacArthur, M. W., Hutchinson, E. G., and Thornton, J. M. (1992) Proteins 12, 345-364[CrossRef][Medline] [Order article via Infotrieve]
  17. Hooft, R. W., Vriend, G., Sander, C., and Abola, E. E. (1996) Nature 381, 272[Medline] [Order article via Infotrieve]
  18. Kraulis, P. J. (1991) J. Appl. Crystallogr. 24, 946-950[CrossRef]
  19. Esnouf, R. M. (1997) J. Mol. Graph. Model. 15, 132-134[CrossRef][Medline] [Order article via Infotrieve]
  20. Merritt, E. A., and Bacon, M. (1997) Methods Enzymol. 277, 505-524[Medline] [Order article via Infotrieve]
  21. DeLano, W. L. (2002) PyMOL User's Manual, DeLano Scientific, San Carlos, CA
  22. Wallace, A. C., Laskowski, R. A., and Thornton, J. M. (1995) Protein Eng. 8, 127-134[Abstract/Free Full Text]
  23. Liu, B. L., Viljoen, G. J., Clarke, I. N., and Lambden, P. R. (1999) J. Gen. Virol. 80, 291-296[Abstract]
  24. Blakeney, S. J., Cahill, A., and Reilly, P. A. (2003) Virology 308, 216-224[CrossRef][Medline] [Order article via Infotrieve]
  25. Belliot, G., Sosnovtsev, S. V., Mitra, T., Hammer, C., Garfield, M., and Green, K. Y. (2003) J. Virol. 77, 10957-10974[Abstract/Free Full Text]
  26. López Vázquez, A., Martín Alonso, J. M., Casais, R., Boga, J. A., and Parra, F. (1998) J. Virol. 72, 2999-3004[Abstract/Free Full Text]
  27. Young, D. C., Tuschall, D. M., and Flanegan, J. B. (1985) J. Virol. 54, 256-264[Abstract/Free Full Text]
  28. Hey, T. D., Richards, O. C., and Ehrenfeld, E. (1986) J. Virol. 58, 790-796[Abstract/Free Full Text]
  29. Plotch, S. J., Palant, O., and Gluzman, Y. (1989) J. Virol. 63, 216-225[Abstract/Free Full Text]
  30. López Vázquez, A., Martín Alonso, J. M., and Parra, F. (2001) Arch. Virol. 146, 59-69[CrossRef][Medline] [Order article via Infotrieve]
  31. Cameron, C. E., Gohara, D. W., and Arnold, J. J. (2002) in Molecular Biology of Picornaviruses (Semler, B., and Wimmer, E., eds) pp. 255-267, ASM Press, Washington, D. C.
  32. Ponstingl, H., Henrick, K., and Thornton, J. M. (2000) Proteins 41, 47-57[CrossRef][Medline] [Order article via Infotrieve]
  33. Qin, W., Luo, H., Nomura, T., Hayashi, N., Yamashita, T., and Murakami, S. (2002) J. Biol. Chem. 277, 2132-2137[Abstract/Free Full Text]
  34. Wang, Q. M., Hockman, M. A., Staschke, K., Johnson, R. B., Case, K. A., Lu, J., Parsons, S., Zhang, F., Rathnachalam, R., Kirkegaard, K., and Colacino, J. M. (2002) J. Virol. 76, 3865-3872[Abstract/Free Full Text]
  35. Pata, J. D., Schultz, S. C., and Kirkegaard, K. (1995) RNA 1, 466-477[Abstract]
  36. Hobson, S. D., Rosenblum, E. S., Richards, O. C., Richmond, K., Kirkegaard, K., and Schultz, S. C. (2001) EMBO J. 20, 1153-1163[CrossRef][Medline] [Order article via Infotrieve]
  37. Ranjith-Kumar, C. T., Kim, Y. C., Gutshall, L., Silverman, C., Khandekar, S., Sarisky, R. T., and Kao, C. C. (2002) J. Virol. 76, 12513-12525[Abstract/Free Full Text]
  38. Bougie, I., Charpentier, S., and Bisaillon, M. (2003) J. Biol. Chem. 278, 3868-3875[Abstract/Free Full Text]
  39. Bougie, I., and Bisaillon, M. (2003) J. Biol. Chem. 278, 52471-52478[Abstract/Free Full Text]
  40. Li, Y., Korolev, S., and Waksman, G. (1998) EMBO J. 17, 7514-7525[CrossRef][Medline] [Order article via Infotrieve]
  41. Sarafianos, S. G., Das, K., Ding, J., Boyer, P. L., Hughes, S. H., and Arnold, E. (1999) Chem. Biol. 6, R137-146[CrossRef][Medline] [Order article via Infotrieve]
  42. Doublie, S., Sawaya, M. R., and Ellenberger, T. (1999) Structure Fold. Des. 7, R31-R35[Medline] [Order article via Infotrieve]
  43. Kensch, O., Restle, T., Wohrl, B. M., Goody, R. S., and Steinhoff, H. J. (2000) J. Mol. Biol. 301, 1029-1039[CrossRef][Medline] [Order article via Infotrieve]
  44. Butcher, S. J., Grimes, J. M., Makeyev, E. V., Bamford, D. H., and Stuart, D. I. (2001) Nature 410, 235-240[CrossRef][Medline] [Order article via Infotrieve]
  45. Adachi, T., Ago, H., Habuka, N., Okuda, K., Komatsu, M., Ikeda, S., and Yatsunami, K. (2002) Biochim. Biophys. Acta 1601, 38-48[Medline] [Order article via Infotrieve]
  46. Leveque, V. J., Johnson, R. B., Parsons, S., Ren, J., Xie, C., Zhang, F., and Wang, Q. M. (2003) J. Virol. 77, 9020-9028[Abstract/Free Full Text]
  47. Zhong, W., Ferrari, E., Lesburg, C. A., Maag, D., Ghosh, S. K., Cameron, C. E., Lau, J. Y., and Hong, Z. (2000) J. Virol. 74, 9134-9143[Abstract/Free Full Text]
  48. Hong, Z., Cameron, C. E., Walker, M. P., Castro, C., Yao, N., Lau, J. Y., and Zhong, W. (2001) Virology 285, 6-11[CrossRef][Medline] [Order article via Infotrieve]
  49. Laurila, M. R., Makeyev, E. V., and Bamford, D. H. (2002) J. Biol. Chem. 277, 17117-17124[Abstract/Free Full Text]
  50. O'Farrell, D., Trowbridge, R., Rowlands, D., and Jager, J. (2003) J. Mol. Biol. 326, 1025-1035[CrossRef][Medline] [Order article via Infotrieve]
  51. Ranjith-Kumar, C. T., Gutshall, L., Sarisky, R. T., and Kao, C. C. (2003) J. Mol. Biol. 330, 675-685[CrossRef][Medline] [Order article via Infotrieve]
  52. Huang, H., Chopra, R., Verdine, G. L., and Harrison, S. C. (1998) Science 282, 1669-1675[Abstract/Free Full Text]
  53. Machín, A., Martín Alonso, J. M., and Parra, F. (2001) J. Biol. Chem. 276, 27787-27792[Abstract/Free Full Text]
  54. Green, K. Y., Mory, A., Fogg, M. H., Weisberg, A., Belliot, G., Wagner, M., Mitra, T., Ehrenfeld, E., Cameron, C. E., and Sosnovtsev, S. V. (2002) J. Virol. 76, 8582-8595[Abstract/Free Full Text]
  55. Harris, K. S., Reddigari, S. R., Nicklin, M. J., Hammerle, T., and Wimmer, E. (1992) J. Virol. 66, 7481-7489[Abstract/Free Full Text]
  56. Wei, L., Huhn, J. S., Mory, A., Pathak, H. B., Sosnovtsev, S. V., Green, K. Y., and Cameron, C. E. (2001) J. Virol. 75, 1211-1219[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Gen. Virol.Home page
M. Hogbom, K. Jager, I. Robel, T. Unge, and J. Rohayem
The active form of the norovirus RNA-dependent RNA polymerase is a homodimer with cooperative activity
J. Gen. Virol., February 1, 2009; 90(2): 281 - 291.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. M. Poranen, P. S. Salgado, M. R. L. Koivunen, S. Wright, D. H. Bamford, D. I. Stuart, and J. M. Grimes
Structural explanation for the role of Mn2+ in the activity of {phi}6 RNA-dependent RNA polymerase
Nucleic Acids Res., November 1, 2008; 36(20): 6633 - 6644.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M. Hass, M. Lelke, C. Busch, B. Becker-Ziaja, and S. Gunther
Mutational Evidence for a Structural Model of the Lassa Virus RNA Polymerase Domain and Identification of Two Residues, Gly1394 and Asp1395, That Are Critical for Transcription but Not Replication of the Genome
J. Virol., October 15, 2008; 82(20): 10207 - 10217.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. F. Zamyatkin, F. Parra, J. M. M. Alonso, D. A. Harki, B. R. Peterson, P. Grochulski, and K. K.-S. Ng
Structural Insights into Mechanisms of Catalysis and Inhibition in Norwalk Virus Polymerase
J. Biol. Chem., March 21, 2008; 283(12): 7705 - 7712.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
D. Garriga, A. Navarro, J. Querol-Audi, F. Abaitua, J. F. Rodriguez, and N. Verdaguer
Activation mechanism of a noncanonical RNA-dependent RNA polymerase
PNAS, December 18, 2007; 104(51): 20540 - 20545.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
N. Beerens, B. Selisko, S. Ricagno, I. Imbert, L. van der Zanden, E. J. Snijder, and B. Canard
De Novo Initiation of RNA Synthesis by the Arterivirus RNA-Dependent RNA Polymerase
J. Virol., August 15, 2007; 81(16): 8384 - 8395.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
T. L. Yap, T. Xu, Y.-L. Chen, H. Malet, M.-P. Egloff, B. Canard, S. G. Vasudevan, and J. Lescar
Crystal Structure of the Dengue Virus RNA-Dependent RNA Polymerase Catalytic Domain at 1.85-Angstrom Resolution
J. Virol., May 1, 2007; 81(9): 4753 - 4765.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. Pan, V. N. Vakharia, and Y. J. Tao
The structure of a birnavirus polymerase reveals a distinct active site topology
PNAS, May 1, 2007; 104(18): 7385 - 7390.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Kemp, B. Bae, J. P. Yu, M. Ghosh, M. Leffak, and S. K. Nair
Structure and Function of the c-myc DNA-unwinding Element-binding Protein DUE-B
J. Biol. Chem., April 6, 2007; 282(14): 10441 - 10448.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
S. W. B. Fullerton, M. Blaschke, B. Coutard, J. Gebhardt, A. Gorbalenya, B. Canard, P. A. Tucker, and J. Rohayem
Structural and Functional Characterization of Sapovirus RNA-Dependent RNA Polymerase
J. Virol., February 15, 2007; 81(4): 1858 - 1871.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
C. E. Zeitler, M. K. Estes, and B. V. Venkataram Prasad
X-ray crystallographic structure of the norwalk virus protease at 1.5-a resolution.
J. Virol., May 1, 2006; 80(10): 5050 - 5058.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Kukolj, G. A. McGibbon, G. McKercher, M. Marquis, S. Lefebvre, L. Thauvette, J. Gauthier, S. Goulet, M.-A. Poupart, and P. L. Beaulieu
Binding Site Characterization and Resistance to a Class of Non-nucleoside Inhibitors of the Hepatitis C Virus NS5B Polymerase
J. Biol. Chem., November 25, 2005; 280(47): 39260 - 39267.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. J. Arnold, M. Vignuzzi, J. K. Stone, R. Andino, and C. E. Cameron
Remote Site Control of an Active Site Fidelity Checkpoint in a Viral RNA-dependent RNA Polymerase
J. Biol. Chem., July 8, 2005; 280(27): 25706 - 25716.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
G. Belliot, S. V. Sosnovtsev, K.-O. Chang, V. Babu, U. Uche, J. J. Arnold, C. E. Cameron, and K. Y. Green
Norovirus Proteinase-Polymerase and Polymerase Are Both Active Forms of RNA-Dependent RNA Polymerase
J. Virol., February 15, 2005; 79(4): 2393 - 2403.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
T. C. Appleby, H. Luecke, J. H. Shim, J. Z. Wu, I. W. Cheney, W. Zhong, L. Vogeley, Z. Hong, and N. Yao
Crystal Structure of Complete Rhinovirus RNA Polymerase Suggests Front Loading of Protein Primer
J. Virol., January 1, 2005; 79(1): 277 - 288.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Ferrer-Orta, A. Arias, R. Perez-Luque, C. Escarmis, E. Domingo, and N. Verdaguer
Structure of Foot-and-Mouth Disease Virus RNA-dependent RNA Polymerase and Its Complex with a Template-Primer RNA
J. Biol. Chem., November 5, 2004; 279(45): 47212 - 47221.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/16/16638    most recent
M400584200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ng, K. K.-S.
Right arrow Articles by Parra, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ng, K. K.-S.
Right arrow Articles by Parra, F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement