JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M313927200 on January 26, 2004

J. Biol. Chem., Vol. 279, Issue 17, 17634-17639, April 23, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/17/17634    most recent
M313927200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hama, K.
Right arrow Articles by Arai, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hama, K.
Right arrow Articles by Arai, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Lysophosphatidic Acid and Autotaxin Stimulate Cell Motility of Neoplastic and Non-neoplastic Cells through LPA1*

Kotaro Hama{ddagger}, Junken Aoki{ddagger}§, Masahiro Fukaya¶, Yasuhiro Kishi{ddagger}, Teruyuki Sakai||, Rika Suzuki||, Hideo Ohta||, Takao Yamori**, Masahiko Watanabe¶, Jerold Chun{ddagger}{ddagger}, and Hiroyuki Arai{ddagger}

From the {ddagger}Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo 113-0033, Japan, the Department of Anatomy, Hokkaido University School of Medicine, Sapporo 060-8638, Japan, the ||Pharmaceutical Research Laboratory, Kirin Brewery Company Ltd., 3 Miyahara, Takasaki, Gunma 370-1295, Japan, the **Division of Molecular Pharmacology, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Toshima-ku, Tokyo 170-8455, Japan, and the {ddagger}{ddagger}Department of Molecular Biology, The Scripps Research Institute, La Jolla, California 92037

Received for publication, December 19, 2003 , and in revised form, January 20, 2004.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Autotaxin (ATX) is a tumor cell motility-stimulating factor originally isolated from melanoma cell supernatant that has been implicated in regulation of invasive and metastatic properties of cancer cells. Recently, we showed that ATX is identical to lysophospholipase D, which converts lysophosphatidylcholine to a potent bioactive phospholipid mediator, lysophosphatidic acid (LPA), raising the possibility that autocrine or paracrine production of LPA by ATX contributes to tumor cell motility. Here we demonstrate that LPA and ATX mediate cell motility-stimulating activity through the LPA receptor, LPA1. In fibroblasts isolated from lpa1-/- mice, but not from wild-type or lpa2-/-, cell motility stimulated with LPA and ATX was completely absent. In the lpa1-/- cells, LPA-stimulated lamellipodia formation was markedly diminished with a concomitant decrease in Rac1 activation. LPA stimulated the motility of multiple human cancer cell lines expressing LPA1, and the motility was attenuated by an LPA1-selective antagonist, Ki16425. The present study suggests that ATX and LPA1 represent potential targets for cancer therapy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell migration is an important cellular function for many physiological processes, such as embryonic morphogenesis, wound healing, immune-cell trafficking, and brain development (1). In addition to physiological functions, cancer cells use migration mechanisms that are similar to those that occur in non-neoplastic cells (2). The principles of cell migration were initially investigated in non-neoplastic fibroblasts, keratinocytes, and myoblasts, and additional studies on tumor cells identified the same basic mechanisms. Understanding more about the cellular and molecular basis of different cell migration/invasion mechanisms will help us to explain how cancer cells disseminate and should lead to new treatment strategies.

Lysophosphatidic acid (LPA)1 (1- or 2-acyl-sn-glycerol-3-phosphate) is a naturally occurring phospholipid. It evokes a variety of biological responses, including platelet aggregation, smooth-muscle contraction, neurite retraction, and cell proliferation (3, 4). LPA stimulates cell migration in many cell types in vitro, including fibroblasts, gliomas, T lymphomas, and colorectal cancer cells (57), indicating a potential role of LPA in cellular migration in both physiological and pathological conditions (8). A role for LPA signaling in cancer cell migration received further support from the identification of autotaxin (ATX), a protein previously implicated in neoplastic invasion and metastasis (9), as a major biosynthetic enzyme for LPA. ATX was found to be identical to lysophospholipase D, an LPA-producing enzyme in blood that converts lysophosphatidylcholine to LPA (10, 11). ATX also shows properties of a nucleotide pyrophosphatase/phosphodiesterase, which might also explain its bioactivities. It has been shown that LPA- and ATX-stimulated cell motility is attenuated by treating cells with pertussis toxin (PTX) (8, 1213), suggesting that G protein-coupled receptors (GPCRs) coupled with Gi/o are involved. LPA elicits most of the cellular events via signal transduction cascades downstream of its specific GPCRs, LPA1/Edg-2, LPA2/Edg-4, LPA3/Edg-7, which belong to the Edg (endothelial cell differentiation gene) family, and LPA4/GPR23, a non-Edg family LPA receptor (4, 1417). Non-GPCR pathways have also been proposed (18, 19). Several experiments have demonstrated that these GPCRs can mediate mitogen-activated protein kinase activation, phospholipase C activation, and calcium mobilization through PTX-sensitive (Gi/o) and -insensitive G proteins (G12/13 and Gq/11/14) (4). However, the LPA receptor subtype involved in LPA-induced cell motility remained to be identified.

In this study, we explored the role of each LPA receptor in LPA- and ATX-induced cell migration. Our results clearly indicate that LPA- and ATX-induced cell motility is driven by LPA1 activation. We also suggest a crucial role of Rac1 activation in LPA1-mediated cell migration.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents—1-oleoyl-LPA (18:1) was purchased from Avanti Polar Lipids Inc. (Alabaster, AL). Other chemicals were purchased from Sigma. Recombinant ATX/lysophospholipase D protein was prepared as described previously (10).

Cell Culture—Mouse skin fibroblast (MSF) cells were prepared from skin of newborn mice generated by wild-type or knock-out (lpa1-/- single, lpa2-/- single, and lpa1-/-lpa2-/- double) intercrosses as described previously (20). MSF cells were cultured in minimum essential medium (Sigma) supplemented with 10% fetal bovine serum, and cells from the first to the fifth passages were used for all experiments. All cancer cell lines used in this study were cultured in RPMI 1640 (Sigma) supplemented with 5% fetal bovine serum as described previously (21).

Chemotaxis Assay—Cell migration was measured in a modified Boyden chamber as described previously (10). In brief, polycarbonate filters with 5-µm (MSF cells) or 8-µm pores (carcinoma cell lines) (Neuro Probe, Inc., Gaithersburg, MD) were coated with 0.001% of fibronectin (Sigma). Cells (1 x 105 cells in 200 µl/well) were loaded into upper chambers and incubated at 37 °C for 3 h to allow migration. The cell migration to the bottom side of the filter was evaluated by measuring optical densities at 590 nm. For PTX and Ki16425 treatment, cells were preincubated with 10 ng ml-1 of PTX for 24 h and 1 µM Ki16425 for 30 min, respectively.

Quantitative Real-time RT-PCR—Total RNA from cells was extracted using ISOGEN (Nippongene, Toyama, Japan) and reverse-transcribed using the SuperScript first-strand synthesis system for RT-PCR (Invitrogen). Oligonucleotide primers for PCR were designed using Primer Express Software (Applied Biosystems, Foster City, CA). The sequences of the oligonucleotides used in PCR reaction were as follows. LPA1 (mouse)-forward gaggaatcgggacaccatgat; LPA1 (mouse)-reverse acatccagcaataacaagaccaatc; LPA1 (human)-forward aatcgggataccatgatgagtctt; LPA1 (human)-reverse ccaggagtccagcagatgataaa; LPA2 (mouse)-forward gaccacactcagcctagtcaagac; LPA2 (mouse)-reverse cttacagtccaggccatcca; LPA2 (human)-forward cgctcagcctggtcaagact; LPA2 (human)-reverse ttgcaggactcacagcctaaac; LPA3 (mouse)-forward gctcccatgaagctaatgaagaca; LPA3 (mouse)-reverse aggccgtccagcagcaga; LPA3 (human)-forward aggacacccatgaagctaatgaa; LPA3 (human)-reverse gccgtcgaggagcagaac. LPA4 (mouse)-forward cagtgcctccctgtttgtcttc; LPA4 (mouse)-reverse gagagggccaggttggtgat. LPA4 (human)-forward cctagtcctcagtggcggtatt; LPA4 (human)-reverse ccttcaaagcaggtggtggtt. GAPDH (mouse/human)-forward gccaaggtcatccatgacaact; GAPDH (mouse/human)-reverse gaggggccatccacagtctt. PCR reactions were performed using an ABI Prism 7000 sequence detection system (Applied Biosystems). The transcript number of mouse GAPDH was quantified, and each sample was normalized on the basis of GAPDH content.

Intracellular Calcium Mobilization—A-2058 cells were incubated with 5 µM fura-2 acetoxymethyl ester (Dojin, Tokyo, Japan) in calcium ringer buffer (150 mM NaCl, 4 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 5.6 mM glucose, 0.1% bovine serum albumin, and 5 mM HEPES, pH 7.4) at 37 °C for 30 min. Following stimulation with LPA, cytosolic calcium was measured by monitoring fluorescence intensity at an emission wavelength of 500 nm and excitation wavelengths of 340 and 380 nm using a CAF-110 (JACS, Tokyo, Japan).

Fluorescence Microscopy—MSF cells were seeded onto glass coverslips, grown in the presence of serum to subconfluence, and starved for 24 h by replacing the medium with serum-free medium containing 0.1% bovine serum albumin. Then the cells were treated with 1 µM LPA in serum-free medium for 3 h and stained for F-actin with BODIPY FL phallacidin (Molecular Probes, Inc., Eugene, OR) according to the manufacture's protocol.

Rac1 and RhoA Activity Assays—Measurement of Rac1 and RhoA activities was performed as described previously (22). Cells starved for 24 h were stimulated with LPA (1 µM) and lysed for 5 min in ice-cold cell lysis buffer containing GST-{alpha}PAK or GST-Rhotekin. The cell lysates were incubated with glutathione-Sepharose 4B (Amersham Biosciences) for 60 min at 4 °C. After the beads had been washed with the cell lysis buffer, the bound proteins were analyzed by Western blotting using anti-Rac1 antibody (BD Biosciences) or anti-RhoA antibody (Santa Cruz Biotechnology).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
To determine whether LPA receptors are required for LPA-dependent cell motility and, if so, which receptor subtype and signaling cascade are utilized, we generated MSF cells isolated from newborn mice. The MSF cells expressed LPA1, LPA2, and LPA4 with an undetectable level of LPA3 as judged by quantitative real-time RT-PCR (Fig. 1B). In the Boyden chamber assay, MSF cells migrated in response to LPA and the response was PTX-sensitive (Fig. 1A). We therefore examined LPA-induced cell motility in MSF cells isolated from previously established LPA receptor knock-out mice (20, 23). The migratory response was completely abolished in MSF cells isolated from lpa1-/- mice (Fig. 2A). MSF cells from lpa2-/- mice migrated normally in response to LPA (Fig. 2A). The lpa1-/- MSF cells migrated normally in response to platelet-derived growth factor, a potent inducer of migration for fibroblasts (Fig. 2B), indicating that the lpa1-/- cells have defects in their response to LPA but not migration per se. We also found that ATX stimulated the migration of MSF cells (Fig. 3) in a PTX-sensitive manner (data not shown). The migratory response induced by ATX also disappeared in MSF cells from lpa1-/- mice but not from wild-type or lpa2-/- mice (Fig. 3). These data demonstrated that of the three LPA receptors expressed in the MSF cells, LPA1 is at least essential for LPA-stimulated cell migration. They also show that the motility effects of ATX are mediated by LPA signaling.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1.
LPA induces PTX-sensitive cell motility in mouse skin fibroblasts. A, LPA stimulates cell motility of MSF cells in a PTX-sensitive manner. MSF cells were pretreated with PTX (100 ng ml-1, 24 h), and LPA-induced cell motility was evaluated using the Boyden chamber assay. B, expression of each LPA receptor mRNA in MSF cells. The level of LPA receptor mRNA in MSF cells was measured using quantitative real-time RT-PCR and is expressed as a relative value to GAPDH mRNA.

 



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2.
LPA1 is essential for LPA-induced cell motility in mouse skin fibroblasts. LPA-induced (A) and platelet-derived growth factor-induced (B) migration of MSF cells isolated from lpa1-/- (filled circles), lpa2-/- (open circles), and wild-type (open triangles) mice. Results shown are representative of at least three independent experiments. Error bars indicate the S.D. of the mean.

 



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 3.
LPA1 is essential for ATX-induced cell motility in mouse skin fibroblasts. ATX-induced migration of MSF cells isolated from lpa1-/- (filled circles), lpa2-/- (open circles), and wild-type (open triangles) mice. Results shown are representative of at least three independent experiments. Error bars indicate the S.D. of the mean.

 
We next examined whether LPA1 is involved in LPA- or ATX-induced cell motility of carcinoma cells by using various carcinoma cell lines that differentially express LPA receptors. LPA stimulated cell migration of multiple carcinoma cell lines, including MDA-MB-231 (breast cancer), PC-3 (prostate cancer), A-2058 (melanoma), A549 (lung cancer), ACHN (renal cancer), SF295 (glioblastoma), and SF539 (glioblastoma) (Fig. 4). Interestingly, these cells were found to express LPA1 endogenously as judged by quantitative real-time RT-PCR (Fig. 4). LPA did not support the migration of MCF7 (breast cancer), HT-29 (colorectal cancer), KM-12 (colorectal cancer), OVCAR-4 (ovarian cancer), OVCAR-8 (ovarian cancer), NCI-H522 (lung cancer), LNCaP (prostate cancer), and HeLa (cervical cancer) cells, and these cells did not appreciably express LPA1 (Fig. 4). There was no obvious correlation between LPA-induced cell motility and expression of the three other LPA receptors, LPA2, LPA3, or LPA4 (Fig. 4). ATX also induced migratory effects in LPA1-expressing cells (Fig. 5) but not in cells that did not express LPA1 (data not shown). Recently, an LPA1-selective antagonist, Ki16425, (Ki values were 0.25 µM for LPA1, 5.60 µM for LPA2, and 0.36 µM for LPA3) were developed (24). It has not been tested whether Ki16425 affects the activation of LPA4. We then monitored intracellular calcium mobilization in HeLa cells transiently transfected with human and mouse LPA4 cDNA and found that it was not inhibited by 1 µM Ki16425 (data not shown). Ki16425 inhibited the migratory response of LPA1-expressing cells to both LPA and ATX (Figs. 4 and 5). Because Ki16425 is also a weak antagonist for LPA3, it is possible that LPA3 could be involved in the LPA- or ATX-stimulated cell motility of LPA3-expressing cells. However, carcinoma cell lines expressing LPA3 but not LPA1 (OVCAR-8 and LNCaP) did not migrate in response to LPA (Fig. 4). In addition, OMPT, an LPA3-selective agonist we recently developed (25), induced a smaller migratory response in A-2058 cells that express both LPA1 and LPA3, although LPA stimulated migration effectively (Fig. 6A). OMPT did activate intracellular calcium mobilization more effectively than LPA (Fig. 6B), indicating that OMPT activates LPA3 in A-2058 cells. These results argue against the possibility that LPA3 mediates LPA- or ATX-induced cell motility-stimulating activity. Thus, it can be concluded that LPA and ATX stimulate cell motility through LPA1 but not through other LPA receptors, at least for the range of neoplastic cells examined here.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 4.
LPA1 is involved in LPA-induced cell motility in multiple carcinoma cell lines. In each cell line, the upper panel shows migratory response to LPA either in the absence (open circles) or presence (filled circles) of an LPA1-selective antagonist, Ki16425 (1 µM), evaluated by the Boyden chamber assay. The lower panel shows expression of each LPA receptor mRNA (lpa1, lpa2, lpa3, and lpa4) measured using quantitative real-time RT-PCR. The LPA-induced migratory responses appear to be parallel with the expression of LPA1.

 



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 5.
Ki16425 inhibits ATX-induced cell motility of carcinoma cell-expressing LPA1. ATX stimulates cell motility of three LPA1-expressing carcinoma cell lines (MDA-MB-231, PC-3, and A-2058), and the motility is suppressed by an LPA1-selective antagonist, Ki16425.

 



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 6.
LPA3 is not involved in LPA-induced cell motility. A, OMPT did not stimulate cell motility of LPA3-expressing cell, A-2058. B, OMPT induced an intracellular calcium mobilization of the cells more efficiently than LPA.

 
It is generally accepted that locomotion in cellular migration involves reorganization of the actin cytoskeleton as is observed in lamellipodia and stress fiber formation (26, 27). LPA signaling stimulates cytoskeletal reorganization in various cell types through activation of Rho GTPases. However, the molecular mechanisms underlined, particularly at receptor level, remained to be solved. We recently showed that LPA-induced stress fiber formation in mouse embryonic meningeal fibroblast cells (MEMFs) requires either LPA1 or LPA2 activation, based on the observation that it was severely affected in MEMFs from lpa1-/-lpa2-/- mice but not in MEMFs from wild-type, lpa1-/-, and lpa2-/- mice (20). In the present study, we tried to confirm the same effect in MSF cells derived from each LPA receptor knock-out mouse. However, we could not evaluate this in the MSF cells because abundant stress fibers were formed even in the absence of LPA. By contrast, we found that LPA-induced lamellipodia formation in MSF cells requires only LPA1 expression. In wild-type and lpa2-/- cells, LPA increased the number of cells with ruffling membranes (lamellipodia formation). In contrast, LPA did not affect the lamellipodia formation in lpa1-/- and lpa1-/-lpa2-/- MSF cells (Fig. 7, A and B).



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 7.
LPA induces lamellipodia formation through LPA1. A, fluorescence microscopy of BODIPY FL phallacidin-stained MSF cells from wild-type, lpa1-/-, and lpa2-/- mice before (upper panels) or after (lower panels) LPA stimulation (1 µM, 3 h). The lamellipodia formation (arrows) was observed in wild-type and lpa2-/- MSF cells but rarely observed in lpa1-/- MSF cells. Bar, 20 µm. B, percentage of wild-type, lpa1-/-, lpa2-/-, and lpa1-/-lpa2-/- MSF cells with lamellipodia after stimulation with 1 µM LPA.

 
The molecular control of actin filament assembly is dependent on the Rho family of small GTPases, particularly RhoA, Rac1, and Cdc42 (28). Rac1 regulates lamellipodia, whereas RhoA regulates the formation of contractile actin-myosin filaments to form stress fibers (28). LPA-stimulated migration of MSF cells was efficiently blocked by pretreatment of the cells with Y-27632 (data not shown), an inhibitor of Rho kinase that inactivates the RhoA pathway. We therefore measured the LPA-induced activation of the two small GTPases, Rac1 and RhoA, in MSF cells. Rac1 and RhoA were measured with GST-PAK and GST-Rhotekin pull-down assays, respectively. When MSF cells from wild-type and lpa2-/- mice were stimulated with 1 µM LPA, a GTP-bound form of Rac1 was dramatically increased (Fig. 8). By contrast, Rac1 activation was almost completely abolished in both lpa1-/- and lpa1-/-lpa2-/- MSF cells (Fig. 8). Although RhoA activation in response to LPA was obvious in wild-type and lpa2-/- MSF cells, it appeared to be reduced in lpa1-/- MSF cells and markedly reduced in lpa1-/--lpa2-/- MSF cells (Fig. 8). These results indicate that LPA1 has a major role in both Rac1 and RhoA activation induced by LPA stimulation (Fig. 9). The Rac1 activation is predominantly dependent on LPA1, whereas RhoA activation is less dependent on LPA1. LPA2 does contribute to the activation of RhoA in the absence of LPA1 expression. In addition, RhoA can be activated to some extent (Fig. 8) in the absence of LPA1 and LPA2, indicating the presence of other LPA receptors and/or indirect mechanisms of RhoA activation (Fig. 9).



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 8.
LPA-induced activation of Rac1 and RhoA in MSF cells. MSF cells were serum-starved for 24 h and stimulated with 1 µM LPA. Activated RhoA and Rac1 were isolated using GST-PAK (Rac1, upper panel) or GST-Rhotekin (RhoA, lower panel) coupled to glutathione-Sepharose beads. Rac1 and RhoA bound to the beads were detected by Western blotting using specific antibodies.

 



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 9.
Model for LPA- or ATX-induced cell motility. ATX activates Rac1 and RhoA through Gi and G12/13, respectively, by producing LPA. The activation of Rac1 and RhoA results in membrane ruffling and stress fiber formation, which finally lead to activation of cell motility. The Rac1 activation is predominantly dependent on LPA, whereas RhoA activation is induced by either LPA1 or LPA2 activation. LPA1- and LPA2-independent pathways also contribute partially to RhoA activation.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
LPA is a multifunctional signaling molecule with diverse activities, including stimulation of cell motility. Recent identification of lysophospholipase D, an LPA-producing enzyme, as ATX, a cell-motility stimulating factor of cancer cells (10, 11), indicated that the activity is one of the intrinsic functions of LPA. In this study we showed that among the four LPA receptors identified so far, LPA1 has a crucial role in LPA-induced cell migration of fibroblast cells (Fig. 2) and multiple cancer cells (Fig. 4), based on the observation that inactivation of LPA1 either by gene-targeting technique or by a receptor-selective antagonist resulted in loss of migratory response. In addition, we observed that the migratory response induced by ATX again disappeared in these cells (Figs. 3 and 5). These results clearly show that ATX exerts its function through LPA production and the following LPA1 activation. Both LPA1 and ATX are highly expressed in brain (14, 29). Recently it was reported that oligodendrocytes express LPA1 and ATX during myelination (30, 31). We also found that LPA1 and ATX are highly enriched within certain regions of developing mouse brain, such as olfactory bulb.2 The colocalization of the two genes suggests that they also function co-operatively in physiological condition.

The migratory responses were found to be PTX-sensitive (Fig. 1A). By contrast, in a previous report LPA was found to stimulate cell motility of other cell types, such as lymphoma cells, in a PTX-insensitive manner (6). Because lymphocytes express LPA2 predominantly with no detectable expression of LPA1 (data not shown), it is possible that LPA2 is involved in LPA-induced migratory response of non-carcinoma neoplasms, such as lymphoma cells. Splenocytes and thymocytes isolated from wild-type, lpa1-/-, lpa2-/-, and lpa1-/-lpa2-/- mice did not show a migratory response to LPA in our system (data not shown). In addition, in the absence of selective agonists or antagonists for LPA2, we could not test the migratory effect of LPA2 on lymphoma cell migration. Further study is necessary to show the role of LPA2 in migratory response of lymphoma cells.

We previously showed that LPA1 and LPA2 had redundant functions in mediating multiple endogenous LPA responses, including phospholipase C activation, Ca2+ mobilization, cell proliferation, and stress fiber formation in mouse embryonic fibroblasts (20). In this study, we demonstrated that LPA-induced lamellipodia formation was severely affected in lpa1-/- MSF cells (Fig. 7, A and B). In addition, we showed that LPA activates Rac1 in an LPA1-dependent manner, whereas it activates RhoA either in LPA1-, LPA2-dependent or LPA1-, LPA2-independent pathway (Fig. 8). Thus, LPA1 is able to activate both Rac1 and RhoA regardless of LPA2 expression (Fig. 9). Because the activation of both RhoA and Rac1 is essential for LPA-stimulated cell migration (12), the lack of Rac1 activation in lpa1-/- MSF cells explains why the cells could not migrate in response to LPA. Many reports have shown that Gi/o and G12/13 regulate the activation of Rac1 and RhoA, respectively (12, 32). Thus, our results again suggest that LPA1 couples with both Gi/o and G12/13, whereas LPA2 mainly couples with G12/13 as we indicated previously using cells transfected with each LPA receptor (Fig. 9) (20, 33). van Leeuwen et al. (12) recently showed that LPA1, when overexpressed in B103 neuroblastoma cells, mediates LPA-induced cell migration through concomitant activation of Rac1. However, the role of other LPA receptors in cell motility remained to be solved, which we did in this study (Figs. 2 and 8). We showed that multiple carcinoma cells utilize the same mechanism for their LPA-induced cell motility (Fig. 4). It is well accepted that cell motility is closely linked to the metastatic and invasive potential of cancer cells. In addition, the activating pathways of both Rac1 and RhoA were also implicated in tumor invasion and metastasis (34, 35). Furthermore, there is accumulating evidence that elevated expression of ATX is observed in various cancer tissues (36, 37) and that the expression is closely linked to the invasive and metastatic potency of cancer cells (38). We therefore propose that both ATX and LPA1 are the potential targets for cancer therapy.


    FOOTNOTES
 
* This work was supported in part by research grants from the Ministry of Education, Culture, Sports, Science, and Technology and the Human Frontier Special Program. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ To whom correspondence should be addressed. Tel.: 81-3-5842-4723; Fax: 81-3-3818-3173; E-mail: jaoki{at}mol.f.u-tokyo.ac.jp.

1 The abbreviations used are: LPA, lysophosphatidic acid; ATX, autotaxin; OMPT, 1-oleoyl-2-O-methyl-rac-glycerophosphothionate; PTX, pertussis toxin; MSF, mouse skin fibroblast; GAPDH, glyceraldehydephosphate dehydrogenase; Edg, endothelial cell differentiation gene; GST, glutathione S-transferase. Back

2 M. Fukaya, M. Watanabe, J. Aoki, and H. Arai, unpublished result. Back


    ACKNOWLEDGMENTS
 
We thank Dr. M. Negishi (Kyoto University) for advice on GST-pull-down assay and for the gift of GST-PAK and GST-RBD constructs and Drs. S. Ishii and T. Shimizu (University of Tokyo) for the generous gift of LPA4 cDNA.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Singer, S. J., and Kupfer, A. (1986) Annu. Rev. Cell Biol. 2, 337-365[CrossRef][Medline] [Order article via Infotrieve]
  2. Friedl, P., and Wolf, K. (2003) Nat. Rev. Cancer 3, 362-374[CrossRef][Medline] [Order article via Infotrieve]
  3. Moolenaar, W. H. (1999) Exp. Cell Res. 253, 230-238[CrossRef][Medline] [Order article via Infotrieve]
  4. Contos, J. J., Ishii, I., and Chun, J. (2000) Mol. Pharmacol. 58, 1188-1196[Medline] [Order article via Infotrieve]
  5. Manning, T. J., Parker, J. C., and Sontheimer, H. (2000) Cell Motil. Cytoskeleton 45, 185-199[CrossRef][Medline] [Order article via Infotrieve]
  6. Stam, J. C., Michiels, F., van der Kammen, R. A., Moolenaar, W. H., and Collard, J. G. (1998) EMBO J. 17, 4066-4074[CrossRef][Medline] [Order article via Infotrieve]
  7. Shida, D., Kitayama, J., Yamaguchi, H., Okaji, Y., Tsuno, N. H., Watanabe, T., Takuwa, Y., and Nagawa, H. (2003) Cancer Res. 63, 1706-1711[Abstract/Free Full Text]
  8. Mills, G. B., and Moolenaar, W. H. (2003) Nat. Rev. Cancer 3, 582-591[CrossRef][Medline] [Order article via Infotrieve]
  9. Stracke, M. L., Clair, T., and Liotta, L. A. (1997) Adv. Enzyme Regul. 37, 135-144[CrossRef][Medline] [Order article via Infotrieve]
  10. Umezu, G. M., Kishi, Y., Taira, A., Hama, K., Dohmae, N., Takio, K., Yamori, T., Mills, G. B., Inoue, K., Aoki, J., and Arai, H. (2002) J. Cell Biol. 158, 227-233[Abstract/Free Full Text]
  11. Tokumura, A., Majima, E., Kariya, Y., Tominaga, K., Kogure, K., Yasuda, K., and Fukuzawa, K. (2002) J. Biol. Chem. 277, 39436-39442[Abstract/Free Full Text]
  12. van Leeuwen, F. N., Olivo, C., Grivell, S., Giepmans, B. N., Collard, J. G., and Moolenaar, W. H. (2003) J. Biol. Chem. 278, 400-406[Abstract/Free Full Text]
  13. Stracke, M. L., Krutzsch, H. C., Unsworth, E. J., Arestad, A., Cioce, V., Schiffmann, E., and Liotta, L. A. (1992) J. Biol. Chem. 267, 2524-2529[Abstract/Free Full Text]
  14. Hecht, J. H., Weiner, J. A., Post, S. R., and Chun, J. (1996) J. Cell Biol. 135, 1071-1083[Abstract/Free Full Text]
  15. An, S., Bleu, T., Hallmark, O. G., and Goetzl, E. J. (1998) J. Biol. Chem. 273, 7906-7910[Abstract/Free Full Text]
  16. Bandoh, K., Aoki, J., Hosono, H., Kobayashi, S., Kobayashi, T., Murakami, M. K., Tsujimoto, M., Arai, H., and Inoue, K. (1999) J. Biol. Chem. 274, 27776-27785[Abstract/Free Full Text]
  17. Noguchi, K., Ishii, S., and Shimizu, T. (2003) J. Biol. Chem. 278, 25600-25606[Abstract/Free Full Text]
  18. McIntyre, T. M., Pontsler, A. V., Silva, A. R., Hilaire, A., Xu, Y., Hinshaw, J. C., Zimmerman, G. A., Hama, K., Aoki, J., Arai, H., and Prestwich, G. D. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 131-136[Abstract/Free Full Text]
  19. Hooks, S. B., Santos, W. L., Im, D. S., Heise, C. E., Macdonald, T. L., and Lynch, K. R. (2001) J. Biol. Chem. 276, 4611-4621[Abstract/Free Full Text]
  20. Contos, J. J., Ishii, I., Fukushima, N., Kingsbury, M. A., Ye, X., Kawamura, S., Brown, J. H., and Chun, J. (2002) Mol. Cell. Biol. 22, 6921-6929[Abstract/Free Full Text]
  21. Yamori, T., Matsunaga, A., Sato, S., Yamazaki, K., Komi, A., Ishizu, K., Mita, I., Edatsugi, H., Matsuba, Y., Takezawa, K., Nakanishi, O., Kohno, H., Nakajima, Y., Komatsu, H., Andoh, T., and Tsuruo, T. (1999) Cancer Res. 59, 4042-4049[Abstract/Free Full Text]
  22. Yamaguchi, Y., Katoh, H., Yasui, H., Mori, K., and Negishi, M. (2001) J. Biol. Chem. 276, 18977-18983[Abstract/Free Full Text]
  23. Contos, J. J., Fukushima, N., Weiner, J. A., Kaushal, D., and Chun, J. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 13384-13389[Abstract/Free Full Text]
  24. Ohta, H., Sato, K., Murata, N., Damirin, A., Malchinkhuu, E., Kon, J., Kimura, T., Tobo, M., Yamazaki, Y., Watanabe, T., Yagi, M., Sato, M., Suzuki, R., Murooka, H., Sakai, T., Nishitoba, T., Im, D. S., Nochi, H., Tamoto, K., Tomura, H., and Okajima, F. (2003) Mol. Pharmacol. 64, 994-1005[Abstract/Free Full Text]
  25. Hasegawa, Y., Erickson, J. R., Goddard, G. J., Yu, S., Liu, S., Cheng, K. W., Eder, A., Bandoh, K., Aoki, J., Jarosz, R., Schrier, A. D., Lynch, K. R., Mills, G. B., and Fang, X. (2003) J. Biol. Chem. 278, 11962-11969[Abstract/Free Full Text]
  26. Lauffenburger, D. A., and Horwitz, A. F. (1996) Cell 84, 359-369[CrossRef][Medline] [Order article via Infotrieve]
  27. Mitchison, T. J., and Cramer, L. P. (1996) Cell 84, 371-379[CrossRef][Medline] [Order article via Infotrieve]
  28. Etienne, M. S., and Hall, A. (2002) Nature 420, 629-635[CrossRef][Medline] [Order article via Infotrieve]
  29. Fuss, B., Baba, H., Phan, T., Tuohy, V. K., and Macklin, W. B. (1997) J. Neurosci. 23, 9095-9103
  30. Weiner, J. A., Hecht, J. H., and Chun, J. (1998) J. Comp. Neurol. 398, 587-598[CrossRef][Medline] [Order article via Infotrieve]
  31. Fox, M. A., Colello, R. J., Macklin, W. J., and Fuss, B. (2003) Mol. Cell. Neurosci. 23, 507-519[CrossRef][Medline] [Order article via Infotrieve]
  32. Kozasa, T., Jiang, X., Hart, M. J., Sternweis, P. M., Singer, W. D., Gilman, A. G., Bollag, G., and Sternweis, P. C. (1998) Science 280, 2109-2111[Abstract/Free Full Text]
  33. Ishii, I., Contos, J. J., Fukushima, N., and Chun, J. (2001) Mol. Pharmacol. 58, 895-902
  34. Michiels, F., Habets, G. G., Stam, J. C., van der Kammen, R. A., and Collard, J. G. (1995) Nature 375, 338-340[CrossRef][Medline] [Order article via Infotrieve]
  35. Itoh, K., Yoshioka, K., Akedo, H., Uehata, M., Ishizaki, T., and Narumiya, S. (1999) Nat. Med. 5, 221-225[CrossRef][Medline] [Order article via Infotrieve]
  36. Yang, Y., Mou, L. J., Liu, N., and Tsao, M. S. (1999) Am. J. Respir. Cell Mol. Biol. 21, 216-222[Abstract/Free Full Text]
  37. Zhang, G., Zhao, Z., Xu, S., Ni, L., and Wang, X. (1999) Chin. Med. J. 112, 330-332[Medline] [Order article via Infotrieve]
  38. Yang, S. Y., Lee, J., Park, C. G., Kim, S., Hong, S., Chung, H. C., Min, S. K., Han, J. W., Lee, H. W., and Lee, H. Y. (2002) Clin. Exp. Metastasis 19, 603-608[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
D. Shida, X. Fang, T. Kordula, K. Takabe, S. Lepine, S. E. Alvarez, S. Milstien, and S. Spiegel
Cross-talk between LPA1 and Epidermal Growth Factor Receptors Mediates Up-regulation of Sphingosine Kinase 1 to Promote Gastric Cancer Cell Motility and Invasion
Cancer Res., August 15, 2008; 68(16): 6569 - 6577.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
M. M. Ptaszynska, M. L. Pendrak, R. W. Bandle, M. L. Stracke, and D. D. Roberts
Positive Feedback between Vascular Endothelial Growth Factor-A and Autotaxin in Ovarian Cancer Cells
Mol. Cancer Res., March 1, 2008; 6(3): 352 - 363.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. Zhao, M. J. Fernandes, G. D. Prestwich, M. Turgeon, J. Di Battista, T. Clair, P. E. Poubelle, and S. G. Bourgoin
Regulation of Lysophosphatidic Acid Receptor Expression and Function in Human Synoviocytes: Implications for Rheumatoid Arthritis?
Mol. Pharmacol., February 1, 2008; 73(2): 587 - 600.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
M. S. Han, S. Y. Park, K. Shinzawa, S. Kim, K. W. Chung, J.-H. Lee, C. H. Kwon, K.-W. Lee, J.-H. Lee, C. K. Park, et al.
Lysophosphatidylcholine as a death effector in the lipoapoptosis of hepatocytes
J. Lipid Res., January 1, 2008; 49(1): 84 - 97.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
M. M. Murph, J. Hurst-Kennedy, V. Newton, D. N. Brindley, and H. Radhakrishna
Lysophosphatidic Acid Decreases the Nuclear Localization and Cellular Abundance of the p53 Tumor Suppressor in A549 Lung Carcinoma Cells
Mol. Cancer Res., November 1, 2007; 5(11): 1201 - 1211.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Chen, L. N. Towers, and K. L. O'Connor
LPA2 (EDG4) mediates Rho-dependent chemotaxis with lower efficacy than LPA1 (EDG2) in breast carcinoma cells
Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1927 - C1933.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Jansen, N. Callewaert, I. Dewerte, M. Andries, H. Ceulemans, and M. Bollen
An Essential Oligomannosidic Glycan Chain in the Catalytic Domain of Autotaxin, a Secreted Lysophospholipase-D
J. Biol. Chem., April 13, 2007; 282(15): 11084 - 11091.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Yanagida, S. Ishii, F. Hamano, K. Noguchi, and T. Shimizu
LPA4/p2y9/GPR23 Mediates Rho-dependent Morphological Changes in a Rat Neuronal Cell Line
J. Biol. Chem., February 23, 2007; 282(8): 5814 - 5824.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-W. Lee, R. Rivera, A. E. Dubin, and J. Chun
LPA4/GPR23 Is a Lysophosphatidic Acid (LPA) Receptor Utilizing Gs-, Gq/Gi-mediated Calcium Signaling and G12/13-mediated Rho Activation
J. Biol. Chem., February 16, 2007; 282(7): 4310 - 4317.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Z. Zhang, Z. Liu, and K. E. Meier
Lysophosphatidic acid as a mediator for proinflammatory agonists in a human corneal epithelial cell line
Am J Physiol Cell Physiol, November 1, 2006; 291(5): C1089 - C1098.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Tanaka, S. Okudaira, Y. Kishi, R. Ohkawa, S. Iseki, M. Ota, S. Noji, Y. Yatomi, J. Aoki, and H. Arai
Autotaxin Stabilizes Blood Vessels and Is Required for Embryonic Vasculature by Producing Lysophosphatidic Acid
J. Biol. Chem., September 1, 2006; 281(35): 25822 - 25830.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. L. Baker, Y. Fujiwara, K. R. Pigg, R. Tsukahara, S. Kobayashi, H. Murofushi, A. Uchiyama, K. Murakami-Murofushi, E. Koh, R. W. Bandle, et al.
Carba Analogs of Cyclic Phosphatidic Acid Are Selective Inhibitors of Autotaxin and Cancer Cell Invasion and Metastasis
J. Biol. Chem., August 11, 2006; 281(32): 22786 - 22793.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. A. van Meeteren, P. Ruurs, C. Stortelers, P. Bouwman, M. A. van Rooijen, J. P. Pradere, T. R. Pettit, M. J. O. Wakelam, J. S. Saulnier-Blache, C. L. Mummery, et al.
Autotaxin, a Secreted Lysophospholipase D, Is Essential for Blood Vessel Formation during Development.
Mol. Cell. Biol., July 1, 2006; 26(13): 5015 - 5022.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Kishi, S. Okudaira, M. Tanaka, K. Hama, D. Shida, J. Kitayama, T. Yamori, J. Aoki, T. Fujimaki, and H. Arai
Autotaxin Is Overexpressed in Glioblastoma Multiforme and Contributes to Cell Motility of Glioblastoma by Converting Lysophosphatidylcholine TO Lysophosphatidic Acid
J. Biol. Chem., June 23, 2006; 281(25): 17492 - 17500.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Boucharaba, C.-M. Serre, J. Guglielmi, J.-C. Bordet, P. Clezardin, and O. Peyruchaud
The type 1 lysophosphatidic acid receptor is a target for therapy in bone metastases
PNAS, June 20, 2006; 103(25): 9643 - 9648.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
K. S. Park, H.-Y. Lee, M.-K. Kim, E. H. Shin, S. H. Jo, S. D. Kim, D.-S. Im, and Y.-S. Bae
Lysophosphatidylserine Stimulates L2071 Mouse Fibroblast Chemotactic Migration via a Process Involving Pertussis Toxin-Sensitive Trimeric G-Proteins
Mol. Pharmacol., March 1, 2006; 69(3): 1066 - 1073.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
S. Koike, K. Keino-Masu, T. Ohto, and M. Masu
The N-terminal hydrophobic sequence of autotaxin (ENPP2) functions as a signal peptide
Genes Cells, February 1, 2006; 11(2): 133 - 142.
[Abstract]