JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M401221200 on February 16, 2004

J. Biol. Chem., Vol. 279, Issue 17, 17850-17860, April 23, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
279/17/17850    most recent
M401221200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xing, F.
Right arrow Articles by Phizicky, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xing, F.
Right arrow Articles by Phizicky, E. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Specificities of Four Yeast Dihydrouridine Synthases for Cytoplasmic tRNAs*

Feng Xing{ddagger}, Shawna L. Hiley§, Timothy R. Hughes§, and Eric M. Phizicky{ddagger}

From the {ddagger}Department of Biochemistry and Biophysics, University of Rochester School of Medicine, Rochester, New York 14642 and §Banting and Best Department of Medical Research, University of Toronto, Toronto, Ontario M5G 1L6, Canada

Received for publication, February 4, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Dihydrouridine is a highly abundant modified nucleoside found widely in tRNAs of eubacteria, eukaryotes, and some archaea. In cytoplasmic tRNA of Saccharomyces cerevisiae, dihydrouridine occurs exclusively at positions 16, 17, 20, 20A, 20B, and 47. Here we show that the known dihydrouridine synthases Dus1p and Dus2p and two previously uncharacterized homologs, Dus3p (encoded by YLR401c) and Dus4p (YLR405w), are required for all of the dihydrouridine modification of cytoplasmic tRNAs in S. cerevisiae. We have mapped the in vivo position specificity of the four Dus proteins, by three complementary approaches: determination of the molar ratio of dihydrouridine in purified tRNAs from different dus mutants; microarray analysis of a large number of tRNAs based on differential hybridization of uridineand dihydrouridine-containing tRNAs to the complementary oligonucleotides; and the development and use of a novel dihydrouridine mapping technique, employing primer extension. We show that each of the four Dus proteins has a distinct position specificity: Dus1p for U16 and U17, Dus2p for U20, Dus3p for U47, and Dus4p for U20a and U20b.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A ubiquitous feature of tRNAs is the presence of numerous base and ribose modifications (1). More than 80 different RNA modifications have been described (2), 25 of which are found in cytoplasmic tRNAs of the yeast Saccharomyces cerevisiae; these occur at 35 positions, leading to about 11 modifications in an average yeast tRNA (3).

Dihydrouridine is among the most abundant modified nucleosides found in tRNA (3); the 905 dihydrouridines found in the 561 curated tRNAs are second in number only to the 1,234 pseudouridines. Consistent with its abundance, dihydrouridine is found widely in tRNAs of eubacteria and eukaryotes (3), although it is less common in archaebacteria (4). Furthermore, dihydrouridines are found at one or more of multiple different positions in tRNA, the vast majority of which are in the D loop at positions 16, 17, 20, 20a, and 20b and at the base of the variable arm at position 47. Only in six exceptional cases is dihydrouridine found elsewhere, and in these cases it occurs at one of four other positions in the D loop (15, 17a, 19, and 21) and at position 48 in the variable arm. The persistent occurrence of dihydrouridine in these positions in so many different organisms underscores the evolutionary importance of the modification and of the sites of modification.

To begin to address the roles of dihydrouridine modifications, an important first step is to decipher the substrate specificity rules for the various modified dihydrouridine residues of tRNA. The yeast S. cerevisiae is highly suitable for this analysis for three reasons. First, yeast tRNAs are modified with dihydrouridine at most of the sites of modification that have been found in characterized tRNAs. Thus, each of the six most common dihydrouridine modification sites are found in multiple yeast cytoplasmic tRNAs (Table I), and two of the five minor dihydrouridine modification sites are found in its sequenced mitochondrial tRNAs, at positions 15 and 17a. Second, formation of most dihydrouridines in yeast cytoplasmic tRNA requires primarily that a uridine is encoded at the appropriate site. Thus, all 83 encoded uridine residues at positions 16, 17, 20, 20a, and 20b of characterized yeast cytoplasmic tRNAs are modified to dihydrouridine, and 17 of the 20 U47 residues in the variable arm are modified (Table I). In contrast, for many other modifications, only certain tRNA species with the corresponding residue are modified. Thus, m1G9 modification occurs at only 10 of the 22 G9 residues of characterized yeast tRNAs (5), {psi}1 modification of yeast cytoplasmic tRNAs occurs only rarely at encoded uridines at 6 of the 15 positions at which {psi} is found (6), and dihydrouridine modifications in tRNA of other organisms are much more sporadic at uridine residues (Table I). Third, the genes encoding dihydrouridine synthases have recently been identified. We previously identified two yeast dihydrouridine synthases (Dus1p and Dus2p) that were responsible for some of the dihydrouridine modification of yeast bulk tRNA in vivo and of certain tRNAs in vitro (7). The yeast Dus proteins are part of a widespread family of likely dihydrouridine synthases found in eukaryotes and prokaryotes, including two other members found in yeast (encoded by open reading frames YLR401c and YLR405w) (7) and three related dihydrouridine synthases identified in Escherichia coli (8).


View this table:
[in this window]
[in a new window]
 
TABLE I
Occurrence of dihydrouridine and uridine (D/U) at different positions of characterized tRNAs (3)

 

We have investigated the specificity of dihydrouridine modification of cytoplasmic tRNAs in yeast, by construction of strains containing every possible combination of deletions of the known or likely dus genes and examination of dihydrouridine modification of tRNAs from these strains. By quantification of the dihydrouridine levels of purified tRNA species, we developed a preliminary map to describe the specificity of the Dus proteins. Microarray analysis of individual dus deletion strains provided an independent map of the specificities that showed good agreement with the one generated from calculating total dihydrouridine content. The specificity model was confirmed and extended by the development and use of a new dihydrouridine mapping method suitable for analysis of individual tRNAs in bulk RNA. Our results indicate that each the four yeast Dus proteins is specific for dihydrouridine modification at one or two distinct positions in cytoplasmic tRNAs.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Strains—Strains used in this study are summarized in Table II. All dus-{Delta} strains that were not purchased were made by PCR-based recombination (9), using primers containing ~35 nucleotides homologous to the ends of individual DUS genes and ~15 nucleotides homologous to marker genes (10). The dus2-{Delta}::LEU2 strains were made by amplification of LEU2 DNA from YEplac181 (11) with ends containing DUS2 sequence, using primers DUS2-5'-LEU2 (5'-AGCGCAGTCACACAGAGATCCCTCAACATAACGAGAACAC) and 3'-LU2-DS2 (5'-GTGTCACTGCCTATGCTACCCTATGAACATATTCC), followed by amplification with primers 5'-DUS2 (5'-CCATCCAAGCCACACCAAATAGCGCAGTCACACAG) and 3'-DS2 (5'-GGTACAACCTTTTGCTTTTTAGTGTCACTGCCTATG) to add more DUS2 flanking sequences to the ends of the fragment. Transformation of linear DNA was performed as described (12).


View this table:
[in this window]
[in a new window]
 
TABLE II
Strains used in this study

 
Strains lacking YLR405w (dus4-{Delta}::URA3) were made by amplification of URA3 DNA from YEplac182 (11) with ends containing DUS4 sequence, except that the DUS4 sequences at the ends were engineered to allow subsequent homologous recombination after transformation, to excise URA3. If the sequence around DUS4 in the chromosome is A-DUS4-B-C (where A, B, and C represent sequence blocks), then the amplified DNA that was constructed is A-C-URA3-B, so that after transformation, the chromosomal sequence is A-C-URA3-B-C. This was accomplished with three rounds of amplification using primers 5'-URA3 (5'-GCTTTTCAATTCAATTCATC) and 3'-URA3 (5'-CCGATGATAAGCTGTCAAAC), followed by amplification with forward primers DUS4C-5'-URA3 (5'-CAAGCGTTACGGCGAGGATGGATTTGGCATGGGCGGCTTTTCAATTCAATTC) and 5'-DUS4-AC (5'-CATTCTGCTTCTTCGCCCTGAATAAAAAAAAGATGCAAGCGTTACGGC), both with reverse primer 3'-URA3-DUS4B (5'-CAGATGGTGCTGAGCCAATTGAAAAGGCAAGCCACCCCGATGATAAGCTGTC). After transformation, selection with 5-fluoroorotic acid allows homologous recombination to excise URA3 and leave the dus4 deletion. Strains lacking YLR-401c (dus3-{Delta}::URA3) were made in the same way as the dus4-{Delta}::URA3 strains, using forward primers DUS3C-5'-URA3 (5'-CGACGAATACGGCATTTCTCAATGTCGTAGATTCTTCGCTTTTCAATTCAATTC) and 5'-DUS3-AC (5'-GAGCAGTAATGAAACATTAATGAACTCAGAATAGGCGACGAATACGGCATTTC) with reverse primer 3'-URA3-DUS3B (5'-GCCCCAGTGTTCCATAGAGAACTGCGCATAATCCCCCG).

All deletion strains were confirmed by PCR analysis of genomic DNA prepared from mutant strains, using primers homologous to the region outside the integrated area in chromosome.

Preparation of Low Molecular Weight RNA from Yeast—Low molecular weight RNA was extracted by phenol at 55-60 °C essentially as described (13), from yeast cells grown in 125 ml of medium to an A600 of 3-4. RNA was precipitated twice with ethanol, resuspended in 1 ml of H2O, and stored at -80 °C.

Purification of Individual tRNAs from Yeast—tRNAPhe, , and tRNATyr were purified as previously described (5) from low molecular weight RNA of wild type and various dus-{Delta} strains, using the following 5'-biotinylated DNA oligomers complementary to the 3' side of corresponding tRNAs: 5Bio-F1 for tRNAPhe (5'/Biotin/GTGGATCGAACACAGGACCT); 5Bio-Y2 for tRNATyr (5'/Biotin/TGGTCTCCCGGGGGCGAGTCGAACG); and 5Bio-L2 for (5'/biotin/GAGATTCGAACTCTTGCATCTTACG). Purity of the tRNA was examined by both quantitative primer extension (using a 50-fold excess of primer to tRNA input) and by HPLC, as described below.

HPLC Analysis of Dihydrouridine—Bulk RNA (~20 µg/injection) and purified tRNA (~1 µg/injection) from different yeast strains were digested with 5 µg of P1 nuclease in buffer containing 30 mM sodium acetate (pH 5.2) and 0.2 mM ZnCl2 at 37 °C overnight and then with 5 units of calf intestinal alkaline phosphatase (Roche Applied Science) in 1x alkaline phosphatase reaction buffer at 37 °C for 3 h. The resulting nucleosides were resolved by HPLC (Waters Alliance model 2690, equipped with a Waters 996 photodiode array detector) on a reverse phase C18 column (Supelco LC-18; 30 cm x 4.0 mm; 5 µm, 120 Å; Supelco, Inc.) essentially as described (14). Individual spectra of the nucleosides retrieved by the photodiode array detector were used to assign the peaks. The number of moles of dihydrouridine and other modified nucleosides per tRNA were calculated as described (5).

Microarray Analysis—Diploid strains bearing homozygous deletions of individual DUS genes proteins (Research Genetics) (15) were grown in 50 ml of SC medium to ~1 x 107 cells/ml in parallel with a wild type (BY4743) culture. Total RNA was extracted using hot phenol as previously described (16), ethanol-precipitated and quantified by measuring the A260. Contaminating DNA was removed by treatment with DNase I (Fermentas) according to the manufacturer's instructions followed by phenol extraction and precipitation. Ten micrograms of total RNA was directly labeled with Alexa Fluor 546 or 647 (Molecular Probes "Ulysis" kit), ethanol-precipitated, and hybridized to a commercially produced microarray (Agilent Technologies) as previously described (17), except that the formamide concentration in the hybridization buffer was reduced to 25%. Arrays were scanned on an Axon 4000B instrument and quantitated with GenePix software. The raw log ratios for each oligonucleotide were calculated from the median intensity at each spot, and the data were normalized by applying a Lowess smoother to the ratios of each experiment over intensity. All microarray data are compiled in the Supplemental Table S1. Detailed probe sequences and other data are compiled on the World Wide Web at hugheslab.med.utoronto.ca/Xing.

Dihydrouridine Mapping~20 µg of bulk cellular RNA was incubated in 8-µl reaction mixtures with 0.1 N KOH at 37 °C for 5 min or longer as indicated, and the pH was neutralized by the addition of 7 µl of 5x annealing buffer (250 mM Tris-HCl (pH 8.3), 150 mM NaCl, and 50 mM dithiothreitol). Then RNA was subject to a primer extension assay as described (5), except that ~8 µg of RNA (containing ~8 pmol of individual tRNA) and 25 pmol of 5'-32P-labeled primer were used in an annealing reaction of 9 µl. Primers used for dihydrouridine mapping the 5' side of tRNAPhe, tRNATyr, and and for the 3' side of tRNATyr are illustrated in Fig. 5. Other primers used in dihydrouridine mapping are 5V-1 for tRNAVal (5'-GCGTGTTAAGCAGATG), 5E-1 for tRNAGlu (5'-GGTCTCCACGGTGAAAGCG), and 5F-1b for the 3' side of tRNAPhe (5'-GGTGCGAATTCTGTGGATC). Primer extension products were resolved on 12% polyacrylamide (19:1), 4 M urea gels and visualized using a PhosphorImager (Amersham Biosciences).



View larger version (52K):
[in this window]
[in a new window]
 
FIG. 5.
Dihydrouridine mapping of three tRNAs in different dus-{Delta} strains. Bulk RNA from yeast was treated with 0.1 N KOH at 37 °C for 5 min, neutralized, and annealed with appropriate 5'-32P-labeled primer, and then the primer was extended as described under "Experimental Procedures." A, C, and E, schematic of mature forms of tRNAPhe (A), (C), and tRNATyr (E), respectively, with positions of primers indicated. Y, wybutosine; T, ribothymidine; M, 4-acetyl cytidine; K, m1G. B, D, F, and G, dihydrouridine mapping of tRNAPhe (B), (D), tRNATyr (3' side) (F), and tRNATyr (5' side) (G). Lanes a-d, sequencing lanes with dideoxynucleotides as indicated; lanes e and f, primer extension from wild type tRNA without (lane e) and with (lane f) KOH treatment; remaining lanes, primer extension of KOH-treated tRNAs from strains, as indicated at the top.

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Dihydrouridine Is Undetectable in Bulk RNA from a Yeast Strain Lacking All Four Dus Protein Family Members—We previously found that dus1-{Delta} and dus2-{Delta} strains each had substantially less dihydrouridine than did control wild type strains, whereas strains lacking the conserved family members encoded by open reading frames YLR401c (now named DUS3) and YLR405w (now named DUS4) had marginally reduced dihydrouridine (7). To investigate this more fully, we have improved the resolution of our initial HPLC methods with longer columns and have quantified the dihydrouridine contribution of each of the four Dus proteins. To this end, we have constructed a series of haploid deletion strains with every possible combination of deletions of the four DUS family members (Table II) (see "Experimental Procedures"). Each of the 15 dus-{Delta} strains is viable in rich medium (YPD) and, surprisingly, grows at comparable rates in this medium at different temperatures.

To evaluate the contribution of the four Dus protein family members to dihydrouridine modification, we extracted RNA from a wild type control strain and several of the dus mutant strains and then compared their nucleoside content by HPLC analysis of appropriately digested RNA. Fig. 1A shows a comparison of the nucleosides in RNA from a wild type strain with those from a dus1-{Delta}, dus2-{Delta}, dus3-{Delta}, dus4-{Delta} quadruple mutant strain. The position of dihydrouridine in the HPLC elution profile is indicated by the arrow and verified according to its spectrophotometric profile (14); as shown in Fig. 1B, and described previously (7), dihydrouridine absorbs at 210 nm but not at 263 nm, whereas the adjacent nucleoside pseudouridine has absorption peaks at both of these wavelengths. It is clear from Fig. 1B that RNA from the dus1-{Delta}, dus2-{Delta}, dus3-{Delta}, dus4-{Delta} quadruple mutant strain lacks any detectable dihydrouridine.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1.
HPLC separation of nucleosides from cellular RNA of wild type and dus-{Delta} strains of yeast. Bulk tRNA prepared from wild type and dus mutant strains was digested to nucleosides and chromatographed on an HPLC column, as described under "Experimental Procedures." A, elution profile at 210 nm of nucleosides from wild type and dus1-{Delta}, dus2-{Delta}, dus3-{Delta}, dus4-{Delta} strains. Nucleosides C, U, G, and A are labeled; the arrow indicates the elution positions of dihydrouridine (D) and pseudouridine ({psi}). B, enlarged view of dihydrouridine and pseudouridine profiles from wild type and dus1-{Delta}, dus2-{Delta}, dus3-{Delta}, dus4-{Delta} strains. Chromatograms are shown at 210 and 263 nm. C, comparison of dihydrouridine and pseudouridine profiles obtained from different multiple dus mutant strains. Nucleosides were separated as described above from wild type strains and double, triple, and quadruple dus-{Delta} strains, as indicated, and profiles were monitored at 210 nm.

 
To quantify the contributions of individual Dus proteins to bulk dihydrouridine modification, RNA from a series of strains with different combinations of dus mutants was analyzed for its dihydrouridine content. As shown in Fig. 1C and calculated from the areas of the peaks, a dus1-{Delta}, dus2-{Delta} strain retains ~35% of the normal dihydrouridine content, and further removal of either DUS4 or DUS3 drops the dihydrouridine level to ~20%. Finally, deletion of the fourth and last DUS homolog (dus1-{Delta}, dus2-{Delta}, dus3-{Delta}, dus4-{Delta}) generates the quadruple knockout, resulting in no detectable dihydrouridine. These results suggest that all four DUS genes contribute to dihydrouridine modification of RNA in vivo.

Analysis of Purified tRNAs from dus Mutant Strains Yields a Preliminary Model for Specificities of the Dus Protein Members in S. cerevisiae—To begin to determine the specificities of the Dus proteins for the six dihydrouridine positions that are modified in yeast cytoplasmic tRNAs, we analyzed three individual tRNAs purified from different dus mutant strains for their dihydrouridine content. As shown in Fig. 2, these tRNAs (tRNAPhe, , and tRNATyr) represent different dihydrouridine distributions. Each tRNA was purified by hybridization of bulk RNA to a 5' biotin-labeled DNA oligomer specific for the target tRNA, followed by binding of the hybridized tRNA to streptavidin beads and elution of the bound tRNA (see "Experimental Procedures"). This purification method yielded tRNA that was judged to be more than 95% pure, based on quantitative primer extension with specific probes, lack of detectable primer extension products with two other probes specific for other tRNAs, and comparison of the yield calculated from primer extension data with the known amount of RNA input (data not shown). To quantify the modified nucleosides in the purified tRNAs, tRNAs were digested to nucleosides and subjected to HPLC analysis, and the relative molarities of dihydrouridine and other modified nucleosides were calculated from the elution profile and the known extinction coefficients (see "Experimental Procedures").



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2.
Dihydrouridine profiles of purified tRNAs from different dus-{Delta} strains. tRNAs were purified from wild type and various dus mutant strains, as described under "Experimental Procedures," and nucleosides were separated by HPLC and monitored at 210 nm, as described in Fig. 1. For each panel, positions of dihydrouridine in tRNA are shown by closed circles in the schematic at the left, and dihydrouridine profiles are shown at the right. A, analysis of tRNAPhe. B, analysis of . C, analysis of tRNATyr.

 
Analysis of tRNAPhe suggests that its two dihydrouridines at positions 16 and 17 are modified by Dus1p. From the chromatograms shown in Fig. 2A, it is clear that tRNAPhe from a dus1-{Delta} strain has little detectable dihydrouridine, whereas tRNAPhe from a wild type or a dus2-{Delta} strain has comparable amounts of dihydrouridine. The quantification shown in Table III confirms this result. tRNAPhe from the wild type and the dus2-{Delta} strain contains 1.4 and 1.5 mol of dihydrouridine/mol of tRNA, and tRNAPhe from dus1-{Delta} strains has no detectable dihydrouridine. By contrast, quantification of most of the other modified nucleosides present in this tRNA ({psi}, m2G, m22G, m5C, and m1A) shows that they are all close to their expected values and are unchanged in tRNAPhe from all three strains. This close correspondence of expected nucleoside composition to observed composition independently validates our claim that these tRNAs are highly pure. This result demonstrates that Dus1p is responsible for modifying positions 16 and 17 of this tRNA, consistent with our previous observation that Dus1p modifies U17 of tRNAPhe in vitro (7).


View this table:
[in this window]
[in a new window]
 
TABLE III
Moles of dihydrouridines in 1 mol of a cytoplasmic tRNA from wild type (WT) and dus-{Delta} strains, as determined by HPLC analysis of nucleosides from purified tRNA species

 
contains two dihydrouridines, D20 and D20b, which appear to be modified by Dus2p and Dus4p. Fig. 2B and Table III show that from a dus1-{Delta} strain (2.2 D/tRNALeu) and a dus3-{Delta} strain (2.1 D/tRNALeu) retains full levels of dihydrouridine in compared with the wild type strain (2.2 D/tRNALeu). However, deletion of either DUS2 (1.0 D/tRNALeu) or DUS4 (1.2 D/tRNALeu) causes loss of one dihydrouridine residue from this tRNA, and deletion of both DUS2 and DUS4 completely eliminated dihydrouridine from this tRNA species. Thus, we conclude that Dus2p and Dus4p each modify one position of , although neither protein can be assigned to a specific residue based on this analysis. These results are also consistent with our previous in vitro results, which demonstrated that Dus2p and Dus4p each had activity with a substrate, although only marginal activity was detected with Dus4p (Ylr405p) (7).

tRNATyr is of particular interest, because dihydrouridine is present at all six known positions of the modification that are found in yeast cytoplasmic tRNA (Table I). As shown in Fig. 2C and Table III, tRNATyr from the wild type strain has 5.2 D/tRNATyr, whereas tRNATyr from a dus1-{Delta}, dus2-{Delta}, dus3-{Delta} strain has nearly 2 dihydrouridine residues (1.8 D/tRNATyr). This suggests that Dus4p activity accounts for formation of two of the six dihydrouridine residues in tRNATyr. These sites could be D20 and D20A or could be D20A and D20B but not D20 and D20B, since our analysis of suggests that Dus2p acts at either D20 or D20B in this tRNA species (assuming that site specificity is conserved in different tRNA species). tRNATyr also has a dihydrouridine at position 47 in the extra loop. As shown in Fig. 2C and Table III, one dihydrouridine residue (0.9 D/tRNATyr) is present in tRNATyr from a dus1-{Delta}, dus2-{Delta}, dus4-{Delta} strain. Thus, we tentatively assign Dus3p to formation of D47.

Microarray Analysis Largely Confirms the Preliminary Model of Dus Protein Specificity—It was previously observed that the absence of dihydrouridine in tRNAs from a dus1 mutant strain could be detected by microarray, using a protocol in which the fluors are coupled directly to the cellular RNA and hybridized to an array of oligonucleotides (16). It was noted that only oligonucleotides covering tRNA positions 16 and 17 reported significant preferential hybridization to RNA from a dus1 mutant relative to RNA from a wild type strain (positive ratios), and it was concluded that the loss of dihydrouridine modification in the dus1 mutant results in higher binding affinity.

We have extended this analysis by examining RNAs from all four dus deletion strains on a microarray with oligonucleotides designed to hybridize to multiple different portions of 70 genomic tRNA sequences in S. cerevisiae, comprising 42 different tRNA species (including 14 that have not previously been analyzed). Oligonucleotides with an average length of 18.4 and Tm of 41 °C were designed to tile across the tRNA sequence at 5-nucleotide intervals. We reasoned that only oligonucleotides specific for regions of tRNA spanning dihydrouridine modification sites would show preferential hybridization to RNA from dus mutant strains, allowing us to evaluate the specificity of each of the Dus proteins. An example of this approach is illustrated in Fig. 3A and Table IV, in which we evaluated hybridization data for oligonucleotides spanning the region around nucleotide 47 of . As can be seen, probes that span position 47 (probes 546-549) yielded significantly more hybridization to RNA from a dus3 mutant compared with wild type RNA but not with RNA from any other dus mutant. By contrast, neighboring oligonucleotides (probes 545 and 550) that do not span position 47 of have similar hybridization for RNAs from all dus mutants and wild type cells. These data are most consistent with the conclusion that Dus3p is specific for postion 47 of .



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 3.
Detecting loss of dihydrouridine modification by microarray. A, schematic of detection by microarray. The partial sequence of is shown aligned with a subset of DNA probes from the microarray. In wild type, dus1-{Delta}, dus2-{Delta}, and dus4-{Delta} strains, there is a dihydrouridine modification at position 47 (top); this position is not modified in the dus3-{Delta} mutant (bottom). The ratios (mutant/WT) for the probes from each microarray are shown in the table; large positive ratios (numbers in red) occur only for oligonucleotides covering the modification and exclusively in the dus3 mutant. B, clustering analysis of dus deletion mutant microarray data. Oligonucleotides with ratios of at least 2.25 (equivalent to 1.5 on a log2 scale) were subjected to hierarchical agglomerative clustering. Oligonucleotides to which there was significantly better binding in the mutant tRNA samples are indicated by red, as shown by the color bar on the right.

 


View this table:
[in this window]
[in a new window]
 
TABLE IV
Microarray analysis of binding of to oligonucleotide probes

 
Analysis of the microarray data largely corroborates the specificity of Dus3p, further confirms our other tentative assignments of Dus protein specificity, and extends the results to other tRNA species. Fig. 3B lists the oligonucleotides with the highest ratio of preferential hybridization (over 2.83-fold) to RNA from one or more of the dus mutant strains (relative to wild type) with array results presented in a clustergram (the data from the entire microarray is shown as supplementary data in Table S1, and can be viewed on the World Wide Web at hugheslab.med.utoronto.ca/Xing). From these data, it is obvious that Dus3p is specific for modification at position 47 for all eight tRNAs for which a signal is observed, including one species () for which there is no previous analysis. Similarly, the assignment of Dus1p specificity to positions 16 and 17 is unequivocal based on 12 positive hybridization ratios observed in RNA from dus1 mutants, using oligonucleotides spanning positions 16 and 17 and terminating before position 20. This includes four tRNA species that have not previously been analyzed (, , , and ). The hybridization results also implicate Dus2p and Dus4p in modifications covering positions 20, 20A, and 20B, but further discrimination is not possible based on these results. Surprisingly, RNA from dus2 mutants also appears to preferentially hybridize to probes specific for the extra arm of , which is not known to have a dihydrouridine, as well as to oligonucleotides 6-18 of and 6-19 of , although the preponderance of data argues that tRNAs are modified by Dus1p before nucleotide 20.

A Primer Extension Method for Mapping Dihydrouridine Modification Sites in tRNA—The above analyses of the specificity of Dus proteins for dihydrouridine modification are incomplete in two respects; it is difficult to assign specificity for Dus2p and Dus4p with either approach, and both methods lack nucleotide resolution. Thus, we sought a convenient and rapid mapping technique to precisely determine the positions of dihydrouridines in a tRNA.

We developed such a dihydrouridine mapping technique based on the observation that dihydrouridine is moderately susceptible to alkaline hydrolysis, which results in breakdown at the 3-4 linkage of dihydrouracil ring (18-20). The product of the ring-opening reaction, {beta}-ureidopropionic acid (Fig. 4A), is therefore expected to lose the capacity for base pairing and to generate a primer extension stop (4B). To test this idea, we incubated 20 µg of wild type bulk RNA (corresponding to ~1 pmol of a specific tRNA) with 0.1 N KOH at 37 °C for 2-45 min, neutralized the sample, and then performed primer extension using a primer specific for the 3'-end region of tRNATyr (see Fig. 5E for positioning of the primer). As shown in Fig. 4C, a band at C48 increases with increased time of alkali treatment, presumably because of the destruction of D47. The sequence ladder on the left confirms that the primer extension is from tRNATyr present in the bulk RNA. In the absence of alkali treatment, there is no stop product formed at this position; rather, the primer can extend through to position 29, 2 nucleotides before m22G26. Thus, this dihydrouridine mapping technique appears to provide a rapid and accurate determination of the site of dihydrouridines in tRNA.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4.
Dihydrouridine mapping approach. A, schematic of reaction of alkali with dihydrouridine to yield {beta}-ureidopropionic acid ribose derivative. B, scheme of dihydrouridine mapping method. Alkali treatment of RNA causes hydrolysis of the ring of dihydrouridine residues, resulting in a primer extension block at the residue N immediately 3' of the hydrolyzed dihydrouridine residue X. C, time course of effect of alkali treatment on primer extension of tRNATyr through D47. Bulk RNA from yeast was treated with 0.1 N KOH at 37 °C for 2-45 min, as indicated, neutralized, and annealed with 5'-32P-labeled primer for tRNATyr (see Fig. 4E), and then the primer was extended as described under "Experimental Procedures." a-d, sequencing ladders of tRNATyr using dideoxynucleotides as indicated; e, no KOH treatment; f-j, primer extension resulting from KOH treatment for 2, 5, 10, 20, and 45 min. The sequence ladder is indicated at the left; the arrow indicates primer extension stop at position C48, corresponding to hydrolysis at D47.

 
To further validate this mapping method, we tested tRNAPhe. As shown (Fig. 2A and Table III), the D16 and D17 modifications of tRNAPhe are due to Dus1p, based on analysis of the nucleoside content of purified tRNAPhe from a dus1 mutant strain. Primer extension analysis of alkali-treated RNA with a tRNAPhe primer confirms this result (Fig. 5B). As anticipated, primer extension stops are found at positions 17 and 18 of tRNAPhe from a wild type strain as well as from dus2-{Delta}, dus3-{Delta}, and dus4-{Delta} strains, 1 residue downstream of the known dihydrouridine positions (Fig. 5B, lanes f and h-j). By contrast, these primer extension stops are both missing in alkali-treated RNA from a dus1-{Delta} strain (lane g). This result confirms that Dus1p modifies U16 and U17 of tRNAPhe and further validates the dihydrouridine mapping procedure.

Dus Protein Specificity for Dihydrouridine Modification of and tRNATyr—Primer extension analysis of tRNALeu allows us to assign Dus2p and Dus4p to the dihydrouridine modifications at positions 20 and 20b, respectively. As shown in Fig. 5D, alkali treatment of RNA from a dus3-{Delta} mutant or a dus1-{Delta} mutant results in the same primer extension stops observed in wild type cells, corresponding to positions 20 and 20b (lanes f, g, and i). However, primer extension of RNA from a dus2 mutant results in the absence of the primer extension stop 1 nucleotide downstream of position 20 (lane h), and primer extension of RNA from a dus4 mutant abrogates the stop corresponding to position 20b (lane j). Thus, Dus2p catalyzes formation of D20, and Dus4p catalyzes formation of D20b of . Consistent with this, there is no primer extension stop in this region in alkali-treated RNA from a dus2-{Delta}, dus4-{Delta} strain (lane k).

tRNATyr has dihydrouridine residues at five positions in the D loop as well as at D47. We proposed above that Dus3p might be responsible for formation of D47, based on our quantitation of the dihydrouridine content of tRNATyr from a dus3-{Delta} strain (Fig. 2C and Table III) and the microarray analysis (Fig. 3A). Our data in Fig. 5F validate this claim, since the primer extension stop corresponding to position 47 (lane f) is absent in RNA from a dus3-{Delta} tRNATyr (lane i) but not in the other three dus deletion strains (lanes g, h, and j).

The cluster of dihydrouridines in the D loop at positions 16, 17, 20, 20a, and 20b makes it difficult to map dihydrouridine modifications in this region (Fig. 5G). Furthermore, for reasons that are unclear, a number of bands appeared even in the absence of alkali treatment of wild type tRNATyr (lane e), and the density of dihydrouridine residues precludes visualization of all five dihydrouridine modifications in treated wild type tRNA (lane f). Because it cannot be compared, there is no score for tRNATyr from the dus1-{Delta} strain (lane g), although we expected to see neither D17 nor D16. As expected, tRNATyr of the dus3-{Delta} strain showed the same mapping pattern as the wild type (lane i), consistent with the assignment of Dus3p to position 47.

Despite these difficulties, we can still use the mapping method to assign all of the dihydrouridines in the D loop of tRNATyr to specific Dus proteins, with the exception of D16, which cannot be mapped. We observe a missing band corresponding to D20 in RNA from a dus2-{Delta} strain (lane h) and two missing bands corresponding to D20a and D20b in RNA from the dus4-{Delta} strain (lane j). Thus, it is clear that Dus2p modifies only U20, and Dus4p modifies both U20a and U20b. We further demonstrated the position specificity of Dus1p, Dus2p, and Dus4p for tRNATyr, using RNA from multiple knockout strains. Thus, RNA from a dus2-{Delta}, dus4-{Delta} mutant strain is missing D20,D20a, and D20b (lane k); RNA from a dus1-{Delta}, dus4-{Delta} mutant strain has D20 because of the presence of DUS2 (lane l); and RNA from a dus1-{Delta}, dus2-{Delta} mutant strain has D20a and D20b because of the presence of DUS4 (lane m). Since a dus1-{Delta}, dus2-{Delta}, dus4-{Delta} mutant is missing all of its modification in the D loop (lane n), this demonstrates that D17 is modified by Dus1p, as expected. We note that the signal for D16 is too weak to ascribe to Dus1p or any other Dus protein.

Based on both the HPLC analysis of purified tRNAs from wild type and dus mutant strains and results from this new dihydrouridine mapping technique, we propose a model of Dus protein specificity for the different dihydrouridine positions of tRNA, as shown in Fig. 6. According to this model, Dus1p modifies U16 and U17, Dus2p modifies U20, Dus4p modifies U20A and U20b, and Dus3p modifies U47.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 6.
Model of specificities of the four yeast Dus proteins for dihydrouridine modification of cytoplasmic tRNAs.

 
Analysis of Other tRNAs Confirms the Specificities of the Dus Family Proteins—To confirm our model for the specificity of Dus protein modification, we tested two other tRNAs. Cytoplasmic has D16, D20, and D20a in the D loop, which are predicted to be modified by Dus1p, Dus2p, and Dus4p, respectively. The data in Fig. 7A confirm this prediction, since primer extension of alkali-treated RNA from a dus1-{Delta} strain does not have a stop corresponding to D16 (lane g), extension of tRNA from a dus2-{Delta} mutant lacks the stop corresponding to D20 (lane h), and extension of tRNA from a dus4-{Delta} strain lacks the D20a stop (lane j). Consistent with this, a dus1-{Delta}, dus2-{Delta}, dus4-{Delta} strain lacks all three dihydrouridines in this tRNA (lane k), a dus2-{Delta}, dus4-{Delta} strain retains only D16 (lane l), a dus1-{Delta}, dus4-{Delta} strain has only D20 (lane m), and a dus1-{Delta}, dus2-{Delta} strain only has D20a (lane n).



View larger version (89K):
[in this window]
[in a new window]
 
FIG. 7.
Dihydrouridine mapping of three other tRNAs. Bulk RNA from yeast was treated with 0.1 N KOH, neutralized, and primer-extended as described in Fig. 4. A-D, primer extension of (A), (B), and (C). Lanes a-d, sequencing lanes with dideoxynucleotides as indicated; lanes e and f, primer extension from wild type tRNA without (lane e) and with (lane f) KOH treatment; remaining lanes, primer extension of KOH-treated tRNAs from strains, as indicated at the top.

 
contains only D20a, which ought to be modified by Dus4p. Fig. 7B shows, as expected, that D20a of is lost exclusively in the dus4-{Delta} strain (lane j) but not in the dus2-{Delta} strain (lane h). This result suggests that both Dus4p and Dus2p possess highly stringent specificities for dihydrouridine modification, even in the absence of other dihydrouridines in the D loop as reference.

Position Alone Does Not Confer Dihydrouridine Modification—The Dus specificity model assigns a specific position(s) for dihydrouridine modification by each Dus protein. Thus, a uridine that is present at each of the six consensus positions for dihydrouridine is modified by a specific Dus protein. There are three exceptions to this rule among sequenced yeast cytoplasmic tRNAs: tRNAPhe1 and tRNAPhe2 (which differ only in the base pair between positions 6 and 67) and tRNALys1, each of which has a U47 instead of dihydrouridine at this position (3). To determine whether the assignment of U47 is correct for these tRNA species, we mapped the extra loop region of tRNAPhe1.As shown in Fig. 7D, the wild type and the four single dus mutant strains all carry an unmodified U47, since there is no primer extension stop at position 48. The observed primer extension stop in all lanes occurs at residue 47, which corresponds to m7G46. Thus, position 47 of tRNAPhe1 is indeed a uridine residue as previously assigned and not a dihydrouridine. Thus, for modification of U47 by Dus3p, other signal(s) appear to be required.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In this paper, we demonstrate that formation of dihydrouridine in yeast cytoplasmic tRNAs is carried out by a family of four dihydrouridine synthases (Dus1p, Dus2p, Dus3p, and Dus4p), each acting at specific positions in tRNAs. Dus1p modifies U16 and U17, Dus2p modifies U20, Dus3p modifies U47, and Dus4p modifies U20a and U20b. These four proteins are responsible for all dihydrouridine modification of cytoplasmic tRNAs in yeast, since bulk cellular RNA from a dus1-{Delta}, dus2-{Delta}, dus3-{Delta}, dus4-{Delta} strain (Fig. 1A) lacks any detectable dihydrouridine and since the specificities of the four proteins account for all known modifications of sequenced yeast cytoplasmic tRNAs. Consistent with these assignments, E. coli tRNAs have dihydrouridines exclusively in the D loop (at positions 16, 17, 20, 20a, and 21) and not at position 47, and a family of three Dus proteins is sufficient for dihydrouridine modification of E. coli tRNAs (8).

We determined the specificity of the Dus proteins in three steps, starting with a set of strains with various combinations of dus mutants. First, we developed a preliminary model of Dus protein specificity by HPLC analysis of nucleosides and quantification of dihydrouridine in purified tRNAs from these strains. This led to the assignment of Dus1p and a preliminary assignment of Dus3p in the same way as E. coli DusA protein was found to be responsible for D21 modification of (8). Second, we used microarray analysis to confirm the preliminary model for Dus1p and Dus3p and to extend the results to multiple tRNA species. However, although both methods could partially define the specificities of Dus2p and Dus4p, we could not define them precisely with the tRNAs and the probes we employed. Third, we developed a new primer extension technique to precisely map all dihydrouridine modification sites, based on brief alkali treatment of bulk tRNA to break the dihydrouridine ring, followed by primer extension to map the newly created primer extension stop. This dihydrouridine mapping technique was used to confirm initial assignments and to assign the remaining specificities.

Each method of dihydrouridine evaluation has its specific advantages. Analysis of nucleosides from purified tRNAs yields accurate quantification of dihydrouridine and of all other modifications in one experiment. Microarray analysis gives an immediate global view of dihydrouridine modification of many species of tRNA and, in principle, of all unique species; indeed, this experiment surveyed 70 of the 274 known tRNA genes (21). Moreover, the microarray method can be generalized to any other modification that yields a hybridization difference. Although we did see a small number of false positive signals in the microarray data, the frequency at which these occur is very low. All nine of the false positive signals were observed in analysis of dus2 mutants, and seven of these occurred within a specific region of ; perhaps these -specific oligonucleotides fortuitously hybridize to the region across nucleotide 20 of this or another tRNA species. The dihydrouridine mapping technique, like the pseudouridine mapping technique developed by Bakin and Ofengand (22, 23), is specific, simple, and precise and generally applicable to any dihydrouridine in RNA, except perhaps at the extreme 3'-end. For each of 13 known dihydrouridine modifications in five tRNAs for which we could see a primer extension result, we were able to unequivocally determine the position of the dihydrouridine modification and the Dus protein responsible for it. However, we note that we could not map D16 in tRNATyr because of the lack of a clear primer extension signal after alkali treatment. This weak signal could be due in part to the large number of dihydrouridine residues in this region, which could mask the primer extension stop corresponding to D16, and in part to enhanced natural resistance of this particular dihydrouridine residue relative to the other dihydrouridines. In support of this, we note that a weak signal is detected from D16 in dus2, dus4 double mutants.

As with most modification enzymes, the Dus proteins do not appear to compensate for each other or to depend on other dihydrouridine modifications for their action at nearby residues. In all cases, the absence of a specific Dus protein leads to the absence of that modification in the tRNA and of no other dihydrouridine modification. In particular, Dus2p and Dus4p faithfully retain their specificity for position 20 and positions 20a and 20b, respectively, in the absence of the other protein (Fig. 7B). Similar nonredundant activities were also observed in analysis of dihydrouridine modification in E. coli.

It is striking that all uridine residues in yeast tRNA at positions 16, 17, 20, 20a, and 20b in the D loop are modified to dihydrouridine. This may be a consequence of the observed high solvent exposure of all of the dihydrouridine-modified positions in the three known structures of yeast tRNAs (tRNAPhe, tRNAAsp, and ) (24-27). For many other modifications, only a portion of the residues with the appropriate base at a particular position are modified by the modification enzymes. For example, 12 of 15 {psi} sites in the cytoplasmic tRNAs of S. cerevisiae are not complete for pseudouridine modification, leaving 35% of total uridines at these 12 positions unmodified (6). This suggests that there are other determinants for this and other modifications, including dihydrouridine modification in other organisms. Interestingly, mutations in tRNASer (G18C and G19C, separately) not only abolished Gm18 modification but also blocked the formation of D20 in tRNASer, suggesting the dependence of the tertiary structure for D20 modification (28).

Both Dus1p and Dus4p are members of a small class of tRNA modification enzymes that are region-specific, in that they modify more than one nucleotide in the same region of the tRNA. In yeast, the only other known members of this class are Trm7p, which catalyzes 2'-O-methylation at positions 32 and 34 (29), and Pus3p, which forms {psi}38 and {psi}39 (30). Other modification enzymes act either at multiple sites, like Pus1p (6, 31, 32) and Trm4 (33), or, more commonly, at single sites. This region specificity argues either for conformational flexibility between the protein binding site and the active site or a flexible region of the tRNA substrate.

Although we have not yet examined mitochondrial tRNA from dus mutant strains to determine whether Dus proteins also act in the mitochondria, we think it is likely that Dus1p and Dus2p will have this role. Yeast mitochondrial tRNAs are modified extensively with dihydrouridine at positions 16 (13 D residues, 1 U residue, 3 others), 17 (3 D, 3 U), and 20 (17 D, 0 U) and not at all at positions 20a (6 U, 2 others), 20b (2 U, 2 others), and 47 (4 U). Based on the specificity assignments here, the lack of other obvious Dus homologs present in the yeast genome, and the known dual compartment specificity of enzymes such as Mod5p (34, 35), Trm2p (36), Pus3p (30), and Pus4p (37) that modify tRNA at similar positions in mitochondria and cytoplasmic tRNA, it seems likely that Dus1p and Dus2p will be responsible for the corresponding modifications in mitochondria. Based on its known region specificity, it also seems likely that Dus1p will be responsible for the occasional modification observed in mitochondrial tRNA at positions 17a (1 D, 0 U) and 15 (1 D, 1 U, and 15 others). Unfortunately, our microarray was not designed in such a was as to be able to answer these questions; however, it should be possible to design an array on which to detect modifications to mitochondrial tRNAs.

The results presented here set the stage for two lines of future research. First, the nature of the substrate specificity of the Dus proteins remains unsolved. Although there must be specific determinants in each Dus protein that dictate where it will bind and modify tRNA, the nature of those determinants is unknown. In this regard, it is surprising that E. coli DusA protein (also called YjbN) is most homologous to Dus1p (3.6 e-9) and much less so to Dus2p (4.4 e-4) and Dus4p (3.2 e-3), since it acts at position 21 (8) and might therefore be expected to be more related to Dus2p or Dus4p. Second, the role of dihydrouridine remains enigmatic. Dihydrouridine is known to cause increased flexibility in loops that contain it because of the propensity of dihydrouridine residues to adopt the C2'-endo conformation (38). Consistent with this increased flexibility, dihydrouridine is found in high levels in cold-adapted (psychrophilic) bacteria and archaea but not in thermophilic archaea (4, 39). Dihydrouridine modification of tRNA also causes less efficient hybridization of oligonucleotides to regions of tRNA with dihydrouridine (16). This could arise as a consequence of the increased propensity of dihydrouridine for the C2'-endo conformation or perhaps because of the loss of the aromatic ring structure of uridine in dihydrouridine. Thus, dihydrouridine may have a role in preventing the formation of alternative tRNA structures in the cell. In addition, overexpression of Dus2p (also called Smm1p) can suppress the temperature-sensitive phenotype caused by a mutation at position 61 in mitochondrial tRNAAsp that impairs 3'-end processing (40, 41); however, it is unclear how this occurs. We observe little growth phenotype in each of our dus mutant strains or in a multiple dus-1, dus2, dus3, dus4 mutant strain on plates or in liquid media at a variety of temperatures (23, 30, 37). This lack of a growth phenotype suggests a subtle phenotype that may only be revealed by examination of dus mutants in combination with other mutants in tRNA genes or modification enzymes (42, 43).


    FOOTNOTES
 
* This research was supported by National Institutes of Health Grant GM 52347 (to E. M. P.), Canadian Institutes of Health Research (CIHR) Grant MOP-49451 (to T. R. H.), and a CIHR postdoctoral fellowship (to S. L. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

The on-line version of this article (available at http://www.jbc.org) contains an additional table. Back

To whom correspondence should be addressed: Dept. of Biochemistry and Biophysics, University of Rochester School of Medicine, 601 Elmwood Ave., Box 712, Rochester, NY 14642. Tel.: 585-275-7268; Fax: 585-271-2683; E-mail: eric_phizicky{at}urmc.rochester.edu.

1 The abbreviations used are: {psi}, pseudouridine; HPLC, high performance liquid chromatography; D, dihydrouridine; m1G, 1-methylguanonsine; m2G, N2-methylguanosine; m22G, N2,N2-dimethylguanosine; m1A, 1-methyladenosine. Back


    ACKNOWLEDGMENTS
 
We are indebted to Dr. James Ofengand at the University of Miami for the initial suggestion of the use of alkali treatment for mapping of dihydrouridine in tRNA; to Elizabeth Grayhack for suggesting a method to design oligonucleotides for multiple knockout strains; to Quaid Morris, Ofer Shai, Brendan Frey, and Tomas Babak for assistance with microarray design and data analysis; and to E. Grayhack and A. Alexandrov for reading the manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hopper, A. K., and Phizicky, E. M. (2003) Genes Dev. 17, 162-180[Free Full Text]
  2. Rozenski, J., Crain, P. F., and McCloskey, J. A. (1999) Nucleic Acids Res. 27, 196-197[Abstract/Free Full Text]
  3. Sprinzl, M., Horn, C., Brown, M., Ioudovitch, A., and Steinberg, S. (1998) Nucleic Acids Res. 26, 148-153[Abstract/Free Full Text]
  4. Noon, K. R., Guymon, R., Crain, P. F., McCloskey, J. A., Thomm, M., Lim, J., and Cavicchioli, R. (2003) J. Bacteriol. 185, 5483-5490[Abstract/Free Full Text]
  5. Jackman, J. E., Montange, R. K., Malik, H. S., and Phizicky, E. M. (2003) RNA 9, 574-585[Abstract/Free Full Text]
  6. Motorin, Y., Keith, G., Simon, C., Foiret, D., Simos, G., Hurt, E., and Grosjean, H. (1998) RNA 4, 856-869[Abstract]
  7. Xing, F., Martzen, M. R., and Phizicky, E. M. (2002) RNA 8, 370-381[Abstract]
  8. Bishop, A. C., Xu, J., Johnson, R. C., Schimmel, P., and de Crecy-Lagard, V. (2002) J. Biol. Chem. 277, 25090-25095[Abstract/Free Full Text]
  9. Wach, A., Brachat, A., Pohlmann, R., and Philippsen, P. (1994) Yeast 10, 1793-1808[CrossRef][Medline] [Order article via Infotrieve]
  10. Langle-Rouault, F., and Jacobs, E. (1995) Nucleic Acids Res. 23, 3079-3081[Free Full Text]
  11. Gietz, R. D., and Sugino, A. (1988) Gene (Amst.) 74, 527-534[CrossRef][Medline] [Order article via Infotrieve]
  12. Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P., and Boeke, J. D. (1998) Yeast 14, 115-132[CrossRef][Medline] [Order article via Infotrieve]
  13. Rubin, G. M. (1975) Methods Cell Biol. 12, 45-64[Medline] [Order article via Infotrieve]
  14. Gehrke, C. W., and Kuo, K. C. (1989) J. Chromatogr. 471, 3-36[CrossRef][Medline] [Order article via Infotrieve]
  15. Giaever, G., Chu, A. M., Ni, L., Connelly, C., Riles, L., Veronneau, S., Dow, S., Lucau-Danila, A., Anderson, K., Andre, B., Arkin, A. P., Astromoff, A., El-Bakkoury, M., Bangham, R., Benito, R., Brachat, S., Campanaro, S., Curtiss, M., Davis, K., Deutschbauer, A., Entian, K. D., Flaherty, P., Foury, F., Garfinkel, D. J., Gerstein, M., Gotte, D., Guldener, U., Hegemann, J. H., Hempel, S., Herman, Z., Jaramillo, D. F., Kelly, D. E., Kelly, S. L., Kotter, P., LaBonte, D., Lamb, D. C., Lan, N., Liang, H., Liao, H., Liu, L., Luo, C., Lussier, M., Mao, R., Menard, P., Ooi, S. L., Revuelta, J. L., Roberts, C. J., Rose, M., Ross-Macdonald, P., Scherens, B., Schimmack, G., Shafer, B., Shoemaker, D. D., Sookhai-Mahadeo, S., Storms, R. K., Strathern, J. N., Valle, G., Voet, M., Volckaert, G., Wang, C. Y., Ward, T. R., Wilhelmy, J., Winzeler, E. A., Yang, Y., Yen, G., Youngman, E., Yu, K., Bussey, H., Boeke, J. D., Snyder, M., Philippsen, P., Davis, R. W., and Johnston, M. (2002) Nature 418, 387-391[CrossRef][Medline] [Order article via Infotrieve]
  16. Peng, W. T., Robinson, M. D., Mnaimneh, S., Krogan, N. J., Cagney, G., Morris, Q., Davierwala, A. P., Grigull, J., Yang, X., Zhang, W., Mitsakakis, N., Ryan, O. W., Datta, N., Jojic, V., Pal, C., Canadien, V., Richards, D., Beattie, B., Wu, L. F., Altschuler, S. J., Roweis, S., Frey, B. J., Emili, A., Greenblatt, J. F., and Hughes, T. R. (2003) Cell 113, 919-933[CrossRef][Medline] [Order article via Infotrieve]
  17. Hughes, T. R., Mao, M., Jones, A. R., Burchard, J., Marton, M. J., Shannon, K. W., Lefkowitz, S. M., Ziman, M., Schelter, J. M., Meyer, M. R., Kobayashi, S., Davis, C., Dai, H., He, Y. D., Stephaniants, S. B., Cavet, G., Walker, W. L., West, A., Coffey, E., Shoemaker, D. D., Stoughton, R., Blanchard, A. P., Friend, S. H., and Linsley, P. S. (2001) Nat. Biotech. 19, 342-347[CrossRef][Medline] [Order article via Infotrieve]
  18. Batt, R. D., Martin, J. K., Ploeser, J. M., and Murry, J. (1954) J. Am. Chem. Soc. 76, 3663-3665
  19. Magrath, D. I., and Shaw, D. C. (1967) Biochem. Biophys. Res. Commun. 26, 32-37[CrossRef][Medline] [Order article via Infotrieve]
  20. Molinaro, M., Sheiner, L. B., Neelon, F. A., and Cantoni, G. L. (1968) J. Biol. Chem. 243, 1277-1282[Abstract/Free Full Text]
  21. Hani, J., and Feldman, H. (1998) Nucleic Acids Res. 26, 689-696[Abstract/Free Full Text]
  22. Bakin, A., and Ofengand, J. (1993) Biochemistry 32, 9754-9762[CrossRef][Medline] [Order article via Infotrieve]
  23. Bakin, A. V., and Ofengand, J. (1998) Methods Mol. Biol. 77, 297-309[Medline] [Order article via Infotrieve]
  24. Kim, S. H., Suddath, F. L., Quigley, G. J., McPherson, A., Sussman, J. L., Wang, A. H., Seeman, N. C., and Rich, A. (1974) Science 185, 435-440[Abstract/Free Full Text]
  25. Westhof, E., Dumas, P., Moras, D., and Romby, P. (1985) J. Mol. Biol. 184, 119-145[CrossRef][Medline] [Order article via Infotrieve]
  26. Basavappa, R., and Sigler, P. B. (1991) EMBO J. 10, 3105-3111[Medline] [Order article via Infotrieve]
  27. Jovine, L., Djordjevic, S., and Rhodes, D. (2000) J. Mol. Biol. 301, 401-414[CrossRef][Medline] [Order article via Infotrieve]
  28. Cavaille, J., Chetouani, F., and Bachellerie, J. P. (1999) RNA 5, 66-81[Abstract]
  29. Pintard, L., Lecointe, F., Bujnicki, J. M., Bonnerot, C., Grosjean, H., and Lapeyre, B. (2002) EMBO J. 21, 1811-1820[CrossRef][Medline] [Order article via Infotrieve]
  30. Lecointe, F., Simos, G., Sauer, A., Hurt, E. C., Motorin, Y., and Grosjean, H. (1998) J. Biol. Chem. 273, 1316-1323[Abstract/Free Full Text]
  31. Massenet