|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 279, Issue 19, 19531-19539, May 7, 2004
ASIC2b-dependent Regulation of ASIC3, an Essential Acid-sensing Ion Channel Subunit in Sensory Neurons via the Partner Protein PICK-1*![]() ![]() ![]() From the Institut de Pharmacologie Moléculaire et Cellulaire, CNRS-UNSA UMR 6097, Institut Paul Hamel, 660, route des Lucioles, Sophia Antipolis, 06560 Valbonne, France
Received for publication, December 1, 2003 , and in revised form, February 17, 2004.
ASIC3, an acid-sensing ion channel subunit expressed essentially in sensory neurons, has been proposed to be involved in pain. We show here for the first time that native ASIC3-like currents were increased in cultured dorsal root ganglion (DRG) neurons following protein kinase C (PKC) stimulation. This increase was induced by the phorbol ester PDBu and by pain mediators, such as serotonin, which are known to activate the PKC pathway through their binding to G protein-coupled receptors. We demonstrate that this regulation involves the silent ASIC2b subunit, an ASIC subunit also expressed in sensory neurons. Indeed, heteromultimeric ASIC3/ASIC2b channels, but not homomeric ASIC3 channels, are positively regulated by PKC. The increase of ASIC3/ASIC2b current is accompanied by a shift in its pH dependence toward more physiological pH values and may lead to an increase of sensory neuron excitability. This regulation by PKC requires PICK-1 (protein interacting with C kinase), a PDZ domain-containing protein, which interacts with the ASIC2b C terminus.
Pain response results from both the immediate response to injury (acute pain) and the persistence of pain in the setting of tissue injury (chronic pain). Acute pain results from direct thermal, mechanical, or chemical activation of particular subsets of primary afferent neurons. In contrast, the persistent component of the pain is associated with the production and release of multiple inflammatory factors, including neurotransmitters and protons (for reviews, see Refs. 1 and 2). These act in concert not only to maintain activity of primary afferent nociceptors and sustain pain but also to heighten nociceptor sensitivity, such that innocuous stimuli produce pain (allodynia). Tissue injury and inflammation thus generate a variety of mediators that profoundly modulate sensory fiber activity and metabolism (3), leading to sensitization. Activation of protein kinase pathways is a major mechanism responsible for this modulation (411), and protein kinase C (PKC)1 has been implicated both in peripheral (69) and central sensitization (4, 5). Inflammatory mediators also have the potential to alter gene transcription and thereby induce long term alterations in the biochemistry of sensory neurons. For instance, recent studies have demonstrated that nerve growth factor and serotonin up-regulate the transcription of the gene encoding the proton-activated cation channel ASIC3 in nociceptors (1214).
Proton-activated cation currents have been described in many neuronal cell types (for reviews, see Refs. 1517). These native H+-gated currents correspond to the cloned acid-sensing ion channels (ASICs; for review, see Ref. 17). ASICs are present in sensory neurons (12, 1824) as well as in central neurons (18, 20, 2528). Functional ASICs are homo- or heteromeric proton-gated Na+-permeable channels formed by the association of different subunits: ASIC1a, ASIC1b, ASIC2a, ASIC2b, and ASIC3 (17, 18, 25, 2932). ASIC3 is principally found in the small and medium nociceptive sensory neurons (12), and its expression has been associated with a biphasic current comprising a fast inactivating component followed by a sustained phase (19). It is involved in acid-evoked nociception in the ischemic myocardium (21, 33, 34) and in modulating moderate to high intensity pain sensation (35). ASIC3 has also been proposed to be an acid sensor that could mediate hyperalgesia and pain in muscle (36). ASIC2b, when expressed alone, is not activated by extracellular protons, but it associates with ASIC2a and/or ASIC3 to form heteromultimeric channels displaying different kinetics, pH dependence, and ion selectivity (18). Of particular interest is the ASIC3+2b heteromer, which is specific for sensory neurons and gives rise to a biphasic current with the sustained component displaying a modified selectivity, in response to an external acidification. It has been proposed that the structural element responsible for this loss of Na+ selectivity is the pretransmembrane domain 1 of ASIC2b (37). This sustained current is thought to play a role in the tonic sensation of pain caused by low pH values (pH of <6). Two different partner proteins of ASICs have been described: CIPP (channel-interacting PDZ domain-containing protein), which interacts with ASIC3 (38) and PICK-1 (protein interacting with protein kinase C), which interacts with ASIC1a, ASIC2a, and ASIC2b (39, 40). These two proteins bind the C termini of ASICs via their PDZ domains. We have shown that CIPP increases the ASIC3 current density (38) and that PICK-1 potentiates the PKC regulation of ASIC2a (41). Although PICK-1 has only one PDZ domain, it can multimerize through its coiled-coil region (42, 43) and can, therefore, cross-link different binding partners. At the central level, interactions between PICK-1 and glutamate receptors have been described (for reviews, see Refs. 44 and 45), and PICK-1 has recently been implicated in the control of synaptic transmission by the mGluR7a receptor complex (46). This work shows that the PKC pathway is involved in the increase of ASIC3-like current recorded from cultured dorsal root ganglion (DRG) neurons by inflammatory mediators such as serotonin or bradykinin. It also shows that this PKC regulation is conferred by the ASIC2b subunit, which brings the PKC-interacting protein PICK-1 into the heteromeric ASIC3+2b complex.
RT-PCR AnalysisThe expression of endogenous PICK-1 in COS-7 cells was tested at the mRNA level by RT-PCR on total RNA. 5 µg of total RNA, extracted with the RNeasy mini kit (Qiagen), was reverse-transcribed by SuperScriptTM II RNase H reverse transcriptase (Invitrogen). One-twentieth of this mixture was used for 35 cycles of PCR to test mRNA expression of ASIC2b, ASIC3, and PICK-1 or 25 cycles of PCR for the glyceraldehyde-3-phosphate dehydrogenase control. To get forward and reverse primers that match the monkey sequence (COS-7 is a cell line derived from African green monkey kidney), we have designed primers containing the very conserved regions between rat and human genes. The forward and reverse primers were 439TCCAAGGGGGACCTCTACTA458 and 758CCATCCTCGCCTGAGTTAAA739 for ASIC2b (nucleotide positions in the open reading frames of human ASIC2b, GenBankTM accession number AL834182 [GenBank] ), 169CTCTACCAGGTGGCTGA185 and 716ACTCGGATCCCCACCTCAAA697 for ASIC3 (nucleotide positions in the open reading frames of human ASIC3, GenBankTM accession number AF095897 [GenBank] ), 412GGCCTGAGCCGGGCCATCCT431 and 827CTGTATTCCTCGTCATCCAT808 for PICK-1 (nucleotide positions in the open reading frame of human PICK-1, GenBankTM accession number AL049654 [GenBank] ). The annealing temperature was 54 °C. In all cases, the forward and the reverse primers were located in different exons. Additional positive controls with 25 cycles of PCR were realized on a few nanograms of plasmids containing cDNAs of rat ASIC2b, rat ASIC3, and mouse PICK-1. Western Blot AnalysisFor the preparation of whole cell lysates, COS-7 cells transfected or not by pCI-IRES-CD8-PICK-1 vector (DEAE-dextran protocol) were washed in phosphate-buffered saline after 3 days of expression, sonicated in lysis buffer (150 mM NaCl, 20 mM Tris, pH 7.4, 1 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 5 µg of leupeptin, 5 µg of antipain, 5 µg of pepstatin A), and the lysate was cleared by centrifugation at 1000 x g for 10 min. 100 µg of protein were loaded on an SDS-polyacrylamide gel (10% gel) and transferred onto nitrocellulose membranes (Hybond-P, Amersham Biosciences). Blots were saturated for 1 h at room temperature with 2% bovine serum albumin, 0.1% Tween in Tris-buffered saline and incubated overnight with an affinity-purified goat anti-PICK-1 antibody (PICK-1 (N-18), sc-9539; Santa Cruz Biotechnology) diluted 100-fold in 0.25% bovine serum albumin, 0.1% Tween in Tris-buffered saline, followed by an additional 1-h incubation with peroxidase-conjugated donkey anti-goat IgG (Jackson Laboratories), with extensive washing in Tris-buffered saline, 0.1% Tween after antibody incubation. Blots were finally developed with SuperSignal (Pierce).
Plasmid Constructions and MutagenesisThe mouse PICK-1 coding sequence (GenBankTM accession number NM008837; 96% amino acid identity with rat PICK-1) was amplified by RT-PCR from mouse brain cDNA and subcloned into the bicistronic vector pCI-IRES-CD8 (47) for expression in COS cells. The mPICK1
Primary Culture of Rat DRG NeuronsDorsal root ganglion neurons were dissected from Wistar rat (57 weeks) and enzymatically dissociated with 0.1% collagenase. Cells were then plated on collagen-coated 35-mm Petri dishes and maintained in culture at 37 °C (95% air, 5% CO2) in Dulbecco's modified Eagle's medium containing 5% fetal calf serum. Electrophysiological experiments were carried out 13 days after plating.
Expression and Electrophysiology in COS CellsCOS cells at a density of 20,000 cells per 35-mm diameter Petri dish were transfected with a mix of the bicistronic vector pCI-IRES-CD8 or pCI-PICK1-IRES-CD8, or pCI-PICK1 Patch-Clamp Solutions and ChemicalsThe pipette solution contained (in mM): KCl 140, ATP-Na2 5, MgCl2 2, CaCl2 2.1, EGTA 5, HEPES 10 (pH 7.25), and the bath solution contained (in mM): NaCl 150, KCl 5, MgCl2 2, CaCl2 2, HEPES 10 (pH 7.4). MES was used instead of HEPES to buffer bath solution pH ranging from 6 to 5. For the experiments on DRGs, the external solutions were supplemented with glucose (10 mM) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 20 µM), and kynurenic acid (10 µM) was added to inhibit glutamate-induced currents. Cells were voltage-clamped to a constant holding potential, and extracellular pH changes were induced by shifting one of eight outlets of a microperfusion system in front of the cell. CNQX, kynurenic acid, phorbol 12,13-dibutyrate (PDBu), the cell permeable diacylglycerol analog 1-oleyl 2-acetyl-sn-glycerol (OAG), serotonin, PKC inhibitors chelerythrine (CHEL), and the PKC fragment 1936 were all from Sigma. The selective group I metabotropic glutamate receptor (mGluR-1) agonist (RS)-3,5-dihydroxyphenylglycine (DHPG) was from Tocris.
DRG Neuron ASIC3-like Current Is Increased by PKC Pathway StimulationNative pH 6.3- and pH 5-evoked ASIC3-like currents were recorded at 80 mV from cultured rat DRG neurons. These two pH values (6.3 and 5) were chosen as they induce half-maximal and maximal activation of the cloned ASIC3 current (19, 38). ASIC3-like currents were identified by kinetics (fast inactivation and biphasic time course), insensitivity to the toxin PcTX1 (which inhibits ASIC1a homomeric currents, Ref. 32), and pH sensitivity on activation (pH0.5 6.3). The percentage of neurons expressing an ASIC3-like current was 24.7% (40/162), a value that is very similar to the 26.5% reported in a previous work already published by our group (13). These currents can include H+-gated currents flowing through homomeric ASIC3 channels and/or heteromeric ASIC3-containing channels such as ASIC3+2b (18, 50). However, the presence of a H+-sensitive K+ current in cultured rat DRG neurons (not shown) did not allow us to systematically discriminate between ASIC3 and ASIC3+2b currents at +30 mV (see below). Fig. 2 describes the effect of serotonin, bradykinin, the mGluR agonist DHPG, and of the phorbol ester PDBu on ASIC3-like current in DRG neurons. Indeed, protein kinase C pathway-coupled serotonin, bradykinin, and glutamate receptors (5HT2Rs, BKBRs, and group I mGluRs) have already been described in sensory neurons (5156). External application of serotonin induced an increase of the pH 6.3-evoked ASIC3-like peak current (Fig. 2A). This effect occurred rapidly (2 min after serotonin was introduced in the external medium), and it was reversed by the PKC inhibitor chelerythrine (Fig. 2B). In the same way, external application of DHPG, a group I mGluRs agonist (Fig. 2A), or of the phorbol ester PDBu (Fig. 2A), also induced increases in the pH 6.3-evoked ASIC3-like peak current amplitude, which were both reversed by chelerythrine. It should be mentioned that in some experiments, chelerythrine application brought the current amplitude to a level lower than the initial basal one (data not shown), suggesting that basal PKC effect had occurred. These results indicate that PKC stimulation induces an increase of the ASIC3-like current in DRG neurons both when the kinase stimulation is direct (by PDBu) or when it takes place through G protein-coupled receptors (GPCRs, by serotonin, bradykinin, or DHPG). As described by Mamet et al. (13) in DRG neurons, pH 6.3-evoked ASIC3-like current generates membrane depolarizations that are close to the action potential (AP) threshold. Thus, the increase of the ASIC3-like current by PKC observed here would convert a submaximal current to a larger one, sufficient to reach the threshold of action potential triggering in DRG neurons.
Both the effect of PDBu and serotonin were stronger on pH 6.3-evoked ASIC3-like currents than on pH 5-evoked ASIC3-like currents (+75.2 ± 16.3%, n = 6 versus +35.5 ± 12.1%, n = 4, p = 0.11 and +71.6 ± 10.2% versus +22.0 ± 12.5%, p < 0.05, respectively), strongly suggesting that the PKC pathway stimulation also shifts the pH dependence of ASIC3-like current toward more physiological pH values (Fig. 2C). Indeed, the pH 6.3/5 ratio allows us to estimate a shift of the sigmoidal pH activation curve ( 0.2 pH unit), assuming no change in the Hill slope number. The Heterologously Expressed Homomeric ASIC3 Current Is Not Increased by PKC StimulationConsidering the results observed on DRG ASIC3-like current, we then studied the PKC regulation of the ASIC3 channel heterologously expressed in COS cells. Surprisingly, external application of PDBu (2 µM) only induced a slight increase of the pH 6.3-evoked ASIC3 current (Fig. 3A). Because in DRG neurons ASIC3-like currents can be generated both by homomeric ASIC3 and by heteromeric ASIC3+2b channels, this observation suggested that PKC regulation takes place on the ASIC3+2b heteromer. Such an explanation seems probable since the ASIC2b C terminus can bind to PICK-1 (39, 40), which itself interacts with PKC (42, 57) and potentiates the PKC-dependent regulation of ASIC2a by direct phosphorylation (41). All subsequent experiments were designed to prove this hypothesis.
PICK-1 Does Not Modify the Main Functional Characteristics of ASIC3 and ASIC3+2bIn a first set of experiments, we tested whether PICK-1 expression, by itself, could induce functional changes in ASIC3, ASIC2b, and ASIC3+2b currents. Fig. 3B shows ASIC3 (top) and ASIC3+2b (bottom) currents recorded from COS cells co-transfected (right panel) or not (left panel) with PICK-1. When the ASIC2b subunit, which does not generate a current by itself, was transfected with PICK-1, no significant current could be recorded either in response to external pH acidification, or after the PKC stimulation by the phorbol ester PDBu 2 µM for 10 min (data not shown). Therefore, neither PICK-1 nor a potential PKC phosphorylation can transform the silent ASIC2b subunit into a functional channel. As initially reported by Lingueglia et al. (18), the pH 5-evoked ASIC3+2b sustained current is cationic and non-selective (outward sustained current at +30 mV, Fig. 3B, bottom left, inset) whereas the ASIC3-sustained current is selective to sodium ions (inward sustained current at +30 mV, Fig. 3B, top left, inset). These properties of ASIC3 and ASIC3+2b sustained currents remained unchanged when PICK-1 was co-expressed (Fig. 3B, top and bottom right, insets). In the same way, the presence of PICK-1 neither modified ASIC3 nor ASIC3+2b cell surface expression levels, as illustrated by the bar graphs representing their peak current densities in Fig. 3C. The pH dependence also remained unaltered (IpH 6.3/IpH 5 in Fig. 3D). Taken together, these data show: (i) that PICK-1 does not modify the ASIC3 current, as it was in fact expected, because PICK-1 has not been reported to interact with ASIC3 (39, 40), and (ii) that the interaction between PICK-1 and ASIC2b does not affect the main functional characteristics of the heteromeric ASIC3+2b channel.
The ASIC3+2b Current Is Increased by PKC Stimulation in the Presence of PICK-1Fig. 4 shows the PICK-1-dependent PKC effect on homomeric ASIC3 and on heteromeric ASIC3+2b currents expressed in vitro. Whole cell pH 6.3-induced ASIC3 (Fig. 4A, top) and ASIC3+2b (Fig. 4A, bottom) currents were recorded at 50 mV before (Fig. 4A, left panel) and during (Fig. 4A, right panel) the external application of PDBu, from COS cells co-transfected with PICK-1. PDBu only induced a slight increase of ASIC3 peak current, whereas it doubled the peak current generated by ASIC3+2b. The effect of PDBu occurred rapidly (within 1 or 2 min), and reversed a few minutes after PDBu was removed from the bath (Fig. 4B). Similar results were also obtained when OAG (50 µM), a diacylglycerol analog, was used instead of PDBu (Fig. 4B, inset). Fig. 4C summarizes the PDBu-induced increase of pH 6.3-induced ASIC3 and ASIC3+2b (wild type and 2b
Both the C-terminal domain of ASIC2b and the PDZ domain of PICK-1 were required for this maximal effect to occur, since co-transfection of ASIC3 with ASIC2b C and PICK-1 (bar 4) or with ASIC2b and PICK-1 PDZ (bar 5) produced a significant decrease of the maximal PDBu effect (+16.8 ± 9.2%, n = 8, p < 0.001 and +49.0 ± 10.7%, n = 9, p < 0.01, respectively).
Somewhat surprising was the PDBu effect observed on ASIC3+2b current recorded from COS cells, which were not co-transfected with PICK-1 (bar 6). Although this effect was significantly lower than the maximal PDBu effect observed when PICK-1 was co-expressed with ASIC3 and ASIC2b (bar 6: +58.6 ± 24.4%, n = 13 versus bar 3: +110.8 ± 11.4%, n = 19, respectively, p < 0.05), we expected a more drastic reduction since PICK-1, in that case, had not been co-transfected. It was observed that this PDBu effect on ASIC3+2b was highly variable from one cell to another. This result lead us to consider that the observed effect could be related to an endogenous basal expression of PICK-1 in the COS cell line. In fact, while neither ASIC3 nor ASIC2b were endogenously expressed in COS cells (Fig. 4D), the presence of PICK-1 was revealed by RT-PCR (Fig. 4D) and by Western blot (Fig. 4E). This observation probably explains why in a significant number of cells, the important endogenous level of PICK-1 could increase the PDBu effect on ASIC3+2b current in the absence of exogenous PICK-1 (Fig. 4C, bar 6) or in the presence of the non-functional PICK-1 Involvement of PKC and Phosphorylation Sites in the Upregulation of ASIC3+2b in the Presence of PICK-1Fig. 5 describes the effect of protein kinase C stimulation by PDBu on ASIC3+2b currents recorded from COS cells co-transfected with PICK-1. The maximal PDBu-induced increase of ASIC3+2b peak current amplitude (Fig. 5A, bar1: +110.8 ± 11.4%, n = 19) was completely abolished when 50 µM PKC inhibitor fragment 1936 was added to the pipette solution (Fig. 5A, bar 2: +16.6 ± 8.9%, n = 7, significantly different from bar 1, p < 0.001). Analysis of ASIC3 and ASIC2b sequences (NetPhos 2.0) revealed that the two proteins had putative phosphorylation sites (7 sites for ASIC3 and 4 sites for ASIC2b), which could be targets for serine/threonine kinases. Among these sites, three (two sites for ASIC3 and one site for ASIC2b, for details see Fig. 1) appeared as major putative PKC phosphorylation sites (as indicated by the Prosite program). Phosphorylation mutants were then generated, and the effect of PDBu were tested on COS cells co-transfected with these mutants and PICK-1 (Fig. 5A, bars 37). When the ASIC3 phosphorylation sites were singly mutated (ASIC3T40G and ASIC3S523G mutants), the effect of PDBu on pH 6.3-evoked ASIC3+2b current remained near maximal (bars 3 and 4: +84.4 ± 21.9%, n = 7 and +81.2 ± 20.9%, n = 6, respectively; not significantly different as compared with bar 1). The same kind of result was also observed with the phosphorylation mutant of ASIC2b (bar 6: +88.8 ± 20.2%, n = 8). In contrast, when both the ASIC3 phosphorylation sites were mutated (bar 5), or when all the phosphorylation sites (those of ASIC3 and the single one in ASIC2b, bar 7) were mutated, the PDBu effect was significantly reduced (+57.2 ± 19.0%, n = 6, and +50.4 ± 15.3%, n = 8, significantly different from bar 1, p < 0.05 and p < 0.01, respectively). These results indicate that the two ASIC3 phosphorylation sites are involved in the PICK-1-dependent effect of PKC on ASIC3+2b current. However, the fact that a residual PDBu effect remained suggests that other phosphorylation sites might also be implicated.
Fig. 5B shows an experiment where the amplitude of the control ASIC3+2b current (recorded from a COS cell co-transfected with PICK-1) already exhibits a basal level corresponding to a stimulation by PKC. In this case, further PDBu application only induced a 50% increase of the pH 6.3-evoked ASIC3+2b peak current from the initial basal level. The true PDBu-induced increase of the ASIC3+2b channel activity in this particular experiment was clearly underestimated since chelerythrine application brought the current amplitude to a level lower than the initial basal one. In a few experiments chelerythrine failed to decrease ASIC3+2b current amplitude (probably because of a lack of basal phosphorylation in these few cases), thus ruling out a direct inhibitory effect on the channel (data not shown). As a consequence, chelerythrine was used as often as possible in order to determine the real unstimulated level of current. Fig. 5C shows that the PDBu-induced increase of the ASIC3+2b peak current amplitude is smaller on the pH 5-evoked current than on the pH 6.3-evoked current (+26.8 ± 8.3% and +100.5 ± 6.2%, respectively, n = 8, p < 0.001). This is similar to what was previously observed for ASIC3-like currents in DRG neurons, and this again suggests that the PKC effect on the current was accompanied by a shift of its pH dependence toward more physiological pH values. Indeed, Fig. 5D shows that, in cells co-transfected with PICK-1, the PKC-induced increase of ASIC3+2b peak current is associated with a shift in its pH dependence (from pH 6.2 to 6.4).
Protein kinase C has largely been implicated in both peripheral and central pain sensitization. It participates in epinephrine-induced mechanical hyperalgesia in the rat and in sensitization of cultured DRG neurons (8), it is involved in the sensitization of mouse nociceptive neurons by nerve growth factor (6), it induces long lasting enhancement of excitatory amino acid-mediated currents in dorsal horn and trigeminal neurons (4), or it triggers activation of silent synapses in the spinal cord (5).
Results presented in this study indicate that there is a PKC-dependent up-regulation of an ASIC3-like current in DRG neurons for the first time. These effects are mimicked in vitro when the heteromeric ASIC3+2b channel (and not homomeric ASIC3 channel) is co-expressed with PICK-1. The PKC-induced increase of ASIC3/ASIC2b current is accompanied by a shift of its pH dependence toward more physiological pH values, and thus may lead to an increase of sensory neurons excitability. PICK-1 was first identified as an interactor of protein kinase C
It is well established that serotonin plays an important role in sensory information processes (59). At the peripheral level, it is released from platelets, mast cells, or basophils that infiltrate an area of tissue damage, and constitutes a major component of the inflammatory chemical milieu, which contributes to the pain of tissue injury via an action on multiple receptor subtypes (3). Of the 15 serotonin receptors (5-HTRs) identified to date, a large number are expressed in DRG neurons (51, 53), including those coupled to G proteins that activate the PKC pathway (5-HT2Rs) and of course the ionotropic 5-HT3 receptor (5-HT3R). Tissue damage results in the proteolytic cleavage of precursors kininogens both in the plasma and in peripheral tissues (for review, see Ref. 60). The resultant kinins, in particular bradykinin, are potents algogens that specifically activate bradykinin B1 and B2 G protein-coupled receptors (for review, see Ref. 54). Both B1 and B2 receptors are constitutively expressed in sensory neurons (55, 61, 62), and their activation has been associated with inflammatory hyperalgesia and sensory neurons sensitization (6365). The production of bradykinin following tissue damage would thus also lead to the potentiation of ASIC3-like currents in sensory neurons through PKC pathway activation. Glutamate is the major excitatory neurotransmitter in the central nervous system. However, data have accumulated showing the effects of glutamate at the peripheral level (for reviews, see Refs. 66 and 67). Moreover, phospholipase C-coupled group I mGluR1 and mGluR5 have been described on peripheral nociceptive afferents (52, 56). At this level, activation of mGluR1 or mGluR5 would lead to PKC pathway activation and to potentiation of ASIC3-like current in sensory neurons. Inflammatory mediators (nerve growth factor, bradykinin, serotonin) have a positive transcriptional effect on the ASIC3 gene (1214). Our data show that some of these mediators also potentiate DRG neuron ASIC3-like current via their binding to G protein-coupled receptors and activation of the PKC pathway. Taken together, all these data support an involvement of ASICs in pain sensitization processes, especially under inflammatory conditions where PKC pathway activators and extracellular protons are released. ASIC2b, although it cannot form a functional channel by itself, has two important roles within the heteromeric complex it forms with ASIC3. (i) With its N-terminal end (37) it can modify the Na+ selectivity of the ASIC3 sustained current to convert it into a non-selective current. (ii) With its C-terminal domain it binds to PICK-1 and permits a PKC-dependent increase of the transient and Na+ selective current mode that is dominant at moderately acidic pH. Both ASIC2b-induced modifications of ASIC3 properties (change of ionic selectivity of the sustained current and increase of the transient current via the PKC pathway) are expected to increase the sensation of pain.
* This work was supported by CNRS, the Institut Paul Hamel, the Association Française contre les Myopathie (AFM), Association pour la Recherche sur le Cancer (ARC), and AstraZenecaAB, Research Area CNS/Pain. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 The abbreviations used are: PKC, protein kinase C; ASIC, acid-sensing ion channel; PICK-1, protein interacting with C kinase; RT-PCR, reverse transcriptase-PCR; MES, 4-morpholineethanesulfonic acid; PDBu, phorbol 12,13-dibutyrate; OAG, 1-oleyl 2-acetyl-sn-glycerol; DHPG, dihydroxyphenylglycine; mGluR, metabotropic glutamate receptor; GPCR, G protein-coupled receptor; CHEL, chelerythrine; 5HT, serotonin; DRG, dorsal root ganglion.
We thank N. Voilley, A. Patel, J. Chemin, and J. Mamet for helpful discussions, M. Jodar for excellent technical assistance, and V. Briet for secretarial assistance.
This article has been cited by other articles:
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||