|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 279, Issue 19, 19649-19657, May 7, 2004
Enhanced Adhesive Capacities of the Naturally Occurring Ile249Met280 Variant of the Chemokine Receptor CX3CR1*![]() ![]()
From the
Laboratoire d'Immunologie Cellulaire, INSERM U543, Faculté de Médecine Pitié-Salpêtrière, 91 Boulevard de l'Hôpital, 75013 Paris, France and the
Received for publication, December 9, 2003 , and in revised form, February 25, 2004.
It was recently shown that individuals carrying the naturally occurring mutant CX3CR1-Ile249Met280 (hereafter called CX3CR1-IM) have a lower risk of cardiovascular disease than individuals homozygous for the wild-type CX3CR1-Val249Thr280 (CX3CR1-VT). We report here that peripheral blood mononuclear cells (PBMC) from individuals with the CX3CR1-IM haplotype adhered more potently to membrane-bound CX3CL1 than did PBMC from homozygous CX3CR1-VT donors. Similar excess adhesion was observed with CX3CR1-IM-transfected human embryonic kidney (HEK) cell lines tested with two different methods: the parallel plate laminar flow chamber and the dual pipette aspiration technique. Suppression of the extra adhesion in the presence of pertussis toxin indicates that G-protein mediated the underlying transduction pathway, in contrast to the G-protein-independent adhesion previously described for CX3CR1-VT. Surprisingly, HEK and PBMC that expressed CX3CR1-IM and -VT were indistinguishable when tested with the soluble form of CX3CL1 for chemotaxis, calcium release, and binding capacity. In conclusion, only the membrane-anchored form of CX3CL1 functionally discriminated between these two allelic isoforms of CX3CR1. These results suggest that each form of this ligand may lead to a different signaling pathway. The extra adhesion of CX3CR1-IM may be related to immune defenses and to atherogenesis, both of which depend substantially on adhesive intercellular events.
Adhesion, a critical stage in cell trafficking and migration (1, 2), requires the presence of numerous adhesion molecules, such as integrins, that need divalent ions to function. Recent studies show that two chemokines, namely, CX3CL1 and CXCL16, are not only chemoattractant as soluble molecules, but also function as adhesion molecules since they are membrane-anchored, regardless of the presence of divalent ions (37). The best known of these is CX3CL1, also called fractalkine. It is expressed on the surface of many types of cells, in particular interleukin-1- and tumor necrosis factor-activated endothelial (4) and dendritic cells (8), as a membrane molecule containing the classic chemokine domain, a mucin-like stalk, and a transmembrane domain tethering it to the cell membrane. CX3CL1 may be cleaved by TACE and released from cells (9, 10). In this soluble form, it behaves like a chemoattractant molecule, just as other chemokines do. The transmembrane feature of the native CX3CL1 protein, combining it with its receptor, CX3CR1, produces a strongly adhesive pair (4, 5, 11) that mediates the rapid capture and firm adhesion of leukocytes. Because this activity persists in the absence of divalent cations, it is thought to be independent of integrins (5, 11, 12). This adhesive feature is also independent of the Gi pathway, since it is still present after pertussis toxin (PTX)1 treatment (4, 5, 11).
The CX3CR1 molecule is expressed on leukocytes, especially monocytes (4) and cytotoxic cells (13, 14), on dendritic cells (15), and on neurons and microglial cells (16, 17). Recently, we identified two common polymorphisms in strong linkage disequilibrium in the CX3CR1 gene: V249I and T280M (18). We also found that these mutations are associated with more rapid progression to AIDS (18, 19), although two studies have failed to confirm this association (20, 21). A recent work indicates that these mutations are linked to earlier immunological failure in response to antiretroviral therapy (22). It seems unlikely that CX3CR1, which functions as an HIV co-receptor in vitro (2325), has the same role under pathophysiologic conditions. The effect of the mutation is probably related to the role of cytotoxic T cells, as pointed out recently (13, 14). These two mutations are also associated with reduced prevalence of acute coronary events and atherosclerosis (2628), but not with peripheral arterial diseases (29). The causal mechanism of these effects remains unclear. Previous studies, including ours, have hypothesized that the mutation might decrease the affinity of CX3CL1 to its receptor (18, 28). Moreover the CX3CR1-Ile249 variant has repeatedly been found to be expressed less often by PBMC than is CX3CR1-Val249 (18, 26). We show here that the situation is more complex. We investigated possible differences in the molecular properties of these variants and found that, although they responded similarly to soluble CX3CL1, they behaved very differently as adhesion molecules. Surprisingly, the mutated Ile249 CX3CR1 genotype was associated with enhanced adhesiveness.
CX3CR1 Variant ConstructsOpen reading frames corresponding to CX3CR1-Val249Thr280 (CX3CR1-VT) and CX3CR1-Ile249Met280 (CX3CR1-IM) were amplified from genomic DNA prepared from PBMC from two healthy donors with the corresponding genotypes. To do that, we used HindIII-tailed forward primer (LT5-CX3CR1, GCGCATATAAGCTTGCCACCATGGATCAGTTCCCTGAATCAG) and XhoI-tailed reverse primer (LT3-CX3CR1, GCGGATATGTCGACCTCGAGTCACGAGTCAGAGAAGGAGCAA). The PCR-cycling conditions were 95 °C for 5 min followed by 30 cycles at 95 °C for 1 min, 52 °C for 1 min, and 72 °C for 1 min. The PCR product was then digested with HindIII and XhoI (Promega, Charbonnières, France), subcloned into the mammalian expression vector pCDNA3.1(+) (Invitrogen, Cergy-Pontoise, France), and then sequenced on both strands with the BigDye Terminator kit (Applied Biosystems, Warrington, UK). Cell Culture and TransfectionHEK cells were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal calf serum, 1 mM sodium pyruvate, 2 mM glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin (Invitrogen). To generate stably transfected clones, we used Transfast (Promega) in accordance with the manufacturer's instructions. We transfected 106 HEK cells in 3-cm dishes with 2 µg of each pcDNA3.1 construct (Invitrogen) with CX3CR1 inserts encoding the CX3CR1 variant gene. Clones were derived by selection in 1 mg/ml G418 (Invitrogen). The clones thus obtained were assayed for CX3CL1 binding, and those expressing high levels of CX3CR1 were selected for further study. The clones were maintained in DMEM medium containing G418 and were checked with CX3CL1 binding for CX3CR1 expression before each experiment. To obtain transiently transfected HEK cells, we used JetPeiTM (cationic polymer transfection reagent, Qbiogene, Illkirch, France) in accordance with the manufacturer's instructions. We used 3 µg of each pcDNA3.1 construct to transfect 4 x 105 HEK cells in a 6-well plate. After 2 days, transfected cells were resuspended by incubation with PBS for 30 min at 37 °C and were checked with CX3CL1 binding for CX3CR1 expression before use. For CX3CL1 transfection in HEK, we used pBlast plasmid (InvivoGen, Toulouse, France) with a CX3CL1 insert or with no insert. For stable expression, clones were derived by selection in 5 µg/ml blasticidin (Euromedex, Mundolsheim, France) for at least 1 month. The clones thus obtained were assayed for CX3CL1 staining by flow cytometry, and those expressing high levels of CX3CL1 were selected for further study. The clones were maintained in DMEM medium containing blasticidin and were checked before each experiment for CX3CL1 expression by flow cytometry. PBMC were isolated from heparinized venous blood from healthy volunteers by one-step centrifugation on a Ficoll-separating solution (Biochrom KG, Berlin, Germany). Flow CytometryThe cells (105 PBMC or 2.5 x 105 HEK) were tested for CX3CR1 expression by flow cytometry after staining by fluorescein isothiocyanate (FITC)-conjugated anti-CX3CR1 monoclonal antibody (MBL, Nagoya, Japan). As a control, the cells were incubated without any antibody. We verified that this produced the same signal as an isotype antibody control. The different PBMC subsets were quantified sequentially, in 2 ways: first, by discriminating lymphocytes and monocytes according to their width and granulometry (SSC versus FSC diagram), and second, by staining with various antibodies as follows. The lymphocytes (CD3+CD4+, CD3+CD8+) and the NK cells (CD4-, CD8low, CD16+, CD56+) were analyzed with FITC-anti-CD3, phycoerythrin (PE)-conjugated anti-CD16 plus anti-CD56, and AlloPhycoCyanin (APC)-conjugated anti-CD4 or anti-CD8. The monocytes (CD3-, CD4 low, CD8-, CD14+) were analyzed with FITC-anti-CD4, PE anti-CD14, APC anti-CD8, and peridinin chlorophyll A protein (PerCP) anti-CD3. All antibodies were from BD Biosciences (Le Pont de Claix, France). FACScaliburTM performed fluorescent analysis with CellQuestProTM software (BD Biosciences). 125I-CX3CL1 Binding AssayPBMC (106 cells per sample) or HEK cells (2 x 105 or 2 x 106 cells per sample, for stable clones or transiently transfected cells, respectively) were washed in PBS and suspended in 200 µl of PBS containing 2.5 mg/ml bovine serum albumin (BSA, fraction V, Sigma) and 0.005% azide with 50 pM 125I-CX3CL1 (Amersham Biosciences) in the presence or absence of 50 nM unlabeled human CX3CL1 (TEBU, Le Perray en Yvelines, France). After 2 h at 37 °C, unbound chemokines were separated from cells by centrifugation in 1 ml of PBS supplemented with 10% sucrose. Gamma emissions were then counted in the cell pellet. For association studies, cells were incubated with 50 pM 25I-CX3CL1 under the same conditions as above (PBS+BSA+azide, 37 °C) for increasing periods of time and washed.
Calcium Response AssayIntracytoplasmic free calcium was measured with Fura-2/AM (Molecular Probes, Leiden, Netherlands). HEK cells (3 x 106) were washed once and loaded for 45 min at 37 °C, in the dark, with 2 µM Fura-2/AM and 2 µM pluronic acid in 1 ml of HBSS buffer supplemented with 10 mM HEPES, 0.5 mM MgCl2, and 1 mM CaCl2. After centrifugation, the pellet was resuspended in 2 ml of the same buffer and transferred to a quartz cuvette for reading. CX3CL1 was added to the cell volume at various concentrations. Fluorescence was monitored with a SAFAS spectrofluorometer (SAFAS S.A., Monaco) in cuvettes thermostatically controlled at 37 °C and stirred continuously. The cell suspension was excited alternately at 340 and 380 nm and fluorescence measured at 510 nm. 10-nm slit widths were used for both excitation and emission. Graphic representation of intracellular calcium concentrations were computed with Equation 1,
Chemotactic Migration AssayChemotaxis was assayed in a 96-well chemotaxis chamber with a filter porosity of 10 µm (NeuroProbe, Cabin John, MD) for HEK cells and 5 µm for PBMC. The cells were washed twice with PBS, resuspended in serum-free RPMI 1640 medium (Invitrogen) containing 5 mg/ml BSA, then labeled for 30 min at 37 °C with 5-(and-6)-carboxyfluorescein diacetate, succinimidyl ester (Molecular Probes) in RPMI 1640. Cells were then washed in PBS and resuspended in HBSS buffer supplemented with 10 mM HEPES, 0.5 mM MgCl2, and 1 mM CaCl2 (106 cells/ml). 80 µl of this cell suspension was loaded onto the filter. A final volume of 28 µl of medium with various concentrations of CX3CL1 was placed in the lower chamber. The 96-well plate was then incubated for 23 h at 37 °C, 100% humidity, and 5% CO2. The filter top surface was rinsed with PBS, and the plate centrifuged for 2 min at 1500 rpm. Fluorescence was measured with a Packard Fusion microplate analyzer (PerkinElmer Life Sciences). Parallel Plate Laminar Flow Chamber Adhesion AssayAdhesion experiments used the parallel plate flow technique and the chamber previously described (31). The coverslips we used were either cultured with adherent HEK cells (HEK-pBlast or HEK-FKN clones) or coated with CX3CL1 (Fig. 1C), as follows: the coverslip was coated with 10 µl of anti-His6 antibody (25 µg/ml in PBS plus 0.5 mM MgCl2 and 1 mM CaCl2) for 30 min at 37 °C, washed in PBS, coated with 10 µl of 100 nM CX3CL1-His6 (RnD Systems, Lille, France) for 1 h at 37 °C, and then coated with saturating solution (PBS plus 3 mg/ml BSA and 50 mg/ml sucrose) for 1 h at 37 °C. The coverslip was pressed by a screwed steel plate against a drilled plexiglass block that contained a cavity measuring 0.1 x 8 x 20 mm3 surrounded by a toric gasket (Satim, Evenos, France). The chamber was set on the stage of an inverted microscope (TE300, Nikon, France) equipped with a phase contrast 10x objective (Nikon, n.a. 0.25) and a cooled CCD camera (Sensicam, PCO, Kelheim, Germany). HEK-CX3CR1 clone cells or PBMC were suspended in PBS, incubated for 30 min at 37 °C with 1 µM 5-(and-6)-carboxyfluorescein diacetate, succinimidyl ester (Molecular Probes), for labeling and resuspended in flow buffer (HBSS supplemented with 2.5 mM EDTA, 2.5 mM EGTA, 10 mM HEPES, 2 mg/ml BSA) at 106 cells per ml for HEK clones and at 4 x 106 cells per ml for transiently transfected HEK and PBMC. For the tests assessing the impact of divalent cations, the buffer contained 0.5 mM MgCl2 and 1 mM CaCl2 rather than EGTA or EDTA. A syringe pump (PHD 2000; Harvard Apparatus, Les Ulis, France) drove 0.5 ml of cell suspension through the chamber at a wall shear stress of 1.5 dynes·cm2. The buffer was warmed to 37 °C before the syringes were filled and maintained at 37 °C by plunging the tubing into a thermostatically controlled bath. After a 10-min wash at 1.5 dynes·cm2, fluorescent images of two separate 0.5 mm2 fields were recorded to count the adherent cells (excitation 450500 nm, emission 510560 nm, dichroic filter Q505lp, Chroma, Brattleboro, VT). The shear stress was then set at 15 dynes·cm2 for 5 min, 75 dynes·cm2 for 2 min, and finally 150 dynes·cm2 for 2 min. The adherent cells were counted at each step. The number of cells was expressed as the mean of the count of the two 0.5 mm2 fields. The number of adherent PBMC cells was expressed as the percentage of the total number of CX3CR1+ injected cells, evaluated by flow cytometry with a CX3CR1-specific monoclonal antibody (MBL, Nagoya, Japan). Specific adhesion was obtained by subtracting the number of cells adhering to the HEK-pBlast coverslip from the number adhering to the HEK-CX3CR1. The results were expressed as the mean ± S.E. of four or more measurements.
Dual Pipette Aspiration TechniqueThe dual pipette adhesion assay was performed on the stage of a Leica inverted microscope, positioned on an anti-vibration platform with a digitally controlled thermostat and equipped with x10 and x63 objectives. The incubation chamber consisted of the bottom of a 90-mm Petri dish covered with the inverted bottom of a second dish of the same size. All surfaces in contact with the cells were precoated with BSA, inactivated for 3 min at 80 °C (3 mg/ml). Before the assay, the chamber was loaded with CO2-independent medium (Invitrogen) supplemented with 2 mM glutamine, penicillin (100 IU/ml), streptomycin (100 µg/ml), 2.5 mM EGTA, and 2.5 mM EDTA. To obtain an inner diameter of between 4.0 and 5.5 µm, we pulled (with a Sutter instrument, model P-2000), cut, and then fire-polished micropipettes with a homemade microforge. Before the adhesion assay, pipettes were filled with sterile isotonic sucrose solution (300330 mosM) and preincubated in BSA. Cells were manipulated with two micropipettes, each held in its own micromanipulator and connected to a combined hydraulic/pneumatic system that provided the necessary control of the aspiration force applied to the cells.
The protocol we used is very similar to that of Chien and co-workers (32). Two cells, collected by gentle aspiration onto the tip of each pipette (cell number 1 in pipette A, cell 2 in pipette B), were brought into contact through the use of the micromanipulators and allowed to remain in contact for different periods of time (Fig. 3C, 230 min). To separate the cells, aspiration in pipette B was maintained at a level sufficiently high to hold cell number 2 tightly, while the aspiration in pipette A was increased in steps measured with a pressure sensor (Validyne: model DP10338; ranging from 0 to 50,000 Pascal units). After each step, the pipettes were moved apart in an effort to detach the adherent cells from one another. A pair pulled intact from pipette A was moved back to the pipette orifice, the aspiration in the pipette was increased, and another attempt was made to detach the cells from each other. The cycle was repeated until the level of aspiration in pipette A was sufficient to pull one cell apart from the other. The aspiration employed in each cycle was monitored continuously. In most cases, cell deformation and contact area variation during the separation process were very limited (less than 20% for the contact area), and the separation took place suddenly, in less than a tenth of a second. The cells appeared to behave more like rigid structures than like two adhering deformable capsules. The usual approach (33, 34) of measuring contact angles at the end of the pipette and at the edge of the contact thus did not seem useful. The separation force (F) for rigid structures can be deduced from the data.2 The values recorded for each of the last two cycles in the series (Pn1 and Pn) were used to calculate F for the pair tested, with Equation 2,
Western Blot Analysis of p44/42 MAP Kinase Phosphorylation HEK cells were starved for 18 h in DMEM without SVF and suspended at 107 cells/ml in RPMI 1640 medium supplemented with 1 mM HEPES and 1 mg/ml BSA. After addition of 50 nM CX3CL1 for the indicated time, the samples (106 cells) were washed in 1 ml of PBS at 4 °C. Pellets were resuspended in 20 µl of Tris, 20 mM, pH 7.5, 1 mM EDTA 1 mM orthovanadate, 25 mM NaF, 5 mM pyrophosphate (Sigma), and 1 mM dithiothreitol supplemented with Complete protease inhibitor from Roche Applied Science for 30 min at 4 °C. Nuclear and cellular debris were removed by centrifugation for 10 min at 10 000 x g. The samples were then assayed for protein content, diluted in sample buffer (50 mM Tris, pH 7, 3% SDS, 10% glycerol, 5% 2-mercaptoethanol, and bromphenol blue) and heated for 3 min at 95 °C. Proteins were separated by standard SDS-PAGE. Gels were electrotransferred to Hybond-P nitrocellulose membrane (Amersham Biosciences), and the blots probed with polyclonal antibodies raised against phospho-p44/42 MAP kinase (Thr202/Tyr204) or p44/42 MAP kinase (Cell Signaling, New England Biolabs, Hitchin, UK) in accordance with the manufacturer's instructions. For detection, we used horseradish peroxidase-conjugated goat anti-mouse IgG (Bio-Rad) and an enhanced chemiluminescence detection system (Amersham Biosciences), in accordance with the manufacturer's instructions, on Curix Blue x-ray film (Agfa, Mortsel, Belgium). LY-294002 and PD-98059 (2'-amino-3'-methoxyflavone) were purchased from New England Biolabs and Biomol, respectively.
Enhanced Cell Adhesive Functioning for PBMC That Express CX3CR1-IMWe used the parallel plate adhesion method to compare the adhesion of PBMC from donors with different CX3CR1 genotypes to a monolayer of CX3CL1-expressing HEK. At low perfusion rates (1.5 dynes·cm2), we repeatedly found that cells from donors heterozygous for the 249 and 280 positions (VI-TM) of CX3CR1 (Fig. 1A, solid squares) were captured in significantly larger numbers than cells from those homozygous for the wild-type genotype (VV-TT) (Fig. 1A, solid triangles). Cells from individuals with both genotypes began to dissociate at a shear stress higher than 1520 dynes·cm2 (Fig. 1A, solid symbols). Nonspecific adhesion, i.e. capture on CX3CL1-negative HEK cells, was very low and very similar for cells of both genotypes (Fig. 1A, open symbols). Pretreatment of PBMC with 100 nM CX3CL1 for 45 min at 37 °C almost totally abolished the adhesion, which indicates that PBMC capture by CX3CL1+ HEK was mostly specific for the CX3CR1/CX3CL1 pair and operated through the interaction between the two molecules. Moreover, our adhesion experiments were performed in the presence of divalent chelators to prevent the activity of other adhesion molecules, such as integrins, that are Ca2+- and Mg2+-dependent. Finally we tested the PBMC adhesion with a more physiological type of CX3CL1+ cell: our results were similar when the CX3CL1+ HEK layer cells were replaced by a smooth muscle aortic cell line that expresses CX3CL1 after pretreatment with TNF and INF (35, 36) (data not shown). The differences we observed in the adhesion behavior of cells with these CX3CR1 variants were not due merely to differences in receptor expression. Instead, we found that the frequency of CX3CR1+ cells was regularly lower in PBMC with the CX3CR1-VI-TM than in cells expressing the nonmutated receptor CX3CR1-VV-TT (Table I). Similarly, the 125I-CX3CL1 binding assay indicated that, as we noted previously (26), cell suspensions with the CX3CR1-VI-TM genotype had only 67 ± 11% (n = 7) as many binding sites (Bmax) as suspensions with CX3CR1-VV-TT cells. Yet, although there were fewer CX3CR1+ cells, there were more cells adhering to membrane CX3CL1. The effect of CX3CR1 mutations was therefore underestimated. Accordingly, we expressed the specific adhesion by calculating the ratio of CX3CR1+ cells specifically adhering to membrane CX3CL1 (see "Experimental Procedures"). Fig. 1B reports PBMC-specific adhesion for each CX3CR1 allele. No significant differences in adhesion were observed between the PBMC expressing CX3CR1 that differed only at the 280 position (Fig. 1B, compare VI-TT with VI-TM and II-TM with II-MM). In contrast, the Ile249 substitution appeared crucial. Adhesion was already significantly greater with the PBMC from heterozygous VI-TT individuals than from the VV-TT homozygote (Fig. 1B). Moreover, PBMC from carriers homozygous for position 249 (i.e. II-TM and II-MM, Fig. 1B, right) adhered significantly more than PBMC from heterozygous (i.e. VI-TT and VI-TM, Fig. 1B, center) donors. The amplitude of extra adhesion therefore appears to be directly correlated with the number of Ile249 alleles, according to a simple gene dosage effect.
To verify the absence of nonspecific cell-cell interaction, we performed experiments with immobilized CX3CL1. We found that PBMC from CX3CR1-VI-TM donors adhered to coverslip coated with recombinant CX3CL1 at a rate more than twice that of cells from CX3CR1-VV-TT individuals, and this was the case regardless of the presence of divalent cations (Fig. 1C, solid bars). This confirms that the excess adhesion in the presence of the Ile249Met280 CX3CR1 mutations is due solely to its interaction with the CX3CL1 ligand. More specifically, it demonstrates that the phenomenon is independent of the divalent ions as is the basal adhesion caused by the CX3CR1-VV-TT molecule (5, 11, 12) (see Fig. 1C, open bars). Finally, we assayed the chemotactic migration of PBMC from individuals with the CX3CR1-VV-TT and CX3CR1-VI-TM genotypes (Fig. 1D). Surprisingly, no difference was detected between these variants in response to soluble CX3CL1, in contrast to the notable differences in their responses to membrane-anchored CX3CL1 (Fig. 1, AC). It thus appears that these CX3CR1 variants can discriminate between the two forms of the ligand. The enhanced adhesiveness of the mutated CX3CR1 was observed with whole PBMC. We then considered whether this effect was specific for a single leukocyte population. Phenotyping the adherent PBMC revealed that all the CX3CR1+ PBMC subpopulations (i.e. monocytes, NK, CD4+, and CD8+ lymphocytes) contributed to this effect in similar proportions (Fig. 1E). This indicates that the excess adhesion we observed is caused by the intrinsic potency of the mutated CX3CR1. We checked this finding further with purified monocytes from various individuals. We found that CX3CR1-VI-TM monocytes adhered at a rate three times higher than the CX3CR1-VV-TT monocytes (data not shown). In contrast, both monocyte populations were indistinguishable in their chemotactic response to CX3CL1. These findings agree with those obtained with whole PBMC (Fig. 1D). We therefore concluded that the excess adhesion we observed with PBMC bearing the Ile249 CX3CR1 allele (Fig. 1B) was not specific to one particular leukocyte subpopulation, but occurs once the mutation is present. Moreover, this change can only be observed when CX3CR1 binds the membrane form of CX3CL1 (Fig. 1, AC) and not in response to its soluble form (Fig. 1D). Enhanced Cell Adhesive Functioning for HEK Clones That Express CX3CR1-IMTo characterize the adhesive properties of the CX3CR1 variants further, we generated HEK clones expressing the wild-type (CX3CR1-VT) and mutated (CX3CR1-IM) forms of the receptor. Using flow cytometry, we confirmed that the clones we chose expressed similar levels of CX3CR1 isoforms (Fig. 2, A and B). Using 125I-CX3CL1 binding, we found that the mean expression of CX3CR1-IM (Bmax) was slightly lower than that of CX3CR1-VT (84%± 19%, n = 8). Finally, using competition experiments (Fig. 2C; Ki = 0.95 ± 0.45 nM for CX3CR1-VT and 0.86 ± 21 nM for CX3CR1-IM, n = 4) and association kinetics (Fig. 2D; k+ = 0.183 ± 0.028 min1 for CX3CR1-VT and 0.178 ± 0.024 min1 for CX3CR1-IM, n = 4), we found that both CX3CR1 variants displayed similar affinity for soluble CX3CL1. Similar results were obtained with the dissociation kinetic assay (data not shown).
Two different clones of each type were tested independently with flow adhesion. As with PBMC, the clones expressing CX3CR1-IM (Fig. 3A, solid circles) adhered more than those expressing CX3CR1-VT (Fig. 4A, solid triangles): the number of CX3CR1+ HEK cells adhering specifically to membrane CX3CL1 at a low perfusion rate (1.5 dynes/cm2) was almost twice as high for the mutated CX3CR1-IM form than for the standard CX3CR1-VT. Both types of clones began to dissociate at shear stress higher than 1520 dynes·cm2, as previously reported (5, 11). Nonspecific adhesion of the clones was assessed with a CX3CL1-negative adherent cell layer (Fig. 3A, open triangles and circles). A control HEK clone expressing the chemokine receptor CCR5 adhered equally poorly to the CX3CL1-expressing cells (Fig. 3A, diamonds). Moreover, the adhesion of the HEK clones that expressed CX3CR1 was almost wholly suppressed when the cells were preincubated with soluble CX3CL1 for 45 min at 37 °C (data not shown). Again this indicates that this adhesion is specific to the CX3CR1/CX3CL1 pairing.
We verified that no particular property selected by clone generation caused these adhesion features in the stable HEK clones: they were also found with HEK transiently transfected with either CX3CR1-VT or CX3CR1-IM plasmids (Fig. 3B, compare VT and IM). In addition, we assayed the HEK transfected with the CX3CR1 plasmid carrying only the V249I mutation, i.e. CX3CR1-IT. Surprisingly these cells adhered at a rate similar to that of the double mutant CX3CR1-IM (Fig. 3B). Moreover the cells expressing the no naturally occurring variant CX3CR1-VM adhered at a rate similar to that observed with CX3CR1-VT cells (Fig. 3B). These findings provide further support for the hypothesis that the excess adhesion is due only to the mutation at position 249. To confirm and quantify this enhanced adhesion with the CX3CR1-IM variant, we used another cell-cell adhesion assay, the dual pipette aspiration technique, previously used to verify CTL target adhesion (32). Briefly, this method consists in determining the force required to dissociate a pair formed by two cells brought into contact by micropipettes. The dissociation force is measured at a given time after pair formation. We found that paired CX3CR1-VT/CX3CL1 HEK cells adhered after only 2 min of contact with a separation force of about 6 nanoNewtons (Fig. 3C, solid triangles), at a level similar to the intercellular adhesiveness due to N-cadherins.3 This CX3CR1-VT/CX3CL1 adhesion was independent of time, as expected from previous data (4, 5, 11), and lasted for 30 min without attenuation (Fig. 3C, solid triangles). After 2 min of contact, the strength of the CX3CR1-IM/CX3CL1 axis was similar to that of the CX3CR1-VT/CX3CL1 pair. In contrast, after contact of 4 min or more, the cells expressing CX3CR1-IM adhered more strongly to the CX3CL1+ cell partners, thereby requiring a dissociation force of 1012 nanoNewtons, i.e. about twice as high as for CX3CR1-VT (Fig. 3C, solid circles). This did not weaken within 30 min of testing. The nonspecific adhesion of both CX3CR1 clones to CX3CL1-negative cells was weak (<2 nanoNewtons) for all the time periods tested (data not shown), as was the adhesion of a HEK clone transfected with a control receptor (CCR5) to cells expressing CX3CL1 (Fig. 3C, diamonds). Similar low adhesion was obtained with the CX3CR1/CX3CL1 cell pair, when the CX3CR1+ clones were pretreated for 45 min at 37 °C with soluble CX3CL1 (data not shown). As with the parallel plate flow adhesion technique, these experiments were performed in the absence of divalent cations. In their presence, however, we also observed a difference between the dissociation forces measured with two CX3CR1 variants, but only after 30 min of cell to cell contact (data not shown). We tested the chemotactic responses of the transfected HEK cell clones to the CX3CL1 gradient. As with PBMC (Fig. 1D), we found no differences between the clones expressing the two CX3CR1 variants (Fig. 3D).
The Excess Adhesion Caused by the Mutated CX3CR1 Is PTX-dependentAlthough most signals triggered by CX3CR1 ligation with the soluble CX3CL1 are G-protein-dependent, the adhesive properties of the CX3CR1/CX3CL1 pair are independent of the Gi pathway, i.e. they are still present after PTX treatment (4, 5, 11). We confirmed this finding here with flow chamber dynamic adhesion assays that used PBMC from CX3CR1-VV-TT donors (Fig. 4A, open bars) or HEK cells expressing CX3CR1-VT (data not shown). Surprisingly, the adhesion observed with cells expressing the CX3CR1-IM variant was reduced after PTX treatment to the level observed with the CX3CR1-VT (Fig. 4A, solid bars). The same result was observed with PBMC adhering to immobilized CX3CL1, either in the presence or absence of divalent ions (data not shown) or using the dual pipette assay with HEK cell pairs (Fig. 4B). This result suggests that the adhesive feature of the mutated CX3CR1 is composed of two additive events: one basal adhesion common to both variants and one specific to the CX3CR1-IM conformation. In contrast, the excess adhesion obtained with the CX3CR1-IM haplotype was insensitive to other pharmacological agents, including LY-294002 and PD-98059, which inhibit, respectively, phosphatidylinositol 3-kinase and p44/42 MAP kinase enzymes (data not shown). Signaling Pathways Mediated by CX3CR1 VariantsPossible differences between the CX3CR1 variants were tested by assaying two other cellular responses. We first examined the calcium response of HEK cell clones that expressed each of the CX3CR1 variants (Fig. 5A); the dose-response curves were indistinguishable. We also tested the activation of the cellular MAP kinase pathway, which CX3CL1 triggers in neurons (37), intestinal epithelial cells (38), microglia cell lines (16), and monocyte cell lines (39). In both of our HEK cell line clones, the maximum p44/42 MAP kinase stimulation was reached within 2 min of CX3CL1 application (Fig. 5, B and C). The extent of MAP kinase phosphorylation was slightly higher in the CX3CR1-IM than in the VT HEK clone (Fig. 5, B and C), but the difference was not statistically significant.
In view of its effect on prognosis in AIDS (18, 19) and in cardiovascular diseases (2628), understanding the molecular modifications caused by the chemokine receptor CX3CR1-IM mutation is an important challenge. We found here that intercellular adhesion mediated by the CX3CR1/CX3CL1 pair was substantially greater with cells that express the CX3CR1-IM variant than with those expressing the CX3CR1-VT variant (Figs. 1, 3, and 4). Moreover, the data from both PBMC (Fig. 1B) and HEK (Fig. 3B) indicate that the V249I mutation alone is responsible for the high level of adhesion we observed. Finally, adhesion mediated by CX3CR1-IM was independent of divalent ions and involved only CX3CL1 as counterligand (Fig. 1), as was the adhesion mediated by CX3CR1-VT (5, 11, 12). This surprisingly enhanced adhesiveness of the CX3CR1 variant was demonstrated with two different techniques that determined distinct indicators. The parallel plate method furnishes the fraction of adhering cells under shear stress, while the dual pipette procedure directly assesses the force required to dissociate cell pairs under axial stress. Both techniques indicate that the CX3CL1-specific adhesion force generated by the CX3CR1-IM variant is significantly greater than that induced by the CX3CR1-VT genotype. Moreover, the dual pipette procedure indicates that this excess adhesion occurs slowly, after a few minutes, thereby suggesting that the adhesive potency of CX3CR1-IM results from the addition of two phenomena: first, immediate adhesion, as observed for CX3CR1-VT, followed by a time-dependent attachment that seems specific to CX3CR1-IM. This slow time course may point to a signaling-dependent mechanism, a hypothesis supported by our experiments with PTX (Fig. 4). Thus the mutated CX3CR1 form may specifically trigger a signal that, added to the basal and instantaneous adhesion because of the CX3CR1/CX3CL1 interaction, yields excess adhesion. Although our data show that MAPK-p44/42 activation is somewhat higher in CX3CR1-IM cells (Fig. 5, B and C), the testing of specific inhibitors ruled out the involvement of the MAP kinase-dependent and the phosphatidylinositol 3-kinase pathways in generating this extra adhesion. The enhanced adhesiveness of the CX3CR1-IM variant was observed in both transfected HEK cells and peripheral blood cells. All the CX3CR1+ PBMC subpopulations adhered to membrane CX3CL1 (5) and showed enhanced adhesiveness when they had the CX3CR1-IM haplotype (Fig. 1, B and E). The association of the CX3CR1-IM genotype with a reduced risk of cardiovascular disease was previously thought to be due to the receptor's reduced capacity to bind its ligand, and frozen PBMC from HIV patients with a mutated genotype showed less ligand affinity (18). A recent report proposes that the Ile249 mutation is associated with a promoter mutation that may result in differential CX3CR1 expression (40). This might explain the significantly lower number of receptors per cell on PBMC from VI compared with VV donors (Refs. 18 and 26 and this report). It cannot, however, account for the excess adhesion we observed here. Our experiments indicate that the differences we observed between CX3CR1 variants are due to intrinsic molecular properties. While our article was under review, a study appeared, reporting that CX3CR1-IM cells have globally impaired responses to CX3CL1, i.e. ligand binding and calcium response, as well as impaired adhesive and chemotactic functions (28). We cannot account for these discrepancies in the responses to soluble CX3CL1 observed in transfected HEK cells (ligand binding, calcium mobilization). It is conceivable that, under different manipulation conditions, the CX3CR1-IM cells might respond somewhat less than the CX3CR1-VT cells. These discrepancies do not really affect our main conclusion. On the other hand, the adhesion data from this report also diverge sharply from ours: the adhesion to an endothelial cell line of K562 cell line transfected with CX3CR1-IM was far lower than that of K562 cells transfected with CX3CR1-VT (28). In contrast, our data were obtained with both PBMC and transfected HEK cell lines in an adhesion assay over immobilized CX3CL1 as well as different layer cells (HEK and smooth muscle cells). Moreover, we performed a supplementary parallel plate adhesion test with either PBMC or transiently transfected K562 cell line using precisely the McDermott's method, i.e. a loading phase at a shear stress of 0.25 dynes·cm2 instead of 1.5 dynes·cm2, a progressive washing and a final wash at 10 dynes·cm2 instead of 15 dynes·cm2. In these conditions, we still observed the excess adhesion of the CX3CR1-IM-expressing cells (data not shown). We should state moreover that this extra adhesion was observed with two different techniques (Fig. 4). It is not impossible that some features of the cell lines used by McDermott et al. (binding sites per cell, actual signaling pathways, adhesion molecules on the 926 endothelial cell line) may explain the discrepancies with our data. The identification of the various steps underlying the CX3CR1-IM effect may illuminate the divergences between these reports.
Our study implies that CX3CR1 behaves differently when addressing soluble or membrane ligand. A similar difference was recently observed for IFN
To our knowledge, our study is the first to report a chemokine receptor mutation associated with increased functions. It appears to originate in a single mutation, replacement of a valine residue by an isoleucine at position 249. This increase in functioning seems to be mediated by gene dosage (Fig. 1B) rather than by a dominant effect. Further studies are nonetheless needed to ensure that the Met280 position is not implicated using PBMC from CX3CR1-II-TT donors and HEK stably transfected with CX3CR1-IT and CX3CR1-VM. For now we can only speculate as to why or how a semi-conservative mutation (Val to Ile) has so dramatic an outcome. Recent structural studies describing the conformation changes in G-protein-coupled receptors (46, 47) often note that the relative movement of helices 6 and 7, where the CX3CR1 natural mutations are located, appears to play an important role. These helices may also be involved in the potential dimerization interface between G-protein-coupled receptor monomers (48). Recent reports show that inactivating the CX3CR1 gene leads to a decrease in the risk of atherogenesis (49, 50). It was therefore paradoxical to find that mutations that appear to protect against cardiovascular diseases (2628) actually enhance the molecule's adhesive properties. The monocytes recruited in the intima layer to form atherosclerotic plaque should first adhere and cross the endothelium barrier (51, 52). The reduction of this transmigration step in the presence of CX3CL1 (53) indicates that the adhesion function of CX3CL1 may counteract the migration driven by inflammatory chemoattractants. It is thus conceivable that excess adhesion might further diminish monocyte extravasation and hence weaken atherogenesis. The additional adhesion we observed may also be involved in NK or CTL cell target interactions in ganglia, especially in HIV patients. The lymph nodes of such patients overexpress CX3CL1 (54), while disease severity is correlated with CX3CR1 expression (14). Hence, the excess adhesion we describe here may profoundly affect both innate and acquired immunity.
* This work was supported in part by Grant 7516 from the Association pour la Recherche sur le Cancer (to P. D.), by the French Ministry of Research (ACI Jeunes Chercheurs, to C. C.), and by the French Association for AIDS Research (ANRS). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 The abbreviations used are: PTX, pertussis toxin; AIDS, acquired immunodeficiency syndrome; BSA, bovine serum albumin; DMEM, Dulbecco's modified Eagle's medium; HBSS, Hank's balanced saline solution; HEK, human embryonic kidney cell line clone 293; HIV, human immunodeficiency virus; MAP, mitogen-activated protein; PBMC, peripheral blood mononuclear cells; PBS, phosphate-buffered saline; FITC, fluorescein isothiocyanate.
2 Y.-S. Chu, S. Dufour, J. P. Thiery, E. Perez, and F. Pincet, submitted manuscript.
3 S. Dufour, personal communication.
4 A. Bourdais and P. Deterre, unpublished data.
5 S. Faure, P. Deterre, and C. Combadière, unpublished data.
We thank Véronique Ollivier for providing us with smooth muscle cell lines, Cédric Lécureuil for help with the flow cytometry, Jean-Pierre Lagarde for help in sequencing plasmid constructions, and Eric Perez for continuing support.
This article has been cited by other articles:
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||