Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M400070200 on February 25, 2004

J. Biol. Chem., Vol. 279, Issue 19, 20028-20034, May 7, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/19/20028    most recent
M400070200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hendzel, M. J.
Right arrow Articles by Th'ng, J. P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hendzel, M. J.
Right arrow Articles by Th'ng, J. P. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The C-terminal Domain Is the Primary Determinant of Histone H1 Binding to Chromatin in Vivo*

Michael J. Hendzel{ddagger}§, Melody A. Lever{ddagger}, Ellen Crawford{ddagger}, and John P. H. Th'ng¶||

From the {ddagger}Cross Cancer Institute and Department of Oncology, University of Alberta, Edmonton, Alberta T6G 1Z2, and Northwestern Ontario Regional Cancer Center, Thunder Bay, Ontario P7B 6V4, Canada

Received for publication, January 5, 2004 , and in revised form, February 23, 2004.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We have used a combination of kinetic measurements and targeted mutations to show that the C-terminal domain is required for high-affinity binding of histone H1 to chromatin, and phosphorylations can disrupt binding by affecting the secondary structure of the C terminus. By measuring the fluorescence recovery after photo-bleaching profiles of green fluorescent protein-histone H1 proteins in living cells, we find that the deletion of the N terminus only modestly reduces binding affinity. Deletion of the C terminus, however, almost completely eliminates histone H1.1 binding. Specific mutations of the C-terminal domain identified Thr-152 and Ser-183 as novel regulatory switches that control the binding of histone H1.1 in vivo. It is remarkable that the single amino acid substitution of Thr-152 with glutamic acid was almost as effective as the truncation of the C terminus to amino acid 151 in destabilizing histone H1.1 binding in vivo. We found that modifications to the C terminus can affect histone H1 binding dramatically but have little or no influence on the charge distribution or the overall net charge of this domain. A comparison of individual point mutations and deletion mutants, when reviewed collectively, cannot be reconciled with simple charge-dependent mechanisms of C-terminal domain function of linker histones.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Histone H1 is the fifth histone subtype and is not one of the histones that form the histone octamer of the nucleosome. Rather, histone H1 binds to the surface of the nucleosome and interacts with nucleosomal DNA at the entry and exit points (1). In doing so, histone H1 is critical in determining the higher-order folding states of chromatin. Because of this property, histone H1 has traditionally been considered a general repressor of transcription (3). Consistent with this hypothesis, histone H1 was found to be modestly depleted in transcriptionally active genes (46). More recently, genetic studies have revealed contributions of H1 histones to the establishment of epigenetic silencing (710). In addition to a structural role, histone H1 also functions in gene-specific regulation. A large number of studies have demonstrated that H1 histones or specific variants are directly involved in the regulation of specific genes (3, 1114), consistent with the observation of differential gene expression when the sole histone H1 gene was knocked out in Tetrahymena thermophila (15).

The structure of H1 histones is typically considered to consist of three separate domains (16). A short stretch of amino acids on the N terminus and a much larger stretch that comprises the C terminus show significant variability between individual subtypes as well as between species. The amino and carboxyl termini have diverged considerably throughout the evolution of metazoans (17). If we restrict the analysis to mammals, the C termini diverge between individual histone H1 variants, but the sequences of the individual C termini are well conserved between species. When histone H1 sequences are examined in a broader range of species, the centrally located region of the protein, the globular domain, is the most highly conserved region among H1 histone family members (18). The structure of the central region of the protein has been solved by x-ray crystallography (19) and is sufficient for binding to the nucleosome in vitro (20). However, studies with reconstituted systems showed that the C-terminal domain (CTD)1 is required to condense chromatin into higher order structures (16, 23). This is also consistent with the presence of only C-terminal-like domains in some protists.

Because of the high density of positively charged amino acids within the CTD, it is commonly believed that condensation is mediated through charge-neutralization of the negatively charged linker DNA. In a recent study, Lu and Hansen (22) found that the ability of histone H1° to stabilize chromatin folding was not evenly distributed; rather, it was localized to two specific subdomains in the CTD. Because the density of positively charged lysine and arginine amino acids is very similar throughout the ~100 amino acids of the C terminus, binding does not correlate in a simple manner with the abundance of positively charged amino acids within the domain. Lu and Hansen (22) proposed that histone H1 initially binds with low specificity in a charge-dependent manner. Upon binding to the DNA, the C terminus then acquires secondary structure. This feature of protein folding has been described as "intrinsic disorder." This mechanism of histone H1 binding contrasts with the binding properties that would be expected if histone H1 were to function according to the "charge patch" hypothesis. The charge patch hypothesis proposes that the clustered positively charged lysines in the C-terminal domain bind DNA and facilitate condensation through neutralization of phosphates on the DNA (24, 25). Although this mechanism of binding may apply to the evolutionarily divergent H1 of T. thermophila, recent structural studies of histone H1s from mammals indicate that regions within the C-terminal domain adopt an {alpha}-helical structure when associated with DNA (2628). Molecular modeling techniques also predict the adoption of secondary structure in the C terminus of histone H1 (21). More specifically, the modeling studies reveal that the C terminus may adopt an high mobility group-box-like structure, and that the C terminus SPKK motifs are sites of DNA binding and function in the compaction of the DNA (21).

We and others have previously used fluorescence recovery after photobleaching (FRAP) to quantify the binding of histone H1 proteins in living cells (2931). These studies revealed that histone H1 binds transiently to the chromatin of living cells. In this study, we quantify the specific contributions of the N- and C-terminal domains of histone H1.1 as well as the T/SPXK motifs in the CTD to the in vivo chromatin binding affinity of histone H1. We find that the C-terminal domain of histone H1 plays a major role in defining the affinity of histone H1 binding in vivo.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—SK-N-SH cells were cultured in Dulbecco's modified Eagle's medium in the presence of 10% fetal calf serum. The cells were transfected using LipofectAMINE 2000 (Invitrogen) according to the manufacturer's instructions. Cells were selected for stable incorporation of the plasmids by selection for 2 weeks in the presence of G418, and cells that stably expressed the fluorescent histone H1.1 were sorted and used in FRAP studies.

FRAP Analyses—Fluorescence recovery after photobleaching was performed using a Zeiss LSM 510 confocal microscope as detailed previously (29). Each experiment shows the results of at least 20 nuclei collected from three separate experiments. The standard deviations are not shown but are typically less than 5% for each time point.

Site-directed Mutagenesis—Cloning of histone H1.1 (GenBank accession no. X57130 [GenBank] ) was described by Lever et al. (29). Mutations of threonine and serine sites on histone H1.1 was performed by sequential PCR as described in the Current Protocols in Molecular Biology. Primers for PCR were synthesized by Sigma Genosys. The sequences of the primers employed to generate mutations were: T152A, CGTCAAGGCTCCGAAAAAGG and CCTTTTTCGGAGCCTTGACGC; T152E, GCGTCAAGGAACCGAAAAAGG and CCTTTTTCGGTTCCTTGACGC; T152K, GCGTCAAGAAACCGAAAAAGG and CCTTTTTCGGTTTCTTGACGC; S183A, GTAGCTAAAGCCCCTGCTAAAGC and GCTTTAGCAGGGGCTTTAGCTAC; S183E, GTAGCTAAAGAACCTGCTAAAGC and GCTTTAGCAGGTTCTTTAGCTAC; and S183K, GTAGCTAAAAAACCTGCTAAAGC and GCTTTAGCAGGTTTTTTAGCTAC. The PCR products were first cloned into pCR2.1 vector using the TA Cloning kit (Invitrogen) and then directionally subcloned into pEGFP-N1 or pEGFP-C1 (BD Biosciences Clontech). Sequencing of PCR products to verify the mutations were performed by Guelph Molecular Supercenter and the Paleo-DNA Laboratory (Lakehead University).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Variation in Amino Acid Sequence among Human Histone H1 Subtypes—The conserved features of all of the histone H1 variants include: 1) a central domain, 2) a large carboxyl terminus rich in proline, lysine, and arginine, and 3) serine/threonine kinase phosphorylation sites within the carboxyl-terminal domain. The C-terminal domain, which constitutes more than half of the total mass of the H1 protein, accounts for most of the sequence heterogeneity between histone H1 variants (18), and this domain was shown to be essential for high affinity in vivo binding to chromatin (29, 30). Fig. 1 shows the amino acid alignment of the C-terminal domains of individual histone H1 subtypes of human and mouse. Each subtype has multiple cyclin-dependent kinase-specific motifs, up to five in histones H1.4 and H1.5 (four in the C-terminal tail and one at the N terminus). The specific lysines predicted to bind and compact the "linker" DNA (21) are highlighted in green.



View larger version (91K):
[in this window]
[in a new window]
 
FIG. 1.
Sequence alignment of the C termini of mouse and human histone H1 variants. The individual histone H1 variants were aligned using ClustalW. The translucent yellow boxes superimposed on the consensus sequence indicate the S/TPXK phosphorylation motifs. The red dots indicate the positions of the lysines in rat histone H1d that are predicted to make specific contacts with the linker DNA as it enters and exits the nucleosome. The colors are used to categorize the amino acids into basic (orange), proline (green), polar (blue), acidic (purple), and nonpolar (yellow).

 
To define the role of phosphorylation in regulating histone H1 binding in vivo, we chose to examine histone H1.1 (also named histone H1a and histone H1S5 (32)). This H1 subtype has only two C-terminal cyclin-dependent kinase-specific sites, which reduces the complexity of determining the effects of phosphorylation on histone H1 binding to chromatin binding in vivo. Recent studies of rat histone H1d binding to chromatin in vitro (33) and a number of recent structural and molecular modeling studies now predict that the C-terminal domain of histone H1 is structured when bound to DNA and chromatin (26, 27). The lysines predicted by molecular modeling (21) to interact with the DNA within the chromatosome are highlighted as red dots in Fig. 1. In this instance, the Thr-152 site aligns with a conserved TPKK site in which both lysines are predicted to binding extranucleosomal DNA. The conserved SPAK site at Ser-183 in histone H1.1 is four amino acids away from the last two lysines mapped as DNA contacts in the molecular model. If histone H1 adopts a more structured C terminus, the phosphorylation of either or both sites within the C terminus of histone H1.1 may have a much greater impact on histone H1 binding in vivo. The substantial increase in histone H1.1 residency time on chromatin after treatment with the general kinase inhibitor, staurosporine, is consistent with a phosphorylation-dependent destabilization of chromatin binding in living cells (29). To address these unresolved questions related to histone H1 structure and function, we designed experiments to further define the specific contributions of individual regions of histone H1 protein to chromatin binding in living cells.

C-terminal GFP Fusion Reduces the Affinity of Histone H1 Binding—Fluorescence recovery after photobleaching was used to measure the binding affinity of green fluorescent protein (GFP)-tagged histone H1 bound to chromatin in living cells. We began by measuring the fluorescence recovery rates of histones containing N- or C-terminal tails modified by fusion to GFP and by introducing specific deletions. Fig. 2 shows the relative recovery rates of GFP-tagged histone H1.1 protein stably expressed in SK-N-SH neuroblastoma cells. The two full-length forms of histone H1.1 bound with the highest affinity to the endogenous chromatin. However, when the GFP tag was placed on the C terminus, the recovery rate was faster than when the tag was at the N terminus. The reduction of binding caused by the C-terminal fusion was almost as great as that seen when the N-terminal domain was deleted. Deletion of the N terminus significantly reduced the binding affinity of the histone H1.1; the C-terminal placement of the GFP bound with a lower affinity than that obtained when the GFP was placed at the N terminus. When staurosporine was added to inhibit kinase activity, the recovery time was increased by about 2-fold (see also Fig. 5). When the C terminus was deleted, the GFP-histone H1.1 deletion protein did not bind well and recovered at rates approaching diffusion. Based on these findings, subsequent studies were done with the histone H1.1 cloned into pEGFP-C1, placing the GFP at the N terminus to minimize possible interference.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 2.
Influence of flanking domains on the relative rates of recovery of histone H1.1. Individual constructs of GFP-tagged histone H1.1 were transfected into SK-N-SH cells, and stable transfectants were used to measure fluorescence recovery after photobleaching (FRAP) of the fluorescent histone. The time in seconds required to achieve 50% fluorescence recovery (T(1/2)) was plotted in the presence and absence of staurosporine. Constructs of histone H1.1 employed in the study had the GFP fused at either the N terminus (gfpH1.1) or the C terminus (H1.1gfp). H1.1DCgfp, histone H1, where histone H1.1 has its CTD replaced by the green fluorescent protein; gfpH1.1DC, histone H1 with the GFP fused to the N terminus of a histone H1.1 construct with the C terminus deleted; DNH1.1gfp, histone H1.1 with a deleted N terminus and the GFP fused to the C terminus; GfpDNH1.1, histone H1.1 with its N terminus replaced by the GFP.

 



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 5.
The effect of double mutations to alanine or glutamic acid on histone H1.1 mobility. FRAP measurements of the mobility of histone H1.1 containing Thr-152 and Ser-183 mutated to either glutamic acid (T152ES183E) or alanine (T152AS183A). The plot shows the relative recovery of fluorescence versus time after photobleaching for each mutant. The full-length histone H1.1 is included as a reference for evaluating relative mobilities.

 
FRAP Analysis of C-terminal Deletions of Histone H1.1—To further define the contribution of the C terminus to histone H1.1 binding in vivo, we initiated a series of FRAP experiments to quantitatively define the contributions of the two C-terminal phosphorylation sites. Within this C-terminal region of histone H1.1, there reside two S/TPXK sites that are phosphorylated by cyclin-dependent kinases (34). These motifs are of particular interest because the commonly repeated sequence SPKK is known to bind DNA in vitro (35). The possibility that these motifs might be ideally positioned to play a critical role in both DNA binding and histone H1-dependent condensation of the chromatin can be inferred from computational predictions of the structure of both the C-terminal domain in association with DNA and the C-terminal domain positioned within the chromatosome (21, 33, 36).

We first examined the contributions of the individual regions of the C-terminal tail using partial deletion mutants of human histone H1.1. Deletion of amino acids 183–214 resulted in a protein that has reduced binding affinity and allows the photobleached region to be replaced in approximately half the time (Fig. 3B), showing that this terminal region of the CTD contributes to the binding to chromatin. Further C-terminal deletions up to lysine 151 resulted in a protein that bound to chromatin with much less affinity and recovered in less than 10% of the time required for the full-length protein (Fig. 3B). When these recovery curves were re-plotted using the log of time of recovery, the largest deletion had a recovery profile that presented as a straight line (Fig. 3C). In contrast, both the 183 deletion and the full-length protein resolved into two kinetic populations in these plots. This may reflect the kinetic footprints of two distinct binding events involved in stabilizing the association of the globular domain with the surface of the nucleosome.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3.
Reduction in chromatin binding of histone H1.1 with truncated CTD. A, sequence alignment of the C-terminal regions of rat histone H1d and human histone H1.1. The lysines highlighted in yellow are predicted to make specific contacts with the DNA. The motifs highlighted in green represent the conserved phosphorylation sequences, except for the conserved SPAK site, which is highlighted in blue. The position of an additional lysine predicted in the histone H1d chromatosome model to specifically contact the DNA is highlighted in red. B, FRAP recovery curves obtained from cells stably transfected with full-length histone H1.1 or histone H1.1 containing deletions up to and including the phosphorylation sites at Thr-152 (Del152) and Ser183 (Del183). The plot shows the relative recovery of fluorescence in the photobleached region versus time. C, the data from B is re-plotted versus the log of time. The error bars show 1 S.D.

 
Glutamic Acid Mutation of Thr-152 and Ser-183—Although the deletion analyses showed that the regions from Thr-152 and Ser-183 to the end of the C-terminal domain augment the binding of histone H1.1 in vivo, they did not reveal the roles that the cyclin-dependent kinase-dependent phosphorylation sites may play in chromatin binding. To assess the specific contributions of phosphorylation of each of these sites, we generated GFP-histone H1.1 hybrid proteins in which the Thr-152 was switched to Glu-152 or the Ser-183 was switched to Glu-183. These substitutions introduce negative charges to mimic phosphorylation at these sites.

Fig. 4 shows the results of FRAP experiments performed on cells stably expressing these mutated histone H1.1 proteins. The results show that either mutation has a significant effect on binding of the histone H1.1 protein to chromatin. The recovery profiles of the deletion mutants are included in this graph to contrast the magnitude of the change in binding relative to the change seen in the deletion mutants. Mutation of Ser-183 to glutamic acid produced binding properties very similar to those of the mutant that was truncated at this same site. This suggests that this SPAK motif, which was not implicated in DNA binding according to the molecular modeling predictions of Bharath et al. (21), is located in a region in which a phosphorylation event will disrupt DNA binding of the lysines that are C-terminal to Ser-183. The insertion of a glutamic acid in position 152 has a much greater effect on the affinity of histone H1.1 binding in vivo than does the Ser-183. It is notable that the replacement of Thr-152 with glutamic acid destabilizes histone H1.1 binding more than truncation of the C terminus at Lys-182, which deletes 12 lysines and an arginine.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 4.
The effects of glutamic acid substitutions at positions 152 and 183 of the H1.1 C terminus. Histone H1.1 constructs that contain either a single glutamic acid substitution of Thr-152 (T152E) or a single glutamic acid substitution of Ser-183 (S183E) were stably expressed in SK-N-SH cells, and the mobility was then measured using FRAP. The recovery profiles of the histone H1.1 constructs containing the corresponding C-terminal deletions are included for comparison.

 
The Effects of Other Point Mutations of Thr-152 and Ser-183 on Histone H1.1 Binding—To further evaluate the contribution of these phosphorylated amino acids in the binding of histone H1.1 in vivo, we generated double glutamic acid and double alanine mutants. Fig. 5 shows the recovery profiles of Thr-152 and Ser-183 mutated to either glutamic acid or alanine. For comparison, the single point mutations to glutamic acid are also shown in this plot. It is remarkable that the mutation of both amino acids to glutamic acid generated a histone H1.1 protein with a FRAP recovery profile almost identical to that of the single glutamic acid substitution at amino acid position 152.

The mutation of Thr-152 and Ser-183 to alanines would prevent phosphorylation, and this would reduce the mobility of histone H1.1, if phosphorylation merely functions to disrupt binding by charge repulsion. When the recovery profile of histone H1 containing double alanine mutations was determined, we observed a destabilization of histone H1.1 binding in vivo relative to the wild-type histone H1. The resulting mutated histone H1.1 has a binding affinity that is midway between the Ser-183 glutamic acid (S183E) mutant and the parent histone H1.1 protein.

Lysine Substitutions of Thr-152 and Ser-183 Increase the Stability of Binding of Histone H1.1—To determine whether the addition of more positive charges to the highly basic C terminus had a direct influence on the binding of histone H1.1 to chromatin in living cells, we substituted Thr-152 or Ser-183 with lysines and measured the binding affinities of these mutant histone H1.1 proteins. Fig. 6 shows that the introduction of a lysine at either position increased the stability of histone H1.1 binding in vivo. This is consistent with the idea that overall net positive charge of these regions is important in regulating histone H1.1 binding. However, when both positions are mutated, the resulting protein bound with lower affinity than either single mutation alone.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 6.
The effect of lysine substitutions at positions 152 and 183 on histone H1.1 mobility. Histone H1.1 constructs with mutations that converted either Thr-152 (T152K), Ser-183 (S183K), or both amino acids (T152KS183K) to lysines were stably expressed in human SK-N-SH cells, and their mobility was examined by FRAP. The plot shows the relative recovery versus time in seconds after photobleaching.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Until the recent development of fluorescence-tagged proteins for use in FRAP, studies relating functions to the structure of histone H1 in chromatin had been limited to in vitro reconstituted systems. Using GFP-tagged histone H1.1 and its mutated variants, we have defined the contribution of the amino- and carboxyl-terminal tail domains to the binding of histone H1.1 to chromatin in living cells. The principal conclusion of our study is that the C-terminal domain of histone H1 is responsible for high-affinity binding of histone H1 to chromatin in vivo and that high-affinity binding can be directly modulated by phosphorylation at Thr-152 and Ser-183. These results bear a striking similarity to a recent in vitro dissection of the functions of the histone H1 C terminus. Using a regularly spaced array of reconstituted nucleosomes, Lu and Hansen (22) have recently determined that specific regions of the histone H1 C terminus function in folding reconstituted nucleosomal arrays. Their results parallel our in vivo results. First, both studies demonstrate that deletion of portions of the C-terminal domain decrease the binding affinity of histone H1 for chromatin. Second, both studies challenge the hypothesis that the C terminus functions simply as a randomly structured polycation that neutralizes charges on the DNA backbone and provide dramatic illustrations of the influence of secondary structure. Lu and Hansen (22) observed that chromatin binding was not evenly distributed along the CTD. Instead, a portion near the center of the C terminus did not affect histone H1 binding in any appreciable way. However, the amino acid segments on either side of this segment are important for stabilizing the folded state of the chromatin array. Likewise, when we examined the binding of histone H1.1 in living cells, we observed that the single substitution of Thr-152 with glutamic acid reduced the affinity of histone H1 binding to a greater extent than did deletion of the C terminus at Lys-182, a region that contains about onethird of the positively charged amino acids found in the C-terminal domain. Finally, both studies also identify the two segments of the C termini that contain T/SPXK motifs as important functional regions of these two histone H1 variants. It is important to note, however, that these studies employ variants with only two T/SPXK motifs. Thus, although these studies are consistent with important DNA binding activities localizing to T/SPXK motifs within the C terminus, we cannot conclude that the T/SPXK motifs are directly involved in DNA binding in vivo. Further studies with other histone H1 variants will be required to clarify the specific significance of these sequence motifs commonly found in H1 C termini. We can conclude, however, that the phosphorylation sites within the C terminus of histone H1.1 can directly modulate the affinity of histone H1 binding in vivo.

We find that mutation of the two C-terminal phosphorylation sites to glutamic acid results in a significant destabilization of histone H1.1 binding in vivo. Although this is in general agreement with the conclusions of Contreras et al. (31), they showed that the mutation of the threonine and serine phosphorylation sites to alanines residues increased the binding to chromatin, contrary to our finding that mutations of these phosphorylation sites destabilize chromatin binding. This difference may be explained by their use of a C-terminal fusion with GFP that we have shown to reduce the affinity of histone H1 binding to chromatin (Fig. 2). Numerous studies have shown that the CTD is critical to the binding of linker histones and that this domain adopts a secondary structure for its function rather than acting as an unstructured polycationic molecule. For the studies reported here, the GFP was localized at the N terminus, where interference with chromatin binding was minimal. Physical studies showed that the N-terminal domain could have two different substructures; the half that is adjacent to the central globular domain forms a {alpha}-helical structure when associated with DNA. The distal half of the N terminus of histone H1, where the GFP is fused, is unstructured and does not bind to the chromatin (28, 37). Hence, the N terminus may effectively be functioning as a spacer to place the GFP away from regions directly involved in chromatin binding.

Although our results are consistent with a role for the phosphorylation sites in regulating binding, we find that the two C-terminal phosphorylation sites in histone H1.1 differ significantly in the magnitude to which they affect binding. The contributions of subdomains of the CTD to linker histone binding was further demonstrated when mutations of the individual Thr-152 and Ser-183 showed different effects on mobility. Rather, mutation of Thr-152 to glutamic acid decreased the binding affinity of histone H1.1 to approximately the same extent as simultaneous mutations of both sites to glutamic acid. These results would not be expected if the C-terminal domain were to associate with DNA solely on the bases of electrostatic interactions. In addition, the addition of two negative charges from the phosphorylation of these two residues would not be sufficient to overcome the net positive charges of the 38 lysine and 2 arginine residues found within the CTD. Rather, the dominant role of the Thr-152 in defining the stability of histone H1.1 binding in vivo is consistent with the importance of this specific conserved T/SPXK motif in the predicted secondary structure of histone H1 within the chromatosome and consistent with the recent in vitro study of Lu and Hansen (22). In particular, this could explain how phosphorylation may be employed to displace histone H1 from chromatin during much of interphase, where the H1 molecules are rarely multiply phosphorylated (38).

In summary, we have determined that the C terminus is critical for high-affinity binding of histone H1.1 to chromatin. In the absence of the CTD, the globular and N terminus does not bind well to chromatin. Functional studies have traditionally emphasized the role of the conserved, winged-helix globular domain of the metazoan H1 histones. The interactions of the globular domain with DNA and nucleosomes have been studied extensively in vitro (1, 3). The importance of the C terminus in defining the affinity of histone H1 binding in vivo predicts that the sequence divergence among individual histone H1 variants will result in differences in chromatin binding affinity in living cells. Consistent with this hypothesis, we observe differences in the affinity of binding of individual histone H1 variants when FRAP experiments are used to probe H1 binding in vivo.2 In light of our results and recent results on the role of the C terminus in mediating chromatin binding and folding in vitro (1, 3), the C terminus is emerging as critical to defining the function of H1 histones in vivo.


    FOOTNOTES
 
* This work was supported by a Canadian Institutes of Health Research project grant (to J. T. and M. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Scholar of the Alberta Heritage Foundation for Medical Research and the Canadian Institutes of Health Research. Back

|| To whom correspondence should be addressed: 980 Oliver Rd., Thunder Bay, Ontario P7B 6V4, Canada. Tel.: 807-684-7245; Fax: 807-684-5803; E-mail: thngj{at}tbh.net.

1 The abbreviations used are: CTD, C-terminal domain; GFP, green fluorescent protein; FRAP, fluorescence recovery after photobleaching. Back

2 J. P. H. Th'ng and M. J. Hendzel, manuscript in preparation. Back



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Vignali, M., and Workman, J. L. (1998) Nat. Struct. Biol. 5, 1025-1028[CrossRef][Medline] [Order article via Infotrieve]
  2. Deleted in proof
  3. Thomas, J. O. (1999) Curr. Opin. Cell Biol. 11, 312-317[CrossRef][Medline] [Order article via Infotrieve]
  4. Kamakaka, R. T., and Thomas, J. O. (1990) EMBO J. 9, 3997-4006[Medline] [Order article via Infotrieve]
  5. Bresnick, E. H., Bustin, M., Marsaud, V., Richard-Foy, H., and Hager, G. L. (1992) Nucleic Acids Res. 20, 273-278[Abstract/Free Full Text]
  6. Garrard, W. T. (1991) Bioessays 13, 87-88[CrossRef][Medline] [Order article via Infotrieve]
  7. Jedrusik, M. A., and Schulze, E. (2001) Development 128, 1069-1080[Abstract]
  8. Gabrilovich, D. I., Cheng, P., Fan, Y., Yu, B., Nikitina, E., Sirotkin, A., Shurin, M., Oyama, T., Adachi, Y., Nadaf, S., Carbone, D. P., and Skoultchi, A. I. (2002) J. Leukoc. Biol. 72, 285-296[Abstract/Free Full Text]
  9. Jedrusik, M. A., and Schulze, E. (2003) Mol. Cell. Biol. 23, 3681-3691[Abstract/Free Full Text]
  10. Alami, R., Fan, Y., Pack, S., Sonbuchner, T. M., Besse, A., Lin, Q., Greally, J. M., Skoultchi, A. I., and Bouhassira, E. E. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 5920-5925[Abstract/Free Full Text]
  11. Folco, H. D., Freitag, M., Ramon, A., Temporini, E. D., Alvarez, M. E., Garcia, I., Scazzocchio, C., Selker, E. U., and Rosa, A. L. (2003) Eukaryot. Cell 2, 341-350[Abstract/Free Full Text]
  12. Koop, R., Di Croce, L., and Beato, M. (2003) EMBO J. 22, 588-599[CrossRef][Medline] [Order article via Infotrieve]
  13. Takami, Y., Nishi, R., and Nakayama, T. (2000) Biochem. Biophys. Res. Commun. 268, 501-508[CrossRef][Medline] [Order article via Infotrieve]
  14. Crane-Robinson, C. (1999) Bioessays 21, 367-371[CrossRef][Medline] [Order article via Infotrieve]
  15. Shen, X., and Gorovsky, M. A. (1996) Cell 86, 475-483[CrossRef][Medline] [Order article via Infotrieve]
  16. Allan, J., Hartman, P. G., Crane-Robinson, C., and Aviles, F. X. (1980) Nature 288, 675-679[CrossRef][Medline] [Order article via Infotrieve]
  17. Kasinsky, H. E., Lewis, J. D., Dacks, J. B., and Ausio, J. (2001) FASEB J. 15, 34-42[Abstract/Free Full Text]
  18. Ponte, I., Vila, R., and Suau, P. (2003) Mol. Biol. Evol. 20, 371-380[Abstract/Free Full Text]
  19. Ramakrishnan, V., Finch, J. T., Graziano, V., Lee, P. L., and Sweet, R. M. (1993) Nature 362, 219-223[CrossRef][Medline] [Order article via Infotrieve]
  20. Vermaak, D., Steinbach, O. C., Dimitrov, S., Rupp, R. A., and Wolffe, A. P. (1998) Curr. Biol. 8, 533-536[CrossRef][Medline] [Order article via Infotrieve]
  21. Bharath, M. M., Chandra, N. R., and Rao, M. R. (2003) Nucleic Acids Res. 31, 4264-4274[Abstract/Free Full Text]
  22. Lu, X., and Hansen, J. C. (2004) J. Biol. Chem. 279: 8701-8707[Abstract/Free Full Text]
  23. Allan, J., Mitchell, T., Harborne, N., Bohm, L., and Crane-Robinson, C. (1986) J. Mol. Biol. 187, 591-601[CrossRef][Medline] [Order article via Infotrieve]
  24. Dou, Y., and Gorovsky, M. A. (2000) Mol. Cell. 6, 225-231[CrossRef][Medline] [Order article via Infotrieve]
  25. Dou, Y., Bowen, J., Liu, Y., and Gorovsky, M. A. (2002) J. Cell Biol. 158, 1161-1170[Abstract/Free Full Text]
  26. Vila, R., Ponte, I., Collado, M., Arrondo, J. L., and Suau, P. (2001) J. Biol. Chem. 276, 30898-30903[Abstract/Free Full Text]
  27. Vila, R., Ponte, I., Jimenez, M. A., Rico, M., and Suau, P. (2000) Protein Sci. 9, 627-636[Medline] [Order article via Infotrieve]
  28. Vila, R., Ponte, I., Collado, M., Arrondo, J. L., Jimenez, M. A., Rico, M., and Suau, P. (2001) J. Biol. Chem. 276, 46429-46435[Abstract/Free Full Text]
  29. Lever, M. A., Th'ng, J. P., Sun, X., and Hendzel, M. J. (2000) Nature 408, 873-876[CrossRef][Medline] [Order article via Infotrieve]
  30. Misteli, T., Gunjan, A., Hock, R., Bustin, M., and Brown, D. T. (2000) Nature 408, 877-881[CrossRef][Medline] [Order article via Infotrieve]
  31. Contreras, A., Hale, T. K., Stenoien, D. L., Rosen, J. M., Mancini, M. A., and Herrera, R. E. (2003) Mol. Cell. Biol. 23, 8626-8636[Abstract/Free Full Text]
  32. Parseghian, M. H., and Hamkalo, B. A. (2001) Biochem. Cell Biol. 79, 289-304[CrossRef][Medline] [Order article via Infotrieve]
  33. Bharath, M. M., Ramesh, S., Chandra, N. R., and Rao, M. R. (2002) Biochemistry 41, 7617-7627[CrossRef][Medline] [Order article via Infotrieve]
  34. Hill, C. S., Rimmer, J. M., Green, B. N., Finch, J. T., and Thomas, J. O. (1991) EMBO J. 10, 1939-1948[Medline] [Order article via Infotrieve]
  35. Suzuki, M. (1989) EMBO J. 8, 797-804[Medline] [Order article via Infotrieve]
  36. Bharath, M. M., Chandra, N. R., and Rao, M. R. (2002) Proteins 49, 71-81[CrossRef][Medline] [Order article via Infotrieve]
  37. Vila, R., Ponte, I., Jimenez, M. A., Rico, M., and Suau, P. (2002) Protein Sci. 11, 214-220[CrossRef][Medline] [Order article via Infotrieve]
  38. Bradbury, E. M. (1992) Bioessays 14, 9-16[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
S. Orthaus, K. Klement, N. Happel, C. Hoischen, and S. Diekmann
Linker histone H1 is present in centromeric chromatin of living human cells next to inner kinetochore proteins
Nucleic Acids Res., June 1, 2009; 37(10): 3391 - 3406.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Sarg, S. Chwatal, H. Talasz, and H. H. Lindner
Testis-specific Linker Histone H1t Is Multiply Phosphorylated during Spermatogenesis: IDENTIFICATION OF PHOSPHORYLATION SITES
J. Biol. Chem., February 6, 2009; 284(6): 3610 - 3618.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. Chen, Q. Meng, L. Ma, Q. Liu, P. Tang, C. Chiu, S. Hu, and J. Yu
A novel DNA sequence periodicity decodes nucleosome positioning
Nucleic Acids Res., November 1, 2008; 36(19): 6228 - 6236.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. L. Conn, M. J. Hendzel, and L. M. Schang
Linker Histones Are Mobilized during Infection with Herpes Simplex Virus Type 1
J. Virol., September 1, 2008; 82(17): 8629 - 8646.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
L. M. Gutiyama, J. P. C. da Cunha, and S. Schenkman
Histone H1 of Trypanosoma cruzi Is Concentrated in the Nucleolus Region and Disperses upon Phosphorylation during Progression to Mitosis
Eukaryot. Cell, April 1, 2008; 7(4): 560 - 568.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
N. Gilbert, I. Thomson, S. Boyle, J. Allan, B. Ramsahoye, and W. A. Bickmore
DNA methylation affects nuclear organization, histone modifications, and linker histone binding but not chromatin compaction
J. Cell Biol., May 7, 2007; 177(3): 401 - 411.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X. Song and M. A. Gorovsky
Unphosphorylated H1 Is Enriched in a Specific Region of the Promoter when CDC2 Is Down-Regulated during Starvation
Mol. Cell. Biol., March 1, 2007; 27(5): 1925 - 1933.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
R. Funayama, M. Saito, H. Tanobe, and F. Ishikawa
Loss of linker histone H1 in cellular senescence
J. Cell Biol., December 18, 2006; 175(6): 869 - 880.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Yellajoshyula and D. T. Brown
Global modulation of chromatin dynamics mediated by dephosphorylation of linker histone H1 is necessary for erythroid differentiation
PNAS, December 5, 2006; 103(49): 18568 - 18573.
[Abstract] [Full Text] [PDF]


Home page
Brief Funct Genomic ProteomicHome page
J. Ausio
Histone variants--the structure behind the function
Brief Funct Genomic Proteomic, September 1, 2006; 5(3): 228 - 243.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. J. Benson, Y. Gu, T. Yakovleva, K. Tong, C. Barrows, C. L. Strack, R. G. Cook, C. A. Mizzen, and A. T. Annunziato
Modifications of H3 and H4 during Chromatin Replication, Nucleosome Assembly, and Histone Exchange
J. Biol. Chem., April 7, 2006; 281(14): 9287 - 9296.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Sarg, W. Helliger, H. Talasz, B. Forg, and H. H. Lindner
Histone H1 Phosphorylation Occurs Site-specifically during Interphase and Mitosis: IDENTIFICATION OF A NOVEL PHOSPHORYLATION SITE ON HISTONE H1
J. Biol. Chem., March 10, 2006; 281(10): 6573 - 6580.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Roque, I. Iloro, I. Ponte, J. L. R. Arrondo, and P. Suau
DNA-induced Secondary Structure of the Carboxyl-terminal Domain of Histone H1
J. Biol. Chem., September 16, 2005; 280(37): 32141 - 32147.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Becker, A. Becker, F. Miyara, Z. Han, M. Kihara, D. T. Brown, G. L. Hager, K. Latham, E. Y. Adashi, and T. Misteli
Differential In Vivo Binding Dynamics of Somatic and Oocyte-specific Linker Histones in Oocytes and During ES Cell Nuclear Transfer
Mol. Biol. Cell, August 1, 2005; 16(8): 3887 - 3895.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. P. H. Th'ng, R. Sung, M. Ye, and M. J. Hendzel
H1 Family Histones in the Nucleus: CONTROL OF BINDING AND LOCALIZATION BY THE C-TERMINAL DOMAIN
J. Biol. Chem., July 29, 2005; 280(30): 27809 - 27814.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Martic, Z. Karetsou, K. Kefala, A. S. Politou, C. R. Clapier, T. Straub, and T. Papamarcaki
Parathymosin Affects the Binding of Linker Histone H1 to Nucleosomes and Remodels Chromatin Structure
J. Biol. Chem., April 22, 2005; 280(16): 16143 - 16150.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
D. Chen, M. Dundr, C. Wang, A. Leung, A. Lamond, T. Misteli, and S. Huang
Condensed mitotic chromatin is accessible to transcription factors and chromatin structural proteins
J. Cell Biol., January 3, 2005; 168(1): 41 - 54.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Roque, M. Orrego, I. Ponte, and P. Suau
The preferential binding of histone H1 to DNA scaffold-associated regions is determined by its C-terminal domain
Nucleic Acids Res., November 23, 2004; 32(20): 6111 - 6119.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/19/20028    most recent
M400070200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hendzel, M. J.
Right arrow Articles by Th'ng, J. P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hendzel, M. J.
Right arrow Articles by Th'ng, J. P. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement