Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M312492200 on February 25, 2004

J. Biol. Chem., Vol. 279, Issue 19, 20096-20107, May 7, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/19/20096    most recent
M312492200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dhakshinamoorthy, S.
Right arrow Articles by Porter, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dhakshinamoorthy, S.
Right arrow Articles by Porter, A. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Nitric Oxide-induced Transcriptional Up-regulation of Protective Genes by Nrf2 via the Antioxidant Response Element Counteracts Apoptosis of Neuroblastoma Cells*

Saravanakumar Dhakshinamoorthy{ddagger} and Alan G. Porter{ddagger}§

From the Institute of Molecular and Cell Biology, 30 Medical Dr., Singapore 117609, Republic of Singapore

Received for publication, November 14, 2003 , and in revised form, February 23, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Nitric oxide (NO) is a signaling molecule that in excess causes cell death. Here we report a mechanism of NO-induced transcriptional up-regulation of genes encoding detoxifying enzymes and protective proteins and their role in counteracting NO-induced apoptosis of neuroblastoma cells. Promoter analysis using reporter assays identified the antioxidant response element (ARE) located in the promoter region of NAD(P)H:quinone oxidoreductase 1 (Nqo1) and other detoxifying enzyme genes as responsible for NO-mediated gene induction. The transcription factors NF-E2-related factor 2 (Nrf2) and small maf proteins were detected in NO-induced nuclear protein-ARE complexes. Nrf2 augmented NO-induced, ARE-dependent gene expression, which was blocked by dominant-negative Nrf2 (DN-Nrf2) lacking the transcriptional activation domain. Consistent with these results, Nrf2 was localized in the cytoplasm in unstimulated cells, and NO triggered its rapid nuclear accumulation. Neuroblastoma cells were stably transfected with DN-Nrf2, which repressed both the expression of protective genes and their induction by NO. These DN-Nrf2 cells exhibited reduced NQO1 enzymatic activity and were sensitized to NO-induced apoptosis. Similar results were obtained when Nrf2 expression was blocked by RNA interference. Conversely, stable cells expressing higher levels of Nrf2 protein had elevated NQO1 activity and were protected from NO. Finally, NO-mediated ARE-dependent gene induction occurred well before apoptosis as judged by caspase activation. These results together suggest that NO signals the transcriptional up-regulation of NQO1 and other detoxifying enzyme and protective genes through Nrf2 via the ARE to counteract NO-induced apoptosis of neuroblastoma cells.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Nitric oxide is a diffusible chemically reactive gas and pro-oxidant synthesized from l-arginine by enzymes termed nitric-oxide synthases (NOS),1 which include two constitutive calcium-dependent forms, neuronal NOS, endothelial NOS, and a calcium-independent, inducible form (1). NO is a signaling molecule involved in a variety of physiological functions such as vasodilation, fertilization, differentiation, inflammation, and apoptosis (2–4). The precise physiological effect of NO essentially depends on the available concentration of NO and the cell type (2–5). NO typically activates soluble guanylyl cyclase in cells to catalyze the conversion of GTP to cGMP that in turn activates cGMP-dependent protein kinase and other kinases, which accounts for many of the normal physiological functions elicited by NO (5).

Strangely, NO influences cell viability either by inducing cell death or by protecting cells against various apoptotic insults. A predominant view is that excessive NO exerts cytotoxic effects in diverse cell types by reacting with superoxide and thereby generating the highly reactive free radical peroxynitrite, which causes nonspecific DNA, protein, and lipid damage (6). Such damage also triggers downstream signaling pathways and gene expression, which might either elicit cellular repair or apoptosis (7). NO is known to regulate gene expression by modulating the activation of transcription factors or by mediating the stability of mRNA (2, 7). The role of NO in modulating the function of transcription factors AP1, EGR-1, NF-{kappa}B, HIF1, and VDR/RXR is documented (8–12). The pro-apoptotic activity of NO is largely mediated via cytochrome c release, loss of mitochondrial potential, and the activation of caspases (13–15). On the other hand, the protective pathway is not clearly understood. It has been proposed that NO can block apoptosis induced by various agents by inhibiting the activation of caspases (16) or by activating anti-apoptotic/protective proteins such as Bcl-xL (17), cAMP-response element-binding protein (CREB) (18), or HO-1 (19). However, it is not known if these various protective mechanisms act in concert or independently and to what extent these protective pathways are cell type-dependent.

Neuronal cells can mount a response to oxidative stress and are able to protect themselves to some extent from NO toxicity. For example, constitutive synthesis of c-Jun-regulated NCAM140 counteracts NO-induced apoptosis of neuroblastoma cells (14). It is well established that pro- and anti-oxidants signal a protective response, including the transcriptional activation of genes encoding detoxifying enzymes and other protective proteins in many cell types through the transcription factor Nrf2 acting on the ARE element (20, 21). However, the NO-mediated transcriptional regulation of this class of genes in neuroblastoma and other cells remains unknown. Here we investigate whether NO can elicit the transcriptional regulation of genes encoding detoxifying enzymes and other protective proteins that would counteract NO-induced apoptosis of SH-Sy5y neuroblastoma cells. We show that NO up-regulates the transcription of mRNAs for phase II detoxifying enzymes and other protective proteins through Nrf2 acting via the ARE. The elevated expression of these genes counteracts NO-induced apoptosis of neuroblastoma cells.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—The human neuroblastoma cell line SH-Sy5y was obtained and used as described previously (14). The IMR-32 neuroblastoma cell line was obtained from ATCC and grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Sodium nitroprusside (SNP), diethylenetriamine nitric oxide adduct (DETA-NO), 3-morpholinosydonimine (SIN1), and other chemicals were obtained from Sigma Co. The enzymes used in this study were purchased from New England Biolabs. The pcDNA 3.1-His-TOPO vector, Platinum Taq polymerase, 10 mM dNTP mix, LipofectAMINE transfection reagent, and RNase-free 20x SSC were purchased from Invitrogen. The pGL3 Basic and pGL3 Promoter vector containing the firefly luciferase gene, internal control plasmid pRL-TK that encodes Renilla luciferase, the dual luciferase assay kit, and the TNT coupled transcription-translation kit were purchased from Promega (Madison, WI). The Hybond ECL nitrocellulose membrane, ECL Western blot analysis kit, Ready-To-Go DNA labeling beads, Redivue [35S]methionine, and Amplify NAMP1000 were purchased from Amersham Biosciences. The RNeasy MiniKit was bought from Qiagen. The nuclear extraction kit was purchased from Panomics Inc. (Redwood City, CA). The antibodies against c-Jun, c-Fos, ATF-4, JunD, JunB, Nrf1, Nrf2, Nrf3, small maf, Keap1, lamin B, {beta}-tubulin, and the control IgG were purchased from Santa Cruz Biotechnology. The NQO1 monoclonal antibody was a generous gift from Dr. David Ross, University of Colorado. The radioactive isotopes for gel shift and Northern analysis were purchased from PerkinElmer Life Sciences.

Plasmid Construction—The full-length cDNA clones encoding mouse Nrf2 (Clone ID 3663276) and mouse small maf (MafK) (Clone ID 4189276) were purchased from Invitrogen. The Nrf2 and the small maf (MafK) cDNAs were sub-cloned into the pcDNA 3.1-His TOPO vector to generate pcDNA-Nrf2 and pcDNA-MafK plasmids. The plasmid encoding the dominant-negative Nrf2 (DN-Nrf2) was a generous gift from Dr. Jaweed Alam, Ochsner Clinic Foundation, New Orleans, LA. DN-Nrf2 was described previously (22). The DN-Nrf2 was sub-cloned into the pcDNA vector to generate pcDNA-DN-Nrf2. The 1.1-kb upstream promoter region of the Nqo1 gene (NCBI# M81596 [GenBank] ) was amplified by PCR from the genomic DNA prepared from SH-Sy5y cells using the following primers: Forward, 5'-tccgggttcaagcgattctcctgcctcag-3' and Reverse, 5'-ggctctggtgcagtccggggcgctgattgg-3'. It was cloned in the pGL3 Basic reporter plasmid at the KpnI/XhoI sites and designated as wild type (WT). The various other deletion constructs were made by PCR using the following primers: Nqo1{Lambda}1-Forward, 5'-acctgccttgaggagcaggggtggtgcag-3' and Reverse, 5'-ggctctggtgcagtccggggcgctgattgg-3'; Nqo1{Lambda}2-Forward, 5'-cacctcagggcacagtgcgcagatggg-3' and Reverse, 5'-ggctctggtgcagtccggggcgctgattgg-3'; Nqo1{Lambda}3-Forward, 5'-caggcgttgggtcccgcccttgtaggctg-3' and Reverse, 5'-ggctctggtgcagtccggggcgctgattgg-3'. All the deletion fragments were cloned into the pGL3 Basic vector at the KpnI/XhoI sites. The reporter plasmids bearing the mutations in XRE, ARE, and AP2 were constructed by PCR-based mutagenesis (15) based on the wild type (WT) reporter plasmid. The primers used were: XRE (F) 5'-GAT TAC AGC ACG CAG CAC CGC G-3'; XRE (R) 5'-CGC GGT GCT GCG TGC TGT AAT C-3'; ARE (F) 5'-GTC ACA GGC TGA GTC AAG AAT CTG-3'; ARE (R) 5'-CAG ATT CTT GAC TCA GCC TGT GAC-3', AP2 (F) 5'-CTT CAT CAG CCT GGG GCC CTC C-3'; AP2 (R) 5'-GGA GGG CCC CAG GCT GAT GAA G-3', respectively. The consensus oligonucleotide sequences/mutant sequences of Nqo1 ARE and the GST Ya ARE were described previously (23). The sense and antisense oligonucleotides corresponding to the cis-elements were synthesized with NheI and XhoI sites, respectively. The oligonucleotides were annealed, phosphorylated using T4 polynucleotide kinase, and cloned at the respective sites in the pGL3 promoter (pGL3P) vector. Four different oligonucleotide sequences were selected for the siRNA knock-down of Nrf2 expression using the siRNA target finder software at www.ambion.com. The selected sequences are si-Nrf2 #1: AACAGGGCCGCCGTCGGGGAG; si-Nrf2 #2: AAGCCGCTTGGAGGCTCATCT; si-Nrf2 #3: AAGTCCCAGTGTGGCATCACC; si-Nrf2 #4: AACAGCATGCCCTCACCTGCT. The hairpin siRNA-encoding oligonucleotides were synthesized along with the loop sequence TTCAAGAGA and the HindIII/BamHI restriction sites and cloned into the siRNA vector pSilencerTM 2.1-U6.

Cell Culture and Transfection of Reporter Plasmids—The LipofectAMINE transfection reagent kit was used to perform the transfections of human SH-Sy5y neuroblastoma cells by procedures as described previously (14). The plasmid pRL-TK encoding Renilla luciferase was used as an internal control in each transfection. Thirty-six hours after transfection, the cells were washed three times with PBS and lysed in Passive Lysis buffer from the Dual-Luciferase reporter assay system kit from Promega (note: washing the cells three times with PBS is essential to remove any trace amount of residual NO donor, which would inhibit the luciferase activity). The same kit was used to assay the samples for luciferase activity. The luciferase assay was performed as described (23). Luciferase activity was measured with a TD-20e luminometer.

Gel Shift and Supershift Assay—SH-Sy5y cells were treated with the NO donors DETA-NO, SIN1, or SNP for various times up to 12 h. Nuclear extracts were prepared using the nuclear extraction kit from Panomics. The in vitro transcription/translation of the plasmids encoding pcDNA-Nrf2 and pcDNA-MafK was performed using the TNT-Coupled Rabbit Reticulocyte Lysate Systems by procedures suggested in the manufacturer's protocol. Redivue L-[35S]methionine was substituted for methionine in the reactions. After the coupled transcription/translation, the proteins were checked for their correct size by SDS-PAGE. In a similar experiment, the proteins were transferred onto a Hybond ECL nitrocellulose membrane and probed with Nrf2 and small maf (MafK) antibodies. Both the in vitro translated proteins gave the expected size products as described previously (23). The double-stranded Nqo1 ARE as described previously (23) was end-labeled with [{gamma}-32P]ATP and T4 polynucleotide kinase. Bandshift and supershift assays were performed by previously described procedures (23). 10 µg of the nuclear extract was used in the gel shift, and 20 µg of the nuclear extract was used for the supershift experiments. The competition assays were performed using the cold wild type ARE, cold mutant AREM1, and cold mutant AREM2. Mutant AREM1 contains a mutation in the AP1-like element (TGAC) of the core ARE (23), and mutant AREM2 contains a mutation in the AP1-like element and the GC box (TGACXXXGC) of the core ARE (23). Mutant AREM2 has the following sequence, 5'-CAG TCA CAG TGA CGC TGA AGA ATC T-3'. For supershift assays 1 µg of the various antibodies was added with the nuclear protein-ARE mixture, and the reactions were incubated for a further 30 min at 4 °C. For gel shift and supershift experiments with the in vitro translated proteins, equimolar concentrations of in vitro translated Nrf2 and small maf proteins (MafK) were used.

Northern Blot Analysis—SH-Sy5y cells were treated with SNP, SIN1, or DETA-NO for various times. After treatment, the cells were washed three times with ice-cold Dulbecco's PBS without calcium and magnesium. The RNA extraction was performed using the RNA extraction kit from Qiagen. Ten micrograms of total RNA was electrophoresed in a 1% formaldehyde agarose gel and blotted by described procedures (24). The Ready-To-Go DNA labeling beads from Amersham Biosciences was used to label the cDNA probes of human NQO1 and {beta}-actin. Prehybridization and hybridization with the labeled Nqo1 cDNA was done according to a method described previously (24). After the hybridization, the membrane was washed and exposed to x-ray film for 12 h. The probe was removed from the membrane by placing it in 0.5% SDS at 95 °C. The membrane was then re-probed with radiolabeled {beta}-actin cDNA, washed, and exposed to x-ray film for 12 h.

Western Blot Analysis—Western blot analysis was performed by described previously methods (14). The nuclear proteins and the cytoplasmic proteins were extracted using the kit from Panomics, Inc. For total protein extraction, the cells were lysed in a buffer containing complete protease inhibitor mixture. After centrifugation, 20 µg of total proteins or 10 µg of nuclear/cytoplasmic proteins were electrophoresed in 10% polyacrylamide gels and transferred to an ECL membrane. Immunoblotting was carried out with antibodies in phosphate-buffered saline with 0.2% Tween 20 and 5% BSA. After washing, the membrane was probed with horseradish peroxidase-conjugated donkey antiserum to rabbit or mouse (Chemicon) and developed by the enhanced chemiluminescence method (Amersham Biosciences).

Stable Cell Selection, Toxicity, and Enzymatic Assays—To generate stable cell lines, the plasmids pcDNA-Nrf2 and pcDNA-DN-Nrf2 and the pcDNA vector were transfected individually in SH-Sy5y cells using LipofectAMINE following the manufacturer's protocol. The stable cells were selected in medium with 600 µg of neomycin/ml. After the selection, the stable clones were maintained in medium containing 200 µg of neomycin/ml. To generate Nrf2 siRNA stable cell lines, the plasmids pSilencer-si-Nrf2 (#3) and pSilencer vector control were transfected individually in SH-Sy5y cells using LipofectAMINE following the manufacturer's protocol. The stable cells were selected in medium with 100 µg of hygromycin/ml. After the selection, the stable clones were maintained in medium containing 50 µg of hygromycin/ml. To measure cell death, the Sytox-Hoechst double-staining method or the Crystal Violet staining method or the caspase assay was employed (15, 25, 26). Cells were plated in 6-well plates and treated with SNP, DETA-NO, or SIN1 for 8, 16, and 24 h. For Sytox-Hoechst staining the Sytox-Hoechst mixture was added in the medium at a concentration of 500 µg/ml (25). The cells were stained for 10 min, and observed under the fluorescent microscope. The apoptotic cells were identified by the condensed nuclei stained as blue and counted. An average of ten fields was counted, and the experiments were done in triplicates. For Crystal Violet staining, the cells were stained with 30% crystal violet in 10% methanol for 10 min after the drug treatment. The excess stain was removed completely by washing with distilled water many times. The cells were dried completely, and the stain was eluted in 50% methanol, 1% acetic acid solution. The absorbance was measured at 590 nm (26). The activity of caspase-3-like proteases was measured using microtiter plates as described (15). The experiments were done in triplicates. NQO1 enzyme activity was determined by previously described procedures (27). The activity was assayed in a reaction mixture with 50 mM Tris-HCl, pH 7.4. The decrease in the absorbance of DCPIP was measured at 600 nM, and the NQO1 activity was represented as nanomoles of DCPIP reduced per minute per milligram of protein. The statistical differences were determined using the Prism software by one-way analysis of variance (ANOVA) followed by the Tukey multiple comparison test.

Semi-quantitative RT-PCR Analysis—Total RNA was extracted from the cells after the NO donor treatment using the RNA extraction kit from Qiagen. Semi-quantitative RT-PCR analysis was performed using the one-step RT-PCR kit from Qiagen using the manufacturer's recommended protocol. 2 µg total RNA was used in each reaction. The primers used for the RT-PCR reactions are as follows. Nqo1-Forward: 5'-atggtcggcagaagagcactgatcg-3' and Reverse: 5'-ttttctagctttgatctggttgtcagttggg-3'; Catalase-Forward: 5'-atggctgacagccgggatcccg-3' and Reverse: 5'-cagatttgccttctcccttgccgcc-3'; SOD-Forward: 5'-atggcgacgaaggccgtgtgcgtg-3' and Reverse: 5'-ttgggcgatcccaattacaccacaag-3'; {beta}-Actin-Forward: 5'-atggatgatgatatcgccgcgctcg-3' and Reverse: R: 5'-gaagcatttgcggtggacgatggaggg-3'; HO-1-Forward: 5'-gagacggcttcaagctggtgatg-3' and Reverse: 5'-gttgagcaggaacgcagtcttgg-3'; GCLM-Forward: 5'-gtccacgcacagcgaggagcttcatg-3' and Reverse: 5'-gatcattgtgagtcaacagctgtatg-3'; GCLC-Forward: 5'-gaggctatgtgtcagacattgattgtcg-3' and Reverse: 5'-gtgtactcctctgcagcgagctccgtg-3'; GST A4-Forward: 5'-ggatgaagttggtacagacccgaag-3' and Reverse: 5'-gaggcttcttcttgctgccaggttcaag-3'; GST P1-Forward: 5'-gctgcgcggccctgcgcatgctg-3' and Reverse: 5'-gcaggttgtagtcagcgaaggag-3'; TRX-F 5'-gctcaggaggtctggcagctgctaag-3' and Reverse: 5'-gtgcaagcatctcttcctattgccag-3'. The cycling conditions used for the various primer sets are as follows. For NQO1, GCLM, GSTP1, TRX, and {beta}-actin: 50 °C for 30 min, 95 °C for 15 min, followed by 26 cycles of 95 °C for 1 min, 72 °C for 2 min, and a final extension at 72 °C for 10 min. For SOD and catalase the same reaction conditions as above were used, but the amplification was performed only for 22 cycles. For GCLC, GSTA4, and HO-1: 50 °C for 30 min, 95 °C or 15 min, followed by 25 cycles of 95 °C for 1 min, 62 °C for 1 min, 72 °C for 1 min, and a final extension at 72 °C for 10 min.

Immunofluorescence and Confocal Microscopy—SH-Sy5y cells were grown and seeded in 6-well plates containing glass coverslips. The cells were either left untreated or were treated with the NO donors (1.5 mM DETA-NO or 2 mM SNP) for 2, 4, and 8 h. Cells were subsequently rinsed with cold PBS and fixed with 4% formaldehyde in PBS for 30 min. The cells were subsequently permeabilized with 0.1% Triton X-100, 0.1% BSA, and 250 mM NaCl in PBS for 30 min. Anti-Nrf2 and Anti-Keap1 polyclonal antibodies (Santa Cruz Biotechnology) were used at 1 µg/100 µl in blocking buffer (0.5% BSA in PBS) and incubated with the coverslip for 1 h. For viewing Nrf2, fluorescein FITC-conjugated donkey anti-rabbit IgG (Jackson Laboratories, Inc.) was used. For viewing Keap1, rhodamine-conjugated AffiniPure donkey anti-goat IgG (Jackson Laboratories, Inc.) was used. The cells were incubated with the TO-PRO3 nuclear stain (Molecular Probes) just before mounting. Coverslips were mounted and viewed by MRC-1024 laser scanning confocal microscopy (Bio-Rad). The microscopic images were processed with the aid of LaserSharp software (Bio-Rad) and Adobe Photoshop.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
The Nqo1 Gene Is a Transcriptional Target of NO—In a quest to identify protective genes that are transcriptionally regulated by NO, SH-Sy5y cells were treated with the NO donors DETA-NO, SIN1, or SNP for various times. Semi-quantitative RT-PCR analysis of the scavenger genes SOD and catalase, and the detoxifying enzyme gene Nqo1 showed that these NO donors did not affect the transcription of SOD and catalase (Fig. 1A). However, the transcript of the detoxifying enzyme gene Nqo1 was significantly up-regulated as early as 2 h by all three NO donors (Fig. 1A). Additional experiments done with IMR-32 neuroblastoma cells also showed a significant up-regulation of the Nqo1 gene as early as 2 h after treatment with all three NO donors (data not shown). The early induction of the Nqo1 gene by DETA-NO and SIN1 was further confirmed by Northern blot analysis (Fig. 1B). Two transcripts of 1.2 and 2.7 kb were observed for the Nqo1 gene, which was in line with a previous published report (28). The transcriptional up-regulation of the Nqo1 gene as seen by semi-quantitative RT-PCR and Northern blotting translated into increased NQO1 protein (Fig. 1C) and increased NQO1 activity (Fig. 1D) upon NO treatment. About 5-fold induction of NQO1 activity was observed after 8 h of treatment with DETA-NO (Fig. 1D). These experiments together establish the Nqo1 gene as a transcriptional target of NO.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 1.
Nqo1 gene is a transcriptional target of NO. A, semi-quantitative RT-PCR analysis. SH-Sy5y cells were treated with the NO donors DETA-NO, SNP, and SIN1 in the indicated concentrations for various times, and semi-quantitative RT-PCR analysis was performed using 2 µg of total RNA for the SOD, catalase, and Nqo1 genes. {beta}-Actin is shown as a control. B, Northern blot analysis. SH-Sy5y cells were treated with the NO donors DETA-NO and SIN1 in the indicated concentrations for various times. 20 µg of total RNA was electrophoresed in a 1% formaldehyde agarose gel, transferred to a membrane, and hybridized with full-length Nqo1 cDNA probe. The membrane was washed and exposed to x-ray film for 16 h. {beta}-Actin is shown as a loading control. C, Western blot analysis. SH-Sy5y cells were treated with 1.5 mM DETA-NO for various times. Total cell lysate was loaded on a 10% polyacrylamide gel. The membrane was probed with an NQO1 monoclonal antibody. D, NQO1 activity assay. NQO1 activity assay was carried out using the previously published protocol (27). The results are represented as nanomoles of DCPIP reduced per minute by 1 mg of the total protein. The values represent mean ± S.E. of three independent experiments.

 
The Antioxidant Response Element Mediates the Transcriptional Regulation of Nqo1 by NO—The Nqo1 gene promoter has three characterized cis-elements, viz., associated protein 2 (AP2), xenobiotic response element (XRE), and ARE (Fig. 2A) that constitute the basal and inducible expression (29). The 1.1-kb upstream region of the Human Nqo1 promoter was amplified using PCR and cloned into the pGL3 basic luciferase reporter vector. A series of promoter deletions as well as the promoter mutations of XRE, ARE, and AP2 were made and cloned into pGL3 basic vector (Fig. 2A). SH-Sy5y cells were transfected with the wild type and the truncated or the mutated reporter plasmids. The wild type reporter plasmid spanning the 1.1-kb upstream promoter region of the human Nqo1 gene had a strong basal activity that was inducible with DETA-NO by ~3-fold (Fig. 2B). The Nqo1{Lambda}1 and Nqo1{Lambda}4 reporter construct with a XRE deletion and a XRE mutation, respectively, had similar basal and inducible levels. However, when the ARE element was deleted (Nqo1{Lambda}2) or mutated (Nqo1{Lambda}5), the basal activity was considerably reduced and the induction by DETA-NO was completely lost (Fig. 2B). The Nqo{Lambda}3 construct lacking XRE, ARE, and AP2 behaved in a similar manner to Nqo1{Lambda}2 (Fig. 2B). The mutation in the AP2 element (Nqo1{Lambda}6) did not affect the basal activity or the induction by DETA-NO (Fig. 2B). Experiments done with SNP and SIN1 as NO donors gave very similar results (data not shown). These data implicate the ARE element in NO-mediated Nqo1 gene induction. To further confirm the role of the ARE in NO-mediated gene regulation and induction, Fig. 2 (C and D) show that the human Nqo1 ARE element had a strong basal activity when cloned in the pGL3 vector under the control of the SV40 promoter. This was further inducible by ~5-fold with SNP (Fig. 2C) or by ~3.5-fold with DETA-NO (Fig. 2D). The basal and the inducible activity were completely abolished using the reporter construct with the mutated ARE (Fig. 2, C and D). Additional reporter assays using IMR-32 cells also gave similar results (data not shown). All these experiments together establish a role for the ARE in NO-mediated Nqo1 gene regulation.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 2.
Antioxidant response element (ARE) mediates transcriptional regulation of the Nqo1 gene by NO. A, schematic map of the human Nqo1 gene promoter constructs. The human Nqo1 gene promoter harbors three well characterized cis-elements, XRE, ARE, and AP2 (29). The promoter region of the human Nqo1 gene (from -935 to +100) was amplified by PCR and cloned into the pGL3 Basic vector and designated as wild type (WT). The 5' region of the promoter was deleted serially and designated as deletion 1 ({Lambda}1), deletion 2 ({Lambda}2), or deletion 3 ({Lambda}3). The WT reporter plasmid was also mutated so as to inactivate XRE ({Lambda}4) or ARE ({Lambda}5) or AP2 ({Lambda}6). B, transcriptional regulation of Nqo1 gene by NO is mediated by ARE and not by XRE or AP2. SH-Sy5y cells were transfected with 0.5 µg of the pGL3 Basic vector or the various reporter plasmids and 0.05 µg of the plasmid pRL-TK encoding Renilla luciferase. At 36 h post-transfection, the cells were treated with 1.5 mM DETA-NO for the indicated times and analyzed for luciferase activity. C, effect of SNP on Nqo1 ARE-mediated luciferase gene expression. The human Nqo1 gene wild type ARE and mutant ARE were cloned into the pGL3 promoter vector with the SV40 promoter. SH-Sy5y cells were transfected with 0.5 µg of the pGL3 promoter vector or the pGL3P-wild type ARE-Luc or the pGL3P-mutant ARE-Luc along with 0.05 µg of the plasmid pRL-TK encoding Renilla luciferase. At 36 h post-transfection, the cells were treated with 2 mM SNP for the indicated times and analyzed for luciferase activity. D, same as panel C, except that DETA-NO was used instead of SNP. In each of panels B–D, the values represent mean ± S.E. of three independent transfection experiments.

 
Nrf2 and Small maf Proteins Bind to the ARE—To identify the transcription factors that mediated the ARE response, nuclear extracts from untreated SH-Sy5y cells and cells treated with DETA-NO were incubated with the radiolabeled Nqo1 ARE oligonucleotide, and gel-shift and supershift assays were performed. Following treatment of SH-Sy5y cells with DETA-NO, there was an increase in the binding of the nuclear factors to the Nqo1 ARE (Fig. 3A). The nuclear factors bound to the ARE migrated as a single complex, which we believe is one large complex of proteins, because we could not separate them even on a longer gel. This binding involves a specific complex of Nqo1 ARE and nuclear proteins as proved by competition assays, in which the cold Nqo1 ARE competed with the complex completely, whereas the cold mutant ARE2 with a mutation in the core ARE sequence (AP1-like element and the GC box) compete very poorly with the complex (Fig. 3B). The cold mutant ARE1, with a mutation only in the AP1-like element of the core ARE, partially competed with the complex (Fig. 3B). Additional experiments done with SNP and SIN1 as NO donors gave similar results (data not shown). To identify the proteins present in the Nqo1 ARE-Nuclear protein complex, supershift assays were performed using the DETA-NO-treated nuclear extracts and the 32P-labeled Nqo1 ARE. The antibodies against c-Fos, JunB, c-Jun, JunD, ATF4, small maf (MafK), large maf (c-maf), Nrf1, Nrf2, and Nrf3 were selected, because these proteins have been implicated in ARE-mediated gene regulation (20). A clear supershift was observed only with Nrf2 and small maf antibodies, whereas Nrf1 gave a very faint signal (Fig. 3C). To check if Nrf2 and small maf proteins can bind to the Nqo1 ARE in vitro, EMSA were performed using the in vitro-translated Nrf2 and small maf (MafK) protein. The small maf and the Nrf2 expression plasmids were used to transcribe and translate MafK and Nrf2 in vitro, which gave the expected size proteins. In the EMSA, Nrf2 failed to bind as a homodimer (Fig. 3D, lanes 2 and 3), whereas the small maf proteins were found to bind the Nqo1 ARE as a homodimer (Fig. 3D, lane 5). However, Nrf2 bound to the Nqo1 ARE as a heterodimer with small maf protein, as shown by the fact that this complex (Fig. 3D, lane 6) could be supershifted using either the Nrf2 antibody (Fig. 3D, lane 7) or a small maf antibody (data not shown). Together, the results from the EMSA establish that Nrf2 and small maf proteins bind to the ARE and are likely to mediate the Nqo1 ARE response to DETA-NO and other NO donors.



View larger version (58K):
[in this window]
[in a new window]
  		FIG. 3.
Electro mobility shift assays (EMSA) show that NO induces DNA-binding of Nrf2 and small maf proteins. A, NO enhances the binding of nuclear factors to the Nqo1 gene ARE. The human Nqo1 gene ARE was end-labeled with [{gamma}-32P]ATP. 50,000 cpm of the labeled ARE was incubated with 10 µg of nuclear extract from SH-Sy5y cells treated with DETA-NO for various times and analyzed in a 5% non-denaturing polyacrylamide gel. The shifted ARE-nuclear protein complex is arrowed. B, competition assay. In a similar experiment, the unlabeled ARE, mutant AREM1, and mutant AREM2 were incubated with the labeled ARE and 10 µg of nuclear extract from SH-Sy5y cells treated with DETA-NO and analyzed in a 5% non-denaturing polyacrylamide gel. The shifted ARE-nuclear protein complex is arrowed. C, supershift assay. In a similar experiment as in A, the c-Fos, JunB, c-Jun, JunD, ATF4, small maf (MafK), large maf (c-maf), Nrf1, Nrf2, and Nrf3 antibodies were used to supershift the Nqo1 ARE-nuclear extract complex. The shifted ARE-nuclear protein complex is arrowed. The supershifted ARE-nuclear protein complex is shown with a double arrow. D, EMSA and supershift assay with in vitro translated proteins. In vitro transcription/translation of the plasmids encoding Nrf2 and small maf (MafK) was performed. The Nqo1 gene ARE was end-labeled with [{gamma}-32P]ATP. 50,000 cpm of the labeled ARE was incubated with in vitro translated MafK alone or in combination with in vitro translated Nrf2 as shown. The MafK and Nrf2 proteins alone and in combinations were preincubated at 37 °C for 15 min before incubation with the labeled ARE. For supershift assay, the band shift reaction was incubated with Nrf2 antibody or IgG for 2 h at 4 °C. The band shift and super shift mixtures were analyzed in a 5% non-denaturing polyacrylamide gel. The gel was dried and autoradiographed. *, nonspecific band from the rabbit reticulocyte lysate.

 
Functional Role of Nrf2 and Small maf Proteins in NO Signaling—Nrf2 and small maf proteins are leucine zipper proteins that play a major role in ARE-mediated detoxifying enzyme gene regulation (21). Transient transfection experiments were performed to study the functional role of Nrf2 and small maf proteins in ARE-mediated Nqo1 gene regulation following NO stimulation. The overexpression of Nrf2 in an increasing concentration results in the significant up-regulation of the pGL3P-wild type ARE-regulated Luciferase gene expression that was further enhanced by 1.5- to 2-fold with the addition of 1.5 mM DETA-NO (Fig. 4A). Further experiments with SNP and SIN1 as NO donors gave similar results (data not shown). The dominant-negative Nrf2 (DN-Nrf2) lacking the N-terminal acidic transactivation domain of Nrf2 is known to reduce or abolish the Nrf2-mediated transactivation of the ARE (22). The overexpression of DN-Nrf2 in an increasing concentration reduced the basal as well the DETA-NO-induced Nqo1 ARE-mediated luciferase gene regulation by more than 50% (Fig. 4B). In similar experiments, overexpression of DN-Nrf2 also reduced the Nrf2-mediated transactivation of the basal and DETA-NO-induced levels of Nqo1 ARE-mediated luciferase gene expression by 50% (Fig. 4C). Additional experiments done with SNP and SIN1 as NO donors gave similar results (data not shown). The overexpression of MafK repressed the basal as well as the DETA-NO-induced Nqo1 ARE-mediated luciferase gene expression (Fig. 4D). Together, the transient transfection studies establish the role of Nrf2 in the transcriptional activation of Nqo1 gene expression in response to NO.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 4.
Effect of overexpression of Nrf2, DN-Nrf2, and MafK on Nqo1 gene ARE-mediated luciferase expression and its induction by NO. A, SH-Sy5y cells were co-transfected with 0.5 µg of the pGL3P-wild type ARE-Luc, and the Nrf2 expression plasmid in concentrations as shown. 0.05 µg of plasmid pRL-TK encoding Renilla luciferase was the internal control in each transfection. The transfected cells were treated with 1.5 mM DETA-NO at 32 h after transfection. The cells were harvested 8 h after treatment and analyzed for luciferase activity. B, in a similar experiment as in A, the Nrf2 expression plasmid was replaced by a DN-Nrf2 expression plasmid in concentrations as shown. The transfected cells were either untreated or treated with 1.5 mM DETA-NO 32 h after transfection. The cells were harvested 8 h after treatment and analyzed for luciferase activity. C, in a similar experiment as in A, the DN-Nrf2 expression plasmid was co-transfected along with the Nrf2 expression plasmid in concentrations as shown. The transfected cells were either untreated or treated with 1.5 mM DETA-NO 32 h after transfection. The cells were harvested 8 h after treatment and analyzed for luciferase activity. D, in a similar experiment as in A, the Nrf2 expression plasmid was replaced by a MafK expression plasmid in concentrations as shown. The transfected cells were either untreated or treated with 1.5 mM DETA-NO 32 h after transfection. The cells were harvested 8 h after treatment and analyzed for luciferase activity. In all panels A–D, the values represent the mean ± S.E. of three independent transfection experiments.

 
Nrf2 Translocates to the Nucleus in Response to NO—To identify the molecular mechanisms governing Nrf2-mediated Nqo1 gene expression in NO signaling, we investigated the localization pattern of Nrf2 in untreated and NO-treated cells. It is known that, under normal conditions, Nrf2 is sequestered in the cytoplasm by the Keap1 protein (30). The translocation of Nrf2 into the nucleus is essential for the transactivation of the various target genes (28, 30, 31). Immunofluorescence studies revealed that under normal conditions Nrf2 (green) was found localized in the cytoplasm along with the keap1 (red) protein (Fig. 5A, top panels). The nucleus stained blue, and the co-localization of Nrf2 and Keap1 was seen as yellow (Fig. 5A, top left panel). When challenged with DETA-NO or SNP, Nrf2 translocated to the nucleus, whereas Keap1 remained in the cytoplasm (Fig. 5A, middle and lower panels). The cell that was under primary focus is shown with a white arrow. Western blot analysis of nuclear extracts and the cytoplasmic extracts using the Nrf2 antibody confirmed that Nrf2 protein accumulated rapidly (as early as 2 h) in the nucleus upon treatment with DETA-NO (Fig. 5B). Lamin B and {beta}-tubulin are shown as markers for nuclear and cytoplasmic proteins (Fig 5B). Lamin B was undetectable in the cytoplasmic extract, and {beta}-tubulin was undetectable in the nuclear extract when the same amounts of proteins were analyzed by Western blot (Fig. 5B). Hence, NO triggers the translocation of Nrf2 (but not Keap1) to the nucleus, where it accumulates.



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 5.
NO induces the nuclear accumulation of Nrf2. A, immunofluorescence using FITC-labeled antibodies. SH-Sy5y cells were grown on 6-well plates containing sterilized glass coverslips and treated with NO donors for 4 h in concentrations as shown. After treatment, the cells were washed, fixed, and stained with Nrf2 antibody and Keap1 antibody for 12 h at 4 °C. The cells were washed and treated with FITC-labeled donkey anti-rabbit IgG and rhodamine-labeled donkey anti-goat IgG for 1 h. The cells were washed, treated with TO-PRO3 nuclear stain for 5 min, and mounted. The slides were visualized using a confocal microscope. The Nrf2 staining is shown in green, the Keap1 staining is shown in red, and the nuclear stain is shown in blue. The co-localization of Nrf2 and Keap1 is shown as yellow. The cell that was under primary focus is shown with a white arrow. B, Western blot analysis. SH-Sy5y cells were treated with DETA-NO for various times. After treatment the cells were washed with PBS and nuclear extracts, and the cytoplasmic extracts were prepared. 10 µg of the cytoplasmic proteins or the nuclear proteins were loaded on a 10% polyacrylamide gel, and Western blotting was performed with an Nrf2 antibody. The nuclear Nrf2 protein runs very close to a nonspecific band (marked by the asterisk). Lamin B and {beta}-tubulin were shown as markers for nuclear and cytoplasmic proteins, respectively.

 
Nrf2 Regulates a Battery of Detoxification and Protective Genes upon NO Treatment—The ARE has been found and characterized in a variety of genes encoding detoxification and antioxidant proteins, including GST Ya, NQO1, {gamma}GCS, HO-1, ferritin H, and thioredoxin; it is established that the ARE and Nrf2 mediate the basal and stimulated expression of these genes (20–22, 32–35). Because we found the ARE and Nrf2 mediated Nqo1 gene expression upon NO treatment, we analyzed whether the other detoxifying and protective genes that are regulated by the ARE and Nrf2 were also stimulated by NO. Semiquantitative RT-PCR analyses revealed that the treatment of SH-Sy5y cells with DETA-NO results in the up-regulation of the various ARE- and Nrf2-regulated detoxifying and protective genes (Fig. 6). A very substantial increase in transcript levels was seen with GCLC, GCLM, GSTP1, and HO-1, and a moderate increase was observed with GSTA4 and TRX (Fig. 6). Similar experiments done with SNP and SIN1 as NO donors gave similar results (data not shown). Hence, NO triggers the release of Nrf2 from Keap1, which then translocates to and accumulates in the nucleus, where it binds to the ARE of Nqo1 and other detoxifying and protective genes to up-regulate their expression.



View larger version (78K):
[in this window]
[in a new window]
  		FIG. 6.
NO induces the coordinated transcriptional up-regulation of detoxifying enzyme and protective genes. SH-Sy5y cells were treated with 1.5 mM DETA-NO for various times. Total RNA was extracted from the cells after NO treatment. Semi-quantitative RT-PCR analysis was performed using 2 µg of total RNA for the GCLC, GCLM, GSTA4, GSTP1, TRX, and HO-1 genes. {beta}-Actin is shown as a control.

 
SH-Sy5y Cells with Stable Expression of DN-Nrf2 Are Sensitized, Whereas Cells with Stable Expression of Nrf2 Are Protected from NO-induced Apoptosis—Treatment of SH-Sy5y cells with the various NO donors is well known to induce apoptosis in a time- and concentration-dependant manner (14, 15, 36, 37). To study the functional relevance of ARE- and Nrf2-mediated up-regulation of detoxifying enzyme and protective genes in NO signaling, stable cells expressing DN-Nrf2 or Nrf2 were generated (Fig. 7). Six independent clones and two pools of clones were selected for each category. The stable cells express slightly higher levels of Nrf2 or DN-Nrf2 (Fig. 7A). Almost all of the selected Nrf2 stable clones had a similar level of Nrf2 protein (Fig. 7A, part I). Among the DN-Nrf2 stable clones, clone #2 displayed the highest expression of the DN-Nrf2 protein (Fig. 7A, part II). Two independently isolated Nrf2 stable clones exhibited significantly higher NQO1 activity (~3-fold increase), whereas two independent DN-Nrf2 stable clones had significantly reduced NQO1 activity (~2- to 4-fold reduction), as compared with the vector control cells (Fig. 7B). Semi-quantitative RT-PCR analyses revealed that the DN-Nrf2-stable cells had significantly lower levels of Nqo1 and other detoxifying and protective genes compared with the vector control cells under basal and DETA-NO-stimulated conditions (Fig. 7C). The basal expression of Nqo1 and HO-1 genes went down to undetectable levels in the DN-Nrf2-stable cells (Fig. 7C). When compared with the wild type SH-Sy5y cells, the Nqo1/ARE-mediated luciferase expression was higher in the Nrf2 stable cells, whereas it was reduced to half in the DN-Nrf2 cells (data not shown).



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 7.
Altered gene expression and NQO1 activity in stable cells expressing DN-Nrf2 or Nrf2. SH-Sy5y cells were transfected with the plasmids pcDNA-Nrf2 and pcDNA-DN-Nrf2 or the pcDNA vector to generate stable cells, which were selected as described under "Experimental Procedures." The expression of the DN-Nrf2 protein and the Nrf2 protein in the stable clones was visualized by Western blot analysis. A, part I: Western blot showing the expression level of Nrf2 protein in the control SH-Sy5y cells (C), vector-transfected stable SH-Sy5y cells (V), and the various stable clones (arrowed). *, nonspecific band. All four clones had similar levels of Nrf2 expression. A, part II: Western blot showing the expression level of DN-Nrf2 protein in the control SH-Sy5y cells (C), vector-transfected stable SH-Sy5y cells (V), and the various stable clones. Clone #2 had the highest level of DN-Nrf2 expression. B, NQO1 activity in the Nrf2 and DN-Nrf2 stable cells was measured as described under "Experimental Procedures." The values represent mean ± S.E. of three independent experiments (p < 0.05). C, RT-PCR analysis of the detoxifying enzyme and other protective genes in the DN-Nrf2 stable cells. The vector control and the DN-Nrf2 cells were either untreated (U) or treated with 1.5 mM DETA-NO for 8 h (T). Total RNA was extracted and semi-quantitative RT-PCR was performed.

 
NO toxicity assays were performed on the wild type and stable cells expressing higher levels of DN-Nrf2 or Nrf2. The NO donors DETA-NO and SNP induced apoptosis in SH-Sy5y cells as visualized by an increase in the number of cells with condensed nuclei that stain an intense brighter blue with Sytox-Hoechst (Fig. 8A, top panels) (25). The Nrf2 stable cells showed a marked reduction in the number of apoptotic cells with condensed nuclei, whereas the DN-Nrf2 stable cells showed a substantial increase in the number of apoptotic cells (Fig. 8A, middle and lower panels, respectively). Sytox-Hoechst-stained cells in several fields were counted to quantitate apoptosis in the vector control and stable lines. The results confirmed that two independent clones of Nrf2 stable cells were significantly (20–25%) protected from toxicity induced by three NO donors compared with the vector control cells (Fig. 8B). Conversely, two independent clones of DN-Nrf2 stable cells were more prone to apoptosis induced by the various NO donors (Fig. 8B). Noticeably, clone #2 with the highest level of DN-Nrf2 protein expression was consistently the most sensitive of the two clones to NO-induced apoptosis (Fig. 8B). Essentially similar results were obtained when NO-mediated death of DN-Nrf2 or Nrf2 cells was independently measured by Crystal Violet staining (Fig. 8C) and caspase-3 activation (Fig. 8D). All these results together suggest that NO signals the up-regulation of detoxifying enzyme and other protective genes through Nrf2 via the ARE to counteract NO-induced apoptosis of neuroblastoma cells.



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 8.
DN-Nrf2 stable cells are more sensitive, whereas stable cells expressing Nrf2 are more resistant to NO-induced apoptosis. NO-induced cell death was quantitated using Sytox-Hoechst or Crystal Violet staining, or by measuring caspase-3 activity. A, upper panels, SH-Sy5y cells were untreated or treated with SNP or DETA-NO and stained with Sytox-Hoechst. The healthy intact nuclei from the control cells are stained uniformly as blue, whereas the condensed deformed apoptotic nuclei in the SNP- or DETA-NO-treated cells are seen as brighter blue spots. Middle panels, same as the top panels except that Nrf2-expressing stable cells were used (clone #2). Lower panels, same as the top panels except that DN-Nrf2-stable cells were used (clone #2). For all panels, the quantitations of the apoptotic cells were performed using Sytox-Hoechst staining as described under "Experimental Procedures" and as shown in B below. B, quantitation of apoptotic cells was performed by Sytox-Hoechst staining of the SH-Sy5y vector control, Nrf2-expressing (two independent clones, including clone #2 shown in A) and DN-Nrf2-stable cells (two independent clones, including clone #2 shown in A) treated with the various NO donors for 16 h. C, quantitation of apoptotic cells was performed by Crystal Violet staining of the SH-Sy5y vector control, Nrf2-expressing (two independent clones) and DN-Nrf2-stable cells (two independent clones) treated with the various NO donors for 16 h. D, apoptosis was measured by caspase-3 activation in the SH-Sy5y vector control cells, Nrf2-overexpressing cells (Clone #2) and DN-Nrf2-stable cells (Clone #2) treated with the various NO donors for 14 h. In each of panels B–D the values represent mean ± S.E. of three independent experiments. The statistical differences were determined by one-way analysis of variance (ANOVA) followed by the Tukey multiple comparison test of vector versus experimental. p < 0.001 for SNP and SIN1 treatments and p < 0.01 for DETA-NO treatment.

 
siRNA-mediated Knock Down of Nrf2 Results in Down-regulation of ARE-dependent Nqo1 Expression and Sensitization to NO-induced Apoptosis—To confirm the results obtained with the DN-Nrf2 stable cells, we designed siRNA constructs to knock down Nrf2 gene expression. A total of four different oligonucleotides spanning the Nrf2 cDNA was cloned into the siRNA vector. To quickly screen for the efficiency of Nrf2 knockdown, the individual constructs were transiently transfected into SH-Sy5y cells together with the Nqo1-ARE Luciferase reporter plasmid, and luciferase assays were performed. Nrf2 is the only protein known to strongly activate the ARE (21), and hence the measurement of ARE activity is a reliable measure of the efficiency of the Nrf2 siRNA constructs. As shown in Fig 9A, constructs #2, #3, and #4 displayed significant reduction in the level of basal ARE activity as well as NO-induced ARE activity. Construct #1 did not show any difference as compared with the vector control (data not shown). Strikingly, construct #3 was the most effective, exhibiting more than 90% reduction in ARE activity. To further confirm the efficiency of the siRNA constructs #2, #3, and #4, NQO1 activity was measured in SH-Sy5y cells transiently transfected with these constructs or the vector control. Constructs #2 and #4 gave about 40% reduction in NQO1 activity, whereas #3 gave around 90% reduction in NQO1 activity (Fig 9B), which mirrors the reductions seen with the ARE measurements (Fig. 9A). Based on these results we selected stable cells expressing construct #3 for further studies. The Nrf2 protein was undetectable in these stable cells by Western blot, and the Nqo1 ARE-mediated luciferase expression was significantly reduced (80%) (data not shown). Cell death and caspase-3 assays showed that siRNA against Nrf2 (construct #3) greatly sensitized SH-Sy5y cells to NO killing (Fig. 9, C and D), which confirms our findings with DN-Nrf2 cells.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 9.
siRNA-mediated knock down of Nrf2 results in down-regulation of ARE-mediated gene expression and sensitization to NO-induced apoptosis. A, screening the various Nrf2 siRNA constructs for their knock-down efficiency. 0.5 µg of the siRNA vector control or Nrf2 siRNA constructs (#2, #3, or #4) were transiently transfected into SH-Sy5y cells together with 0.5 µg of the pGL3P-wild type ARE-Luc and 0.05 µg of the plasmid pRL-TK encoding Renilla luciferase. At 36 h post-transfection, the cells were treated with 2 mM SNP for 8 h and analyzed for luciferase activity. The values represent mean ± S.E. of three independent transfection experiments. B, the siRNA vector control or the Nrf2 siRNA constructs (#2, #3,or #4) were transiently transfected into SH-Sy5y cells. At 36 h post-transfection, the cells were harvested and the NQO1 activity was measured. The values represent mean ± S.E. of three independent transfection experiments (p < 0.05). C, quantitation of apoptotic cells was performed by Sytox-Hoechst staining of the siRNA vector control and si-Nrf2 (#3) clone treated with the various NO donors for 16 h. D, apoptosis was measured by caspase-3 activation in the siRNA vector control cells and si-Nrf2 (#3) clone treated with the various NO donors for 14 h. In each of panels C and D the values represent mean ± S.E. of three independent experiments. The statistical differences were determined by one-way ANOVA followed by the Tukey multiple comparison test of vector versus experimental. p < 0.001 for SNP and SIN1 treatments and p < 0.01 for DETA-NO treatment.

 
ARE-mediated Gene Induction Occurs Prior to Caspase-3 Activation—The results presented in Figs. 1, 2, and 6 suggest that ARE and NQO1 activities as well as the up-regulation of ARE-regulated genes are first observed at 2–4 h after NO donor treatment. We have previously amply documented that NO-induced apoptosis of SH-Sy5y cells is first detected after a long delay at around 8 h following NO donor treatment (14, 15), suggesting that ARE-mediated expression of protective proteins attempts to counteract cell death. To confirm that ARE-mediated protective gene induction occurs prior to cell death, we compared the kinetics of Nqo1-ARE and caspase-3 activation in NO donor-treated cells. Whereas NQO1-ARE activity started at 2 h and peaked at 8 h, caspase-3 activity was first detected after 8 h and peaked at 14 h, thus providing evidence that ARE-mediated gene expression does indeed occur much earlier than the onset of apoptosis (Fig. 10).



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 10.
NO-induced ARE activation occurs prior to caspase-3 activation. Comparison of the kinetics of Nqo1-ARE and caspase-3 activation in NO donor-treated cells. SH-Sy5y cells were transfected with 0.5 µg of the pGL3P-wild type ARE-Luc. At 36 h post-transfection, the cells were treated with 2 mM SNP for various times. The cells were harvested after the treatment and assayed for NQO1-ARE activity and caspase-3 activity. The values represent mean ± S.E. of three independent experiments. The statistical differences were determined by one-way ANOVA followed by the Tukey multiple comparison test of control versus experimental. p < 0.05 for Nqo1 activity and p < 0.001 for caspase-3 activity.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
NO is a pleiotrophic molecule that can generate reactive nitrogen/oxygen species such as peroxynitrite upon decomposition (6). The cellular responses to this oxidative and nitrosative stress are important for the survival of cells (39). Hence, it is entirely consistent that we find NO activates a battery of detoxifying enzymes and other proteins with protective functions. NQO1 belongs to the family of phase II enzymes that includes NAD(P)H:quinone oxidoreductases (NQOs) that catalyze two-electron reductive metabolism and detoxification of quinones (20); GSTs, which conjugate hydrophobic electrophiles and ROS with glutathione (21); {gamma}-glutamylcysteine synthetase ({gamma}-GCS), which plays a role in glutathione metabolism (33); ferritin-H, which plays an important role in iron storage (34); and HO-1, which catalyzes the first and rate-limiting step in heme catabolism (22). NQO1 also plays an important role in maintaining the redox balance in cells (38).

Our study also demonstrates a role for the ARE and Nrf2 in NO-mediated detoxifying enzyme and protective gene up-regulation. ARE elements have been found and characterized in the promoter regions of the human and rat Nqo1 genes, rat and mouse GST Ya subunit genes, the rat GST P gene, the human {gamma}-GCS gene, the ferritin-L gene, the human thioredoxin gene, and the human HO-1 gene (20, 21). Mutational analysis of the ARE identified GTGACXXXGC as the core of the ARE sequence (20, 21). Because the AREs of many detoxifying enzymes are highly conserved, it is likely that these genes may be coordinately regulated by a single mechanism involving the ARE. Our study convincingly demonstrates that the ARE mediates NO-induced detoxifying enzyme and protective gene up-regulation. When the ARE element was deleted from the Nqo1 promoter region, or when it was mutated, the basal expression was reduced, and the induction by NO was completely lost. When the core ARE element cloned under the SV40 promoter was mutated, the basal and the NO-induced Nqo1 ARE-mediated luciferase gene expression was completely lost. Luciferase reporter assays using the GST Ya ARE also gave similar results as Nqo1 ARE.2 Overall our data demonstrate a requirement for the ARE region in NO-mediated protective gene induction.

The nuclear transcription factors such as c-Jun, JunB, JunD, c-fos, Fra-1, Nrf1, Nrf2, YABP, ARE-BP-1, small maf (MafK), large maf and the estrogen receptor have been reported to bind the ARE (20, 21). Among these transcription factors, c-Jun, Jun-B, Jun-D, c-Fos, Fra1, Nrf1, Nrf2, and small maf and large maf proteins have been shown to bind to the ARE of the human Nqo1 gene (20, 39). In the present investigation, both Nrf2 and small maf proteins (but none of the other transcription factors mentioned above) were detected in the nuclear proteins that bound to the Nqo1 ARE following NO treatment This indicates that Nrf2 and the small maf proteins are the critical mediators of NO-induced ARE-dependent gene regulation. The fact that Nrf2 is a key regulator of ARE-mediated expression and induction of other detoxifying enzymes, including GST Ya, {gamma}-GCS, and HO-1 (40–44) supports our findings. The small maf (MafK) proteins lack a transactivation domain and can bind the ARE as a homodimer and as a heterodimer with Nrf2 (Fig. 3D) (23, 40, 42–44). The homodimeric complex acts as a repressor (23), and the heterodimeric complex associated with Nrf2 is believed to be an activator of ARE-mediated gene regulation (40, 43, 44). Nevertheless, small maf proteins are required as binding partners for Nrf2 as well as for Nrf2-mediated transactivation of the ARE (38, 41, 43, 44).

A cytosolic protein, Keap1, was previously cloned and characterized (30). Under normal conditions, Keap1 retains Nrf2 in the cytoplasm, but exposure of cells to antioxidants leads to the release of Nrf2 from Keap1 (28, 30, 31). Nrf2 then translocates to the nucleus resulting in the activation of ARE-mediated gene expression. We observed that the various NO donors induced a rapid nuclear translocation of Nrf2, which is supported by a recent report on the NO-induced nuclear accumulation of Nrf2 in endothelial cells (45). Hence, it appears that NO elicits a signal that presumably passes through the Keap1-Nrf2 complex, resulting in the dissociation of Keap1-Nrf2 followed by nuclear accumulation of Nrf2. The signal that dissociates Keap1-Nrf2 remains unknown. The signal could be NO by itself or peroxynitrate or reactive oxygen/nitrogen species. A rapid increase in the ROS levels of SH-Sy5y cells has been observed following treatment of cells with the NO donor NOC18, supporting this hypothesis (46). The major mechanisms of modification in the regulation of gene transcription include phosphorylation/dephosphorylation and redox regulation (47, 48). Recent studies have suggested a role for p38 kinase, MEK kinase, and phosphatidylinositol 3'-kinase in the ARE-mediated regulation of detoxifying enzyme genes (49–51). However, the molecular targets for these kinases remain unknown. Other studies have disputed the involvement of p38 and MEK kinases in ARE-mediated gene expression and instead have shown that PKC phosphorylates Nrf2, thereby inducing ARE-mediated gene expression (52). Nrf2 also contains a critical cysteine residue in its DNA-binding domain that has been shown to be redox regulated (53). Very recently, the critical reactive cysteine residues of Keap1 protein have been mapped and were proposed as the direct sensors of cellular stress signals (54). NO is a modulator of the cellular redox state and is known to redox regulate cysteines (55). NO is also known to activate various kinases, including p38 kinase (36). Hence, phosphorylation/dephosphorylation and/or redox regulation may play a role in the modification of Keap1 or Nrf2 in response to NO. Furthermore, it is interesting to note that the rat hepatocyte inducible nitric-oxide synthase gene has a functional ARE that is inducible with superoxide (56). If this is the case in neuroblastoma cells, a positive feedback regulation of NO synthesis by NO is possible through the ARE. However, this hypothesis needs to be verified experimentally.

The coordinated induction of the phase II enzymes has been shown to protect cells against toxicity, mutagenicity, and carcinogenicity resulting from exposure to environmental and synthetic chemicals and drugs (57). We show that the coordinated induction of phase II enzymes and protective genes through the ARE and Nrf2 counteracts NO-mediated apoptosis. This is evident from the fact that the DN-Nrf2-stable cells with lower levels of detoxifying enzyme and protective genes were sensitized to NO-induced apoptosis, whereas the Nrf2-stable cells were significantly protected from NO-induced apoptosis. Similarly, cells expressing siRNA complementary to Nrf2 mRNA had lower levels of ARE and NQO1 activities and were more susceptible to NO-induced apoptosis. The precise mechanisms governing the protection or sensitization in the stable cells remain to be investigated, but a collective biological effect of the various ARE-Nrf2-regulated genes is plausible.

Our findings on the existence of NO-mediated ARE regulation and cell survival mechanisms in SH-Sy5y neuroblastoma cells are also supported by the studies on tert-butylhydroquinone-mediated ARE regulation of phase II-defensive proteins in IMR-32 neuroblastoma cells and primary neurons (51, 58, 59). More recently, it has been shown that phase II detoxifying enzymes and protective genes are significantly down-regulated in the primary neuronal cultures from Nrf2-/- mice (60), which supports our data on the down-regulation of the various ARE-Nrf2-regulated genes in DN-Nrf2 stable cells.

Glutathione is an important antioxidant in the brain and is synthesized by the glutamate-cysteine ligase gene (GCL). GCL exists as a heterodimer comprising a large catalytic subunit (GCLC) and a small modifier subunit (GCLM). Our study clearly shows that NO up-regulates both the transcripts of GCL, which would presumably result in increased intracellular glutathione levels. Increased intracellular glutathione has been shown to provide greater resistance for cells during acute NO stress (61) and increased oxidative stress (62). We also showed NO up-regulates HO-1, which is another important protein implicated in the survival of neurons (63). HO-1-overexpressing neurons are highly resistant to cell death induced by oxidative stress (63), and mice lacking the gene for HO-1 exhibit increased susceptibility to apoptosis and necrosis induced by cisplatin (64). However, the mechanism by which HO-1 counteracts cell death is not fully understood. NQO1 promotes the obligatory two-electron reduction of quinones to hydroquinones and hence lowers the level of quinones that would react rapidly with thiol groups and deplete cellular glutathione (65). Furthermore, NQO1 could reduce {alpha}-tocopherolquinone to {alpha}-tocopherolhydroquinone, which acts as a powerful cellular antioxidant (66). The role of NQO1 in preventing glutamate toxicity in N18-RE-105 neuronal cell line has been reported as well (67). Our results on NO-mediated activation of these and other detoxifying enzymes and protective proteins are consistent with a recent report on the microarray analysis of NO-inducible genes in NIH3T3 fibroblasts (2).

In Nrf2-/- neurons, a cluster of genes that maintain calcium homeostasis such as visinin-like 1, calbindin, and synaptotagmin-1 are significantly down-regulated, and these neurons are highly susceptible to calcium ionophore, ionomycin, or mitochondrial toxin (1-methyl-4-phenyl-1,2,5,6-tetrahydropyridine)-induced apoptosis (68). In mouse cerebellar granule cells, excess NO is known to induce apoptosis through alterations in cellular calcium homeostasis and subsequent activation of caspases (69). Hence, it is also possible that the DN-Nrf2- and siRNA-Nrf2-stable neuroblastoma cells are sensitized to NO-induced apoptosis because of the down-regulation of genes required for the maintenance of calcium homeostasis. Overall, it is most likely that NO-mediated coordinated induction of phase II enzymes and other proteins counteracts NO-induced apoptosis of neuronal and neuroblastoma cells by collectively activating various protective mechanisms. Our findings provide insights into how neuronal cells might attempt to protect themselves from trauma- or ischemia-induced excitotoxicity that results in part from excessive NO production.


   FOOTNOTES
 
* This work was supported in part by the Institute of Molecular and Cell Biology and A*STAR, Singapore. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ An adjunct staff member of the Department of Surgery, National University of Singapore. Back

{ddagger} To whom correspondence may be addressed. Tel.: 65-6874-3761; Fax: 65-6779-1117; E-mail: saravanad{at}imcb.a-star.edu.sg (S. D.) and mcbagp{at}imcb.a-star.edu.sg (A. G. P.).

1 The abbreviations used are: NOS, nitric-oxide synthase; ARE, antioxidant response element; DETA-NO, diethylenetriamine nitric oxide adduct; EMSA, electrophoretic mobility shift assay; HO-1, heme oxygenase 1; Nrf2, NF-E2-related factor 2; NQO1, NAD(P)H:quinone oxidoreductase 1; ROS, reactive oxygen species; SIN1, 3-morpholinosydonimine; SNP, sodium nitroprusside; SOD, superoxide dismutase; WT, wild type; XRE, xenobiotic response element; GST, glutathione S-transferase; siRNA, small interference RNA; PBS, phosphate-buffered saline; BSA, bovine serum albumin; ANOVA, analysis of variance; RT, reverse transcription; FITC, fluorescein isothiocyanate; AP2, associated protein 2; GCS, glutamylcysteine synthetase; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; GCL, glutamate-cysteine ligase; GCLC, large catalytic subunit of GCL; GCLM, small modifier subunit of GCL; DCPIP, 2,6-dichlorophenolindophenol sodium salt. Back

2 S. Dhakshinamoorthy and A. G. Porter, unpublished results. Back


   ACKNOWLEDGMENTS
 
We thank our colleagues for helpful comments. We thank Dr. Jawed Alam, Ochsner Clinic Foundation, New Orleans, LA, for providing us with the dominant-negative Nrf2 plasmid, and Prof. David Ross and Dr. David Siegel, both from The University of Colorado Health Science Center, Denver, CO, for providing NQO1 antibody. We thank Dr. Starling B. Emerald for assistance with immunofluorescence experiments, and Dr. Hannes Hentze and Lei Li for assistance with caspase assays.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Michel, T., and Feron, O. (1997) J. Clin. Invest. 100, 2146-2152[Medline] [Order article via Infotrieve]
  2. Hemish, J., Nakaya, N., Mittal, V., and Enikolopov, G. (2003) J. Biol. Chem. 278, 42321-42329[Abstract/Free Full Text]
  3. Bogdan, C. (1998) J. Exp. Med. 187, 1361-1365[Free Full Text]
  4. Moncada, S., and Erusalimsky, J. D. (2002) Nat. Rev. Mol. Cell. Biol. 3, 214-220[CrossRef][Medline] [Order article via Infotrieve]
  5. Lucas, K. A., Pitari, G. M., Kazerounian, S., Ruiz-Stewart, I., Park, J., Schulz, S., Chepenik, K. P., and Waldman, S. A. (2000) Pharmacol. Rev. 52, 375-413[Abstract/Free Full Text]
  6. Brune, B., von Knethen, A., and Sandau, K. B. (1999) Cell Death Differ. 6, 969-975[CrossRef][Medline] [Order article via Infotrieve]
  7. Bogdan, C. (2001) Trends Cell Biol. 11, 66-75[CrossRef][Medline] [Order article via Infotrieve]
  8. Pilz, R. B., Suhasini, M., Idriss, S., Meinkoth, J. L., and Boss, G. R. (1995) FASEB J. 9, 552-558[Abstract]
  9. Berendji, D., Kolb-Bachofen, V., Zipfel, P. F., Skerka, C., Carlberg, C., and Kroncke, K. D. (1999) Mol. Med. 5, 721-730[Medline] [Order article via Infotrieve]
  10. Matthews, J. R., Botting, C. H., Panico, M., Morris, H. R., and Hay, R. T. (1996) Nucleic Acids Res. 24, 2236-2242[Abstract/Free Full Text]
  11. Kimura, H., Weisz, A., Kurashima, Y., Hashimoto, K., Ogura, T., D'Acquisto, F., Addeo, R., Makuuchi, M., and Esumi, H. (2000) Blood 95, 189-197[Abstract/Free Full Text]
  12. Kroncke, K. D., and Carlberg, C. (2000) FASEB J. 14, 166-173[Abstract/Free Full Text]
  13. Uehara, T., Kikuchi, Y., and Nomura, Y. (1999) J. Neurochem. 72, 196-205[CrossRef][Medline] [Order article via Infotrieve]
  14. Feng, Z. W., Li, L., Ng, P. Y., and Porter, A. G. (2002) Mol. Cell. Biol. 22, 5357-5366[Abstract/Free Full Text]
  15. Li, L., Feng, Z., and Porter A. G. (2004) J. Biol. Chem. 279, 4058-4065[Abstract/Free Full Text]
  16. Kim, Y. M., Chung, H. T., Kim, S. S., Han, J. A., Yoo, Y. M., Kim, K. M., Lee, G. H., Yun, H. Y., Green, A., Li, J. R., Simmons, R. L., and Billiar, T. R. (1999) J. Neurosci. 19, 6740-6747[Abstract/Free Full Text]
  17. Okada, S., Zhang, H., Hatano, M., and Tokuhisa, T. (1998) J. Immunol. 160, 2590-2596[Abstract/Free Full Text]
  18. Ciani, E., Guidi, S., Della Valle, G., Perini, G., Bartesaghi, R., and Contestabile, A. (2002) J. Biol. Chem. 277, 49896-49902[Abstract/Free Full Text]
  19. Choi, B. M., Pae, H. O., and Chung, H. T. (2003) Free Radic. Biol. Med. 34, 1136-1145[CrossRef][Medline] [Order article via Infotrieve]
  20. Dhakshinamoorthy, S., Long, D. J., and Jaiswal, A. K. (2000) Curr. Topics Cell. Reg. 36, 201-216[Medline] [Order article via Infotrieve]
  21. Nguyen, T., Sherratt, P. J., and Pickett, C. B. (2003) Annu. Rev. Pharmacol. Toxicol. 43, 233-260[CrossRef][Medline] [Order article via Infotrieve]
  22. Alam, J., Stewart, D., Touchard, C., Boinapally, S., Choi, A. M. K., and Cook, J. L. (1999) J. Biol. Chem. 274, 26071-26078[Abstract/Free Full Text]
  23. Dhakshinamoorthy, S., and Jaiswal, A. K. (2000) J. Biol. Chem. 275, 40134-40141[Abstract/Free Full Text]
  24. Sambrook, J., Fritsch, E, F., and Maniatis T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  25. Hentze, H., Lin, X. Y., Choi, M. S. K., and Porter, A. G. (2003) Cell Death Differ. 10, 956-968[CrossRef][Medline] [Order article via Infotrieve]
  26. Tosetti, F., Vene, R., Arena, G., Morini, M., Minghelli, S., Noonan, D. M., and Albini, A. (2003) Mol. Pharmacol. 63, 565-573[Abstract/Free Full Text]
  27. Jaiswal, A. K. (2000) Arch. Biochem. Biophys. 375, 62-68[CrossRef][Medline] [Order article via Infotrieve]
  28. Dhakshinamoorthy, S., and Jaiswal, A. K. (2001) Oncogene 20, 3906-3917[CrossRef][Medline] [Order article via Infotrieve]
  29. Jaiswal, A. K. (1991) Biochemistry 30, 10647-10653[CrossRef][Medline] [Order article via Infotrieve]
  30. Itoh, K., Wakabayashi, N., Katoh, Y., Ishii, T., Igarashi, K., Engel, J. D., and Yamamoto, M. (1999) Genes Dev. 13, 76-86[Abstract/Free Full Text]
  31. Sekhar, K. R., Spitz, D. R., Harris, S., Nguyen, T. T., Meredith, M. J., Holt, J. T., Guis, D., Marnett, L. J., Summar, M. L., and Freeman, M. L. (2002) Free Radic. Biol. Med. 32, 650-662[CrossRef][Medline] [Order article via Infotrieve]
  32. Rushmore, T. H., Morton, M. R., and Pickett, C. B. (1991) J. Biol. Chem. 266, 11632-11639[Abstract/Free Full Text]
  33. Mulcahy, R. T., Wartman, M. A., Bailey, H. H., and Gipp, J. J. (1997) J. Biol. Chem. 272, 7445-7454[Abstract/Free Full Text]
  34. Tsuji, Y., Ayaki, H., Whitman, S. P., Morrow, C. S., Torti, S. V., and Torti, F. M. (2000) Mol. Cell. Biol. 20, 5818-5827[Abstract/Free Full Text]
  35. Kim, Y. C., Masutani, H., Yamaguchi, Y., Itoh, K., Yamamoto, M., and Yodoi, J. (2001) J. Biol. Chem. 276, 18399-18406[Abstract/Free Full Text]
  36. Ghatan, S., Larner, S., Kinoshita, Y., Hetman, M., Patel, L., Xia, Z. G., Youle, R. J., and Morrison, R. S. (2000) J. Cell Biol. 150, 335-347[Abstract/Free Full Text]
  37. Dennis, J., and Bennett, J. P. (2003) J. Neurosci. Res. 72, 89-97[CrossRef][Medline] [Order article via Infotrieve]
  38. Gaikwad, A., Long, D. J., Stringer, J. L., and Jaiswal, A. K. (2001) J. Biol. Chem. 276, 22559-22564[Abstract/Free Full Text]
  39. Dhakshinamoorthy, S., and Jaiswal, A. K. (2002) Oncogene 21, 5301-5312[CrossRef][Medline] [Order article via Infotrieve]
  40. Itoh, K., Chiba, T., Takahashi, S., Ishii, T., Igarashi, K., Katoh, Y., Oyake, T., Hayashi, N., Satoh, K., Hatayama, I., Yamamoto, M., and Nabeshima, Y. (1997) Biochem. Biophys. Res. Commun. 236, 313-322[CrossRef][Medline] [Order article via Infotrieve]
  41. Ishii, T., Itoh, K., Takahashi, S., Sato, H., Yanagawa, T., Katoh, Y., Bannai, S., and Yamamoto, M. (2000) J. Biol. Chem. 275, 16023-16029[Abstract/Free Full Text]
  42. Nguyen, T., Huang, H. C., and Pickett, C. B. (2000) J. Biol. Chem. 275, 15466-15473[Abstract/Free Full Text]
  43. Gong, P. F., Hu, B., Stewart, D., Ellerbe, M., Figueroa, Y. G., Blank, V., Beckman, B. S., and Alam, J. (2001) J. Biol. Chem. 276, 27018-27025[Abstract/Free Full Text]
  44. Wild, A. C., Moinova, H. R., and Mulcahy, R. T. (1999) J. Biol. Chem. 274, 33627-33636[Abstract/Free Full Text]
  45. Buckley, B. J., Marshall, Z. M., and Whorton, A. R. (2003) Biochem. Biophys. Res. Commun. 307, 973-979[CrossRef][Medline] [Order article via Infotrieve]
  46. Moriya, R., Uehara, T., and Nomura, Y. (2000) FEBS Lett. 484, 253-260[CrossRef][Medline] [Order article via Infotrieve]
  47. Karin, M., and Hunter, T. (1995) Curr. Biol. 5, 747-757[CrossRef][Medline] [Order article via Infotrieve]
  48. Bauer, C. E., Elsen, S., and Bird, T. H. (1999) Annu. Rev. Microbiol. 53, 495-523[CrossRef][Medline] [Order article via Infotrieve]
  49. Yu, R., Mandlekar, S., Lei, W., Fahl, W. E., Tan, T. H., and Kong, A. T. (2000) J. Biol. Chem. 275, 2322-2327[Abstract/Free Full Text]
  50. Yu, R., Chen, C., Mo, Y. Y., Hebbar, V., Owuor, E. D., Tan, T. H., and Kong, A. T. (2000) J. Biol. Chem. 275, 39907-39913[Abstract/Free Full Text]
  51. Lee, J. M., Hanson, J. M., Chu, W. A., and Johnson, J. A. (2001) J. Biol. Chem. 276, 20011-20016[Abstract/Free Full Text]
  52. Huang, H. C., Nguyen, T., and Pickett, C. B. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 12475-12480[Abstract/Free Full Text]
  53. Bloom, D., Dhakshinamoorthy, S., and Jaiswal, A. K. (2002) Oncogene 21, 2191-2200[CrossRef][Medline] [Order article via Infotrieve]
  54. Dinkova-Kostova, A. T., Holtzclaw, W. D., Cole, R. N., Itoh, K., Wakabayashi, N., Katoh, Y., Yamamoto, M., and Talalay, P. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 11908-11913[Abstract/Free Full Text]
  55. Stamler, J. S. (1994) Cell 78, 931-936[CrossRef][Medline] [Order article via Infotrieve]
  56. Kuo, P. C., Abe, K., and Schroeder, R. A. (2000) Gastroenterology 118, 608-618[CrossRef][Medline] [Order article via Infotrieve]
  57. Talalay, P., Fahey, J. W., Holtzclaw, W. D., Prestera, T., and Zhang, Y. (1995) Toxicol. Lett. 82–83, 173-179
  58. Lee, J. M., Moehlenkamp, J. D., Hanson, J. M., and Johnson, J. A. (2001) Biochem. Biophys. Res. Commun. 280, 286-292[CrossRef][Medline] [Order article via Infotrieve]
  59. Johnson, D. A., Andrews, G. K., Xu, W., and Johnson, J. A. (2002) J. Neurochem. 81, 1233-1241[CrossRef][Medline] [Order article via Infotrieve]
  60. Lee, J. M., Calkins, M. J., Chan, K. M., Kan, Y. W., and Johnson, J. A. (2003) J. Biol. Chem. 278, 12029-12038[Abstract/Free Full Text]
  61. Gegg, M. E., Beltran, B., Salas-Pino, S., Bolanos, J. P., Clark, J. B., Moncada, S., and Heales, S. J. R. (2003) J. Neurochem. 86, 228-237[CrossRef][Medline] [Order article via Infotrieve]
  62. Shih, A. Y., Johnson, D. A., Wong, G., Kraft, A. D., Jiang, L., Erb, H., Johnson, J. A., and Murphy, T. H. (2003) J. Neurosci. 23, 3394-3406[Abstract/Free Full Text]
  63. Chen, K., Gunter, K., and Maines, M. D. (2000) J. Neurochem. 75, 304-313[CrossRef][Medline] [Order article via Infotrieve]
  64. Shiraishi, F., Curtis, L. M., Truong, L., Poss, K., Visner, G. A., Madsen, K., Nick, H. S., and Agarwal, A. (2000) Am. J. Physiol. 278, F726-F736
  65. Dinkova-Kostova, A. T., and Talalay, P. (2000) Free Radic. Biol. Med. 29, 231-240[CrossRef][Medline] [Order article via Infotrieve]
  66. Siegel, D., Bolton, E. M., Burr, J. A., Liebler, D. C., and Ross, D. (1997) Mol. Pharmacol. 52, 300-305[Abstract/Free Full Text]
  67. Murphy, T. H., Delong, M. J., and Coyle, J. T. (1991) J. Neurochem. 56, 990-995[Medline] [Order article via Infotrieve]
  68. Lee, J. M., Shih, A. Y., Murphy, T. H., and Johnson, J. A. (2003) J. Biol. Chem. 278, 37948-37956[Abstract/Free Full Text]
  69. Leist, M., Volbracht, C., Kuhnle, S., Fava, E., Ferrando-May, E., and Nicotera, P. (1997) Mol. Med. 3, 750-764[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Physiol. GenomicsHome page
A. Pautz, P. Rauschkolb, N. Schmidt, J. Art, M. Oelze, P. Wenzel, U. Forstermann, A. Daiber, and H. Kleinert
Effects of nitroglycerin or pentaerithrityl tetranitrate treatment on the gene expression in rat hearts: evidence for cardiotoxic and cardioprotective effects
Physiol Genomics, July 1, 2009; 38(2): 176 - 185.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
S. Lim, A. C. Hung, and A. G. Porter
Focused PCR Screen Reveals p53 Dependence of Nitric Oxide-Induced Apoptosis and Up-Regulation of Maspin and Plasminogen Activator Inhibitor-1 in Tumor Cells
Mol. Cancer Res., January 1, 2009; 7(1): 55 - 66.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
S. A. Salama, M. W. Kamel, C. R. Diaz-Arrastia, X. Xu, T. D. Veenstra, S. Salih, S. K. Botting, and R. Kumar
Effect of Tumor Necrosis Factor-{alpha} on Estrogen Metabolism and Endometrial Cells: Potential Physiological and Pathological Relevance
J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 285 - 293.
[Abstract] [Full Text] [PDF]

Home page
 GENES CELLSHome page
K. Yoh, A. Hirayama, K. Ishizaki, A. Yamada, M. Takeuchi, S.-i. Yamagishi, N. Morito, T. Nakano, M. Ojima, H. Shimohata, et al.
Hyperglycemia induces oxidative and nitrosative stress and increases renal functional impairment in Nrf2-deficient mice.
Genes Cells, November 1, 2008; 13(11): 1159 - 1170.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. A. Rushworth and D. J. MacEwan
HO-1 underlies resistance of AML cells to TNF-induced apoptosis
Blood, April 1, 2008; 111(7): 3793 - 3801.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Diet, K. Abbas, C. Bouton, B. Guillon, F. Tomasello, S. Fourquet, M. B. Toledano, and J.-C. Drapier
Regulation of Peroxiredoxins by Nitric Oxide in Immunostimulated Macrophages
J. Biol. Chem., December 14, 2007; 282(50): 36199 - 36205.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
S. Dhakshinamoorthy, S. R. Sridharan, L. Li, P. Y. Ng, L. M. Boxer, and A. G. Porter
Protein/DNA arrays identify nitric oxide-regulated cis-element and trans-factor activities some of which govern neuroblastoma cell viability
Nucleic Acids Res., August 15, 2007; (2007) gkm594v1.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
G. E. Mann, D. J. Rowlands, F. Y.L. Li, P. de Winter, and R. C.M. Siow
Activation of endothelial nitric oxide synthase by dietary isoflavones: Role of NO in Nrf2-mediated antioxidant gene expression
Cardiovasc Res, July 15, 2007; 75(2): 261 - 274.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
X.-m. Liu, K. J. Peyton, D. Ensenat, H. Wang, M. Hannink, J. Alam, and W. Durante
Nitric oxide stimulates heme oxygenase-1 gene transcription via the Nrf2/ARE complex to promote vascular smooth muscle cell survival
Cardiovasc Res, July 15, 2007; 75(2): 381 - 389.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
K. Kitiphongspattana, T. A. Khan, K. Ishii-Schrade, M. W. Roe, L. H. Philipson, and H. R. Gaskins
Protective role for nitric oxide during the endoplasmic reticulum stress response in pancreatic beta-cells
Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1543 - E1554.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
M. O. Leonard, N. E. Kieran, K. Howell, M. J. Burne, R. Varadarajan, S. Dhakshinamoorthy, A. G. Porter, C. O'Farrelly, H. Rabb, and C. T. Taylor
Reoxygenation-specific activation of the antioxidant transcription factor Nrf2 mediates cytoprotective gene expression in ischemia-reperfusion injury
FASEB J, December 1, 2006; 20(14): 2624 - 2626.
[Abstract] [Full Text] [PDF]

Home page
 Exp. Biol. Med.Home page
E. B. Manukhina, H. F. Downey, and R. T. Mallet
Role of nitric oxide in cardiovascular adaptation to intermittent hypoxia.
Experimental Biology and Medicine, April 1, 2006; 231(4): 343 - 365.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
J. Gao, K. Kashfi, X. Liu, and B. Rigas
NO-donating aspirin induces phase II enzymes in vitro and in vivo
Carcinogenesis, April 1, 2006; 27(4): 803 - 810.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
J.-M. Lee, J. Li, D. A. Johnson, T. D. Stein, A. D. Kraft, M. J. Calkins, R. J. Jakel, and J. A. Johnson
Nrf2, a multi-organ protector?
FASEB J, July 1, 2005; 19(9): 1061 - 1066.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/19/20096    most recent
M312492200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dhakshinamoorthy, S.
Right arrow Articles by Porter, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dhakshinamoorthy, S.
Right arrow Articles by Porter, A. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement