|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 279, Issue 19, 20147-20153, May 7, 2004
A Common Cross-species Function for the Double Epidermal Growth Factor-like Modules of the Highly Divergent Plasmodium Surface Proteins MSP-1 and MSP-8*![]() ![]() ![]() From the Walter and Eliza Hall Institute of Medical Research, Melbourne, Victoria 3050, Australia
Received for publication, February 2, 2004 , and in revised form, February 18, 2004.
An understanding of structural and functional constraints on the C-terminal double epidermal growth factor (EGF)-like modules of merozoite surface protein (MSP)-1 and related proteins is of importance to the development of these molecules as malaria vaccines and drug targets. Using allelic replacement, we show that Plasmodium falciparum parasites can invade erythrocytes and grow efficiently in the absence of an MSP-1 protein with authentic MSP-1 EGF domains. In this mutant parasite line, the MSP-1 EGFs were replaced by the corresponding double EGF module from P. berghei MSP-8, the sequence of which shares only low identity with its MSP-1 counterpart. Hence, the C-terminal EGF domains of at least some Plasmodium surface proteins appear to perform the same function in asexual blood-stage development. Mapping the surface location of the few residues that are common to these functionally complementary EGF modules revealed the presence of a highly conserved pocket of potential functional significance. In contrast to MSP-8, an even more divergent double EGF module, that from the sexual stage protein PbS25, was not capable of complementing MSP-1 EGF function. More surprisingly, two chimeric double EGF modules comprising hybrids of the EGF domains from P. falciparum and P. chabaudi MSP-1 were also not capable of replacing the P. falciparum MSP-1 EGF module. Together, these data suggest that although the MSP-1 EGFs can accommodate extensive sequence diversity, there appear to be constraints that may restrict the simple accumulation of point mutations in the face of immune pressure in the field.
The surface coat of the erythrocyte-invasive form of Plasmodium parasites is comprised of a number of proteins, the most abundant of which appears to be merozoite surface protein (MSP)1-1. This large ( 200-kDa) glycosylphosphatidylinositol membrane-anchored protein is processed during invasion, leaving only a C-terminal 19-kDa fragment (MSP-119) associated with parasite membranes in newly invaded erythrocytes (1). MSP-119 is almost entirely composed of two epidermal growth factor (EGF)-like domains. This double EGF module is considered an important target of protective antibodies both in naturally exposed individuals (24) and in vaccinated and experimentally infected animals (58). Consequently, recombinant proteins incorporating the MSP-119 EGF domains are leading candidates for inclusion in a vaccine for the control of the most important cause of human malaria, Plasmodium falciparum.
Despite considerable effort, the biological function of the MSP-1 EGF domains is not yet certain, although recent binding studies argue that MSP-119 mediates binding to band 3 on the surface of human erythrocytes (9). Whatever its precise role, we have shown previously that the MSP-1 EGF-like domains are functionally conserved across divergent Plasmodium species. Specifically, in these studies we constructed P. falciparum parasites that are deficient for wild-type MSP-1 and instead express MSP-1 chimeras that incorporate the EGF domains from the rodent malaria P. chabaudi MSP-1 molecule (4, 10). These lines invade and grow normally in human erythrocytes. In a reciprocal approach, we have also shown that the P. falciparum MSP-1 EGF domains can complement the function of the corresponding module in the rodent malaria P. berghei in parasites grown in vivo (11). Hence, if the MSP-1 double EGF module does mediate an essential interaction with the erythrocyte surface, then each module, no matter what its Plasmodium species of origin, should bind efficiently to receptor orthologs from broad host origins. The finding that the MSP-119 domain could be changed to antigenically divergent forms without an obvious effect on growth has proved useful for the development of a novel correlate-of-protection invasion inhibition assay (4, 11); however, it has also raised an interesting dilemma of considerable relevance to vaccine development: will vaccine-induced immune pressure rapidly select for antibody escape mutants? We and others have hypothesized that this is unlikely because the requirement for the MSP-119 module to form a tight U-shaped fold may place considerable constraints on the molecule such that compensatory changes may be required to accommodate individual point mutations (4, 12). Consistent with this view, point mutations are not common in P. falciparum MSP-119 sequences from field isolates, despite the likelihood that this module is under considerable selection pressure (13, 14). Here, we addressed whether MSP-119 could functionally accommodate more radical change and, in the process, examined the possibility that the double EGF modules of different MSPs may be capable of performing the same biological role. Using allelic replacement in P. falciparum, we show that the MSP-1 EGF domains can be functionally complemented by the double EGF module found in a different and highly divergent parasite protein, P. berghei MSP-8 (15, 16). However, we also show that some other double EGF domains, including chimeras of P. falciparum-P. chabaudi MSP-119 sequences, do not appear to function in the context of MSP-1, suggesting that there are structural and functional constraints on sequence changes to this module.
Plasmid ConstructionThe DNA sequence immediately 5' to the double EGF-like domains of P. falciparum MSP-1 was amplified from D10 genomic DNA using the following oligonucleotides (restriction sites are underlined): PfMSP1/8.1 (CTGTAAGGGTAAGTGGTAGTTCAGGATCCACAAAAG) and PfMSP1/8.2 (GGGCATTTCTCATTTTTACATTGGTGTTGTGAAATGTTTAACATATCTTGG). The DNA sequence encoding the double EGF-like domains and glycosylphosphatidylinositol anchor attachment sequence of P. berghei MSP-8 was amplified from P. bergehi (ANKA strain) genomic DNA using the following oligonucleotides (restriction sites are underlined): PfMSP1/8.3 (CACAACACCAATGTAAAAATGAGAAATGCCCAATAAACTCAAATTG) and PfMSP-1/8.4 (CCGCTCGAGTTACATTATATATATGCATACTATTGAAATTAAAAAG. The 5' P. falciparum MSP-1 DNA and the P. berghei MSP-8 EGF DNA were sewn together by PCR using the oligonucleotides PfMSP1/8.1 and PfMSP1/8.4. The resulting chimeric DNA sequence was digested with the restriction enzymes BamHI and XhoI and then ligated into BglII/XhoI-digested vector pHH1 (17) to create the plasmid pMSP1/Pb8.
Parasite Culture and TransfectionP. falciparum D10 strain parasites were cultured and synchronized as per standard procedures (18, 19). Ring-stage parasites ( Nucleic Acid AnalysisGenomic DNA isolated from mixed trophozoite/schizont-stage parasites was analyzed by Southern blot hybridization largely using standard procedures (22). Protein Expression and PurificationThe DNA sequence corresponding to the terminal region of the P. berghei MSP-8 gene was amplified from P. falciparum (D10 line) genomic DNA using the following oligonucleotides (restriction sites are underlined): PbMSP8EGF.1 (CGCGACGCGTGGATCCACCATGATTTGTAAAAATGAGAAATGCCCAATAAAC) and PbMSP8EGF.2 (CTAGTCTAGACTCGAGCTAACTAGATGAACAATATATACCATCTCC). The resulting PCR products were digested with the restriction enzymes BamHI and XhoI (Promega), ligated into the appropriate pGEX vectors, and expressed in Escherichia coli BL21 cells (Stratagene) as glutathione S-transferase fusion proteins (23). Generation of AntibodiesTo generate antisera, 6-week-old female Balb/c mice and 3-month-old New Zealand White rabbits were immunized with 40 and 150 µg of glutathione S-transferase fusion protein, respectively, in Freund's complete adjuvant. Animals were boosted three times with 35 and 120 µg of protein in Freund's incomplete adjuvant 5 weeks after injection, after which the animals were bled for serum collection. Anti-glutathione S-transferase antibodies were removed from rabbit serum using a glutathione S-transferase-bound CnBr-activated Sepharose 4B column (Amersham Biosciences). SDS-PAGE and Western BlottingTo obtain pure ring-stage parasite populations, parasites were double-synchronized 4 h apart with 5% sorbitol (Sigma). Parasite proteins were obtained by saponin lysis (0.15%) of infected red blood cells at several time points after synchronization. Proteins were separated on 12% nonreducing SDS-PAGE gels and transferred to nitrocellulose membranes for Western blotting as described previously (4).
Growth, Invasion, and Invasion-Inhibition AssaysThe growth rate of parasite lines was compared in a 5-day growth rate assay as described previously (24). For invasion assays, mature-stage parasites were adjusted to 1% parasitemia and 4% hematocrit. Aliquots of 1 ml were washed and resuspended in control NaHCO3 (0.2%)-buffered media or in buffered media containing either Vibrio cholerae neuraminidase (0.066 unit/ml; Calbiochem), L-1-tosylamido-2-phenylethyl chloromethyl ketone-treated trypsin (0.9 mg/ml; Sigma), or Antibody inhibition assays were performed essentially as described previously (4), except that re-invaded parasites were allowed to mature through to the trophozoite stage. Seventy of 100 µl of culture media was removed from each well and replaced with 70 µl of buffered media. The washed red blood cells were resuspended; 10 µl was removed and transferred to a fluorescence-activated cell-sorting (FACS) tube. 190 µl of phosphate-buffered saline containing 10.5 mg/ml ethidium bromide was mixed with red blood cells and left to stain the parasite nucleus of infected red blood cells at room temperature for 5 min. FACS analysis was then performed on a FACsort (Becton Dickinson). Each well of a triplicate set was analyzed individually by counting 100,000 red blood cells. Red blood cells infected with re-invaded parasites were identified based on fluorescence and FACS data analyzed using CellQuest V3.3 software. Molecular ModelingModels of EGF modules were generated by comparative modeling (25) using the P. falciparum MSP-119 crystal structure (26). The alignment used to generate these structures is shown in Fig 1B. The MODELLER (6v2) program (27) was used to generate 25 initial model structures. The structure with the lowest MODELLER objective function was used for further analysis. The quality of the model was assessed using the Profiles-3D (28) program. All models had positive s-scores across all residues from the Profiles-3D verification analysis (applying a 21-residue sliding window). Buried surface areas were calculated as the difference in solvent-accessible surface areas in uncomplexed and complexed structures using the program NACCESS v.2.1.1.
Functional Complementation of the MSP-1 EGF Domains with Those from P. berghei MSP-8 Using allelic replacement into the full-length P. falciparum MSP-1 gene, we have shown previously that the double EGF-like module from P. chabaudi MSP-1 can fully complement the function of its P. falciparum counterpart in erythrocyte invasion (4, 10). This surprising result led us to examine whether the double EGF module from a more distantly related, non-MSP-1 molecule could similarly complement function in P. falciparum MSP-1. For this we chose the double EGF domain region from a recently identified antigen known as MSP-8 (15, 16). Like MSP-1, MSP-8 is glycosylphosphatidylinositol-anchored and contains a double EGF-like domain at its C terminus, although these proteins bear little resemblance elsewhere in their sequences. As evidenced by phylogenetic analysis of double EGF domain sequences from human (P. falciparum) and rodent species (P. berghei and P. yoelii), MSP-8 EGF sequences form a distinct evolutionary grouping, clearly separated from MSP-1 EGF sequences (Fig. 1A). Also included in this analysis was the sequence from the C-terminal double EGF-like domains of the sexual-stage ookinete surface antigen PfS25 (29). As expected, the PfS25 sequence was only distantly related to both MSP-1 and MSP-8 EGF sequences. The P. berghei MSP-8 double EGF sequence is 81 amino acids in length, considerably shorter than the corresponding MSP-1 sequences (Fig. 1B). The domain shares 22% amino acid identity with P. falciparum MSP-1 EGF domains after the inclusion of five gaps in the alignment and excluding the canonical cysteine residues (Fig. 1B). We generated a transfection construct, pMSP1/Pb8, designed to replace the nucleotides encoding the P. falciparum MSP-1 EGF domains with the corresponding residues from P. berghei MSP-8 as shown in Fig. 1C. Upon transfection into the P. falciparum line D10, pMSP1/Pb8 was shown to have integrated into the MSP-1 gene. The transfected population, D10-MSP1/Pb8, was cloned, and randomly selected clones were analyzed. Southern blot analysis of XbaI-digested genomic DNA from a representative clone showed that the plasmid had integrated into the target site through the expected recombination event with the disappearance of the endogenous 6.1-kb fragment and the appearance of the expected 4.2- and 9-kb integration fragments (Fig. 1, C and D). The 7.1-kb fragment also observed represents tandemly repeated plasmid copies that typically integrate into the locus after this type of recombination event, probably as a consequence of plasmids initially replicating as concatamers before integration (30, 31). To examine expression of the hybrid MSP-1/MSP-8 protein, extracts of blood-stage D10-MSP1/Pb8 parasites were analyzed by probing Western blot membranes with antibodies generated against the EGF domains of P. falciparum MSP-1 and P. berghei MSP-8. Whereas parental D10 parasites expressed the expected P. falciparum MSP-1 reactive species at 200, 42, and 19 kDa, samples from D10-MSP1/Pb8 did not react with this reagent (Fig. 2A). In contrast, identical blots probed with P. berghei MSP-8 antibodies reacted in the opposite manner with strongly reactive species observed in D10-MSP1/Pb8 parasites. As expected, cross-reactive 200- and 42-kDa species were detected in both lines, with an antibody specific for the 33-kDa fragment of P. falciparum MSP-1 demonstrating that the MSP-1 molecules of these two parasite lines differ only in their MSP-119 region (Fig. 2A). Double labeling IFA showed the expected specific reciprocal pattern of expression, with characteristic surface labeling observed with both antibodies (Fig. 2B). A time-course experiment revealed that the MSP-1 proteins expressed by the two parasite lines were co-regulated late in the erythrocytic cycle (Fig. 2C). Together, these data show that D10-MSP1/Pb8 parasites express an MSP-1 hybrid that incorporates the EGF domains from P. berghei MSP-8 at its C terminus.
Replacement of the MSP-1 EGF domains in this manner did not significantly affect parasite growth in a 5-day growth rate assay (Fig. 3A). Furthermore, D10-MSP1/Pb8 parasites appear to invade erythrocytes using the same invasion pathway as parental D10 parasites because both lines were indistinguishable in their ability to enter erythrocytes treated with various enzyme combinations that define such pathways (Fig. 3B) (3235). As described previously (35), the D10 line invaded red blood cells using a mostly trypsin-dependent, neuraminidase- and chymotrypsin-independent pathway. Also as expected, D10-MSP1/Pb8 parasites are capable of avoiding the erythrocyte invasion-inhibitory effect of P. falciparum antibodies that target the MSP-1 EGF module (Fig. 3C). Taken together, the P. berghei MSP-8 EGF domains appear to efficiently complement the function of their MSP-1 counterparts.
MSP-8 EGF Domains Are Predicted to Fold Similarly to Those of MSP-1: Identification of a Conserved PocketThe crystal and NMR structures of the P. falciparum MSP-1 EGF domains have been determined (26, 36), as have the crystal structures for the P. cynomolgi and P. knowlesi versions of this molecule (37, 38). All studies show that the MSP-1 EGF domains form a flat, almost disc-like structure with the two domains folded back on one another, not end-on-end as in some other multi-EGF domain proteins. Several residues in each EGF domain line the interface and clearly contribute to a tight association between the domains. In the P. falciparum MSP-1 structures, the most important of these residues appear to be Phe19, Lys29, Leu32, Leu86, Phe87, Ile90, and Phe91, although other residues are also involved in interdomain contacts (26). These key residues are highlighted on a sequence alignment of the three EGF domain sequences that have complementary function (Fig. 1B). In P. berghei MSP-8, conservative changes are evident in only four of these seven positions. Nevertheless, using computer-simulated molecular modeling, the P. berghei MSP-8 EGF domains were predicted to form a highly stable structure very similar in size and shape to the MSP-1 EGF structure (Fig. 4A). A similar tight interface was predicted to occur between the two MSP-8 EGF domains. Specifically, the three-dimensional profile score for the model of P. berghei MSP-8 is 26. This compares favorably with the three-dimensional profile score of 34 for the NMR structure of P. falciparum MSP-1 (36) and the expected value of 43 for a protein of this size (28). At the interface between the two EGF domains of P. falciparum MSP-1, there is 1036 Å2 of surface buried. A slightly smaller surface area, 830 Å2, is buried in the model of P. berghei MSP-8.
Given functional complementarity and the likelihood of a very similar fold for the double EGF domains of MSP-1 and MSP-8, we addressed whether the spatial arrangement of the few residues that are conserved between these sequences provides insight into potentially important functional regions of these domains. Fig. 4B shows surface representation of the crystal structure of P. falciparum MSP-119 with identical (dark blue) and conserved (light blue) amino acids highlighted. A distinct conserved region was evident on one face of the EGF module. This region comprised a significant depression and involves residues in the highly conserved Asn-Gly stretch at the beginning of EGF domain 2 (Fig. 1B) as well as a number of other residues from both EGF domains. It is possible that this conserved pocket represents a site of functional importance. Constraint on P. falciparum MSP-1 EGF Domain Function The successful replacement of the MSP-1 EGF domains with those from P. berghei MSP-8 raised the possibility that even more radical change may be accommodated at the C terminus of MSP-1. To explore this, we attempted to use the same allelic replacement approach to determine whether the C-terminal double EGF domains from the P. berghei version of P25 (PbS25) could complement MSP-119 function. These domains share only 9% amino acid identity with their MSP-1 counterparts, excluding the cysteine residues. The plasmid constructed for this purpose, pPbS25.3', was identical to that shown in Fig. 1C except for the EGF domains. This plasmid was successfully transfected into P. falciparum D10 parasites on two separate occasions; however, on each occasion, the plasmid was maintained episomally for an extended period and did not integrate into the MSP-1 locus (data not shown). Hence, it appears unlikely that the C-terminal PbS25 EGF domains are capable of complementing the function of the MSP-1 EGF module.
Further in this regard, in the course of testing various P. falciparum/P. chabaudi MSP-1 chimeras (summarized in Fig. 5), we found that although the double EGF module of P. chabaudi can complement the function of its P. falciparum counterpart (see D10-PcMEGF and D10-PcM3' chimeras), two chimeras that incorporate one domain each of P. falciparum and P. chabaudi did not integrate into the MSP-1 locus despite successful transfection and extended episomal maintenance of these constructs on two separate occasions each (data not shown). These constructs differed from each other only in the origin of the spacer region (Fig. 5). Whereas the failure of any one of these plasmids to integrate into the MSP-1 locus does not prove that the chimeric domains in question are incapable of fully complementing MSP-119 function, given that the same plasmid backbone was used in all instances and that two very similar plasmids (D10-PcME2+ and D10-PcME2) failed to integrate, it seems likely that modules comprising one domain each from P. falciparum and P. chabaudi do not complement P. falciparum MSP-119 function. It is possible that this incompatibility is because there are impediments to correct folding of the resulting chimeric domains. However, the three-dimensional profile scores for models of the MSP-1 EGF modules in D10-PcME2+ and D10-PcME2 were determined to be 40 and 39, respectively, which are significantly larger than 19, the value below which an incorrectly folded structure would be indicated, and are similar to the three-dimensional profile score of 43 for the fully functional chimeric MSP-1 EGF module in D10-PcM3'. In each of these chimeras, the interface between the two EGF domains buries
The finding that the EGF module of P. berghei MSP-8 can complement the function of its MSP-1 counterpart reveals that the EGF domains of MSP-1 can accommodate extensive amino acid change without compromising the ability of the parasite to invade erythrocytes and to mature apparently normally through its blood-stage cycle. The double MSP-8 EGF domains exist naturally as a module at the C terminus of MSP-8, a protein that otherwise shows no apparent similarity to MSP-1. Therefore, the double EGF modules found at the C terminus of MSP-1 and MSP-8 appear capable of performing the same function both within and between very divergent Plasmodium species. EGF-like domains typically have binding functions, and it has long been assumed that such a role may exist for those at the C terminus of MSP-1. Recent work suggests that erythrocyte band 3 is a receptor for the P. falciparum MSP-1 EGFs (9). In this regard, MSP-119 has been suggested to mediate a chymotrypsin-sensitive invasion pathway in P. falciparum (9). Paradoxically, however, erythrocyte invasion of the D10 line is not sensitive to chymotrypsin, but as antibody inhibition studies have clearly demonstrated (this paper and Refs. 4 and 10), the D10 parasite line appears to require MSP-119 for invasion. Because it is not revealed by enzyme treatments, it seems unlikely that the MSP-119-band 3 interaction plays a role in invasion that is equivalent to the binding mediated by the apically located erythrocyte binding antigen family. Alternatively, it may be that the EGF module of MSP-1 does not have an essential receptor binding role. Rather, the function of these domains may be redundant; for example, they may play a passive role such as providing stability or appropriate spatial orientation of the large head group of MSP-1. However, a purely structural role for the MSP-1 EGF module also seems unlikely, given the apparent inability of MSP-1 to accommodate three different double EGF modules. Two of these modules comprised a mixture of EGF domains from P. chabaudi and P. falciparum MSP-1. This observation is consistent with the view that the appropriate tight packing of the EGF domains is essential for a specific function and that mutations on one EGF may be incompatible with those in close contact on the other. However, molecular modeling did not provide structural indications why the P. chabaudi/P. falciparum chimeras lacked function. Because longer P. chabaudi chimeras are functional in P. falciparum (see Fig. 5), the data suggest that residues within the second half of the first EGF domain comprising residues Gly24 to Arg42 from P. chabaudi are incompatible with the second EGF domain from P. falciparum. In the sequence alignment (Fig 1B) of P. chabaudi with P. falciparum, differences in the second half of the first EGF domain are generally conservative, although there are several differences involving changes in formal charge (E24G, Q36K, E37N, and G38D). In the second EGF domain, there are a large number of differences involving formal charge (E51N, D59S, T61D, T63R, E65V, S69D, S71R, E77T, T79K, K80E, and D82T). Not surprisingly, all these residues are solvent-exposed. The lack of apparent intramolecular structural incompatibilities in the chimeric molecules suggests that the incompatibility in the chimeras possibly arises at the intermolecular level, where a particular combination of residues from both domains is required for normal, potentially electrostatic interaction. Such a constraint explains, in part, why it is that, despite considerable immune pressure, the MSP-1 EGF sequences are relatively conserved in field isolates of P. falciparum. Given that the diversity of the sequences of MSP-1 EGFs from other species appears to be more extensive than in P. falciparum, it is likely that there are additional explanations for the lack of diversity in P. falciparum MSP-1 sequences. It remains plausible that, although it appears to be an ancient organism, P. falciparum strains circulating today have a relatively recent common ancestor, and as a result, there has been less time for mutations to accumulate in parasite antigens such as MSP-119 that have particular structure-function constraints (39, 40). With a few notable exceptions (e.g. MSP-2), most of the known membrane-associated proteins found at the surface of Plasmodium merozoites posses either one or two EGF domains at their C terminus. In this paper, by demonstrating that the double EGF module of one of these proteins can perform the apparently essential function of another, the likelihood arises that some or all of these domains may perform a common biological role. Although the precise nature of this role remains to be elucidated, it is now reasonable to suggest that it may be possible to design drugs that target multiple EGF domains and hence interfere with this common function. Of relevance to this, we identified a distinct region on one face of the double EGF module that is highly conserved across MSP-1 and MSP-8. Because these otherwise very divergent domains perform the same function, at least in the context of MSP-1, this conserved pocket is of potential functional importance. Alternatively, this region may be inaccessible to antibodies and hence not susceptible to selective pressure. However, if the former is true, this pocket would constitute a potential drug target, especially because it has the appropriate dimensions that make it accessible by small compounds. Significantly, the common cross-species function of the MSP-1 and MSP-8 EGF modules means that drug candidates can be screened for potency both in vitro using cultured P. falciparum and in rodents using P. beghei or other murine malaria species.
* This work was supported in part by the National Health and Medical Research Council of Australia. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 The abbreviations used are: MSP, merozoite surface protein; EGF, epidermal growth factor; FACS, fluorescence-activated cell-sorting.
We thank Michael Blackman for the kind gift of monoclonal antibody X509 and Tania de Koning-Ward, Alex Maier, and Alan Cowman for helpful advice. We are grateful to the Australian Red Cross Blood Service for the provision of human blood and serum.
This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||