JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M308656200 on October 30, 2003

J. Biol. Chem., Vol. 279, Issue 2, 1408-1414, January 9, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/2/1408    most recent
M308656200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jin, P.
Right arrow Articles by Fu, G. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jin, P.
Right arrow Articles by Fu, G. K.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cloning and Characterization of a GABAA Receptor {gamma}2 Subunit Variant*

Pei Jin{ddagger}, Juan Zhang, Courtney Rowe-Teeter, Junming Yang, Laura L. Stuve, and Glenn K. Fu

From the Incyte Corporation, Palo Alto, California 94304

Received for publication, August 6, 2003 , and in revised form, October 13, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We have cloned a novel {gamma}-aminobutyric acid type A (GABAA) receptor {gamma}2 subunit variant named {gamma}2XL. {gamma}2XL contains an alternatively spliced exon, resulting in the addition of 40 amino acids to the N-terminal extracellular domain between Ser171 and Tyr172. We show that {gamma}2XL failed to localize to the cell surface when it was coexpressed with the {alpha}2 and {beta}1 subunits in human embryonic kidney 293 cells. Expression of {gamma}2XL in 293 cells suppressed GABAA receptor binding in a dose-dependent manner by preventing GABAA receptor cell-surface localization. We also generated a {gamma}2 mutant with Ser171 and Tyr172 converted to glycine and threonine, respectively. We demonstrate that this mutant has a significantly lower affinity for the {alpha}2 and {beta}1 subunits and failed to reach the cell surface when coexpressed with these subunits. Together, our results indicate that Ser171 and Tyr172 in the {gamma}2 subunit constitute a critical motif. When this motif is disrupted by insertion of the alternative exon, access of the {gamma}2 subunit to the cell surface is prevented.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
{gamma}-Aminobutyric acid type A (GABAA)1 receptors are the major inhibitory receptors in brain and are also the targets of clinically important drugs such as benzodiazepines, barbiturates, neurosteroids, and anesthetics (1). Several distinct classes of GABAA receptor subunits have been identified (1-6), and the native GABAA receptor has been proposed to be a pentameric transmembrane protein formed by two {alpha} and two {beta} subunits and one {gamma} subunit (7). Heterologous expression of recombinant GABAA receptor subunits in cultured cells shows that the combination of {alpha} and {beta} subunits is sufficient for creating the GABA-binding sites and for eliciting GABA-gated Cl- currents (7). Benzodiazepines bind to a distinct site on the GABAA receptor and positively modulate GABA-gated Cl- currents (8). Formation of benzodiazepine-binding sites requires the presence of a third component, the {gamma} subunit (7, 8). The {gamma}2 subunit has recently been found to be essential for clustering and postsynaptic localization of GABAA receptors (9) and is also required for GABAA receptor endocytosis (10-12). In addition, mutations in the {gamma}2 subunit have been linked to GABAA receptor dysfunction in familial epilepsy syndromes (13-15).

The {gamma}2 subunit has been identified as two alternatively spliced variants, {gamma}2L and {gamma}2S. {gamma}2L contains an alternative exon that encodes 8 amino acids inserted in the intracellular loop between the third and fourth transmembrane domains. Patterns of {gamma}2L and {gamma}2S expression are overlapping but distinct (16, 17). Genetically engineered mice bearing only {gamma}2S exhibit increased affinity for benzodiazepines and show increased sensitivity in behavioral responses to these agonists (18).

This work describes the cloning and characterization of a third {gamma}2 subunit splice variant, {gamma}2XL. This variant possesses an additional alternative exon that encodes a stretch of 40 amino acids inserted in the N-terminal extracellular domain, but lacks the 8-amino acid alternative exon found in {gamma}2L. {gamma}2XL was localized intracellularly when coexpressed with the {alpha}2 and {beta}1 subunits in 293 cells. Overexpression of {gamma}2XL decreased ligand binding to the GABAA receptor composed of the {alpha}2, {beta}1, and {gamma}2 subunits. We further identified that 2 amino acids in the {gamma}2 subunit (Ser171 and Tyr172) are essential for subunit interaction and cell-surface expression. Coincidently, these 2 amino acids directly flank the inserted alternative exon and are extremely conserved among members of the GABAA receptor subunit superfamily. Identification of a novel exon inserted in the highly conserved motif in the {gamma}2 subunit will further our understanding of the mechanisms that control GABAA receptor assembly and membrane trafficking.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of {alpha}2, {beta}1, {gamma}2, and {gamma}2XL Receptor Subunits—First-strand cDNAs were synthesized with StrataScript reverse transcriptase (Stratagene) using an mRNA pool prepared from 168 representative normal and diseased human tissues. These tissues covered all the major organs of the human anatomy. Total RNA was extracted from each tissue sample using TRIzol (Invitrogen), followed by mRNA isolation using Oligotex (QIAGEN Inc.) and DNase treatment. The integrity of mRNA was checked by agarose gel electrophoresis prior to pooling. GABAA receptor {gamma}2 subunit cDNA (NCBI Nucleotide Database RefSeq NM_000816 [GenBank] )2 and {gamma}2XL were cloned using a PCR primer pair flanking the entire open reading frame (5'-GCGATGAGTTCGCCAAATATATG and 5'-CATCTCTCCATGAGACTCAGTGAATAAG). PCR products were cloned into the pDrive cloning vector (QIAGEN Inc.), and the cDNA insert size from ~200 randomly selected recombinant clones was determined by PCR amplification. Representative clones with subtle differences in molecular mass were completely sequenced. {gamma}2XL was identified by alignment of cloned cDNA sequences with the human {gamma}2 subunit genomic DNA (RefSeq NT_023133 [GenBank] .11) using the software SIM4 (19). {alpha}2 (RefSeq NM_000807 [GenBank] ) and {beta}1 (RefSeq _000812) subunit cDNAs were cloned by reverse transcription-PCR using primers 5'-GGCGGTGATGAAGACAAAATTGAA and 5'-GATAACATGGGTCTCAATTCAAGG and primers 5'-GTAATGTGGACAGTACAAAATCGAGAG and 5'-CGCTGTTGGGGACCTGTAAG, respectively. All cloned cDNAs were verified by complete insert sequencing.

Plasmid Constructs—To prepare DNA constructs for GABAA receptor-ligand binding assays, {alpha}2, {beta}1, {gamma}2, and {gamma}2XL cDNA inserts were removed from the pDrive cloning vector by restriction digestion and subcloned into the pCEP4 expression vector (Invitrogen).

To facilitate protein detection, epitope tags were added to the receptor subunits by PCR. To add a Myc-His tag to the C termini of {gamma}2 and {gamma}2XL, the cDNAs were amplified by PCR using primers 5'-GTACAAGCTTACCATGAGTTCGCCAAATATATGGAGCACA and 5'-ATCCTCGAGCAGGTAGAGGTAGGAGACCCAATAGAC and cloned into the HindIII/XhoI sites of the pcDNA3.1/Myc-His A plasmid (Invitrogen). To enhance detection, a second Myc tag was introduced between amino acids 8 and 9 of mature {gamma}2 and {gamma}2XL by PCR. The cDNA was amplified in two pieces using primers 5'-ATCAAGCTTACCATGGGTTCGCCAAATATATGGAGCACAGGA and 5'-ATCGAATTCATAGTCATCATCAGATTTCTG and primers 5'-ATGAATTCGAACAAAAACTCATCTCAGAAGAGGATCTGGATTATGCTTCTAACAAAACATGGGTC and 5'-ATCCTCGAGCAGGTAGAGGTAGGAGACCCAATAGAC. The PCR fragments were digested with HindIII and EcoRI or with EcoRI and XhoI and cloned back into the HindIII/XhoI sites of the pcDNA3.1/Myc-His A plasmid.

We constructed {alpha}2 and {beta}1 subunits with a C-terminal V5 tag using PCR. For {alpha}2-V5, PCR was performed with primers 5'-GTAAAGCTTACCATGGGACAAAATTGAACATCTAGAACATC and 5'-GTCTGGATCCTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATGGCTTACCCCAAGGACTGACCCCTAATAC. For {beta}1-V5, PCR was performed with primers 5'-GTACAAGCTTACCATGGGGACAGTACAAAATCGAGAGAGTCTG and 5'-GTCTGGATCCTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCCCAGTGTACATAGTAAAGCCAATAGAC. The PCR products were digested with HindIII and BamHI and cloned into pcDNA3.1 (Invitrogen).

The {gamma}2(S171G/Y172T) and {gamma}2(S171G/Y172T)-Myc constructs were prepared from {gamma}2XL and {gamma}2XL-Myc, respectively, by deleting the alternative exon using PCR. The coding sequence of {gamma}2XL was amplified using primers 5'-ATCAAGCTTACCATGGGTTCGCCAAATATATGGAGCACAGGA and 5'-GACTGGTACCGGAGAACTCCAAGGGGCAGGA and primers 5'-GACTGGTACCGGCTATCCACGTGAAGAAATTGTT and 5'-ATCCTCGAGCAGTCAGAGGTAGGAGACCCAATAGAC. The PCR products were digested with HindIII and KpnI or with KpnI and XhoI and cloned into the HindIII/XhoI sites of the pcDNA3.1 plasmid to introduce the S171G and Y172T mutations at the KpnI restriction site.

Quantitative PCR (Q-PCR)—mRNAs were isolated from 18 human brain tissues using Oligotex. Two human brain total RNAs were purchased (Stratagene). Following DNase treatment, the mRNA samples were verified by Q-PCR to be free of detectable genomic DNA contamination. First-strand cDNA was generated using StrataScript reverse transcriptase. Q-PCR primers and probes were designed using Primer Express Version 1.5 (Applied Biosystems). The {gamma}2XL primer/probe set lies within the alternative exon to yield a 63-bp amplicon (primers 5'-GTGGTGTGATCTCGGCTCACT and 5'-GCCAAGGTGGGAGGATCAG and probe 5'-AGCCTTCGCTTCTGG).

The control primer/probe set was selected from exons 7 and 8 of the {gamma}2 subunit gene, which flanks a 6792-bp intron, to yield a 100-bp amplicon (primers 5'-TGTCGTCCTATCCTGGGTGTCT and 5'-TGCTGAGGGTGGTCATTGTC and probe 5'-TTCCAGCCAGAACAT). Q-PCRs were performed for 50 cycles on an ABI7900 (Applied Biosystems) according to the manufacturer's instructions. The threshold cycle values were determined by the ABI software default {Delta}Rn vAlue.

Cell Cultures and Transfection—Human embryonic kidney 293 cells were maintained in Dulbecco's modified Eagle's medium and 10% fetal bovine serum (Invitrogen) and transfected using LipofectAMINE 2000 (Invitrogen) following the manufacturer's instructions. Transfection was performed either in 10-cm dishes with 24 µg/dish plasmid DNA or in 6-well plates with 5 µg/well plasmid DNA.

Radioligand Binding—Cells were harvested 48 h after cotransfection with equal amounts of the {alpha}2, {beta}1, and either {gamma}2 or {gamma}2XL constructs. To prepare the membrane fraction, cells were homogenized in ice-cold wash buffer (10 mM potassium phosphate, pH 7. 2) by passage through a 27-gauge needle. Cell homogenates were washed by two centrifugation-resuspension cycles in 1 ml of ice-cold wash buffer. Cell homogenates were centrifuged at 4 °C for 60 min at 15,000 x g. The pellets were resuspended in 600 µl of ice-cold assay buffer (10 mM potassium phosphate, pH 7. 2, and 100 mM potassium chloride) and centrifuged at 500 x g for 5 min. The supernatant, which contained the enriched membrane fraction, was collected and stored at -80 °C after the protein concentration was determined. For radioligand binding, 150-200 µg of membrane protein preparation was incubated on ice for 60 min with 10 nM [3H]Ro 15-1788 (78 Ci/mmol; PerkinElmer Life Sciences) or 10 nM [3H]muscimol (28.5 Ci/mmol; PerkinElmer Life Sciences) in a total volume of 200 µl. Unbound ligands were removed at the end of the incubation by rapid filtration on Whatman GF/C filters with a Model 1225 sampling manifold (Millipore Corp.). The filters were washed once with 15 ml of ice-cold assay buffer, and the filter-retained radioactivity was determined by liquid scintillation counting.

Protein Analysis—Cells were transfected with tagged or untagged GABAA receptor subunit constructs and harvested 48 h later. Nickel-nitrilotriacetic acid (Ni-NTA)-agarose beads (QIAGEN Inc.) were used for purifying His6-tagged proteins under native conditions following the manufacturer's instructions. Purified His6-tagged proteins were eluted and separated on SDS-polyacrylamide gels for immunoblotting using anti-Myc or anti-V5 antibody (both from Invitrogen). Antibodies were diluted 1:5000.

Immunocytochemistry—Transfected cells plated on poly-L-lysine (25 µg/ml)-coated coverslips were fixed in 3% paraformaldehyde in phosphate-buffered saline (PBS) 24 h after transfection. When membrane permeabilization was required, cells were treated with PBS and 0.1% (v/v) Triton X-100 for 10 min following fixation. Cells were washed three times with PBS and blocked for 10 min in PBS containing 10% fetal bovine serum and 0.5% bovine serum albumin. Anti-Myc antibody (diluted 1:100) was applied for 1 h, followed by three washes with PBS. Fluorescein-conjugated anti-mouse IgG (diluted 1:100; Calbiochem) was applied for 1 h. Coverslips were washed three times with PBS, mounted on glass slides, and examined using a fluorescent microscope (Carl Zeiss, Inc.).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Cloning of a Novel Splice Variant of the {gamma}2 Subunit Gene—A novel GABAA receptor {gamma}2 subunit variant was cloned (submitted to the GenBankTM/EBI Data Bank with accession number CD014120 [GenBank] ) using reverse transcription-PCR with forward and reverse primers that flank the open reading frame of the human GABAA receptor {gamma}2 subunit cDNA (NCBI Nucleotide Database RefSeq NM_000816 [GenBank] ). This variant is identical to {gamma}2S, except that it contains an exon insertion of 120 bp between exons 5 and 6 of the {gamma}2 subunit gene (Fig. 1). This additional exon encodes 40 amino acids that are inserted in the N-terminal extracellular domain between Ser171 and Tyr172 of the mature {gamma}2 subunit (Fig. 2). This novel {gamma}2 subunit variant was named as {gamma}2XL. A BLAST search against the NCBI Alu Database3 identified the presence of an Alu-J element in the antisense orientation (20, 21) within the 2572-bp {gamma}2 subunit intron 5 sequence (see Fig. 1). Part of the 5'-end Alu-J sequence (120 bp) is spliced to become the alternative exon of {gamma}2XL. Reverse transcription-PCR experiments using a forward primer specific to the alternative exon and a reverse primer against exon 6 (see Fig. 1) further revealed the existence of this Alu-derived alternative exon in cynomolgus monkey {gamma}2 subunit mRNA transcripts (data not shown). A BLAST search against available intron 5 sequences derived from other GABAA receptor subunit superfamily members confirmed the presence of an intronic Alu in {alpha}1, {alpha}3, {alpha}5, {beta}1, {gamma}1, {rho}1, and {pi} subunit genes, accounting for about half of the intron 5 sequences analyzed (data not shown).



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 1.
Illustration of the {gamma}2 subunit gene fragment and its splicing patterns. Exons are shown as boxes, and introns as lines. Exons were mapped out by alignment of the {gamma}2 and {gamma}2XL cDNAs with the {gamma}2 subunit genomic sequence (NCBI Nucleotide Database RefSeq NT_023133 [GenBank] .11) using the exon alignment software SIM4 (19). The positions of the exons on the genomic DNA are indicated on top of the exons.

 



View larger version (63K):
[in this window]
[in a new window]
  		FIG. 2.
Protein sequence alignment. Shown is the alignment of the {gamma}2 and {gamma}2XL precursor sequences. The putative signal peptide (Sp) and transmembrane domains (Tm) are indicated. Note that Tyr172 is converted to tryptophan as a result of the exon insertion in {gamma}2XL.

 

A Weak Donor Splice Site Flanks the Alternative Exon—Pre-mRNA splicing is a complex process that begins with the interactions between splice site elements and the spliceosome components (22). We examined the splice site elements in intron 5 (between exons 5 and 6) of the {gamma}2 subunit gene and found a perfect lariat branch point and acceptor elements for the alternative exon (Fig. 3). The 3'-end of the alternative exon is flanked by a "GC" nucleotide pair, which is an intrinsically weak donor in pre-mRNA splicing due to a mismatched base pair C (instead of a T) in the interaction between the donor and U1 small nuclear RNA (23).



View larger version (10K):
[in this window]
[in a new window]
  		FIG. 3.
Schematic drawings of the exon-intron structures and comparison of splice site elements. Exons are shown as boxes, and introns as lines. Splice site elements are indicated. Cores of branch points, acceptors, and donors are underlined. A, consensus splice site elements for typical metazoan exon splicing (22). Y, pyrimidine; R, purine; N, any nucleotide. B, splice site elements for splicing the alternative exon of {gamma}2XL.

 
RNA Expression—mRNA expression of {gamma}2XL in brain was quantitated by Q-PCR using mRNAs from different human brain regions. PCR primers used for detecting {gamma}2XL were selected within the alternative exon and will amplify only {gamma}2XL. PCR primers used for detecting the {gamma}2 subunit were selected from exons 7 and 8 of {gamma}2 (a region also shared by {gamma}2XL) and will therefore detect {gamma}2, including {gamma}2S and {gamma}2L (24), and {gamma}2XL. Expression of {gamma}2XL was detected in all brain mRNAs tested (Fig. 4). However, the levels of {gamma}2XL expression were much lower than those of {gamma}2 subunit expression, as reflected by the significantly (~10-fold) higher threshold cycle values. {gamma}2XL expression was lowest in hippocampus and was lower in fetal brain than in adult brain (Fig. 4).



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 4.
Expression of {gamma}2XL mRNA. mRNAs were prepared from tissue samples derived from different human brain regions. Expression of {gamma}2XL mRNA was analyzed by Q-PCR with the primer/probe set selected within the alternative exon and is compared with expression of {gamma}2 mRNA. The primer/probe set for detecting {gamma}2 subunit expression was selected from exons 7 and 8 of the {gamma}2 subunit gene. The data shown are means of duplicate assays. Experiments were repeated with essentially the same results. Ct, threshold cycle.

 
Expression of Recombinant {gamma}2XL in Human Cells—A Myc-His tag was fused in-frame to the 3'-end of {gamma}2 or {gamma}2XL to facilitate protein detection. A second Myc tag was inserted between amino acids 9 and 10 of the mature proteins to enhance the signals detected. As shown in Fig. 5, anti-Myc antibody detected {gamma}2XL expressed in human embryonic kidney 293 cells as a band of ~54 kDa, which is slightly larger than the {gamma}2 subunit. {gamma}2XL with Myc tags at both the 5'- and 3'-ends gave a much stronger signal than did {gamma}2XL with a single 3'-end Myc tag. The {gamma}2 and {gamma}2XL constructs with two Myc tags were therefore chosen for immunoblotting and immunocytochemistry assays throughout this study.



View larger version (43K):
[in this window]
[in a new window]
  		FIG. 5.
Expression of recombinant {gamma}2XL-Myc in 293 cells. Cells were transfected with the indicated cDNA constructs. Control cells received no DNA. Recombinant proteins containing a His tag located immediately after the 3'-end Myc tag were purified using Ni-NTA-agarose beads. Equal amounts of the eluted proteins were used for immunoblotting with anti-Myc antibody. {gamma}2XL-Myc(3') has a Myc-His tag fused at the 3'-end and gave a weaker band than did {gamma}2XLMyc(5'3'), which contains a second Myc tag inserted between amino acids 8 and 9 of the mature proteins. Therefore, the {gamma}2 and {gamma}2XL constructs with two Myc tags were chosen for all subsequent experiments. The asterisk indicates a background band.

 
Cells Coexpressing {alpha}2, {beta}1, and {gamma}2XL Fail to Bind Benzodiazepines—GABAA receptor subunits were cotransfected into 293 cells. Cells were harvested 48 h after transfection, and membrane fractions were prepared. The membrane preparation from cells cotransfected with the {alpha}2 and {beta}1 subunits bound [3H]muscimol, a GABA agonist, but did not bind [3H]Ro 15-1788, a benzodiazepine antagonist (Fig. 6, A and B). The membrane preparation from cells cotransfected with the {alpha}2, {beta}1, and {gamma}2 subunits bound both [3H]muscimol and [3H]Ro 15-1788 (Fig. 6, A and B). These results are consistent with published results that the combination of {alpha} and {beta} subunits is sufficient for creating the GABA-binding sites and that a third component, the {gamma} subunit, is required for formation of the benzodiazepine-binding sites (12, 25, 26). However, the membrane preparation from cells coexpressing {alpha}2, {beta}1, and {gamma}2XL did not bind [3H]Ro 15-1788 and bound to a lower amount of [3H]muscimol (Fig. 6, A and B).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 6.
Binding of [3H]Ro 15-1788 and [3H]muscimol to recombinant receptors containing {alpha}2{beta}1{gamma}2 or {alpha}2{beta}1{gamma}2XL. {gamma}2 or {gamma}2XL was coexpressed with the {alpha}2 and {beta}1 subunits in 293 cells and assayed for [3H]Ro 15-1788 (A) and [3H]muscimol (B) binding. Controls received no DNA. The data shown are single representative experiments. Bars are means ± S.E. of triplicate determinations.

 
Overexpression of {gamma}2XL Suppresses GABAA Receptor Binding—To further examine the effect of {gamma}2XL on GABAA receptor binding, we cotransfected 293 cells with the GABAA receptor {alpha}2, {beta}1, and {gamma}2 subunits together with increasing amounts of {gamma}2XL. The membrane preparation from cells cotransfected with the {alpha}2, {beta}1, and {gamma}2 subunits bound [3H]Ro 15-1788 (Fig. 7A) and [3H]muscimol (Fig. 7B). However, the binding of both [3H]Ro 15-1788 and [3H]muscimol decreased progressively with increasing amounts of {gamma}2XL (Fig. 7, A and B). To demonstrate that the level of {gamma}2XL protein expression corresponds to the amount of {gamma}2XL cDNA transfected, cells were transfected with Myc-His-tagged {gamma}2XL ({gamma}2XL-Myc), and the expressed protein was purified using Ni-NTA-agarose beads. Increased expression of the {gamma}2XL-Myc protein was demonstrated in cells transfected with greater amounts of {gamma}2XL-Myc cDNA (Fig. 7C).



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 7.
Overexpression of {gamma}2XL reduces binding of [3H]Ro 15-1788 and [3H]muscimol to the recombinant receptor containing {alpha}2{beta}1{gamma}2. The GABAA receptor {alpha}2, {beta}1, and {gamma}2 subunits were cotransfected with increasing amounts of {gamma}2XL as indicated. Empty vector DNA was included to equilibrate the total amount of DNA for each transfection, as transfection efficiencies can vary with DNA quantity. Membrane preparations from cotransfected cells were analyzed for [3H]Ro 15-1788 (A) and [3H]muscimol (B) binding. The data shown are single representative experiments. Bars are means ± S.E. of triplicate determinations. Also shown is the protein accumulation in 293 cells transfected with increasing amounts of the {gamma}2XL-Myc construct (C).

 
Failure of {gamma}2XL to Localize to the Cell Surface—Assembly and cell-surface expression of GABAA receptor {alpha}{beta} or {alpha}{beta}{gamma} heteromers have previously been described (12, 25, 26). Our observation that overexpression of {gamma}2XL decreased GABAA receptor binding (Fig. 7) indicates that perhaps the presence of an additional exon insertion in the {gamma}2 subunit may have caused a conformational change to the GABAA receptor on the cell surface. Alternatively, the {gamma}2 subunit variant may have affected the membrane trafficking of the GABAA receptor and interfered with its localization to the cell surface. To test these hypotheses, {gamma}2-Myc or {gamma}2XL-Myc was coexpressed with the {alpha}2 and {beta}1 subunits in 293 cells. Receptor expression was analyzed by immunofluorescence staining using anti-Myc antibody. Cells coexpressing {alpha}2{beta}1{gamma}2-Myc generated robust cell-surface staining (Fig. 8A). However, no immunostaining could be detected on the surface of cells coexpressing {alpha}2{beta}1{gamma}2XL-Myc (Fig. 8C). When the cell membrane was permeabilized, both transfected cells showed a strong perinuclear staining typical of an endoplasmic reticulum staining pattern (Fig. 8, B and D). The failure of the {gamma}2XL-Myc protein to localize to the cell surface, together with the decreased GABAA receptor binding of both [3H]Ro 15-1788 and [3H]muscimol when increasing amounts of {gamma}2XL protein were expressed, indicates that {gamma}2XL is capable of suppressing the cell-surface expression of the GABAA receptor.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 8.
Surface expression and intracellular localization of {gamma}2-Myc, {gamma}2XL-Myc, and {gamma}2(S171G/Y172T)-Myc in cells coexpressing {alpha}2 and {beta}1. Cells were cotransfected with the indicated combinations of cDNA constructs. They were assayed 24 h after transfection for expression of Myc-tagged proteins on the cell surface (A, C, and E) or for the intracellular presence of Myc-tagged proteins in permeabilized cells (B, D, and F).

 
Identification of Critical Amino Acids That Mediate {gamma}2 Subunit Cell-surface Expression—We were interested in identifying amino acids in the {gamma}2 subunit that are responsible for its cell-surface expression. When the alternative exon was deleted from {gamma}2XL, we inserted a KpnI restriction site at the deletion junction. This led to the substitution of Ser171 with glycine and Tyr172 with threonine, resulting in the {gamma}2 mutant {gamma}2(S171G/Y172T) (Fig. 9; see also Fig. 2). Cells expressing the {alpha}2 and {beta}1 subunits and Myc-His-tagged {gamma}2(S171G/Y172T) showed only perinuclear immunostaining in permeabilized cells, and no cell-surface staining could be detected (Fig. 8, E and F). Ligand binding assays further confirmed that the membrane preparation from cells coexpressing {alpha}2{beta}1{gamma}2(S171G/Y172T) was able to bind [3H]muscimol, but failed to bind [3H]Ro 15-1788 (data not shown). These results demonstrate that Ser171 and Tyr172 are necessary for the cell-surface expression of the {gamma}2 subunit. Interestingly, a search against the GenBankTM/EBI Data Bank using the BLASTP program showed that Ser171 and Tyr172 of the {gamma}2 subunit are extremely conserved among the members of the GABAA receptor subunit superfamily (Fig. 9).



View larger version (59K):
[in this window]
[in a new window]
  		FIG. 9.
Conservation of Ser171 and Tyr172 in the GABAA receptor subunit superfamily. Ser171 and Tyr172 and the flanking sequence of the {gamma}2 subunit were searched against the GenBankTM/EBI Data Bank using the BLASTP program (44). The top hits within the GABAA receptor superfamily are aligned together with the corresponding sequence of {gamma}2(S171G/Y172T). Arrows indicate the S171G and Y172T mutations. The numbers on the left indicate the beginning amino acids of the listed precursor proteins. The box indicates conservation of Ser171 and Tyr172 in the GABAA receptor superfamily. Asterisks indicate identical amino acids in all listed proteins.

 
Receptor Subunit Interaction—The interaction of GABAA receptor subunits has been demonstrated previously (25, 27, 28). To study the interaction of {gamma}2XL with other receptor subunits, we tagged the {alpha}2 and {beta}1 subunits with a V5 epitope at the C terminus. Subunits with or without a tag were coexpressed in 293 cells as detailed in Fig. 10A. Subunit complexes in cell lysates were purified using Ni-NTA-agarose beads under native conditions and separated on SDS-polyacrylamide gels. Immunoblots were probed with anti-Myc or anti-V5 antibody. The results in Fig. 10A show that anti-Myc antibody detected expression of {gamma}2-Myc and {gamma}2XL-Myc in cotransfected cells. However, the levels of {gamma}2XL-Myc were lower than those of {gamma}2-Myc. This may reflect a difference in protein stability or partial blockage of the His6 tag in {gamma}2XL as a result of the exon insertion. The interaction of {gamma}2-Myc with {alpha}2-V5 and {beta}1-V5 was detected by anti-V5 antibody (Fig. 10, A and B, lower panels). Subunit association among {gamma}2XL-Myc, {alpha}2-V5, and {beta}1-V5 was also demonstrated, although the affinity of binding appeared to be lower than that among {gamma}2-Myc, {alpha}2-V5, and {beta}1-V5, indicating that the exon insertion in {gamma}2XL negatively affects the receptor subunit association. The interaction of Myc-His-tagged {gamma}2(S171G/Y172T) with {alpha}2-V5 and {beta}1-V5 was also studied in cells coexpressing these subunits. The results show that, similar to {gamma}2XL-Myc, {gamma}2(S171G/Y172T)-Myc bound significantly less {alpha}2-V5 and {beta}1-V5 than did {gamma}2-Myc (Fig. 10B). These results clearly demonstrate that Ser171 and Tyr172 are critical for subunit interaction with the {alpha}2 and {beta}1 subunits.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 10.
Analysis of GABAA receptor subunit interaction. A, interaction of {gamma}2XL with the {alpha}2 and {beta}1 subunits; B, interaction of {gamma}2(S171G/Y172T) with the {alpha}2 and {beta}1 subunits. The {gamma}2, {gamma}2XL, and {gamma}2(S171G/Y172T) constructs all carry a C-terminal His6 tag in addition to Myc tags. The {alpha}2 and {beta}1 constructs with or without a V5 tag were used depending on the experimental requirements. 293 cells were cotransfected with the indicated combinations of DNA constructs. Recombinant proteins expressed were purified using Ni-NTA-agarose beads and eluted. Equal amounts of the eluted proteins were used for immunoblotting with anti-Myc (upper panels) and anti-V5 (lower panels) antibody.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Two splice variants of the GABAA receptor {gamma}2 subunit, {gamma}2L and {gamma}2S, have previously been cloned and extensively characterized. We cloned a third GABAA receptor {gamma}2 subunit variant, {gamma}2XL. {gamma}2XL contains an additional exon that is derived from an Alu element. Interestingly, this Alu-derived exon is also spliced in monkey {gamma}2 subunit mRNA, as detected by reverse transcription-PCR (data not shown). We also found the presence of this Alu element in intron 5 sequences of about half of the GABAA receptor subunit superfamily members.

Alu elements are short interspersed sequences that amplify in primate genomes (20, 29, 30). More than 5% of human alternatively spliced exons are Alu-derived (31). Because Alu elements are only found in primate genomes, Alu-derived exons might contribute to some of the characteristically unique features of primates (32). Indeed, Alu exonization not only contributes to protein diversity and genome evolution, but has been shown to cause human genetic diseases (32-36). For example, a C-to-G single nucleotide mutation that activates a donor splice site causes constitutive splicing of the intronic Alu in the ornithine {delta}-aminotransferase gene and inactivates it. This results in autosomal recessive chorioretinal degeneration caused by deficiency of ornithine {delta}-aminotransferase (34).

To determine the physiological significance of the {gamma}2XL splice variant, we examined its tissue expression in human brain. Our Q-PCR results show that the abundance of {gamma}2XL transcripts was drastically lower than that of {gamma}2 transcripts in all human brain regions tested. In analyzing the splice site elements in the intron between exons 5 and 6 of the {gamma}2 subunit gene, we found a perfect branch point and acceptor site consensus for splicing of the alternative exon, but an intrinsically weak donor site (GC) that flanks the 3'-end of the alternative exon (22, 23). It has been reported that ~99% of the splice sites are the GT-AG donor-acceptor type. The major variant is the GC-AG type, accounting for ~0.5% of the total donor sites (37). GC is a weak donor in pre-mRNA splicing because of a mismatched base pair C in the interaction between the donor and U1 small nuclear RNA (23). This discovery explains, from a molecular basis, why the alternative exon is rarely included in the mature {gamma}2 transcripts. However, it remains to be explored if there is a cell type- or disease-specific factor that compensates for such a weak donor and that promotes inclusion of the alternative exon in {gamma}2 transcripts. For example, a neuron-specific RNA-binding protein (Nova) has been found to promote the inclusion of the 8-amino acid miniexon in {gamma}2Ltranscripts (38).

Our results show that {gamma}2XL failed to be expressed on the cell surface when coexpressed with the {alpha}2 and {beta}1 subunits. If overexpressed, {gamma}2XL decreased the cell-surface number of GABAA receptors available for binding both [3H]muscimol (GABA site) and [3H]Ro 15-1788 (benzodiazepine site) ligands. The mechanisms by which {gamma}2XL inhibits binding of these ligands remain to be elucidated. {gamma}2XL may block the cell-surface expression of the GABAA receptor by its intracellular association with the {alpha}2 and {beta}1 subunits or by sequestering factors crucial to the subunit assembly and membrane trafficking of the receptor (39-41). Indeed, the {gamma}2 subunit has been found to bind the GABAA receptor-associated protein, a factor involved in GABAA receptor trafficking (42, 43). This work has focused on the effect of {gamma}2XL on the {alpha}2 and {beta}1 subunits, and the functional relationship of {gamma}2XL with other GABAA receptor subunits (e.g. the more dominant {alpha}1 and {beta}2 subunits) remains to be characterized.

We identified 2 amino acid residues (Ser171 and Tyr172) essential for {gamma}2 subunit function. Interestingly, these 2 residues not only directly flank the inserted alternative exon, but also are extremely conserved among the members of the GABAA receptor subunit superfamily. Substitution of these amino acids in the {gamma}2 subunit with Gly171 and Thr172, respectively, significantly decreased the association of the heteromeric subunit with the {alpha}2 and {beta}1 subunits and prevented its cell-surface expression. It was previously reported that a {gamma}2 mutant with Tyr172 converted to serine (Y172S) had little effect on the binding of [3H]Ro 15-1788 when coexpressed with the {alpha}1 and {beta}2 subunits (5). Perhaps, of the 2 identified residues, only Ser171 is indispensable. Alternatively, Ser171 and Tyr172 may be important only for the function of and association with {alpha}2 and {beta}1, the subunits used for characterization in this study.

In summary, this is the first report to identify a novel splice variant of the GABAA receptor {gamma}2 subunit with an Alu-derived alternative exon inserted between 2 critical amino acids, Ser171 and Tyr172. When these 2 amino acids were mutated or disrupted by insertion of the alternative exon, access of the {gamma}2 subunit to the cell surface was prevented. Identification of such amino acids essential for {gamma}2 subunit function will enhance our understanding of the structure-function relationship of {gamma}2 in the context of the subunit association and cell-surface expression of GABAA receptors.


   FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) CD014120 [GenBank] .

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed: Incyte Corp., 3160 Porter Dr., Palo Alto, CA 94304. Tel.: 650-621-8639; Fax: 650-845-4664; E-mail: pjin{at}incyte.com.

1 The abbreviations used are: GABAA, {gamma}-aminobutyric acid type A; Q-PCR, quantitative PCR; Ni-NTA, nickel-nitrilotriacetic acid; PBS, phosphate-buffered saline. Back

2 Available at www.ncbi.nlm.nih.gov/Entrez/Nucleotide Back

3 Available at www.ncbi.nlm.nib.gov/pub/jmc/Alu/. Back


   ACKNOWLEDGMENTS
 
We thank Drs. Richard Goold, Ben Cocks, Andrew Shyjan, and Sue Daniels for review of this manuscript. We are grateful to the Incyte RNA Group for providing mRNAs and to the Sequencing Group for DNA sequencing.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Davies, P. A., Hanna, M. C., Hales, T. G., and Kirkness, E. F. (1997) Nature 385, 820-823[CrossRef][Medline] [Order article via Infotrieve]
  2. McKernan, R. M., and Whiting, P. J. (1996) Trends Neurosci. 19, 139-143[CrossRef][Medline] [Order article via Infotrieve]
  3. Bloom, F. E. (2001) in Goodman & Gilman's Pharmacological Basis of Therapeutics (Hardman, J. G., and Limbird, L. L., eds) 10th Ed., McGraw-Hill Book Co., New York
  4. Hedblom, E., and Kirkness, E. F. (1997) J. Biol. Chem. 272, 15346-15350[Abstract/Free Full Text]
  5. Whiting, P. J., McAllister, G., Vassilatis, D., Bonnert, T. P., Heavens, R. P., Smith, D. W., Hewson, L., O'Donnell, R., Rigby, M. R., Sirinathsinghji, D. J., Marshall, G., Thompson, S. A., Wafford, K. A., and Vasilatis, D. (1997) J. Neurosci. 17, 5027-5037[Abstract/Free Full Text]
  6. Cutting, G. R., Lu, L., O'Hara, B. F., Kasch, L. M., Montrose-Rafizadeh, C., Donovan, D. M., Shimada, S., Antonarakis, S. E., Guggino, W. B., Uhl, G. R., and Kazazian, H. H. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 2673-2677[Abstract/Free Full Text]
  7. Nayeem, N., Green, T. P., Martin, I. L., and Barnard, E. A. (1994) J. Neurochem. 62, 815-818[Medline] [Order article via Infotrieve]
  8. Pregenzer, J. F., Im, W. B., Carter, D. B., and Thomsen, D. R. (1993) Mol. Pharmacol. 43, 801-806[Abstract]
  9. Kneussel, M. (2002) Brain Res. Brain Res. Rev. 39, 74-83[CrossRef][Medline] [Order article via Infotrieve]
  10. Essrich, C., Lorez, M., Benson, J. A., Fritschy, J. M., and Luscher, B. (1998) Nat. Neurosci. 1, 563-571[CrossRef][Medline] [Order article via Infotrieve]
  11. Kittler, J. T., Delmas, P., Jovanovic, J. N., Brown, D. A., Smart, T. G., and Moss, S. J. (2000) J. Neurosci. 20, 7972-7977[Abstract/Free Full Text]
  12. Connolly, C. N., Kittler, J. T., Thomas, P., Uren, J. M., Brandon, N. J., Smart, T. G., and Moss, S. J. (1999) J. Biol. Chem. 274, 36565-36572[Abstract/Free Full Text]
  13. Baulac, S., Huberfeld, G., Gourfinkel-An, I., Mitropoulou, G., Beranger, A., Prud'homme, J. F., Baulac, M., Brice, A., Bruzzone, R., and LeGuern, E. (2001) Nat. Genet. 28, 46-48[CrossRef][Medline] [Order article via Infotrieve]
  14. Bowser, D. N., Wagner, D. A., Czajkowski, C., Cromer, B. A., Parker, M. W., Wallace, R. H., Harkin, L. A., Mulley, J. C., Marini, C., Berkovic, S. F., Williams, D. A., Jones, M. V., and Petrou, S. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 15170-15175[Abstract/Free Full Text]
  15. Wallace, R. H., Marini, C., Petrou, S., Harkin, L. A., Bowser, D. N., Panchal, R. G., Williams, D. A., Sutherland, G. R., Mulley, J. C., Scheffer, I. E., and Berkovic, S. F. (2001) Nat. Genet. 28, 49-52[CrossRef][Medline] [Order article via Infotrieve]
  16. Araki, T., Sato, M., Kiyama, H., Manabe, Y., and Tohyama, M. (1992) Neuroscience 47, 45-61[CrossRef][Medline] [Order article via Infotrieve]
  17. Gutierrez, A., Khan, Z. U., and De Blas, A. L. (1994) J. Neurosci. 14, 7168-7179[Abstract]
  18. Quinlan, J. J., Firestone, L. L., and Homanics, G. E. (2000) Pharmacol. Biochem. Behav. 66, 371-374[CrossRef][Medline] [Order article via Infotrieve]
  19. Florea, L., Hartzell, G., Zhang, Z., Rubin, G. M., and Miller, W. (1998) Genome Res. 8, 967-974[Abstract/Free Full Text]
  20. Deininger, P. L., and Batzer, M. A. (2002) Genome Res. 12, 1455-1465[Abstract/Free Full Text]
  21. Roy-Engel, A. M., Salem, A. H., Oyeniran, O. O., Deininger, L., Hedges, D. J., Kilroy, G. E., Batzer, M. A., and Deininger, P. L. (2002) Genome Res. 12, 1333-1344[Abstract/Free Full Text]
  22. Smith, C. W., and Valcarcel, J. (2000) Trends Biochem. Sci. 25, 381-388[CrossRef][Medline] [Order article via Infotrieve]
  23. Thanaraj, T. A., and Clark, F. (2001) Nucleic Acids Res. 29, 2581-2593[Abstract/Free Full Text]
  24. Whiting, P., McKernan, R. M., and Iversen, L. L. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9966-9970[Abstract/Free Full Text]
  25. Connolly, C. N., Krishek, B. J., McDonald, B. J., Smart, T. G., and Moss, S. J. (1996) J. Biol. Chem. 271, 89-96[Abstract/Free Full Text]
  26. Taylor, P. M., Connolly, C. N., Kittler, J. T., Gorrie, G. H., Hosie, A., Smart, T. G., and Moss, S. J. (2000) J. Neurosci. 20, 1297-1306[Abstract/Free Full Text]
  27. Klausberger, T., Ehya, N., Fuchs, K., Fuchs, T., Ebert, V., Sarto, I., and Sieghart, W. (2001) J. Biol. Chem. 276, 16024-16032[Abstract/Free Full Text]
  28. Klausberger, T., Sarto, I., Ehya, N., Fuchs, K., Furtmuller, R., Mayer, B., Huck, S., and Sieghart, W. (2001) J. Neurosci. 21, 9124-9133[Abstract/Free Full Text]
  29. Mighell, A. J., Markham, A. F., and Robinson, P. A. (1997) FEBS Lett. 417, 1-5[CrossRef][Medline] [Order article via Infotrieve]
  30. Roy-Engel, A. M., Carroll, M. L., Vogel, E., Garber, R. K., Nguyen, S. V., Salem, A. H., Batzer, M. A., and Deininger, P. L. (2001) Genetics 159, 279-290[Abstract/Free Full Text]
  31. Sorek, R., Ast, G., and Graur, D. (2002) Genome Res. 12, 1060-1067[Abstract/Free Full Text]
  32. Lev-Maor, G., Sorek, R., Shomron, N., and Ast, G. (2003) Science 300, 1288-1291[Abstract/Free Full Text]
  33. Knebelmann, B., Forestier, L., Drouot, L., Quinones, S., Chuet, C., Benessy, F., Saus, J., and Antignac, C. (1995) Hum. Mol. Genet. 4, 675-679[Abstract/Free Full Text]
  34. Mitchell, G. A., Labuda, D., Fontaine, G., Saudubray, J. M., Bonnefont, J. P., Lyonnet, S., Brody, L. C., Steel, G., Obie, C., and Valle, D. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 815-819[Abstract/Free Full Text]
  35. Vervoort, R., Gitzelmann, R., Lissens, W., and Liebaers, I. (1998) Hum. Genet. 103, 686-693[Medline] [Order article via Infotrieve]
  36. Deininger, P. L., and Batzer, M. A. (1999) Mol. Genet. Metab. 67, 183-193[CrossRef][Medline] [Order article via Infotrieve]
  37. International Human Genome Sequencing Consortium (2001) Nature 409, 860-921[CrossRef][Medline] [Order article via Infotrieve]
  38. Dredge, B. K., and Darnell, R. B. (2003) Mol. Cell. Biol. 23, 4687-4700[Abstract/Free Full Text]
  39. Kneussel, M., Haverkamp, S., Fuhrmann, J. C., Wang, H., Wassle, H., Olsen, R. W., and Betz, H. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 8594-8599[Abstract/Free Full Text]
  40. Kittler, J. T., Rostaing, P., Schiavo, G., Fritschy, J. M., Olsen, R., Triller, A., and Moss, S. J. (2001) Mol. Cell. Neurosci. 18, 13-25[CrossRef][Medline] [Order article via Infotrieve]
  41. Bedford, F. K., Kittler, J. T., Muller, E., Thomas, P., Uren, J. M., Merlo, D., Wisden, W., Triller, A., Smart, T. G., and Moss, S. J. (2001) Nat. Neurosci. 4, 908-916[CrossRef][Medline] [Order article via Infotrieve]
  42. Wang, H., Bedford, F. K., Brandon, N. J., Moss, S. J., and Olsen, R. W. (1999) Nature 397, 69-72[CrossRef][Medline] [Order article via Infotrieve]
  43. Stangler, T., Mayr, L. M., and Willbold, D. (2002) J. Biol. Chem. 277, 13363-13366[Abstract/Free Full Text]
  44. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389-3402[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles: