Originally published In Press as doi:10.1074/jbc.M309782200 on March 10, 2004
J. Biol. Chem., Vol. 279, Issue 20, 21266-21270, May 14, 2004
Interleukin (IL)-6 and IL-10 Induce Decorin mRNA in Endothelial Cells, but Interaction with Fibrillar Collagen Is Essential for Its Translation*
Marco Strazynski
,
Johannes A. Eble
,
Hans Kresse
, and
Elke Schönherr
¶
From the
Institute of Physiological Chemistry and Pathobiochemistrys, University of Münster and University Hospital Münster, D-48129 Münster, Germany and the
Matrix Biology and Tissue Repair Research Unit, University of Wales College of Medicine Dental School, Cardiff CF14 4XY, United Kingdom
Received for publication, September 3, 2003
, and in revised form, March 10, 2004.
 |
ABSTRACT
|
|---|
Decorin, a small multifunctional proteoglycan, is expressed by sprouting endothelial cells (ECs) during inflammation-induced angiogenesis in vivo and by human ECs co-cultured with fibroblasts in a collagen lattice. To investigate how decorin is induced, human EA.hy 926 ECs and/or human umbilical vein ECs were treated with interleukin (IL)-10 and IL-6. Both treatments induced decorin mRNA in human ECs. IL-6 and IL-10 led to a dose-dependent mRNA increase with a maximum at 10 and 50 ng/ml, respectively. The combination of both interleukins together had a stronger effect than one alone. Immunostaining demonstrated that both interleukins caused decorin synthesis in ECs and the formation of capillary-like structures in a collagen lattice. However, immunoprecipitations of interleukin-treated ECs cultured on plastic were negative. Only interleukin-stimulated ECs grown on a collagen type I matrix or growth factor-reduced Matrigel were able to synthesize the proteoglycan. Acid-soluble collagen type I did not support decorin protein synthesis. The addition of antibodies to
1 or
2 integrins or the
2 integrin inhibitor rhodocetin led to an inhibition of synthesis. These data show that IL-10 and IL-6 induce decorin mRNA transcription, but additional signals from the extracellular matrix are necessary for its translation.
 |
INTRODUCTION
|
|---|
The functional state of endothelial cells (quiescent or angiogenic) goes along with the expression of specific small leucinerich repeat proteoglycans (SLRPs).1 Resting endothelial cells in large blood vessels as well as confluent primary endothelial cells in vitro do not synthesize decorin, but they express biglycan, which becomes up-regulated when endothelial cells start to migrate (1). Similar observations were made in EA.hy 926 cells, a cell line derived from human umbilical vein endothelial cells (2). However, when endothelial cells form capillaries, they express decorin (1). This could be observed in vivo in human capillary endothelium during inflammation-induced angiogenesis, as well as in vitro in a co-culture model with EA.hy 926 cells and rat fibroblasts grown in a floating collagen lattice to mimic the situation during angiogenesis in vivo (2).
Decorin is the most well known member of the SLRP family. These small proteoglycans are characterized by core proteins containing several leucine-rich repeat motifs flanked by cysteine-rich clusters. As proteoglycans they are linked to at least a single glycosaminoglycan chain. Decorin is almost ubiquitously expressed and has been implicated in the control of collagen fibril formation and the regulation of TGF-
activity (for review, see Refs. 3 and 4). More recently it has been shown to influence directly the behavior of several different types of cells. For example, it can interact with members of the ErbB receptor family on tumor cells and lead to a more differentiated phenotype of these cells (5, 6). In endothelial cells decorin induction initiates the alignment of cells in cord-like structures on top of a collagen matrix or leads to the formation of endothelial cell-lined cavities inside the collagen matrix (2). These morphological changes are accompanied by an induction and activation of specific matrix metalloproteinases (MMP-1, MMP-2, MMP-9, and MMP-14) (7). In addition, it could be shown that endothelial cells that synthesize decorin escape apoptosis (2). All these changes were only observed in decorin-synthesizing cells, independent of the mode of decorin induction. Thus decorin production could be induced either by co-culture with fibroblasts or by infection of the cells with a replication-deficient adenovirus containing the human decorin cDNA, indicating that decorin is instrumental in the formation of capillary-like structures in collagen lattices.
The physiological regulation of decorin synthesis in different cell types is still a matter of discussion, as the same cytokine can have opposite effects on decorin synthesis; TGF-
has been shown to up-regulate decorin in mesangial cells but to down-regulate the proteoglycan in most other cell types (8, 9). Besides TGF-
, several other cytokines have been implicated in the regulation of decorin synthesis on a transcriptional as well as on a translational or posttranslational level (IL-1, tumor necrosis factor (TNF)-
, TGF-
, epidermal growth factor, etc.; Ref. 4). However, no cytokine that has been associated with angiogenesis (VEGF, basic fibroblast growth factor, TNF-
, IL-1, and TGF-
) could be identified as an inducer of decorin synthesis in endothelial cells (2).
As decorin induction in endothelial cells in vivo is observed during inflammation (2, 10) cytokines released during this process are potential candidates for its induction. One of these cytokines is IL-6. It can react with a variety of cells by a trimeric receptor complex that consists of a membrane-bound signaling receptor (gp130), which is expressed ubiquitously, and a species-specific IL-6 receptor, which can be expressed by a limited number of cells and which has no signaling function by itself. However, the IL-6 receptor can be shed or synthesized without transmembrane domain and thereby react as soluble protein (sIL-6R) with the cytokine. This cytokine-receptor complex (sIL-6R·IL-6) can bind to gp130 and transfer sensitivity for the cytokine to cells that normally do not express the IL-6 receptor (11). Another inflammatory cytokine, which has been shown to induce decorin mRNA expression in fibroblasts, is IL-10 (12). IL-10 is a multifunctional cytokine that was first recognized for its inhibition of inflammatory processes. Later, multiple cell-dependent effects on differentiation and proliferation have been described (for review, see Ref. 13). In macrophages IL-10 activates the JAK/STAT pathway and leads to inhibition of cell activation, and in endothelial cells it causes a down-regulation of cell adhesion molecules (13). But in general the effects of IL-10 on cells of non-immunological origin have not been investigated in detail.
In this study we analyzed the role of IL-6 and IL-10 in decorin expression in endothelial cells. For the first time we could show that cytokine stimulation is only sufficient for inducing mRNA expression but that integrin-mediated adhesion to fibrillar collagens is necessary to induce translation at least in endothelial cells.
 |
EXPERIMENTAL PROCEDURES
|
|---|
MaterialsHuman IL-10 and IL-6 were from TEBU (Frankfurt, Germany). Chondroitin ABC lyase was from Seikagaku Kogyo (Tokyo, Japan). Secondary antibodies were from BioRad. Monoclonal antibodies to
1 integrin (AGF1 (14), kindly provided by Dr. H. Gardner, Biogene Idec, Cambridge, MA) and
2 integrin (P1E6, Chemicon, Hofheim, Germany) and a control isotypic monoclonal mouse antibody (IgG1, X0931, Dako, Hamburg, Germany) were used. Rhodocetin was purified as described previously (15).
Cell CultureEA.hy 926 cells were maintained in MCDB-131 medium supplemented with 10% fetal calf serum, hypoxanthine (100 µM), aminopterin (0.4 µM), thymidine (16 µM), penicillin (100 units/ml), and streptomycin (100 µg/ml, all from Invitrogen). For experiments cells were cultured in serum-free Waymouth MAB 87/3 medium supplemented with selenite, transferrin, and insulin (all from Sigma), Ciprobay (Bayer, Leverkusen, Germany), Zinacef (GlaxoSmithKline), and penicillin/streptomycin overnight before adding different concentrations and combinations of interleukins and/or conditioned medium (see below). Cells were harvested at the indicated times. Cell culture in floating collagen lattices was done as described previously (2) with the exception that acid-soluble rat tail tendon collagen was used. The purity of the collagen preparation was proven by SDS-PAGE. Collagen type I was the major protein in the preparation, but the presence of collagen type III could not be ruled out (result not shown). This collagen was also used to coat cell culture dishes. Briefly, acid-soluble collagen was neutralized and spread on hydrophilic dishes. After gel formation (30 min, 37 °C) cells were plated as usual.
Semiquantitative Real Time PCRRNA was isolated using the RNeasy kit (Qiagen, Hilden, Germany). Quality of isolated RNA was tested by agarose gel electrophoresis. Reverse transcription was performed with Omniscript reverse transcriptase (Qiagen) according to the manufacturer's instructions. PCR was performed using the GeneAmp 5700 sequence detection system and SYBR Green PCR core reagents (PE Applied Biosystems, Weiterstadt, Germany) according to the specifications of the manufacturer with the indicated primers: glyceraldehyde-3-phosphate dehydrogenase; sense, GTCAGTGGTGGACTGACCT-3', and antisense, ACCTGGTGCTCAGTGTAGCC (amplification product 123 bp); and decorin; sense, AGCTGAAGGAATTGCCAGAA, and antisense, TGGTGCCCAGTTCTATGACA (amplification product 132 bp). Cycling conditions were 95 °C for 10 min, 40 cycles at 95 °C for 15 s, and 60 °C for 1 min. Specificity of PCR products was verified by dissociation curve analysis. Specific mRNA expression was normalized to glyceraldehyde-3-phosphate dehydrogenase, and augmentations were calculated under stimulated versus non-stimulated conditions (
Ct method).
ImmunoprecipitationEA.hy 926 (3 x 106 cells) or human skin fibroblasts (as positive control) were seeded in a 75-cm2 flask. EA.hy 926 cells were cultured on plastic or on collagen as described and subsequently preincubated with IL-10 and IL-6 for 8 h. Interleukins were renewed, and cells were metabolically labeled with [3H]leucine (20 µCi/ml of medium, ICN Biomedical, Eschwege, Germany) for 16 h. Immunoprecipitations were carried out as described previously with a monospecific rabbit anti-human decorin antiserum (16). When indicated, samples were digested with chondroitin ABC lyase and subjected to SDS-PAGE under reducing conditions. Signals were detected on X-Omat AR films (Eastman Kodak Co.).
For inhibition experiments EA.hy 926 cells (2.5 x 106) were preincubated with the respective antibodies (5 ng/ml) and seeded on collagen type I matrices in Waymouth medium (see above) with 1% heat-inactivated fetal calf serum. After 24 h the medium was changed to serum-free medium with the respective antibodies plus IL-6 and IL-10 for 8 h. Then the cells were metabolically labeled in the presence of the same additives for 16 h, and immunoprecipitations were carried out as described. In inhibition studies with rhodocetin the integrin inhibitor was added in the indicated concentrations together with the interleukins, and the rest of the experiment was carried out as described.
For the analysis of different matrices tissue culture plastic was coated with fibrillar collagen, acid-soluble collagen, and collagen type VI (1 mg/ml, prepared according to Trueb and co-workers (17)). In addition, cell culture dishes were coated with growth factor-reduced Matrigel (BD Biosciences), which was additionally extracted over night with serum-free medium, before EA.hy 926 cells were plated. The cells were stimulated, metabolically labeled, and harvested as described above.
ImmunohistochemistryImmunostaining of collagen gels was performed as described previously (2), except that in addition to chondroitin ABC lyase (2 h, 37 °C) in 5% bovine serum albumin, 10% goat serum (Sigma) in phosphate-buffered saline, proteinase XXIV (0.005%, 10 min, 37 °C, Sigma) was used to unmask epitopes.
 |
RESULTS
|
|---|
Induction of Decorin mRNA in Endothelial Cells by IL-10 and IL-6In previous experiments we excluded a large number of growth factors and cytokines associated with angiogenesis as inducers of decorin synthesis in endothelial cells (2). In this study IL-6 and IL-10 were tested because both are released during inflammation in vivo. In addition, IL-10 has been shown previously to induce decorin mRNA synthesis in fibroblasts (12). Semiquantitative reverse transcription-PCR showed that IL-10 can dose dependently increase decorin mRNA production in endothelial cells in a concentration range between 12.5 and 50 ng/ml. The expression of decorin mRNA doubled after 8-12 h and reached a maximum at 16 h (n = 3, result not shown). Therefore, mRNA was harvested after 16 h in the following experiments. In several experiments (at least n = 3) IL-10 (50 ng/ml) led to a 5-fold increase in amplification, while higher doses had no further effect or reduced specific mRNA synthesis (Fig. 1A). IL-6 also caused a 5-fold increase in decorin mRNA levels, but the highest decorin expression was achieved with 10 ng/ml. Higher concentrations of IL-6 reduced decorin mRNA levels (Fig. 1B). Using both cytokines at optimal concentrations a stronger effect on decorin mRNA expression was observed (Fig. 2). These results indicate that IL-10 and IL-6 may influence decorin mRNA synthesis by at least partially different pathways. The addition of cytokines to endothelial cells cultured on a fibrillar collagen matrix led to a reduced increase in the expression rate (13-29%) compared with uncoated dishes (Fig. 2). This reduction is very likely due to increased unspecific binding of cytokines to the collagen coat compared with the plastic surface.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2. Influence of combined IL-10/IL-6 application on the expression of decorin mRNA in EA.hy 926 cells. Samples were processed as described in Fig. 1. The stimulation of decorin (DCN) mRNA synthesis could be enhanced further by combined IL application compared with single application of IL-10 (50 ng/ml) and IL-6 (10 ng/ml), respectively. Black bars, plastic dishes; gray bars, collagen-coated dishes. Collagen coating of cell culture plastic reduced the effect of the cytokines on decorin stimulation.
|
|
Decorin Protein SynthesisImmunohistochemical studies showed that EA.hy 926 cells in collagen gels start to synthesize decorin protein after stimulation with IL-10 and IL-6 (Fig. 3). After 6 days of culture cells treated with IL-10 (Fig. 3A) or the combination of IL-10 and IL-6 (result not shown) showed tubular structures surrounded by decorin, while untreated cells neither showed any staining for decorin nor any formation of capillary-like structures (Fig. 3B). A comparable effect due to IL-6 stimulation was temporally delayed (Fig. 3C). Thus decorin core protein was detectable at day 12 of the incubation (Fig. 3D). These results indicate that the two cytokines can induce decorin synthesis in this angiogenesis model in cell culture.

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 3. Immunostaining for decorin of IL-6 and IL-10 or untreated EA.hy 926 cells cultured in a collagen lattice. EA.hy 926 cells were cultured in a three-dimensional collagen gel for 6 days in the presence of (A) IL-10 (50 ng/ml). B, untreated controls. C, IL-6 (10 ng/ml) was applied to cells for 6 days and for (D) 12 days. Collagen gels were fixed, and paraffin sections were stained for decorin. Sections of IL-10-treated cultures showed the formation of tubular structures surrounded by decorin after 6 days, while IL-6-treated cultures needed 12 days for decorin synthesis and capillary formation. Magnification is 1000-fold.
|
|
In the next series of experiments we attempted to immunoprecipitate decorin from the medium and the cell layer of endothelial cells growing on plastic dishes as used in routine cell culture. Even when these cells were actively synthesizing decorin mRNA as shown in Fig. 1 no decorin could be found by immunoprecipitation (Fig. 4A). Therefore, we tested various conditions (different time points, concentrations, and types of labeled metabolites; different concentrations and combinations of interleukins; and fibroblast conditioned medium), but translation of decorin mRNA into core protein and posttranslational modification to proteoglycan were not observed. Only when EA.hy 926 cells were seeded on a collagen type I matrix similar to the matrix in the angiogenesis model synthesis of decorin could be detected (Fig. 4A). An increased effect of the combination of IL-10 and IL-6 was also observed on the level of protein synthesis (Fig. 4A). To test whether protein synthesis like mRNA synthesis is dependent on the amount of interleukin in the medium, dosages from 25 to 100 ng/ml IL-10 and from 5 to 20 ng/ml IL-6 were added to endothelial cells growing on a collagen matrix. Immunoprecipitations of metabolically labeled decorin showed that there is no dose dependence on the amount of interleukin added. Under conditions when cells are cultured on fibrillar collagen and a 5- to 6-fold increase in the mRNA level is observed, translation is induced. Higher concentrations of interleukins, which do not lead to a further mRNA increase on plastic (see Fig. 1), still induce the same increase in decorin translation on collagen-coated dishes. These results demonstrate that the collagen matrix has two effects on decorin induction: a positive effect on translation of decorin (Fig. 4B) and a negative effect on mRNA transcription because of sequestration of the interleukins (Fig. 2). In addition, these results prove that the interaction of endothelial cells with their surrounding matrix is of crucial importance for decorin protein synthesis in endothelial cells.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 4. Immunoprecipitations of decorin from IL-6- and IL-10-treated EA.hy 926 cultures. A, EA.hy 926 cells (3 x 106) were cultured on tissue culture plastic (lanes 1, 2, 6, and 7) or on collagen-coated dishes (lanes 3, 4, 8, and 9) and treated in the presence of [3H]leucine with the combination of IL-10 (50 ng/ml) and IL-6 (10 ng/ml) for 16 h (lanes 2, 4, 7, and 9). Decorin was purified by immunoprecipitation with a monospecific antibody to human decorin. One-half of each sample was digested with chondroitin ABC lyase (lanes 6-10) to show the core protein. Radiolabeled decorin from human fibroblasts was applied as positive control (lanes 5 and 10). Only endothelial cells cultured on a collagen matrix synthesize decorin in response to IL-10/IL-6. B, EA.hy 926 cells (3 x 106) were cultured on collagen, and interleukins were added as described in A. Lanes 2 and 10, IL-10, 25 ng/ml; lanes 3 and 11, IL-10, 50 ng/ml; lanes 4 and 12, IL-10, 100 ng/ml; lanes 5 and 13, IL-6, 5 ng/ml; lanes 6 and 14, IL-6, 10 ng/ml; lanes 7 and 15, IL-6, 20 ng/ml; lanes 1 and 9, control. Immunoprecipitations were carried out as described in A, and half of the sample was digested with chondroitin ABC lyase (lanes 9-16). Human decorin from fibroblasts was applied as positive control (lanes 8 and 16). Decorin protein synthesis is stimulated by both IL-10 (50 and 100 ng/ml) and IL-6 (10 and 20 ng/ml), but no increase is observed for the higher concentration compared with the lower one. Only a threshold amount of cytokine had to be applied.
|
|
To investigate whether this behavior is specific for EA.hy 926 cells, primary human umbilical vein endothelial cells were stimulated with IL-6 and IL-10 under similar conditions. Immunoprecipitations of metabolically labeled decorin showed that also primary cells are dependent on the collagen matrix for decorin protein synthesis (Fig. 5).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 5. Immunoprecipitations of decorin from IL-6- and IL-10-treated primary human umbilical vein endothelial cells. Human umbilical vein endothelial cells were treated as described for EA.hy 926 cells in Fig. 4A. Cells either cultured on plastic (lanes 1, 2, 6, and 7) or on collagen-coated dishes (lanes 3, 4, 8, and 9) were treated with a combination of IL-10 (50 ng/ml) and IL-6 (10 ng/ml) for 16 h (lanes 2, 4, 7, and 9). Decorin was immunoprecipitated, and half of each sample was digested with chondroitin ABC lyase (lanes 6-10) to show the core protein. Radiolabeled decorin from human fibroblasts was applied as positive control (lanes 5 and 10). Only primary endothelial cells cultured on a collagen matrix synthesize decorin in response to IL-10/IL-6.
|
|
Matrix Requirements for Decorin SynthesisTo further investigate the requirements for the stimulation of protein synthesis different types of coatings were compared. Neutralized collagen type I from rat tail tendon or from calf skin (2), which forms a fibrillar matrix, supported decorin synthesis. However, a coat of the same collagen in its acid-soluble form had no effect (Fig. 6A). Also a coat of monomeric collagen type VI did not have any effect. However, growth factor-reduced Matrigel, which by itself had no effect on decorin synthesis, could support interleukin-stimulated decorin translation (Fig. 6A). These data show that the interaction with a fibrillar matrix of collagen type I or a network-forming matrix of collagen type IV, laminin, and entactin is necessary for the induction of decorin protein synthesis.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 6. Immunoprecipitations of decorin from IL-6- and IL-10-treated EA.hy 926 cultures seeded on different matrices. A, EA.hy 926 cells (3 x 106) were cultured on collagen type I matrices (lanes 1, 2, 10, and 11), on acid-soluble collagen type I (lanes 3, 4, 12, and 13), on Matrigel (lanes 5, 6, 14, and 15), or on collagen type VI (lanes 7, 8, 16, and 17) and treated with the combination of IL-10 (50 ng/ml) and IL-6 (10 ng/ml) for 16 h (lanes 2, 4, 6, 8, 11, 13, 15, and 17) in the presence of [3H]leucine. Decorin was purified by immunoprecipitation with a monospecific antibody to human decorin. One-half of each sample was digested with chondroitin ABC lyase (lanes 10-18) to show the core protein. Radiolabeled decorin from human fibroblasts was applied as positive control (lanes 9 and 18). Only endothelial cells cultured on a collagen matrix or Matrigel synthesize decorin in response to IL-10/IL-6. B, EA.hy 926 cells (3 x 106) were cultured on a collagen matrix in the presence or absence of different inhibitors when interleukins were added as described in A. Lanes 1 and 5, control without inhibitor; lanes 2 and 6, rhodocetin (5 µg/ml); lanes 3 and 7, monoclonal antibody to human 1 integrin (5 ng/ml); lanes 4 and 8, monoclonal antibody to 2 integrin (5 ng/ml). Immunoprecipitations were carried out as described in A, and half of the sample was digested with chondroitin ABC lyase (lanes 7-12). Collagen matrix and interleukin-stimulated decorin protein synthesis is inhibited by the integrin inhibitor rhodocetin. Furthermore, antibodies to 2 integrins reduce the decorin translation more than antibodies to 1 integrin.
|
|
To analyze the cellular interactions, antibodies to
1 and
2 integrins were applied to endothelial cells plated on a fibrillar collagen type I matrix. In previous experiments (using 50 µg/ml-0.5 ng/ml) a concentration of antibody was determined that does not lead to cell detachment and apoptosis within 24 h (result not shown). Addition of 5 ng/ml antibodies directed against
1 or
2 integrin subunits at the time of cell seeding and during incubation with the cytokines led both to a reduction in decorin synthesis (Fig. 6B) compared with culture conditions without antibodies or isotypic control antibodies. Antibodies to
1 integrin inhibited decorin synthesis by 70%, while antibodies to
2 integrin led to 85% inhibition compared with the control. These results were corroborated by incubation with the integrin inhibitor rhodocetin, which abolished decorin synthesis completely at a concentration that was shown previously to inhibit cell adhesion by about 50% (15). Rhodocetin blocks collagen binding of
2
1 integrin in a arginine-glycine-aspartic acid-independent manner and presumably antagonizes
2
1 integrin signaling by binding to the A-domain of the
2 subunit proximal to the collagen binding site (18). These data indicated that
2
1 integrin as well
1
1 integrin is involved in the induction of decorin translation in endothelial cells.
 |
DISCUSSION
|
|---|
This study shows that IL-6 and IL-10, two cytokines that are released during inflammation and wound healing, can induce decorin synthesis in endothelial cells. Decorin synthesis has been observed previously in endothelial cells in different cell culture models of angiogenesis (2, 19) and also in vivo (2, 10). Two independent in vivo investigations showed that the inflammatory component is of special importance, as decorin was only found in newly formed capillaries in granulomatous tissue or in neovessels in temporal arteritis but not in capillaries of the ovary in different phases of follicle and corpus luteum formation.
Both IL-6 and IL-10 are released during inflammation and wound healing. The importance of IL-6 has been emphasized recently by wound healing studies in the IL-6-null mouse. Without challenge the mouse does not show any obvious phenotype, but during wound healing leukocyte infiltration and re-epithelialization as well as angiogenesis and collagen accumulation are reduced (20). In contrast, IL-10 has been associated with antiangiogenic processes. Thus an increase in angiogenesis was observed in the IL-10-null mouse in the hindlimb ischemia model. This increase in angiogenesis was associated with a prolonged up-regulation of VEGF and increased matrix metalloproteinase activity (21). However, these findings in the constitutive IL-10-null mice cannot rule out that a regulated induction of IL-10 expression during inflammation-induced angiogenesis may be necessary to down-regulate VEGF expression and to induce decorin synthesis in endothelial cells. Furthermore the constitutive lack of IL-10 may induce other mechanisms that are not involved in angiogenesis under normal circumstances.
The influence of IL-6 and IL-10 on the metabolism of proteoglycans has not yet been analyzed in detail. In synovial cells IL-6 increased the synthesis of versican, a large hyaluronan-binding proteoglycan, but changes in other proteoglycans were not observed (22). In chondrocytes the total proteoglycan content was reduced by IL-6 (23). However, the IL-6-null mouse showed a stronger reduction in proteoglycan content in an arthritis model than the wild type mouse (24) indicating that IL-6 has not only inhibitory effects on proteoglycan synthesis. Even less is known about the effect of IL-10. Yamamoto and co-workers (12) found a stimulation of decorin expression in fibroblasts, and van Roon and co-workers (25) described a direct stimulation of cartilage proteoglycans. In this study we show for the first time that IL-6 and IL-10 both induce decorin in vascular endothelial cells. The concentrations that are necessary to induce decorin synthesis are similar to the ones used in previous studies (12, 22). These concentrations exceed the concentration found in human plasma. However, plasma concentrations may not reflect the actual concentration of cytokine molecules, which are present close to the endothelial cell surface during inflammation, because both IL-6 and IL-10 can be bound and concentrated by heparan sulfate proteoglycans in the vicinity of or on the surface of endothelial cells (26, 27). The less than additive effect of the combined addition of IL-6 and IL-10 on decorin expression may be due to the fact that both interleukins are using intracellularly the JAK/STAT pathway (13, 28), and both can activate STAT3 and STAT1, which may be limiting for a further increase of decorin transcription. This possibility needs to be investigated.
The importance of the surrounding matrix for the induction of decorin can be clearly seen by the fact that decorin protein synthesis could only be observed in the presence of a collagen type I matrix and was not observed with acid-soluble collagen type I or collagen type VI. In addition, experiments by Järveläinen and co-workers (19) showed that in spontaneously sprouting bovine aortic endothelial cells collagen type I and decorin synthesis are simultaneously induced during endothelial tube formation. Furthermore we showed by using inhibitory antibodies as well as the integrin inhibitor rhodocetin that integrin signaling in endothelial cells is necessary for decorin protein synthesis. Rhodocetin is a specific snake venom inhibitor specifically directed against the
2
1 integrin. Its effects against tumor invasion and other
2
1 integrin-related functions in fibrosarcoma cells have been shown recently (29). Here we show that it is also functional on endothelial cells. As Matrigel contains ligands for the
1
1 and
2
1 integrins as well, it also could induce decorin translation. Our data emphasizes the role of collagen-binding integrins
1
1 and
2
1 in angiogenesis that has been revisited recently (30). Previous studies by Senger and co-workers (31, 32) have demonstrated that both collagen-binding integrins play a key role in vessel formation, presumably by cross-talking with VEGF signaling.
Our results show that these integrins may regulate neovascularization in yet another way. After the primary induction of angiogenesis by e.g. VEGF endothelial cells may be induced to migrate and degrade the extracellular matrix (MMP-1 and MMP-14 expression). However, when this primary stimulus is reduced the endothelial cells would encounter intact fibrillar collagen. If the contact with fibrillar collagen occurs simultaneously with a cytokine stimulus (IL-6 and IL-10) decorin synthesis would be induced. The newly synthesized decorin again could control collagen fibrillogenesis as well as MMP-1 and MMP-14 synthesis (7), which could lead to further migration into the direction of the stimulus but also to a feedback inhibition of decorin synthesis. These data directly show the complex interactions between matrix/cytokine/matrix-modifying enzymes. They further demonstrate that in a complex process like angiogenesis determination of mRNA expression alone is not enough to predict the synthesis and availability of a functional protein.
 |
FOOTNOTES
|
|---|
* This work was supported by the Deutsche Forschungsgemeinschaft, Sonderforschungsbereiche (SFB) 293, Project A7 (to E. S.), and SFB 492, Project B3 (to J. A. E.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
Deceased. 
¶ To whom correspondence should be addressed: Matrix Biology and Tissue Repair Research Unit, University of Wales College of Medicine Dental School, Heath Park, Cardiff CF14 4XY, United Kingdom. Tel.: 44-29-2074-2595; Fax: 44-29-2074-4509; E-mail: schonherreh{at}cardiff.ac.uk.
1 The abbreviations used are: SLRP, small leucine-rich proteoglycan; TGF, transforming growth factor; MMP, matrix metalloproteinase; IL, interleukin; VEGF, vascular endothelial growth factor; JAK, Janus kinase; STAT, signal transducer and activator of transcription. 
 |
ACKNOWLEDGMENTS
|
|---|
The technical assistance of M. Bahl is gratefully acknowledged. We thank Dr. Humphrey Gardner (Biogene Idec, Cambridge, MA) for the generous gift of the AGF1-AK.
 |
REFERENCES
|
|---|
- Kinsella, M. G., Tsoi, C. K., Järveläinen, H. T., and Wight, T. N. (1997) J. Biol. Chem. 272, 318-325[Abstract/Free Full Text]
- Schönherr, E., O'Connell, B. C., Schittny, J., Robenek, H., Fastermann, D., Fisher, L. W., Plenz, G., Vischer, P., Young, M. F., and Kresse, H. (1999) Eur. J. Cell Biol. 78, 44-55[Medline]
[Order article via Infotrieve]
- Iozzo, R. V. (1998) Annu. Rev. Biochem. 67, 609-652[CrossRef][Medline]
[Order article via Infotrieve]
- Reed, C. C., and Iozzo, R. V. (2003) Glycoconj. J. 19, 249-255
- Santra, M., Mann, D. M., Mercer, E. W., Skorski, T., Calabretta, B., and Iozzo, R. V. (1997) J. Clin. Investig. 100, 149-157[Medline]
[Order article via Infotrieve]
- Iozzo, R. V., Moscatello, D. K., McQuillan, D. J., and Eichstetter, I. (1999) J. Biol. Chem. 274, 4489-4492[Abstract/Free Full Text]
- Schönherr, E., Schaefer, L., O'Connell, B. C., and Kresse, H. (2001) J. Cell. Physiol. 187, 37-47[CrossRef][Medline]
[Order article via Infotrieve]
- Border, W. A., Okuda, S., Languino, L. R., and Ruoslahti, E. (1990) Kidney Int. 37, 689-695[Medline]
[Order article via Infotrieve]
- Breuer, B., Schmidt, G., and Kresse, H. (1990) Biochem. J. 269, 551-554[Medline]
[Order article via Infotrieve]
- Nelimarkka, L., Salminen, H., Kuopio, T., Nikkari, S., Ekfors, T., Laine, J., Pelliniemi, L., and Järveläinen, H. (2001) Am. J. Pathol. 158, 345-353[Abstract/Free Full Text]
- Jones, S. A., Horiuchi, S., Topley, N., Yamamoto, N., and Fuller, G. M. (2001) FASEB J. 15, 43-58[Abstract/Free Full Text]
- Yamamoto, T., Eckes, B., and Krieg, T. (2001) Biochem. Biophys. Res. Commun. 281, 200-205[CrossRef][Medline]
[Order article via Infotrieve]
- Moore, K. W., de Waal Malefyt, R., Coffman, R. L., and O'Garra, A. (2001) Annu. Rev. Immunol. 19, 683-765[CrossRef][Medline]
[Order article via Infotrieve]
- Szulgit, G., Rudolph, R., Wandel, A., Tenenhaus, M., Panos, R., and Gardner, H. (2002) J. Investig. Dermatol. 118, 409-415[CrossRef][Medline]
[Order article via Infotrieve]
- Eble, J. A., Beermann, B., Hinz, H. J., and Schmidt-Hederich, A. (2001) J. Biol. Chem. 276, 12274-12284[Abstract/Free Full Text]
- Glössl, J., Beck, M., and Kresse, H. (1984) J. Biol. Chem. 259, 14144-14150[Abstract/Free Full Text]
- Trueb, B., Schreier, T., Bruckner, P., and Winterhalter, K. H. (1987) Eur. J. Biochem. 166, 699-703[Medline]
[Order article via Infotrieve]
- Eble, J. A., and Tuckwell, D. S. (2003) Biochem. J. 376, 77-85[CrossRef][Medline]
[Order article via Infotrieve]
- Järveläinen, H. T., Iruela-Arispe, M. L., Kinsella, M. G., Sandell, L. J., Sage, E. H., and Wight, T. N. (1992) Exp. Cell Res. 203, 395-401[CrossRef][Medline]
[Order article via Infotrieve]
- Lin, Z. Q., Kondo, T., Ishida, Y., Takayasu, T., and Mukaida, N. (2003) J. Leukocyte Biol. 73, 713-721[Abstract/Free Full Text]
- Silvestre, J. S., Mallat, Z., Duriez, M., Tamarat, R., Bureau, M. F., Scherman, D., Duverger, N., Branellec, D., Tedgui, A., and Levy, B. I. (2000) Circ. Res. 87, 448-452[Abstract/Free Full Text]
- Eklund, E., Broberg, K., Westergren-Thorsson, G., Bjardahlen, A., Hedlund, M., and Malmstrom, A. (2002) Matrix Biol. 21, 325-335[CrossRef][Medline]
[Order article via Infotrieve]
- Jikko, A., Wakisaka, T., Iwamoto, M., Hiranuma, H., Kato, Y., Maeda, T., Fujishita, M., and Fuchihata, H. (1998) Cell Biol. Int. 22, 615-621[CrossRef][Medline]
[Order article via Infotrieve]
- van de Loo, F. A., Kuiper, S., van Enckevort, F. H., Arntz, O. J., and van den Berg, W. B. (1997) Am. J. Pathol. 151, 177-191[Abstract]
- van Roon, J. A., van Roy, J. L., Gmelig-Meyling, F. H., Lafeber, F. P., and Bijlsma, J. W. (1996) Arthritis Rheum. 39, 829-835[Medline]
[Order article via Infotrieve]
- Mummery, R. S., and Rider, C. C. (2000) J. Immunol. 165, 5671-5679[Abstract/Free Full Text]
- Salek-Ardakani, S., Arrand, J. R., Shaw, D., and Mackett, M. (2000) Blood 96, 1879-1888[Abstract/Free Full Text]
- Heinrich, P. C., Behrmann, I., Haan, S., Hermanns, H. M., Müller-Newen, G., and Schaper, F. (2003) Biochem. J. 374, 1-20[CrossRef][Medline]
[Order article via Infotrieve]
- Eble, J. A., Niland, S., Dennes, A., Schmidt-Hederich, A., Bruckner, P., and Brunner, G. (2002) Matrix Biol. 21, 547-558[CrossRef][Medline]
[Order article via Infotrieve]
- Hynes, R. O. (2002) Nat. Med. 8, 918-921[CrossRef][Medline]
[Order article via Infotrieve]
- Senger, D. R., Claffey, K. P., Benes, J. E., Perruzzi, C. A., Sergiou, A. P., and Detmar, M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 13612-13617[Abstract/Free Full Text]
- Senger, D. R., Perruzzi, C. A., Streit, M., Koteliansky, V. E., de Fougerolles, A. R., and Detmar, M. (2002) Am. J. Pathol. 160, 195-204[Abstract/Free Full Text]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. R. Fiedler, E. Schonherr, R. Waddington, S. Niland, D. G. Seidler, D. Aeschlimann, and J. A. Eble
Decorin Regulates Endothelial Cell Motility on Collagen I through Activation of Insulin-like Growth Factor I Receptor and Modulation of {alpha}2{beta}1 Integrin Activity
J. Biol. Chem.,
June 20, 2008;
283(25):
17406 - 17415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hartner, L. Schaefer, M. Porst, N. Cordasic, A. Gabriel, B. Klanke, D. P. Reinhardt, and K. F. Hilgers
Role of fibrillin-1 in hypertensive and diabetic glomerular disease
Am J Physiol Renal Physiol,
June 1, 2006;
290(6):
F1329 - F1336.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. R. Taylor and R. L. Gallo
Glycosaminoglycans and their proteoglycans: host-associated molecular patterns for initiation and modulation of inflammation
FASEB J,
January 1, 2006;
20(1):
9 - 22.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Schonherr, C. Sunderkotter, R. V. Iozzo, and L. Schaefer
Decorin, a Novel Player in the Insulin-like Growth Factor System
J. Biol. Chem.,
April 22, 2005;
280(16):
15767 - 15772.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.