HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 279, Issue 20, 21287-21293, May 14, 2004

This Article Abstract Full Text (PDF) All Versions of this Article: 279/20/21287    most recent M311124200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Morel, J.-L. Articles by Mironneau, J. Search for Related Content PubMed PubMed Citation Articles by Morel, J.-L. Articles by Mironneau, J. Social Bookmarking                      What's this?

Decreased Expression of Ryanodine Receptors Alters Calcium-induced Calcium Release Mechanism in mdx Duodenal Myocytes^*

Jean-Luc Morel, Lala Rakotoarisoa, Loice H. Jeyakumar, Sidney Fleischer, Chantal Mironneau, and Jean Mironneau

From the Laboratoire de Signalisation et Interactions Cellulaires, CNRS UMR 5017, Université de Bordeaux II, 146 rue Léo Saignat, 33076 Bordeaux Cedex, France and the Department of Biological Sciences, Vanderbilt University, Nashville, Tennessee 37235

Received for publication, October 9, 2003 , and in revised form, February 3, 2004.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
It is generally believed that alterations of calcium homeostasis play a key role in skeletal muscle atrophy and degeneration observed in Duchenne's muscular dystrophy and mdx mice. Mechanical activity is also impaired in gastrointestinal muscles, but the cellular and molecular mechanisms of this pathological state have not yet been investigated. We showed, in mdx duodenal myocytes, that both caffeine- and depolarization-induced calcium responses were inhibited, whereas acetylcholine- and thapsigargin-induced calcium responses were not significantly affected compared with control mice. Calcium-induced calcium release efficiency was impaired in mdx duodenal myocytes depending only on inhibition of ryanodine receptor expression. Duodenal myocytes expressed both type 2 and type 3 ryanodine receptors and were unable to produce calcium sparks. In control and mdx duodenal myocytes, both caffeine- and depolarization-induced calcium responses were dose-dependently and specifically inhibited with the anti-type 2 ryanodine receptor antibody. A strong inhibition of type 2 ryanodine receptor in mdx duodenal myocytes was observed on the mRNA as well as on the protein level. Taken together, our results suggest that inhibition of type 2 ryanodine receptor expression in mdx duodenal myocytes may account for the decreased calcium release from the sarcoplasmic reticulum and reduced mechanical activity.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Dystrophin is a cytoskeletal structural protein present in skeletal, cardiac, and smooth muscles (1). Although it is well established that the lack of dystrophin expression is the primary genetic defect in Duchenne's muscular dystrophy, functionality of smooth muscles in patients with Duchenne's muscular dystrophy and in mdx mice has received little attention. However, different degrees of disorders have been observed in mdx smooth muscles of the digestive track (impaired nitrergic relaxation and increase of spontaneous tone, Refs. 2 and 3), and different clinical manifestations, including gastric dilatation and intestinal pseudo-obstructions, have been reported in patients with Duchenne's muscular dystrophy (4, 5). The role of dystrophin in smooth muscle contraction is still largely unknown.

In skeletal and cardiac muscles, it has been suggested that an elevation in [Ca²⁺]_i under resting conditions may activate Ca²⁺-dependent proteases inducing muscle damage (1). In fact, some groups have found a difference in [Ca²⁺]_i between normal and dystrophic skeletal muscles from patients and mdx mice (6, 7). Other groups have not been able to confirm these data (8), although an elevated subsarcolemmal Ca²⁺ concentration has been reported by studying activation of Ca²⁺-activated K⁺ channels (9). An increased Ca²⁺ influx through cationic channels has been detected in mdx skeletal fibers, suggesting that a dysregulation of channel activity may be involved in this neuromuscular disorder (10). Controversial data also have been reported for the peak Ca²⁺ responses upon stimulation. Some groups have found larger Ca²⁺ rises in mdx mice (7), others have found them to be similar to controls (11), and some have even reported reductions (12).

A key aspect of the Ca²⁺ signaling pathway is represented by its spatial and temporal complexity. Localized changes in [Ca²⁺]_i are pivotal events in triggering important cellular responses such as contraction, secretion, gene expression, and metabolic activation. In smooth muscle cells, Ca²⁺ release channels of the sarcoplasmic reticulum (SR)¹ modulate the [Ca²⁺]_i in response to activation of voltage-gated Ca²⁺ channels (13) and membrane receptors (14, 15).

In this study, we tested the hypothesis that, in visceral smooth muscle lacking dystrophin, the Ca²⁺ responses evoked by the Ca²⁺-induced Ca²⁺ release (CICR) mechanism could be affected by the mutation. We addressed this issue by using patch clamp technique coupled to confocal microscopy with Fluo-4 to analyze Ca²⁺ signals, binding experiments, and Western blotting to evaluate the expression of ryanodine receptors (RYRs) in duodenal myocytes from wild-type and mdx mice. We show for the first time that the RYR2 expression is impaired in mdx duodenal myocytes and that this alteration may account for the reduced Ca²⁺ responses evoked by caffeine and activation of voltage-gated Ca²⁺ channels.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Cell Preparation—The investigation conformed with the European Community and French guiding principles in the care and use of animals. Authorization to perform animal experiments (A-33-063-003) was obtained from the Préfecture de la Gironde (France).

Wild-type control (C57BL/10) and mdx (C57BL/10 mdx) mice aged 5-8 months were killed by cervical dislocation. Isolated myocytes were obtained from the longitudinal layer of the duodenum by enzymatic dispersion as described previously (16). Cells were seeded on glass slides in M199 culture medium containing 10% fetal calf serum, 2 mM glutamine, 1 mM pyruvate, 20 units/ml penicillin, and 20 µg/ml streptomycin. Cells were kept in an incubator gassed with 95% air and 5% CO₂ at 37 °C and used within 8 h.

Reverse Transcription-Polymerase Chain Reaction—Total RNA was extracted from freshly isolated mouse duodenal smooth muscle cells using an RNeasy minikit (Qiagen, Hilden, Germany) following the instructions of the supplier. The reverse transcription (RT) reaction was performed using a Sensiscript RT kit (Qiagen). Total RNA was incubated with oligo(dT) primers (Promega, Lyon, France) at 65 °C for 5 min. After a cooling time of 15 min at 25 °C, RT mixture was added, and the total mixture was incubated for 60 min at 37 °C. The resulting cDNA was stored at -20 °C. The PCR was performed with 1 µg of cDNA, 1.25 units of HotStart Taq DNA polymerase (Qiagen), a 1 µM concentration of each primer, and a 200 µM concentration of each deoxynucleotide triphosphate in a final volume of 50 µl. The PCR conditions were 95 °C for 15 min, then 25-35 cycles at 94 °C for 1 min, 60 °C (RYR1 and RYR2) or 56 °C (RYR3) for 1 min, and 72 °C for 1 min. At the end of PCR, samples were kept at 72 °C for 10 min for final extension and then stored at 4 °C. Reverse transcription and PCR were performed with a thermal cycler (Eppendorf, Le Pecq, France). Amplification products were separated by electrophoresis (2% agarose gel) and visualized by ethidium bromide staining. The minimum detection of RYR amplification products was obtained with 15 ng of cDNA. Gels were photographed with EDAS 120 and analyzed with KDS1D 2.0 software (Kodak Digital Science, Paris, France). The relative amount of the amplification products was determined and normalized to that of the glyceraldehyde-3-phosphate dehydrogenase fragment. The identity of the PCR products was verified by DNA sequencing.

Sense (s) and antisense (as) primer pairs specific for RYR1, RYR2, and RYR3 were designed on the known cloned receptor sequences deposited in the GenBank^TM sequence data base (accession numbers X83932 [GenBank] , X83933 [GenBank] , and X83934 [GenBank] , respectively) with Lasergene software (DNASTAR, Madison, WI). The nucleotide sequence and the length of the expected PCR products (in parentheses), respectively, for each primer pair were as follows: RYR1(s), GAAGGTTCTGGACAAACACGGG; RYR1(as), TCGCTCTTGTTGTAGAATTTGCGG (435 bp); RYR2(s), GAATCAGTGAGTTACTGGGCATGG; RYR2(as), CTGGTCTGAGTTCTCCAAAAGC (635 bp); RYR3(s), AGAAGAGGCCAAAGCAGAGG; RYR3(as), GGAGGCCAACGGTCAGA (269 bp) (17).

Western Blot—The longitudinal layer of the duodenum from wild-type and mdx mice was homogenized in an appropriate volume of 10% SDS. After centrifugation (10 min, 2700 rpm), supernatants were collected, and the protein content was measured according to Bradford (18). Equal amounts of protein (50 µg) from wild-type and mdx tissues were heated at 95 °C for 3 min in Laemmli buffer, separated by 6% SDS-polyacrylamide gel electrophoresis, and electrically transferred to polyvinylidene difluoride membranes (70 min, 100 V, 4 °C). Nonspecific binding was blocked by incubating membrane in phosphate buffer/Tween 20 (0.1%) containing 5% nonfat dry milk for 1 h, and blots were incubated (overnight, 4 °C) with anti-RYR1 (1:1000), anti-RYR2 (1:500), or anti-RYR3 (1:500) antibody (19, 20). Primary antibodies were detected with a horseradish peroxidase-coupled secondary antibody (Santa Cruz Biotechnology, 1:3000). RYR subtypes were detected using an enhanced chemoluminescence kit (Amersham Biosciences), and proteins were quantified using the KDS1D 2.0 software.

Fluorescence and Patch Clamp Measurements—Measurements of [Ca²⁺]_i were performed, in part, with an Indo-1 setup as described elsewhere (16). Briefly cells were loaded either with 1 µM Indo-1 acetoxymethyl ester for 30 min or with 50 µM Indo-1 added to the pipette solution and entering the cells after establishment of the whole-cell recording mode. [Ca²⁺]_i was estimated from the 405/480 nm fluorescence ratio using a calibration determined within cells (16). Briefly fluorescence ratios were calculated for each cell with a pipette solution containing 10 mM EGTA (R_min) or after application of a 200-mV hyper-polarizing step causing membrane breakdown (R_max). R_min and R_max values from control (n = 94) and mdx myocytes (n = 95) were 0.36 ± 0.05, 4.27 ± 0.03, 0.38 ± 0.05, and 4.44 ± 0.09, respectively. An intracellular value for the quantity K = K_d was determined according to Almers and Neher (21) in control and mdx duodenal myocytes. is defined as F₄₈₀ (at R_min)/F₄₈₀ (at R_max). K values from control (n = 94) and mdx myocytes (n = 95) were 979 ± 116 and 1357 ± 376 nM, respectively. These parameters were used to calculate the [Ca²⁺]_i values according to Grynkiewicz's formula (22). All measurements were made at 25 ± 1 °C.

For other experiments, Fluo-4 (50 µM) was dialyzed into the cell through the patch clamp pipette. Images were acquired using the line scan mode of a confocal Bio-Rad MRC1024 microscope connected to a Nikon Diaphot microscope. Excitation light was delivered by a 25-milliwatt argon ion laser (Ion Laser Technology, Salt Lake City, UT) through a Nikon Plan Apo x60, 1.4 numerical aperture objective lens. Fluo-4 was excited at 488 nm, and emitted fluorescence was filtered and measured at 522 ± 35 nm. At the setting used to detect Fluo-4 fluorescence, the resolution of the microscope was near 0.4 x 0.4 x 1.5 µm (x, y, and z axis). Scanned lines were plotted vertically, and each line was added to the right of the preceding line to form the line scan image. Fluorescence signals are expressed as pixel per pixel fluorescence ratios (F/F₀) where F is the fluorescence during a response and F₀ is the rest level fluorescence of the same pixel. Image processing and analysis were performed by using Lasersharp 2000 (Bio-Rad) and IDL softwares (Research Systems, Inc., Boulder, CO).

Voltage clamp was made with a standard patch clamp technique using a List EPC-7 patch clamp amplifier (Darmstadt-Eberstadt, Germany). Patch pipettes had resistances of 3-4 megaohms. Anti-ryanodine receptor antibodies were added to the pipette solution to allow dialysis of the cell after a breakthrough in whole-cell recording mode for at least 5 min, a time longer than that expected for diffusion of substances in solution (23).

Flash Photolysis—Caged Ca²⁺, 1-(4,5-dimethoxy-2-nitrophenyl) EDTA (1 mM, in the presence of 0.25 mM CaCl₂) was introduced into the cell via the patch clamp pipette with 5 min allowed for equilibration. Photolysis was produced by a 1-ms pulse from a xenon flash lamp (Hi-Tech Scientific, Salisbury, UK) focused to a 2-mm-diameter spot around the cell. Light was band pass-filtered with a UG11 glass between 300 and 350 mm. Flash intensity could be adjusted by varying the capacitor-charging voltage between 0 and 380 V, which corresponded to a change in the energy input into the flash lamp from 0 to 240 J. On flash photolysis, Ca²⁺ was released within 2-4 ms, and the small percentage of conversion of the caged compound (20%) allows the application of a second pulse without altering the Ca²⁺ responses (13, 24).

RYR Immunostaining—Myocytes were washed with phosphate-buffered saline, fixed with 4% (v/v) formaldehyde and 0.5% glutaraldehyde for 10 min at room temperature, and permeabilized in phosphate-buffered saline containing 3% fetal calf serum and 1 mg/ml saponin for 20 min. Cells were incubated with phosphate-buffered saline, saponin (1 mg/ml), and either specific anti-RYR2 or anti-RYR3 antibody (1 µg/ml) overnight at 4 °C (25). Then cells were washed (4 x 5 min) and incubated with the appropriate secondary antibody conjugated to fluorescein isothiocyanate for 45 min at room temperature. After washing in phosphate-buffered saline, cells were mounted in Vectashield (Ab-Cys, Paris, France). Images of the stained cells were obtained with a confocal microscope (Bio-Rad MRC1024), and fluorescence was estimated by gray level analysis using Laserpix software (Bio-Rad) in 0.5-µm confocal sections. On each cell, fluorescence was acquired from a z-series analysis (20 ± 5 sections) using Lasersharp software (Bio-Rad) and expressed by volume unit. Cells were compared by keeping acquisition parameters (gray scale, exposure time, iris aperture, gain, laser power, etc.) constant. Nonspecific fluorescence (NSF) was determined when specific anti-RYR subtype antibody was preincubated with its antigen peptide for 1 h before application of the immunostaining protocol. When the cell fluorescence obtained with the anti-RYR sub-type antibody was higher than NSF, the cell was considered to be immunopositive, and specific fluorescence (F - NSF) was estimated.

[³H]Ryanodine Binding Assay—Microsomal membranes from the longitudinal layer of mouse duodenum were prepared by homogenization with a Kontes Potter-Elvehjem pestle in a solution containing 20 mM Tris-HCl, 1 mM EGTA, and 1 mM phenylmethylsulfonyl fluoride, pH 7. The homogenate was centrifuged at 1200 rpm for 10 min at 4 °C. Microsomal membranes were obtained as a pellet by centrifugation of the supernatant at 40,000 rpm for 90 min at 4 °C. Microsomal membranes were then resuspended in the buffer and stored at -80 °C. Protein concentration was determined according to Bradford (18).

[³H]Ryanodine binding was carried out as described previously (26). For saturation experiments, the incubation medium contained 1 M KCl, 25 mM HEPES (pH 7.4 at 37 °C), and 0.1 mM CaCl₂. After a 3-h incubation at 37 °C, aliquots were filtered through Whatmann GF/C glass fiber filters and washed three times with 8 ml of ice-cold 0.1 M Tris (pH 7.4 at 4 °C). The filters were placed into scintillation vials containing 4 ml of liquid scintillation mixture, and the retained radioactivity was measured in a Packard 1500 Tri-Carb counter. The specific binding was defined as the difference between binding in the absence (total binding) and in the presence (nonspecific binding) of 10 µM ruthenium red. Nonspecific binding accounted for less than 5% of total binding at 2 nM [³H]ryanodine.

Solutions—The physiological solution contained 130 mM NaCl, 5.6 mM KCl, 1 mM MgCl₂, 2 mM CaCl₂, 11 mM glucose, and 10 mM HEPES, pH 7.4 with NaOH. The basic pipette solution contained 130 mM CsCl, 10 mM HEPES, pH 7.3 with CsOH. Acetylcholine and active compounds were applied to the recorded cell by pressure ejection for the period indicated on the records.

Chemicals and Drugs—Collagenase was obtained from Worthington (Freehold, NJ). M199 medium, streptomycin, penicillin, glutamine, and pyruvate were from Invitrogen. Fetal calf serum was from BioMedia (Boussens, France). Indo-1 and Indo-1 acetoxymethyl ester were from Calbiochem. Fluo-4 was from Molecular Probes (Interchim, Montluçon, France). All other products were from Sigma. The rabbit anti-RYR3-specific antibody was directed against the deduced amino acid sequence, residues 4326-4336 (11 amino acids), of rabbit RYR3 (19). The rabbit anti-RYR2-specific antibody was directed against the deduced amino acid sequence, residues 1344-1365 (22 amino acids), of rabbit RYR2 (20).

Data Analysis—Data are expressed as means ± S.E.; n represents the number of cells or experiments. Significance was tested by means of paired Student's t test when cells were their own control; otherwise an unpaired t test was used. p values <0.05 were considered significant.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Ca²⁺ Responses in Duodenal Myocytes from mdx Mice—In control duodenal myocytes from C57BL/10 mice, dystrophin was present and located at the periphery of the cell sections, whereas dystrophin was absent in mdx mice (not shown). In freshly isolated single myocytes from control and mdx mice, the resting [Ca²⁺]_i levels were estimated to be 61 ± 5 nM (n = 94) and 59 ± 5nM (n = 95), respectively, and were not significantly different (p > 0.05). Applications of caffeine (10 mM) or acetylcholine (ACh, 10 µM) activated transient increases in [Ca²⁺]_i that have been shown to depend essentially on Ca²⁺ release from the SR (16). With time intervals of 3 min between successive applications of the stimulating substances, similar Ca²⁺ responses were obtained in the same cell, indicating complete refilling of the internal Ca²⁺ store within 3 min (16). As shown in Fig. 1, the caffeine-induced Ca²⁺ responses were decreased by about 50% in mdx duodenal myocytes, whereas the ACh-induced Ca²⁺ responses were not significantly reduced when compared with control mice. As caffeine is known as a pharmacological activator of RYRs, we tested the effects of membrane depolarizations on Ca²⁺-induced Ca²⁺ release. In control mice, maximal Ca²⁺ inward currents in response to depolarizing steps from -70 to 0 mV triggered maximal transient Ca²⁺ responses (Fig. 2A). In mdx mice, the Ca²⁺ responses were reduced by about 45%, whereas the Ca²⁺ currents were similar (Fig. 2, A and B). Quantitative results indicated that Ca²⁺ current densities evoked by a depolarizing step from -70 to 0 mV were similar in control (13.4 ± 1.4 pA/picofarad, n = 13) and mdx mice (14.1 ± 1.1 pA/picofarad, n = 14). This current is due to activation of two different types of calcium channels: a typical L-type calcium channel and a second type resistant to dihydropyridines but inhibited by mapacalcine (27). It is noteworthy that, in the presence of a mixture of 1 µM oxodipine and 5 µM mapacalcine for 5 min to block sarcolemmal Ca²⁺ channels, both inward current and increase in [Ca²⁺]_i were suppressed during test depolarizations in control and mdx mice (not shown). As illustrated by the current-voltage relationships in Fig. 2B, the threshold potential and the potential corresponding to peak current were not different in control and mdx mice. The [Ca²⁺]_i-voltage relationship revealed that, in mdx mice, the peak Ca²⁺ responses were significantly reduced in the voltage range from -10 to +20 mV (Fig. 2B). To establish whether mdx mutation may reduce the loading of the intracellular Ca²⁺ store, we studied the effect of thapsigargin (a SR Ca²⁺ ATPase inhibitor) to deplete the SR. In myocytes from control mice, application of 1 µM thapsigargin (in Ca²⁺-free 0.5 mM EGTA-containing solution for 30 s) evoked a sustained increase in [Ca²⁺]_i of 112 ± 14 nM (n = 11). In mdx mice, the thapsigargin-induced Ca²⁺ response was not significantly affected (110 ± 21 nM, n = 13). Taken together, these results indicate that, in mdx mice, the decrease of Ca²⁺ responses evoked by caffeine and depolarizing steps did not appear to be due to an inhibition of voltage-dependent Ca²⁺ channels or Ca²⁺ loading of the SR.

View larger version (17K): [in this window] [in a new window]   FIG. 1. Ca2+ responses in duodenal myocytes from control and mdx mice. A, typical increases in [Ca2+]i induced by 10 mM caffeine (Caf) and 10 µM ACh in control and mdx duodenal myocytes. B, compiled data for the effects of caffeine and ACh in control (open bars) and mdx mice (hatched bars). Myocytes were loaded with Indo-1 acetoxymethyl ester and used within 8 h. Data are means ± S.E. with the number of cells tested indicated in parentheses. , p < 0.05.

View larger version (14K): [in this window] [in a new window]   FIG. 2. Ca2+ current and increase in [Ca2+]i as a function of membrane potential in control and mdx mice. A, typical recordings obtained from control and mdx duodenal myocytes in response to depolarizing steps from -70 to 0 mV. B, Ca2+ current and [Ca2+]i against membrane potential. Holding potential, -70 mV. Data are means ± S.E. for three to seven cells in control () and mdx duodenal myocytes (). Myocytes were loaded with Indo-1 and held at -70 mV. , p < 0.05.

View larger version (68K): [in this window] [in a new window]   FIG. 3. Ca2+ responses evoked by various depolarizing steps in control and mdx duodenal myocytes. A, effects of depolarizing steps (from -70 to -30 or 0 mV) on line scan fluorescence images from control and mdx mice. Note the absence of any Ca2+ sparks. B and C, peak amplitude ((F/F0)) in control (open bars) and mdx duodenal myocytes (hatched bars) with the number of cells tested indicated in parentheses. Myocytes were loaded with Fluo-4 and held at -70 mV. Depolarizing steps to -30 mV (B) or 0 mV (C) were used. , p < 0.05.

View larger version (31K): [in this window] [in a new window]   FIG. 4. Ca2+ responses evoked by flash photolysis Ca2+ jumps in voltage-clamped duodenal myocytes from control and mdx mice. A, UV flash of 26 J-evoked line scan fluorescence images in control and mdx mice. B, peak amplitude ((F/F0)) of Ca2+ responses evoked by UV flashes of increasing energy in control (open bars) and mdx duodenal myocytes (hatched bars). Data are means ± S.E. with the number of cells tested indicated in parentheses. C, normalized curves obtained by plotting F/Fmax against flash intensity in control () and mdx duodenal myocytes (). Myocytes were loaded with Fluo-4 and caged DM-nitrophen and held at -70 mV. , p < 0.05.

View larger version (27K): [in this window] [in a new window]   FIG. 8. Effects of anti-RYR2 and anti-RYR3 antibodies on the Ca2+ responses evoked by caffeine in control and mdx mice. A, effects of anti-RYR2 and anti-RYR3 antibodies on the peak amplitude ((F/F0)) of Ca2+ responses evoked by 10 mM caffeine in control duodenal myocytes (open bars). B, effects of anti-RYR2 and anti-RYR3 antibodies on peak amplitude of Ca2+ responses evoked by caffeine in mdx duodenal myocytes (hatched bars). Filled bars, effects of inactivated anti-RYR2 antibody preincubated with its antigenic peptide. Myocytes were loaded with Fluo-4 and held at -70 mV. Data are means ± S.E. with the number of cells tested indicated in parentheses. , p < 0.05. Ab, antibody.

View larger version (19K): [in this window] [in a new window]   FIG. 5. [3H]Ryanodine binding to duodenal microsomal preparations. A, typical specific [3H]ryanodine binding in control () and mdx mice (). Data are means of four different preparations. B, Scatchard analysis of specific binding in control () and mdx mice (). B, bound; F, free.

View larger version (47K): [in this window] [in a new window]   FIG. 6. Expression of RYRs in duodenum from control and mdx mice. A, RT-PCR-based analysis of RYR2 and RYR3 mRNAs in freshly dissociated duodenal myocytes for 25, 30, and 35 cycles. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal standard. Relative mRNA expression levels of RYR2 and RYR3 were compared with glyceraldehyde-3-phosphate dehydrogenase expression for 30 and 35 cycles in control (open bars) and mdx duodenal myocytes (hatched bars). Molecular size standards are indicated in bp. , p < 0.05. B, Western blotting of RYR2 and RYR3 in duodenum from control and mdx mice with pooled and normalized (Norm.) results from five preparations. Data are means ± S.E. with the number of experiments indicated in parentheses.

View larger version (30K): [in this window] [in a new window]   FIG. 7. Immunostaining in confocal cell sections of duodenal myocytes from control mice with the anti-RYR2 antibody or the anti-RYR3 antibody. Compiled data illustrating the mean specific fluorescence (F - NSF) in control (open bars) and mdx mice (hatched bars) obtained with the anti-RYR2 antibody or the anti-RYR3 antibody. Data are means ± S.E. with the number of cells tested indicated in parentheses obtained from five different mice. , p < 0.05. AU, arbitrary units; Ab, antibody.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
In Duchenne's muscular dystrophy patients and mdx mice, it is generally accepted that the missing link between the absence of dystrophin and muscle hypotonia is due to an alteration in Ca²⁺ homeostasis, but no firm conclusions have yet been reached. In the gastrointestinal track, impaired nitrergic relaxation and increase of spontaneous tone have been reported in mdx mice (2, 3). We have readdressed this issue by measuring [Ca²⁺]_i in localized areas with confocal microscopy, voltage-gated Ca²⁺ currents and global Ca²⁺ release from the SR, and ryanodine receptor expression in duodenal myocytes from control and mdx mice.

Under resting conditions, no significant difference in bulk cytosolic [Ca²⁺]_i between mdx and control mice was observed in duodenal myocytes as well as in line scan images using two different Ca²⁺ dyes in agreement with previous data obtained in vas deferens (29). In addition, no variation in SR Ca²⁺ loading was detected as illustrated by the absence of significant reduction in ACh-induced Ca²⁺ release at a concentration of ACh (10 µM) that had been shown to completely deplete the SR (16). Capacitive Ca²⁺ entry was not affected in mdx duodenal myocytes as revealed by similar thapsigargin-induced Ca²⁺ responses obtained in control and mdx mice. In contrast, both caffeine- and depolarization-induced Ca²⁺ responses were significantly inhibited in mdx compared with control duodenal myocytes. The reduction of depolarization-induced Ca²⁺ responses was not dependent on a reduced voltage-gated Ca²⁺ current as the current densities in mdx and control mice were similar. These results were therefore consistent with the possibility that Ca²⁺ influx was less able to activate the CICR mechanism and/or with a reduction in RYR expression in mdx duodenal myocytes. Ca²⁺ responses evoked by flash photolysis of caged Ca²⁺ were reduced in mdx duodenal myocytes, but the Ca²⁺ sensitivity of these responses, illustrated by the normalized curves of Ca²⁺ release versus flash photolysis intensity, was not different in mdx compared with control mice suggesting that the gain of function of the CICR was not altered. In contrast, RYR expression was reduced in mdx mice as the maximal binding capacity of [³H]ryanodine to duodenal membranes was strongly decreased, suggesting that the reduction of RYRs might account for the diminished Ca²⁺ responses to caffeine and voltage-gated Ca²⁺ currents. However, three RYR subtypes are generally expressed in smooth muscles, and their roles as functional Ca²⁺ release channels have been questioned (17, 28).

Duodenal myocytes expressed both RYR2 and RYR3 isoforms but not RYR1. This is in contrast with vascular myocytes that express all three RYR subtypes (17) and non-pregnant myometrial cells that express only RYR3 (28). At physiological extracellular Ca²⁺ concentration, RYR3 is insensitive to caffeine in non-pregnant myometrial cells. In vascular myocytes, both RYR1 and RYR2 are required for triggering Ca²⁺ sparks and Ca²⁺ waves induced by activation of L-type Ca²⁺ current (17). Our results show that both RYR2 and RYR3 are unable to induce Ca²⁺ sparks in control duodenal myocytes, supporting our model that co-expression of RYR1 and RYR2 is needed to trigger elementary Ca²⁺ signals in smooth muscle. In duodenal myocytes, Ca²⁺ responses are dependent on the expression of RYR2 as the anti-RYR2-specific antibody inhibited in a concentration-dependent manner the caffeine- and the depolarization-induced Ca²⁺ waves. In contrast, the anti-RYR3-specific antibody was ineffective, indicating that, at physiological extracellular Ca²⁺ concentration, RYR3 did not participate in the CICR mechanism in duodenal myocytes in agreement with previous data obtained in vascular myocytes (17). In both control and mdx mice, caffeine- and depolarization-induced Ca²⁺ waves revealed the same sensitivity to the anti-RYR2-specific antibody and the same absence of effects of the anti-RYR3-specific antibody, suggesting that inhibition of RYR2 expression was responsible for the reduced Ca²⁺ responses observed in mdx duodenal myocytes. These results were supported by the specific inhibition of RYR2 expression in duodenum of mdx mice as revealed by both RT-PCR and Western blot experiments. This is the first data showing that inhibition of RYR2 expression may be involved in dystrophic smooth muscle. However, a mutation of the RYR1 gene has been reported in human congenital myopathies, resulting in reduced level of SR Ca²⁺ release (30).

The absence of dystrophin generates modifications of ion channels that may lead to alterations of Ca²⁺ flux. Changes of Ca²⁺ channel activity or appearance of novel forms of cationic channels have been reported in dystrophic muscles (10, 31). It has been speculated that the lack of dystrophin in skeletal muscle may induce localized structural disorders leading to disrupted excitation-contraction coupling in relation to chronic elevation of [Ca²⁺]_i, which may stop Ca²⁺ release from the SR in localized areas and contribute to muscle weakness (1). However, the contractile responses of mechanically skinned muscle fibers are practically similar in both control and mdx mice (32), suggesting that the fundamental mechanisms of muscle contractility are not impaired in the absence of dystrophin. In contrast, our results in dystrophic duodenum show that the selective inhibition of RYR2 expression is responsible for the decreased CICR efficiency, which may account for a reduced mechanical activity in smooth muscle. Further experiments are necessary that are beyond the scope of this work to establish the sequence of events from the lack of dystrophin to alterations of protein expression, particularly of RYR isoforms, and to correlate inhibition of RYR expression with disorders of CICR and contraction in other muscles.

	FOOTNOTES

 
^* This work was supported by a grant from the Association Française contre les Myopathies (France). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 33-5-57-57-12-31; Fax: 33-5-57-57-12-27; E-mail: jean.mironneau{at}umr5017.u-bordeaux2.fr.

¹ The abbreviations used are: SR, sarcoplasmic reticulum; ACh, acetylcholine; CICR, calcium-induced calcium release; RYR, ryanodine receptor; RT, reverse transcription; NSF, nonspecific fluorescence.

	ACKNOWLEDGMENTS

 
We thank N. Biendon for secretarial assistance, J.-L. Lavie for confocal image analysis, M. Hénaff for Western blot experiments, and S. Netzer for RT-PCR experiments.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Gillis, J. M. (1999) J. Muscle Res. Cell Motil. 20, 605-625[CrossRef][Medline] [Order article via Infotrieve]
2. Baccari, M. C., Romagnani, P., and Calamai, F. (2000) Neurosci. Lett. 282, 105-108[CrossRef][Medline] [Order article via Infotrieve]
3. Mule, F., and Serio, R. (2001) Gastroenterology 120, 1430-1437[CrossRef][Medline] [Order article via Infotrieve]
4. Barohn, R. J., Levine, E. J., Olson, J. O., and Mendell, J. R. (1988) N. Engl. J. Med. 319, 15-18[Abstract]
5. Leon, S. H., Schuffler, M. D., Kettler, M., and Rohrmann, C. A. (1986) Gastroenterology 90, 455-459[Medline] [Order article via Infotrieve]
6. Turner, P. R., Westwood, T., Regen, C. M., and Steinhardt, R. A. (1988) Nature 335, 735-738[CrossRef][Medline] [Order article via Infotrieve]
7. Bakker, A. J., Head, S. I., Williams, D. A., and Stephenson, D. G. (1993) J. Physiol. 460, 1-13[Abstract/Free Full Text]
8. Collet, C., Allard, B., Tourneur, Y., and Jacquemond, V. (1999) J. Physiol. 520, 417-429[Abstract/Free Full Text]
9. Mallouk, N., Jacquemond, V., and Allard, B. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 4950-4955[Abstract/Free Full Text]
10. Vandebrouck, C., Martin, D., Colson-Van Schoor, M., Debaix, H., and Gailly, P. (2002) J. Cell Biol. 158, 1089-1096[Abstract/Free Full Text]
11. Head, S. I., Williams, D. A., and Stephenson, D. G. (1992) Proc. R. Soc. Lond. B Biol. Sci. 248, 163-169[Medline] [Order article via Infotrieve]
12. Rivet-Bastide, M., Imbert, N., Cognard, C., Duport, G., Rideau, Y., and Raymond, G. (1993) Cell Calcium 14, 563-571[CrossRef][Medline] [Order article via Infotrieve]
13. Arnaudeau, S., Boittin, F. X., Macrez, N., Lavie, J. L., Mironneau, C., and Mironneau, J. (1997) Cell Calcium 22, 399-411[CrossRef][Medline] [Order article via Infotrieve]
14. Boittin, F. X., Macrez, N., Halet, G., and Mironneau, J. (1999) Am. J. Physiol. 277, C139-C151[Medline] [Order article via Infotrieve]
15. Boittin, F. X., Coussin, F., Morel, J. L., Halet, G., Macrez, N., and Mironneau, J. (2000) Biochem. J. 349, 323-332[CrossRef][Medline] [Order article via Infotrieve]
16. Morel, J. L., Macrez, N., and Mironneau, J. (1997) Br. J. Pharmacol. 121, 451-458[Medline] [Order article via Infotrieve]
17. Coussin, F., Macrez, N., Morel, J. L., and Mironneau, J. (2000) J. Biol. Chem. 275, 9596-9603[Abstract/Free Full Text]
18. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve]
19. Jeyakumar, L. H., Copello, J. A., O'Malley, A. M., Wu, G. M., Grassucci, R., Wagenknecht, T., and Fleischer, S. (1998) J. Biol. Chem. 273, 16011-16020[Abstract/Free Full Text]
20. Jeyakumar, L. H., Ballester, L., Cheng, D. S., McIntyre, J. O., Chang, P., Olivey, H. E., Rollins-Smith, L., Barnett, J. V., Murray, K., Xin, H. B., and Fleischer, S. (2001) Biochim. Biophys. Res. Commun. 281, 979-986[CrossRef][Medline] [Order article via Infotrieve]
21. Almers, W., and Neher, E. (1985) FEBS Lett. 192, 13-18[CrossRef][Medline] [Order article via Infotrieve]
22. Grynkiewicz, G., Poenie, M., and Tsien, R. Y. (1985) J. Biol. Chem. 260, 3440-3450[Abstract/Free Full Text]
23. Viard, P., Exner, T., Maier, U., Mironneau, J., Nurnberg, B., and Macrez, N. (1999) FASEB J. 13, 685-694[Abstract/Free Full Text]
24. Escobar, A. L., Cifuentes, F., and Vergara, J. L. (1995) FEBS Lett. 364, 335-338[CrossRef][Medline] [Order article via Infotrieve]
25. Mironneau, J., Coussin, F., Jeyakumar, L. H., Fleischer, S., Mironneau, C., and Macrez, N. (2001) J. Biol. Chem. 276, 11257-11264[Abstract/Free Full Text]
26. Morel, J. L., Boittin, F. X., Halet, G., Arnaudeau, S., Mironneau, C., and Mironneau, J. (1997) Am. J. Physiol. 273, H2867-H2875[Medline] [Order article via Infotrieve]
27. Morel, J. L., Drobecq, H., Sautière, P., Tartar, A., Mironneau, J., Quar, J., Lavie, J. L., and Hugues, M. (1997) Mol. Pharmacol. 51, 1042-1052[Abstract/Free Full Text]
28. Mironneau, J., Macrez, N., Morel, J. L., Sorrentino, V., and Mironneau, C. (2002) J. Physiol. 538, 707-716[Abstract/Free Full Text]
29. Boland, B., Himpens, B., Casteels, R., and Gillis, J. M. (1993) J. Muscle Res. Cell Motil. 14, 133-139[CrossRef][Medline] [Order article via Infotrieve]
30. Monnier, N., Romero, N. B., Lerale, J., Nivoche, Y., Qi, D., MacLennan, D. H., Fardeau, M., and Lunardi, J. (2000) Hum. Mol. Genet. 9, 2599-2608[Abstract/Free Full Text]
31. Franco, A., Jr., and Lansman, J. B. (1990) Nature 344, 670-673[CrossRef][Medline] [Order article via Infotrieve]
32. Plant, D. R., and Lynch, G. S. (2003) Am. J. Physiol. 285, C522-C528

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				P. Sharma, T. Tran, G. L. Stelmack, K. McNeill, R. Gosens, M. M. Mutawe, H. Unruh, W. T. Gerthoffer, and A. J. Halayko Expression of the dystrophin-glycoprotein complex is a marker for human airway smooth muscle phenotype maturation Am J Physiol Lung Cell Mol Physiol, January 1, 2008; 294(1): L57 - L68. [Abstract] [Full Text] [PDF]

				F. Dabertrand, N. Fritz, J. Mironneau, N. Macrez, and J.-L. Morel Role of RYR3 splice variants in calcium signaling in mouse nonpregnant and pregnant myometrium Am J Physiol Cell Physiol, September 1, 2007; 293(3): C848 - C854. [Abstract] [Full Text] [PDF]

				N. Fritz, N. Macrez, J. Mironneau, L. H. Jeyakumar, S. Fleischer, and J.-L. Morel Ryanodine receptor subtype 2 encodes Ca2+ oscillations activated by acetylcholine via the M2 muscarinic receptor/cADP-ribose signalling pathway in duodenum myocytes J. Cell Sci., May 15, 2005; 118(10): 2261 - 2270. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 279/20/21287    most recent M311124200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Morel, J.-L. Articles by Mironneau, J. Search for Related Content PubMed PubMed Citation Articles by Morel, J.-L. Articles by Mironneau, J. Social Bookmarking                      What's this?