JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M312791200 on March 12, 2004

J. Biol. Chem., Vol. 279, Issue 21, 21724-21731, May 21, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/21/21724    most recent
M312791200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Flores-Diaz, M.
Right arrow Articles by Alape-Giron, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Flores-Diaz, M.
Right arrow Articles by Alape-Giron, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Cellular UDP-glucose Deficiency Causes Overexpression of Glucose/Oxygen-regulated Proteins Independent of the Endoplasmic Reticulum Stress Elements*

Marietta Flores-Diaz{ddagger}§, Juan-Carlos Higuita{ddagger}, Inger Florin{ddagger}, Tetsuya Okada||, Piero Pollesello**, Tomas Bergman{ddagger}{ddagger}, Monica Thelestam{ddagger}, Kazutoshi Mori§§, and Alberto Alape-Giron{ddagger}§¶¶||||

From the {ddagger}Microbiology and Tumorbiology Center and {ddagger}{ddagger}Department of Medical Biochemistry and Biophysics, Karolinska Institutet, SE-171 77 Stockholm, Sweden, the §Instituto Clodomiro Picado, Facultad de Microbología and ¶¶Departamento de Bioquímica, Facultad de Medicina, Universidad de Costa Rica, San Jose 2060, Costa Rica, the ||Graduate School of Biostudies, Kyoto University, Kyoto 606-8304, Japan, the §§Department of Biophysics, Graduate School of Science, Kyoto University, Kitashirakawa-Oiwake, Sakyo-ku, Kyoto 606-8502, Japan, and **Orion-Pharma, R&D, Drug Design Unit, NMR Laboratory, P. O. Box 65, FIN-02101 Espoo, Finland

Received for publication, November 24, 2003 , and in revised form, March 5, 2004.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A low level of UDP-Glc occurs in cells exposed to hypoxia or glucose starvation. This work reveals that a 65% reduction in the cellular UDP-Glc level causes up-regulation of the mitochondrial chaperone GRP75 and the endoplasmic reticulum (ER) resident chaperones GRP58, ERp72, GRP78, GRP94, GRP170, and calreticulin. Conditions that cause misfolding of proteins within the ER activate the transcription factors ATF6{alpha}/{beta} and induce translation of the transcription factors XBP-1/TREB5 and ATF4/CREB2. These transcription factors induce the overexpression of ER chaperones and CHOP/GADD153. However, the 65% decrease in the cellular UDP-Glc level does not cause activation of ATF6{alpha}, splicing of XBP-1/TREB5, induction of ATF4/CREB2, or expression of CHOP/GADD153. The activity of the promoters of the ER chaperones is increased in UDP-Glcdeficient cells, but the activity of the CHOP/GADD153 promoter is not affected, in comparison with their respective activities in cells having compensated for the UDP-Glc deficiency. The results demonstrate that the unfolded protein response remains functionally intact in cells with a 65% decrease in the cellular UDP-Glc level and provide evidence that this decrease is a stress signal in mammalian cells, which triggers the coordinate overexpression of mitochondrial and ER chaperones, independently of the ER stress elements.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The cellular response to stressful conditions includes metabolic adjustments and changes in gene expression. In mammalian cells the proteins most commonly overproduced in response to stress are molecular chaperones, which during normal cellular growth play essential roles in folding, oligomerization, and membrane translocation of newly synthesized polypeptides (1, 2). During stress, chaperones bind to misfolded polypeptides hence avoiding their aggregation and facilitating their repair (1, 2). Chaperones induced by heat shock, heavy metals, or exposure to amino acid analogues are termed heat shock proteins (HSPs)1 (1). Another set of chaperones, overproduced upon exposure to glucose starvation or hypoxia, are termed glucose/oxygen-regulated proteins (GRPs/ORPs) (2, 3). Several of the GRPs/ORPs are residents of the endoplasmic reticulum (ER), and their overproduction is induced through a signal transduction pathway referred to as the unfolded protein response (UPR) (4, 5). This pathway is activated by exposure to conditions that cause accumulation of misfolded proteins within the ER, such as treatment with glycosylation inhibitors or substances that perturb the oxidative milieu or calcium homeostasis in the ER (4, 5). The promoter region of the GRP genes possesses a cis-regulatory element, known as the ERSE (ER stress response element) (6), with the consensus sequence CCAATN9CCACG. This is recognized by the general transcription factor NF-Y/CBF on its CCAAT part and by the basic leucine zipper-type transcription factors ATF6{alpha}/{beta} and XBP-1/TREB5 on its CCACG part (68). ATF6{alpha}/{beta} are expressed constitutively as glycoproteins anchored in the ER membrane (9, 10). Upon ER stress they undergo proteolysis, which releases their N-terminal fragments (p50ATF6{alpha} and p60ATF6{beta}) that enter into the nucleus, dimerize, and bind to the promoters of the ER-resident GRP/ORP genes inducing their transcription (9, 10). Proteolysis of ATF6 also induces transcription of the genes encoding the transcription factors XBP-1/TREB5 and CHOP/GADD153, the promoters of which contain ERSE sequences (7, 11). Another response to the accumulation of misfolded proteins within the ER lumen is the dimerization and autophosphorylation of the ER transmembrane protein kinases IRE1{alpha}/{beta}, which leads to activation of their endoribonuclease function (12, 13). The endoribonuclease activity of IRE1{alpha}/{beta} is required to splice XBP-1/TREB5 mRNA resulting in the production of a potent transcriptional activator that enhances further the activity of its own promoter as well as those of the ER-resident GRPs/ORPs and CHOP/GADD153 (11, 14, 15). Besides binding ERSE, the product encoded by the spliced XBP-1/TREB5 mRNA broadens the spectrum of genes induced by ER stress, as it also binds with high affinity to another regulatory site known as the unfolded protein response element (UPRE) with consensus sequence TGACGTG(G/A) (11, 1517). The activation of Ire1{alpha}/{beta} and the splicing of the XBP-1/TREB5 mRNA are absolutely required for signaling through this transcription factor because overexpression of the product encoded by the unspliced XBP-1 mRNA cannot activate UPRE (15). Accumulation of misfolded proteins within the ER lumen can also lead to a prompt activation of the ER transmembrane protein kinase PERK, which phosphorylates the {alpha}-subunit of eukaryotic translation initiation factor 2 (18). This results in a transient and general translational attenuation, which, however, is accompanied by an increased synthesis of ATF4/CREB2 (5, 19, 20). This transcription factor directly contributes to the transcriptional induction of the GRP78 and CHOP/GADD153 genes by binding to their promoters in a site different from ERSEs and UPRE (21, 22).

UDP-Glc is a required precursor in the synthesis of the carbohydrate moiety of N-glycoproteins. Furthermore, it is required in the quality control of newly synthesized glycoproteins within the ER (23). A low level of UDP-Glc occurs in mammalian cells exposed to hypoxia or glucose starvation (for references see Ref. 23). In Escherichia coli a low UDP-Glc level seems to be a signal that induces the expression of a set of stress proteins required for survival under adverse conditions (24). Similarly, in plant cells a low UDP-Glc level due to hypoxia or sugar starvation induced the synthesis of at least one stress protein (25). However, whether a low UDP-Glc level is a stress signal in mammalian cells has not yet been determined.

We previously isolated a Chinese hamster mutant cell line, Don Q, having a permanent low level of UDP-Glc because of a recessive point mutation affecting the UDP-Glc pyrophosphorylase gene (UDPG:PP) (23). From Don Q we isolated a spontaneous revertant cell, Don QR, in which the mutation was reverted in one allele, partially compensating for the UDP-Glc deficiency (23). These cells provide a unique opportunity to investigate how mammalian cells are affected by fluctuations in the cellular UDP-Glc content. In this work we used them as a model system to determine whether a decrease in the cellular UDP-Glc level induces up-regulation of stress proteins.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials—The Chinese hamster lung fibroblasts of the cell line Don, referred to here as Don wt, were from ATCC (CCL 16). The UDP-Glc-deficient mutant cell, referred to here as Don Q, and the spontaneous revertant, referred to here as Don QR, and the transfectant clones QC, B9, and G3 were previously isolated (23, 26). Chemicals were from Sigma unless otherwise stated. Lipofectin, LipofectAMINE 2000, cell culture media, and supplements were from Invitrogen. Pharmalytes® were from Amersham Biosciences and all other electrophoresis reagents were from Bio-Rad. Protein sequencing reagents were from Applied Biosystems. Enzymes for molecular biology were from Fermentas AB (Graciuno, Lithuania). Polyclonal antibodies against GRP58/endoplasmic reticulum protein 57 (ERp57), ERp72/calcium-binding protein 2 (CaBP2), GRP94/ERp99/endoplasmin, GRP170/oxygen-regulated protein 150 (ORP150), the ER-resident peptidyl-prolyl cis-trans isomerase cyclophilin 2 (CPH2), the UDP-Glc:glycoprotein glucosyltransferase, and calreticulin were kindly provided by Drs. M. Kito (University of Kyoto), D. Ferrari (Georg-August Universität), P. Csermely (Semmelweis University), J. R. Subjeck (State University of New York College), G. Stucliffe (Research Institute of Scripps Clinic), A. J. Parodi (Instituto de Investigaciones Fundación Campomar), and M. Michalak (University of Alberta), respectively. Polyclonal antibodies against ATF6 were produced and purified as described (7); the monoclonal antibody JG1 against GRP75/peptide-binding protein 74 (PBP74)/mortalin (27) was kindly provided by Dr. S. Pierce (Northwestern University, Chicago, IL); polyclonal antibodies against GRP78/immunoglobulin-binding protein (BiP)/ORP80, and protein-disulfide isomerase were from Affinity Bioreagents Inc., against C/EBP homologous protein/growth arrest and DNA damage 153 (CHOP/GADD153) and ATF4/CREB2 were from Santa Cruz Biotechnology, Inc. (Santa, Cruz, CA), against HSP60, HSP25, and heme oxygenase 1/HSP32 were from Stressgene Biotechnologies Corp. (Victoria, Canada), as well as the monoclonal antibody SPA-815 against a cytosolic HSP70. Secondary antibodies conjugated to horseradish peroxidase were from Dako A/S (Glostrup, Denmark).

Two-dimensional Polyacrylamide Gel Electrophoresis, N-terminal Sequencing, and Western Blot Analyses—Cells were cultivated at 37 °C in Eagle's minimum essential medium supplemented with 10% fetal bovine serum, 5 mM L-glutamine, penicillin (100 units/ml), and streptomycin (100 µg/ml) in a humid atmosphere containing 5% CO2. Proteins in cell lysates were analyzed by two-dimensional gel electrophoresis (isoelectric focusing using pH 3–10 Pharmalytes® followed by SDS-PAGE in 7.5–20% (w/v) gradient gels) and visualized by staining with Coomassie Brilliant Blue. Each cell line was analyzed at least seven times. N-terminal sequence analysis of proteins separated on two-dimensional gels (28, 29) was performed using Applied Biosystems 470A or 477A instruments. Homology searches in SwissProt were done using BLAST.

For induction of the UPR, cells were treated with 7 µg/ml tunicamycin for 3–24 h before harvesting. Cell lysates (30 µg of protein/lane) were subjected to electrophoresis under reducing conditions on a 10% (w/v) SDS-polyacrylamide gel, electroblotted onto 0.45-µm nitrocellulose membranes, and subjected to Western blot analyses as described (23). Immunoreactive bands were detected and quantified with a densitometer using ImageQuant (Amersham Biosciences). Each immunoblot analysis was repeated 2–4 times with similar results.

1H NMR Spectroscopy—Cell metabolites were extracted from confluent monolayers of 75-cm2 culture flasks of each cell line using a dual-phase extraction method (20). The methanol/water phase was freeze-dried and resuspended in a buffer with 8 mM Na2HPO4 and 2 mM KH2PO4, pH 7.2 (prepared with D2O). Spectra were acquired, and adenine nucleotides and UDP-Glc were quantified as described (23, 30). The measurements were performed at least three times for each cell line.

Plasmids and Luciferase Assays—A 311-bp fragment of the human GRP78 promoter (–304 to +7 region; numbers indicate nucleotide positions relative to the transcription start site), a 397-bp fragment of the human GRP94 promoter (–363 to +34 region), a 1099-bp fragment of the human GRP58 promoter (–1081 to +18 region), a 511-bp fragment of the human calreticulin promoter (–459 to +52 region), a 668-bp fragment of the murine ERp72 promoter (–647 to +21 region), a 887-bp fragment of the human CHOP promoter (–870 to +17 region), and a 459-bp fragment of the XBP-1 promoter (–330 to +129 region) were amplified by polymerase chain reaction and cloned immediately upstream of the luciferase coding sequence of the pGL3-basic vector (Promega), as described (6, 7). Mutants of the GRP78, GRP94, and calreticulin promoters with disrupted ERSE sequences were prepared by site-directed mutagenesis as described (6). ERSE1, ERSE2, and ERSE3 of the GRP78 promoter, ERSE1 and ARSE3 of the GRP94 promoter, and ERSE2 and ERSE3 of the calreticulin promoter were disrupted by mutating their sequences to gatcTN9aacat, CtcgaN9aacac, gagcTN9aacgc, atgttN9Agctc, gatcTN9aacat, agctcN9aactc, and atgttN9Agatc, respectively (where lowercase letters indicate mutated nucleotides). Mutated promoters were cloned in the pGL3-basic vector (Promega), as described (6). A reporter plasmid containing a 1288-bp fragment of the human ORP150 gene (–332 to +956 region) cloned in the pGL3-basic vector (31) was kindly provided by Dr. H. Yanagi (HSP Research Institute, Kyoto, Japan). The reporter plasmid p5XUPREGL3 containing five repeats of the oligonucleotide CTCGAGACAGGTGCTGACGTGGCATTC cloned into pOFLuc-GL3 in front of the c-fos minimal promoter and the firefly luciferase gene (17) was kindly provided by Dr. R. Prywes (Columbia University, New York). The reporter plasmids –457/LUC and –457(mut)/LUC containing the rat GRP78 wild type promoter and the modified version with the mutated ATF/CRE site, respectively (22), were kindly provided by Prof. A. Lee (University of Southern California, Los Angeles, CA). The expression plasmid encoding a dominant negative mutant of the A subunit of the transcription factor NF-Y (32) was kindly provided by Dr. M. Pitarque (Karolinska Institute). The expression plasmids pCGNATF6-(1–373), encoding the wild type cytoplasmic region of the human ATF6{alpha}, and pCGNATF6-(1–373)m1, encoding a mutant version of this protein harboring a replacement of amino acids 315–317 from KNR to TAA and lacking DNA binding activity (17), were kindly provided by Dr. R. Prywes. The reference plasmid pRL-SV40, which carries the Renilla luciferase gene under the control of the SV40 enhancer and promoter, was from Promega.

Cells cultured in 48-well plates were cotransfected with reporter plasmids (1 µg) carrying the firefly luciferase gene, the reference plasmid pRL-SV40 (0.05 µg), and without or with an expression plasmid (3 µg) using LipofectAMINE 2000. Cells were incubated with 100 ml of the lipid-DNA complex in Opti-MEM at 37 °C for 5 h and then incubated in supplemented Eagle's minimum essential medium at 37 °C for 24 h. Cells were then lysed in 200 µl of passive lysis buffer (Promega) and firefly, as well as Renilla, luciferase activity was measured with 5 µl of the cell lysate by using the dual luciferase reporter assay system (Promega) and a TD2020 luminometer (Turner Designs, Sunnyvale, CA).

Assessment of XBP-1 Splicing—Total RNA from QC, B9, and G3 cells treated with or without tunicamycin (10 µg/ml, 20 h) was isolated using the SV total RNA isolation system (Promega), and XBP-1 RNA splicing was assessed by semi-quantitative reverse transcriptase-PCR (33) using the following primers: {beta}-actin-192, 5'-GATTCCTATGTGGGCGACGAG-3'; {beta}-actin-704, 5'-CCATCTCTTGCTCGAAGTCC-3'; XBP-(1–354), 5'-CCTTGTGGTTGAGAACCAGG-3'; unspliced XBP-(1–804), 5'-CTAGAGGCTTGGTGTATAC-3'; spliced XBP-(1–1150), 5'-CGAATTCTTAGACACTAATCAGC-3'. The amplified fragments were then subjected to electrophoresis on a 3% NuSieve 1% Sea Kem-agarose gel, followed by ethidium bromide staining and densitometric quantification of band intensities.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A Cellular UDP-Glc Deficiency Is Associated with Overproduction of a Specific Set of Stress Proteins—To determine whether the mutant Don Q has any specific changes in the cellular protein pattern, whole cell lysates of Don wt, the mutant Don Q, and the revertant QR were analyzed by two-dimensional gel electrophoresis (Fig. 1). Several protein spots were consistently detected in higher amounts in Don Q than in Don wt and QR cell lysates. The molecular masses of the four most conspicuously overproduced proteins were ~59, 62, 70, and 74 kDa, and their isoelectric points were 7, 4.5, 6, and 5, respectively. These four overproduced proteins were identified by their N-terminal amino acid sequences as GRP58/ERp61/ERp57 (34), calreticulin (35), GRP75/PBP74/mortalin (36), and GRP78/BiP/ORP80 (37), respectively (Table I). Western blot experiments further confirmed the identity of the overproduced proteins and showed that they occur in about 3 times higher relative amounts in Don Q than in Don wt and QR cells (Fig. 2). Because three of these proteins belong to the ER-resident stress-inducible GRPs/ORPs, additional Western blot analyses were performed with antibodies against other members of this protein family: ERp72/CaBP2 (34), GRP94/ERp99/endoplasmin (3), and GRP170/ORP150 (31). The relative amounts of these proteins were also about 3–4 times higher in Don Q than in the Don wt and QR cells (Fig. 2).



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 1.
A UDP-Glc deficiency is associated with a change in the cellular protein pattern. Lysates of Don wt, Q, and QR cells were prepared as described under "Experimental Procedures," and proteins were separated by two-dimensional gel electrophoresis and stained with Coomassie Brilliant Blue. The four most conspicuously overproduced proteins in Don Q are denoted by 1 (p62), 2 (p74), 3 (p70), and 4 (p59), whereas actin (molecular mass 42 kDa) is denoted by A.

 


View this table:
[in this window]
[in a new window]
 
TABLE I
N-terminal sequence alignments of proteins overproduced in Don Q cells.

Proteins from Don Q lysates were separated by two-dimensional gel electrophoresis and electroblotted as described under "Experimental Procedures." The four most conspicuously overproduced proteins (p59, p62, p70, and p74) were submitted to amino acid sequence analysis and similarity searches performed.

 



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 2.
UDP-Glc-deficient cells overproduce GRPs/ORPs and CRT. Cell lysates of Don wt, Q, and QR cells were subjected to Western blot analysis using antibodies against the indicated proteins as described under "Experimental Procedures."

 
However, other stress-inducible proteins, such as the cytosolic HSP70 and HSP25 and the mitochondrial HSP60 were found in comparable amounts in the three cell lines (Fig. 2). Furthermore, the protein-disulfide isomerase, the UDP-Glc: glycoprotein glucosyltransferase, the peptidyl-prolyl cis-trans isomerase CPH2, and the antioxidant enzyme heme oxygenase 1/HSP32, which are overproduced when there is an accumulation of misfolded proteins in the ER (2), were also found in similar amounts in Don wt, Q, and QR according to Western blot analysis (Fig. 2). Thus, in Don Q only a specific set of stress proteins is induced, which includes a mitochondrial chaperone and some of the proteins known to be induced by accumulation of misfolded proteins within the ER.

A Cellular UDP-Glc Deficiency Induces Chaperones from the Mitochondria and the ER but Does Not Affect CHOP Expression—Don Q cells were transfected with bovine UDPG:PP cDNA to compensate for the missing activity of the UDP-Glc-producing enzyme, and several clones were isolated of which B9 and G3 are representatives (26). 1H NMR measurements showed that the UDP-Glc concentration in these transfectant clones was comparable with that found in Don wt or QR cells, i.e. about 2–3 times higher than in Don Q and a control clone of Don Q (QC) transfected with the vector only (Table II). Despite these differences in the UDP-Glc level, the concentrations of ATP, ADP, and AMP, respectively, were equal in all the transfected clones as well as in the Don wt, Q, and QR cells (Table II).


View this table:
[in this window]
[in a new window]
 
TABLE II
Level of adenine nucleotides and UDP-Glc in cell extracts from Don wt, Q, QR cells, clones of Don Q transfected with the bovine wild type UPG:PP cDNA (B9, G3) and a clone of Don Q transfected with only the vector (QC)

Metabolites were extracted and H NMR spectra obtained as described under "Experimental Procedures." Protein concentrations were determined in parallel flasks. The values represent the mean ± S.D. of at least three determinations.

 
The relative amounts of calreticulin and the six GRPs/ORPs in the B9 and G3 transfectants were from 2.3 to 3.4 times lower than in the UDP-Glc-deficient control QC, as compared by Western blot analysis (not shown). Furthermore, reporter assays showed that the promoters of ORP150, GRP94, GRP78, ERp72, GRP58, and calreticulin are from 2.6 to 4.1 times more active in QC than in B9 or G3 cells (Fig. 3), demonstrating that the overproduction of these chaperones is because of an increased gene transcription. Because the UDP-Glc level in the B9 clone is only 70% of that in the wild type cell (Table II), this result also indicates that a threshold of UDP-Glc decrease is necessary for the induction of the stress proteins.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3.
A cellular UDP-Glc deficiency activates the promoters of the GRPs/ORPs, CRT and XBP-1, without affecting the activity of the CHOP promoter. Wt, QC, G3, or B9 cells (hatched, black, gray, and white bars, respectively) were transiently co-transfected with the plasmid pSV40R and a reporter plasmid having the wild type promoters of ORP150, GRP94, GRP78, ERp72, GRP58, CRT, CHOP, or XBP-1 in the vector pGL3-basic, as described under "Experimental Procedures." Firefly and Renilla luciferase activity in cell lysates was measured 24 h later using the dual luciferase assay system. Fold expression was calculated by dividing the average value of relative luciferase activity in lysates of each cell line with the relative luciferase activity in B9.

 
The expression of CHOP/GADD153 and the ER chaperones is coordinately regulated during UPR activation (2). Interestingly, CHOP/GADD153 was not detectable under normal conditions in Q/QC cells (Fig. 4, lane 7). Accordingly, the CHOP promoter showed the same activity in QC, B9, and G3 cells (Fig. 3). However, it could be induced after exposure to the glycosylation inhibitor tunicamycin, as detected by Western blot (Fig. 4, lanes 8 and 9). The results therefore suggested that the cellular UDP-Glc deficiency causes the overproduction of calreticulin and the GRPs/ORPs by a pathway distinct from that triggered by tunicamycin.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 4.
Exposure to tunicamycin induces ATF6{alpha} activation and CHOP expression and enhances GRP78 overexpression in cells with different levels of UDP-Glc. Cells were cultured in the presence or absence of tunicamycin (TM) (7 µg/ml) for the indicated periods of time. Lysates were prepared and submitted to Western blot analysis using antibodies against CHOP, ATF6{alpha}, or GRP78 as described under "Experimental Procedures." p90ATF6{alpha} and p50ATF6{alpha} are indicated by the open and closed arrowheads, respectively. The band marked as # denotes the unglycosylated form of p90ATF6{alpha}, whereas the identity of the band marked by * is currently unknown.

 
A Cellular UDP-Glc Deficiency Does Not Cause ATF6{alpha} Activation, XBP-1/TREB5 Splicing, or ATF4/CREB2 Induction— Under normal growth conditions Don wt, QR, or G3 cells produce GRP78 at a basal level, express p90ATF6 but not p50ATF6, and do not express CHOP/GADD153 (Fig. 4, lanes 1, 6, and 10). Exposure of these cells to tunicamycin triggers the UPR as evidenced by the conversion of p90ATF6 to p50ATF6, the 3-fold increase in the amount of GRP78 after 24 h, and the induction of CHOP/GADD153 (Fig. 4, lanes 2–5, 11, and 12). Remarkably, p50ATF6 was not detectable under normal conditions in Don Q/QC (Fig. 4, lane 7), suggesting that the up-regulation of ER-resident chaperones in these cells is independent of ATF6 activation. Accordingly, the activity of the GRP78 promoter in UDP-Glc-deficient cells was not reduced by cotransfection with dominant negative mutants of ATF6{alpha} or NF-Y/CBF, which reduce promoter activation upon tunicamycin exposure (Fig. 5A and not shown). Furthermore, the activity of the GRP78 promoter increased by co-transfection with the cytoplasmic domain of ATF6 similarly in QC and G3 cells (Fig. 5, A and B). In addition, exposure of Don Q/QC cells to tunicamycin was found to induce the conversion of p90ATF6 to p50ATF6 and to cause a 3-fold increment in the amount of endogenous GRP78 after 24 h (Fig. 4, lanes 8 and 9).



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 5.
The activity of the GRP78 promoter in UDP-Glc-deficient cells is not affected by co-transfection with a dominant negative mutant of ATF6{alpha} and increases by co-transfection with the cytoplasmic domain of ATF6{alpha}, as in cells with a normalized UDP-Glc level. QC cells (A) or G3 cells (B) were transiently co-transfected with a reporter plasmid containing the firefly luciferase gene fused with the promoter of the GRP78, the plasmid pSV40R and the plasmid pCGN (vector), a dominant negative mutant of ATF6{alpha} cloned in pCGN (ATF6 M1), or the wild type cytoplasmic domain of ATF6{alpha} cloned in pCGN (ATF6 wt) and maintained in the absence or presence of tunicamycin (TM) (7 µg/ml, 20 h). Firefly and Renilla luciferase activities in cell lysates were measured 24 h later using the dual luciferase assay system. The firefly luciferase activity is presented relative to the Renilla luciferase activity in the corresponding sample.

 
Because XBP-1/TREB5 is induced in UDP-Glc-deficient cells (Fig. 3), the activity of this transcription factor was evaluated in reporter assays using the plasmid 5XUPREGL3. Interestingly, the transcriptional activity of XBP-1/TREB5 is not higher in UDP-Glc-deficient cells than in cells with a normalized UDP-Glc level (Fig. 6A). Accordingly, the spliced form of XBP-1/TREB5 is not present in UDP-Glc-deficient cells, although it can be induced upon tunicamycin exposure (Fig. 6B). Furthermore, the UDP-Glc deficiency does not affect the amount of ATF4/CREB2, the production of which was also induced upon tunicamycin exposure regardless of the cellular UDP-Glc level (Fig. 6C). Taken together the results indicate that the classic UPR is not activated in QC cells and remains functionally active despite the UDP-Glc deficiency.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 6.
A cellular UDP-Glc deficiency does not cause XBP-1 activation or ATF4/CREB2 induction. A, QC, B9, and G3 cells were transiently co-transfected with the plasmid pSV40R and the 5XUPRE site luciferase reporter plasmid (p5XUPREGL3) as described under "Experimental Procedures." Firefly and Renilla luciferase activities in cell lysates were measured 24 h later using the dual luciferase assay system. The firefly luciferase activity is presented relative to the Renilla luciferase activity. B, QC or G3 cells were grown in the presence or absence of tunicamycin (TM) (10 µg/ml, 20 h), and reverse transcriptase-PCR analysis of XBP-1 was performed as described under "Experimental Procedures." C, cell lysates of QC and G3 cells grown in the presence or absence of tunicamycin (10 µg/ml, 20 h) were submitted to Western blot analysis using antibodies against ATF4/CREB2 as described under "Experimental Procedures."

 
The Induction of ER Chaperones by a UDP-Glc Deficiency Is Not Mediated by ERSEs—To evaluate the role of ERSEs in the induction of the ER chaperones GRP78, GRP94, and calreticulin by the UDP-Glc deficiency, we compared the activity of reporter plasmids in which the ERSEs were disrupted in cells with different levels of UDP-Glc (Fig. 7A). The results showed that despite the disruption of the ERSEs the promoter activity of the genes encoding these stress proteins is higher in UDP-Glc-deficient cells.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 7.
The ERSEs are not required for the activation of the GRP94, GRP78, or CRT promoters, neither is the ATF/CRE site required for the activation of the GRP78 promoter, induced by the cellular UDP-Glc deficiency. A, QC, G3, or B9 cells (black, gray, and white bars, respectively) were transiently co-transfected with the plasmid pSV40R and a reporter plasmid containing the firefly luciferase gene fused with mutated versions of the promoters of the GRP94, GRP78, or CRT in which the ERSEs were disrupted, as described under "Experimental Procedures." Firefly and Renilla luciferase activities in cell lysates were measured 24 h later using the dual luciferase assay system. Fold expression was calculated by dividing the average value of relative luciferase activity in lysates of each cell line with the relative luciferase activity in B9. B, QC cells were transiently co-transfected with the plasmid pSV40R and a reporter plasmid containing the luciferase gene fused with the wild type rat GRP78 promoter or a mutated version in which the ATF/CRE site was disrupted, as described under "Experimental Procedures." Firefly and Renilla luciferase activities in cell lysates were measured 24 h later using the dual luciferase assay system. The firefly luciferase activity is presented relative to the Renilla luciferase activity in the corresponding sample.

 
We also evaluated the role of the ATF/CRE binding site located upstream of the ERSEs of the rat GRP78 promoter in the induction of this chaperone by UDP-Glc deficiency. The activity in the QC cells of a reporter plasmid with the wild type promoter was compared with that of a modified version of this promoter in which that site was mutated (Fig. 7B). The results showed that disruption of the ATF/CRE site in the GRP78 promoter did not affect its activity in the UDP-Glc-deficient cells.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
This work revealed that a permanent 65% reduction in the cellular UDP-Glc level is a triggering factor that induces the overexpression of several stress-inducible chaperones, one of the mitochondria (GRP75) and six of the ER (GRP170, GRP94, GRP78, ERp72, GRP58, and calreticulin). GRP75 is required for the import and folding of mitochondrial proteins, but little is known about the control of its expression (36). GRP78 and GRP170 are part of the ER machinery that imports proteins of the secretory pathway into the ER and together with GRP94 assist in the folding and assembly of secretory and membrane proteins (38). ERp72 and GRP58 are members of the thioredoxin superfamily that participate in disulfide isomerization during protein folding (34), whereas calreticulin prevents unfolded glycoproteins from leaving the ER and facilitates their interaction with other chaperones (35). Furthermore, calreticulin and GRP78 account for most of the Ca2+ buffering capacity of the ER (39, 40). These conserved proteins are ubiquitously expressed at a basal level but overproduced in cells of ischemic tissues, as well as in cultured cells exposed to hypoxia or glucose starvation (41, 42), two conditions known to induce a reduction in the cellular UDP-Glc level (23).

UDP-Glc Deficiency and UPR Signaling—Exposure of cells to ER stressors, such as tunicamycin, induces the UPR by activation of several basic region leucine zipper transcription factors (5). Thus, a tight linkage exists among ER stress, the activation of ATF6{alpha}/{beta}, the splicing of XBP-1/TREB5, the induction of ATF4/CREB2, and the expression of ER chaperones, co-chaperones, and other ER-associated proteins (5, 21, 22). Triggering the UPR in mammalian cells induces the up-regulation of several ER-resident folding enzymes including the protein-disulfide isomerase, peptidyl-prolyl cis-trans isomerases, and the UDP-Glc:glycoprotein glucosyltransferase (2, 19). However, we found in this work that these folding enzymes are not up-regulated upon a partial deficiency of UDP-Glc. Moreover, the results showed that the increased transcription of ER chaperone genes in response to a permanent UDP-Glc deficiency is independent of ERSEs (Fig. 7A), and the chaperone overexpression is not dependent on ATF6{alpha} activation, XBP-1/TREB5 splicing, or ATF4/CREB2 induction (Figs. 4 and 6). Nevertheless, in UDP-Glc-deficient cells the UPR remains functional because exposure to tunicamycin leads to ATF6{alpha} activation, XBP-1 splicing, ATF4/CREB2 induction, a further increase in the GRP78 level, and the induction of CHOP/GADD153 (Fig. 4).

It has been recently demonstrated that an ATF/CRE binding site located upstream of the ERSEs in the GRP78 promoter regulates its induction upon exposure to thapsigargin (22). The GRP78 promoter activation via this site is independent of ATF6 processing and does not require the ERSE (22). However, we found no difference in the activity of the wild type GRP78 promoter and a modified version of this promoter in which the ATF/CRE site is mutated (Fig. 7B), excluding its involvement in response to a low UDP-Glc level. Thus, the actual promoter element(s) and transcription factor(s) activated by UDP-Glc deficiency have yet to be defined. It has been recently concluded that additional cis-acting elements different from UPRE and ERSE in the promoters of GRP78 and other ER-resident chaperones control their induction in mouse embryo fibroblasts lacking XBP-1/TREF, ATF6{alpha}, and ATF6{beta} (43). We are currently investigating the possibility that various basic region leucine zipper transcription factors like Zhangfei, which was recently shown to interact with ATF6 and ATF4 among others (44), could control the overexpression of the ER chaperones in UDP-Glc-deficient cells.

UDP-Glc Deficiency and Cell Survival—The classic UPR induced upon acute ER stress also involves expression of the non-ER-localized transcription factor CHOP/GADD153, which has been implicated in growth arrest and cell death (45). Moreover, cellular treatments that cause accumulation of misfolded proteins within the ER trigger activation of the c-Jun N-terminal kinase pathway and the activation of caspases 3, 7, and 12, inducing an apoptotic response (4648). Thus, if the ER chaperone up-regulation is not sufficient to relieve ER stress the cells will ultimately die. The experimental system used in the present study differs from those of most UPR studies in one essential aspect: generally the treatments triggering the UPR are acute and lead to cell death whereas in the model cell line used in this study, the stress, i.e. the UDP-Glc deficiency, is permanent (49). These cells survive and thrive, implying that they have adapted to coping with this cellular stress.

The survival of the UDP-Glc-deficient cells could be explained in part because CHOP/GADD153 is not induced. Furthermore, we have considered the possibility that this metabolic deficiency activates some survival signal(s) to balance their stress condition. Indeed, it has been found that NF{kappa}B is activated in the Q cell line and that this activation is needed for its survival.2 In addition, the chaperones overproduced at chronic UDP-Glc deficiency may have some cytoprotective effect in themselves. Cytoprotective properties have been previously ascribed to GRP78 and GRP170, because they were shown to be required for cell survival under hypoxia (50, 51). GRP78 and calreticulin were also found to protect cells from Ca2+ overload (5255), and recently it was reported that GRP78 prevents cell death by interacting directly with caspases 7 and 12 hence inhibiting their activation (56).

A UDP-Glc Deficiency as a Stress Signal—There are at least two different ways in which a UDP-Glc deficiency could induce the overexpression of stress proteins: it could cause protein misfolding within the ER, hence triggering the classical UPR, or alternatively, UDP-Glc may have a role as a signaling molecule such that its loss would lead to increased transcription of a selective set of chaperones. We favor the latter alternative because several of the hallmarks of the classic UPR signaling pathway are absent in the UDP-Glc-deficient cells. Considering that UDP-Glc is actively transported to the lumen of the ER (57) and that its amount in the model cell used in this study is 35% of normal, this could suffice to allow a proper quality control of N-linked glycoproteins. Accordingly, it has been shown that reducing the cellular level of UDP-GlcNAc to 5% of the normal level did not affect the synthesis or secretion of N-linked glycoproteins (58). Moreover, a G protein-coupled specific cell surface receptor for UDP-Glc, P2Y14, was recently identified (59, 60), and the release of small amounts of UDP-Glc from a variety of cultured cells into the medium was demonstrated (61). UDP-Glc was postulated as a novel autocrine and paracrine signaling molecule, although the physiological processes regulated by its widely distributed receptor remain to be clarified. Whether such a UDP-Glc receptor or a similar one could exist and function intracellularly is not known. Anyway, a lack of cytosolic (or extracellular) activating signals mediated via a UDP-Glc receptor might explain the particular stress response observed in UDP-Glc-deficient cells. Further studies are warranted to clarify the pathway by which a low UDP-Glc level triggers a stress response in mammalian cells.

UDP-Glc-deficient Cells as Model for Tumor Cell Adaptations—Solid tumors contain regions of low glucose concentration and low oxygen tension because of their abnormal vasculature (62), and it is likely that a UDP-Glc deficiency occurs in these regions (23). The UDP-Glc-deficient cell line used in this study has features resembling those of tumor cells from the ischemic regions. Mitochondrial and ER chaperones are often up-regulated in solid tumors both in experimental models and clinical samples (63, 64). As in UDP-Glc-deficient cells, NF{kappa}Bis activated in many tumor cells, and the NF{kappa}B activation is believed to have an important survival function (6567). The overproduction of calreticulin and the GRPs/ORPs correlates with the resistance of tumor cells to radiation, tumor necrosis factor, cytotoxic lymphocytes, several chemotherapeutic drugs, and photodynamic therapy (6871). The overproduction of GRP78 and GRP94 is also known to increase the tumorogenic potential of malignant cells and to favor tumor progression in experimental models (72, 73). Thus, the UDP-Glc-deficient cells used in this study might serve as a unique model system for characterizing the adaptive processes that tumor cells undergo at ischemic conditions. Understanding the signals and pathways by which tumor cells overproduce stress proteins, at conditions that do not trigger cell death, is of more than basic cell biological interest because it might help to identify molecular targets for rational therapeutic intervention strategies in malignant diseases.


    FOOTNOTES
 
* This work was supported in part by Swedish Cancer Society Grants 3826 and 1806, Fundación CR-USA Grant 1302-CT, Vicerrectoría de Investigación de la Universidad de Costa Rica Grant 741-A3-503, Swedish Medical Research Council Grants 16X-05969 and 03X-10832, the Ministry of Education, Culture, Sports, Science and Technology of Japan Grant 15GS0310, and Magnus Bergvall Foundation and Karolinska Institutet Research Funds. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Recipient of a fellowship from the Instituto Colombiano para el desarrollo de la ciencia y la tecnologia (Colciencias). Back

|||| To whom correspondence should be addressed. Tel.: 506-22-93-135 or 506-22-90-344; Fax: 506-29-20-485; E-mail: aalape{at}cariari.ucr.ac.cr.

1 The abbreviations used are: HSPs, heat shock proteins; GRPs, glucose-regulated proteins; ORPs, oxygen-regulated proteins; ER, endoplasmic reticulum; ERSE, endoplasmic reticulum stress response element; UPR, unfolded protein response; ATF, activating transcription factor; XBP-1, X-box binding protein 1; UDPG:PP, UDP-Glc pyrophosphorylase; BiP, immunoglobulin-binding protein; CHOP/GADD153, C/EBP homologous protein/growth arrest and DNA damage 153; UPRE, unfolded protein response element; wt, wild type; CREB, cAMP-response element-binding protein. Back

2 J. C. Higuita, T. Frisan, and M. Thelestam, manuscript in preparation. Back


    ACKNOWLEDGMENTS
 
We thank Dr. M. Pitarque and Dr. M. Vondracek (Karolinska Institutet) for expert advice on promoter analysis and quantitative reverse transcriptase-PCR, respectively, Dr. H. Yanagi, Prof. R. Prywes, Dr. M. Pitarque, and Prof. A. Lee for providing plasmids, and Drs. M. Kito, D. Ferrari, P. Csermely, J. E. Subjeck, G. Stucliffe, A. J. Parodi, M. Michalak, and S. Pierce for providing antibodies. We also thank Drs. C. Von Eichel-Streiber and M. Moos (Johanes Gutenberg Universität), and Profs. H. Jornvall (Karolinska Institutet), J. M. Gutiérrez, and B. Lomonte (Universidad de Costa Rica) for critical reading of early versions of the manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Morimoto, R. I., and Santoro, M. G. (1998) Nature Biotech. 16, 833–838[CrossRef][Medline] [Order article via Infotrieve]
  2. Kaufman R. J. (1999) Genes Dev. 13, 1211–1233[Free Full Text]
  3. Lee, A. S. (2001) Trends Biochem. Sci. 26, 504–510[CrossRef][Medline] [Order article via Infotrieve]
  4. Mori, K. (2000) Cell 10, 451–454
  5. Kaufman, R. J., Scheuner, D., Schröder, M., Shen, X., Lee, K., Liu, C. Y., and Arnold, S. M. (2002) Nature Mol. Cell. Biol. Rev. 3, 411–421
  6. Yoshida, H., Haze, K., Yanagi, H., Yura, T., and Mori, K. (1998) J. Biol. Chem. 273, 33741–33749[Abstract/Free Full Text]
  7. Yoshida, H., Okada, T., Haze, K., Yanagi, H., Yura, T., Negishi, M., and Mori, K. (2000) Mol. Cell. Biol. 20, 6755–6767[Abstract/Free Full Text]
  8. Yoshida, H., Okada, T., Haze, K., Yanagi, H., Yura, T., Negishi, M., and Mori, K. (2001) Mol. Cell. Biol. 21, 1239–1248[Abstract/Free Full Text]
  9. Haze, K., Yoshida, H., Yanagi, H., Yura, T., and Mori, K. (1999) Mol. Biol. Cell 10, 3787–3799[Abstract/Free Full Text]
  10. Haze, K., Okada, T., Yoshida, H., Yanagi, H., Yura, T., Negishi, M., and Mori, K. (2001) Biochem. J. 355, 19–28[CrossRef][Medline] [Order article via Infotrieve]
  11. Yoshida, H., Matsui, T., Yamamoto, A., Okada, T., and Mori, K. (2001) Cell 107, 881–891[CrossRef][Medline] [Order article via Infotrieve]
  12. Tirasophon, W., Lee, K., Callaghan, B., Welihinda, A., and Kaufman, R. J. (2000) Genes Dev. 14, 2725–2736[Abstract/Free Full Text]
  13. Wang, X. Z., Harding, H. P., Zhang, Y., Jolicoeur, E. M., Kuroda, M., and Ron, D. (1998) EMBO J. 17, 5708–5717[CrossRef][Medline] [Order article via Infotrieve]
  14. Calfon, M., Zeng, H. Q., Urano, F., Till, J. H., Hubbard, S. R., Harding, H. P., Clark, S. G., and Ron, D. (2002) Nature 415, 92–96[CrossRef][Medline] [Order article via Infotrieve]
  15. Lee, K., Tirasophon, W., Shen, X., Michalak, M., Prywes, R., Okada, T., Yoshida, H., Mori, K., and Kaufman, R. J. (2002) Genes Dev. 16, 452–466[Abstract/Free Full Text]
  16. Yoshida, H., Matsui, T., Hosokawa, N., Kaufman, R. J., Nagata, K., and Mori, K. (2003) Dev. Cell 4, 265–271[CrossRef][Medline] [Order article via Infotrieve]
  17. Wang, Y., Shen, J., Arenzana, N., Tirasophon, W., Kaufman, R. J., and Prywes, R. (2000) J. Biol. Chem. 275, 27013–27020[Abstract/Free Full Text]
  18. Harding, H. P., Zhang, Y., and Ron, D. (1999) Nature 397, 271–274[CrossRef][Medline] [Order article via Infotrieve]
  19. Okada, T., Yoshida, H., Akazawa, R., Negishi, M., and Mori, K. (2002) Biochem. J. 366, 585–594[CrossRef][Medline] [Order article via Infotrieve]
  20. Harding, H. P., Novoa, I., Zhang, Y., Zeng, H., Wek, R., Schapira, M., and Ron, D. (2000) Mol. Cell. 6, 1099–1108[CrossRef][Medline] [Order article via Infotrieve]
  21. Ma, Y., Brewer, J. W., Diehl, J. A., and Hendershot, L. M. (2002) J. Mol. Biol. 318, 1351–1365[CrossRef][Medline] [Order article via Infotrieve]
  22. Luo, S., Baumeister, P., Yang, S., Abcower, S. F., and Lee, A. S. (2003) J. Biol. Chem. 278, 37375–37385[Abstract/Free Full Text]
  23. Flores-Díaz, M., Alape-Girón, A., Persson, B., Pollesello, P., Moos, M., von Eichel-Streiber, C., Thelestam, M., and Florin, I. (1997) J. Biol. Chem. 272, 23784–23791[Abstract/Free Full Text]
  24. Bohringer, J., Fischer, D., Mosler, G., and Hengee-Aronis, R. (1995) J. Bacteriol. 177, 413–432[Abstract/Free Full Text]
  25. Maas, C., Schaal, S., and Werr, W. (1990) EMBO J. 9, 3447–3452[Medline] [Order article via Infotrieve]
  26. Flores-Díaz, M., Alape-Girón, A., Titball, R. W., Moos, M., Guillouard, I., Cole, S., Howells, A. M., von Eichel-Streiber, C., Florin, I., and Thelestam, M. (1998) J. Biol. Chem. 273, 24433–24438[Abstract/Free Full Text]
  27. Green, J. M., Gu, L., Ifkovits, C., Kaumaya, P. T. P., Conrad, S., and Pierce, S. (1995) Hybridoma 14, 347–353[Medline] [Order article via Infotrieve]
  28. Bergman, T., and Jörnvall, H. (1987) Eur. J. Biochem. 169, 9–12[Medline] [Order article via Infotrieve]
  29. Matsudaira, P. (1987) J. Biol. Chem. 262, 10035–10038[Abstract/Free Full Text]
  30. Pollesello, P., Eriksson, O., Vittur, F., Paoletti, S., Geimonen, E., and Toffanin, R. (1995) NMR Biomed. 8, 190–196[Medline] [Order article via Infotrieve]
  31. Kaneda, S., Yura, T., and Yanagi, H. (2000) J. Biochem. (Tokyo) 128, 529–538[Abstract/Free Full Text]
  32. Mantovani, R., Li, X. Y., Pessara, U., Hooft van Huisjduijnen, R., Benoist, C., and Mathis, D. (1994) J. Biol. Chem. 269, 20340–20346[Abstract/Free Full Text]
  33. Vondracek, M., Weaver, D. A., Sarang, Z., Hedberg, J. J., Willey, J. C., Wärngard, L., and Grafström, R. C. (2002) Int. J. Cancer, 99, 776–782[CrossRef][Medline] [Order article via Infotrieve]
  34. Ferrari, D. M., and Söling, H-D. (1999) Biochem. J. 339, 1–10[CrossRef][Medline] [Order article via Infotrieve]
  35. Michalak, M., Corbett, E. F., Mesaeli, N., Nakamura, K., and Opas, M. (1999) Biochem. J. 344, 281–292[CrossRef][Medline] [Order article via Infotrieve]
  36. Singh, B., Soltys, B. J., Wu, Z. C., Patel, H. V., Freeman, K. B., and Gupta, R. S. (1997) Exp. Cell Res. 234, 205–216[CrossRef][Medline] [Order article via Infotrieve]
  37. Roll, D. E., Murphy, B. J., Laderoute, K. R., Sutherland, R. M., and Smith, H. C. (1991) Mol. Cell. Biochem. 103, 141–148[Medline] [Order article via Infotrieve]
  38. Kuznetsov, G., and Nigam, S. K. (1998) N. Engl. J. Med. 339, 1688–1695[Free Full Text]
  39. Lievremont, J. P., Rizzuto, R., Hendershot, L., and Meldolesi, J. (1997) J. Biol. Chem. 272, 30873–30879[Abstract/Free Full Text]
  40. Fasolato, C., Pizzo, P., and Pozzan, T. (1998) Mol. Biol. Cell 9, 1513–1522[Abstract/Free Full Text]
  41. Massa, S. M., Swanson, R. A., and Sharp, F. R. (1995) Cerebrovascular Brain Met. Rev. 8, 95–158
  42. Bush, K. T., Keller, S. H., and Nigam, S. K. (2000) J. Clin. Investig. 106, 621–626[Medline] [Order article via Infotrieve]
  43. Lee, A. H., Iwakoshi, N. N., and Glimcher, L. H. (2003) Mol. Cell. Biol. 23, 7448–7459[Abstract/Free Full Text]
  44. Newman, J. R., and Keating, A. E. (2003) Science 300, 2097–2101[Abstract/Free Full Text]
  45. Zisner, H., Kuroda, M., Wang, X. Z., Batchvarova, N., Lightfoot, R. T., Remotti, H., Stevens, J. L., and Ron, D. (1998) Genes Dev. 12, 982–999[Abstract/Free Full Text]
  46. Nakagawa, T., Zhu, H., Morishima, N., Li, E., Xu, J., Yankner, B. A., and Yuan, J. (2000) Nature 403, 98–103[CrossRef][Medline] [Order article via Infotrieve]
  47. Urano, F., Wang, X., Bertolotti, A., Zhang, Y., Chung, P., Harding, H. P., and Ron, D. (2000) Science 287, 664–666[Abstract/Free Full Text]
  48. Yoneda, T., Imaizumi, K., Oono, K., Yui, D., Gomi, F., Katayama, T., and Tohyama, M. (2001) J. Biol. Chem. 276, 13935–13940[Abstract/Free Full Text]
  49. Higuita, J. C., Alape-Girón, A., Thelestam, M., and Katz, A. (2003) Biochem. J. 370, 995–1001[CrossRef][Medline] [Order article via Infotrieve]
  50. Koong A. C., Chen, E. Y., Lee, A. S., Brown, J. M., and Giaccia, A. J. (1994) Int. J. Radiat. Oncol. Biol. Phys. 28, 661–666[Medline] [Order article via Infotrieve]
  51. Ozawa, K., Kuwabara, K., Tamatani, M., Takatsuji, K., Tsukamoto, Y., Kaneda, S., Yanagi, H., Stern, D. M., Eguchi, Y., Tsujimoto, Y., Ogawa, S., and Tohyama, M. (1999) J. Biol. Chem. 274, 6397–6404[Abstract/Free Full Text]
  52. Liu, H., Bowes, R. C., van de Water, B., Sillence, C., Nagelkerke, J. F., and Stevens, J. L. (1997) J. Biol. Chem. 272, 21751–21759[Abstract/Free Full Text]
  53. Liu, H., Miller, E., van de Water, B., and Stevens, J. L. (1998) J. Biol. Chem. 273, 12858–12862[Abstract/Free Full Text]
  54. Bush, K. T., George, S. K., Zhang, P. L., and Nigam, S. K. (1999) Am. J. Physiol. 277, F211–F218[Medline] [Order article via Infotrieve]
  55. Yu, Z., Luo, H., Fu, W., and Mattson, M. P. (1999) Exp. Neurol. 155, 302–314[CrossRef][Medline] [Order article via Infotrieve]
  56. Rao, R. V., Peel, A., Logvinova, A., del Rio, G., Hermel, E., Yokota, T., Goldsnith, P. C., Ellerby, L. M., Ellerby, H. M., and Bredsen, D. E. (2002) FEBS Lett. 514, 122–128[Medline] [Order article via Infotrieve]
  57. Hirschberg, C. B., Robbins, P. W., and Abeijon, C. (1998) Annu. Rev. Biochem. 67, 49–69[CrossRef][Medline] [Order article via Infotrieve]
  58. Boehmelt, G., Wakeham, A., Elia, A., Sasaki, T., Plyte, S., Potter, J., Yang, Y., Tsang, E., Ruland, J., Iscove, N. N., Bennis, J. W., and Mak, T. W. (2000) EMBO J. 19, 5092–5104[CrossRef][Medline] [Order article via Infotrieve]
  59. Chambers, J. K., Macdonald, L. E., Sarau, H. M., Arnes, R. S., Freeman, K., Foley, J. J., Zhu, Y., McLaughlin, M. M., Murdock, P., McMillan, L., Trill, J., Swift, A., Aiyar, N., Taylor, P., Vawter, L., Naheed, S., Szekeres, P., Hervieu, G., Scott, C., Watson, J. M., Murphy, A. J., Duzic, E., Klein, C., Bergsma, D. J., Wilson, S., and Livi, G. P. (2000) J. Biol. Chem. 275, 10767–10771[Abstract/Free Full Text]
  60. Freeman, K., Tsui, P., Moore, D., Emson, P. C., Vawter, L., Naheed, S., Lane, P., Bawagan, H., Herrity, N., Murphy, K., Sarau, H. M., Arnes, R. S., Wilson, S., Livi, G. P., and Chambers, J. K. (2001) Genomics 78, 124–128[CrossRef][Medline] [Order article via Infotrieve]
  61. Lazarowski, E. R., Shea, D. A., Boucher, R. C., and Harden, T. K. (2003) Mol. Pharmacol. 63, 1190–1197[Abstract/Free Full Text]
  62. Brown, J. M., and Giaccia, A. J. (1998) Cancer Res. 58, 408–416
  63. Sarto, C., Binz, P-A., and Mocarelli, P. (2000) Electrophoresis 21, 1218–1226[CrossRef][Medline] [Order article via Infotrieve]
  64. Shin, B. K., Wang, H., Yim, A. M., Le Naour, F., Brichory, F., Jang, J. H., Zhao, R., Puravs, E., Tra, J., Michael, C. W., Misek, D. E., and Hanash, S. M. (2003) J. Biol. Chem. 278, 7607–7616[Abstract/Free Full Text]
  65. Bargou, R. C., Emmerich, F., Krappmann, D., Bommert, K., Mapara, M. Y., Arnold, W., Royer, H. D., Grinstein, E., Greiner, A., Scheidereit, C., and Dorken, B. (1997) J. Clin. Investig. 12, 2961–2969
  66. Chen, F., Castranova, V., and Shi, X. (2001) Am. J. Pathol. 159, 387–397[Abstract/Free Full Text]
  67. Karin, M., Cao, Y., Florian, R., and Li, Z. (2002) Nat. Rev. Cancer 2, 301–310[CrossRef][Medline] [Order article via Infotrieve]
  68. Bini, L., Magi, B., Marzocchi, B., Arcuri, F., Tripodi, S., Cintorino, M., Sanchez, J-C., Frutiger, S., Hughes, G., Pallini, V., Hochstrasser, D. F., and Tosi, P. (1997) Electrophoresis 18, 2832–2841[CrossRef][Medline] [Order article via Infotrieve]
  69. Takano, S., Wadhwa, R., Yoshii, Y., Nose, T., Kaul, S. C., and Mitsui, Y. (1997) Exp. Cell Res. 237, 38–45[CrossRef][Medline] [Order article via Infotrieve]
  70. Tsukamoto, Y., Kuwabara, K., Hirota, S., Kawano, K., Yoshikawa, K., Ozawa, K., Kobayashi, T., Yanagi, H., Stern, D. M., Tohyama, M., Kitamura, Y., and Ogawa, S. (1998) Lab. Investig. 78, 699–706[Medline] [Order article via Infotrieve]
  71. Reddy, R. K., Mao, C., Baumeister, P., Austin, R. C., Kaufman, R. J., and Lee, A. S. (2003) J. Biol. Chem. 278, 20915–20924[Abstract/Free Full Text]
  72. Menoret, A., Meflah, K., and Lependu, J. (1994) Int. J. Cancer 56, 400–405[Medline] [Order article via Infotrieve]
  73. Jamora, C., Denner, G.