JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M312673200 on March 16, 2004

J. Biol. Chem., Vol. 279, Issue 21, 22228-22235, May 21, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/21/22228    most recent
M312673200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Le Lay, J.
Right arrow Articles by Stein, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Le Lay, J.
Right arrow Articles by Stein, R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification of a Novel PDX-1 Binding Site in the Human Insulin Gene Enhancer*

John Le Lay, Taka-aki Matsuoka{ddagger}, Eva Henderson, and Roland Stein§

From the Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, Tennessee 37215

Received for publication, November 19, 2003 , and in revised form, March 9, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Islet {beta} cell type-specific transcription of the insulin gene is regulated by a number of cis-acting elements found within the proximal 5'-flanking region. The control sequences conserved between mammalian insulin genes are acted upon by transcription factors, like PDX-1 and BETA-2, that are also involved in islet {beta} cell function and formation. In the current study, we investigated the contribution to human insulin expression of the GG2 motif found between nucleotides -145 and -140 relative to the transcription start site. Site-specific mutants were generated within GG2 that displayed a parallel increase (i.e. -144 base pair) or decrease (i.e. -141 base pair) in insulin enhancer-driven reporter and gel shift binding activity in {beta} cells consistent with human GG2 being under positive regulatory control. In contrast, the corresponding site in the rodent insulin gene, which only differs from the human at nucleotides -144 and -141, is negatively regulated by the Nkx2.2 transcription factor (Cissell, M. A., Zhao, L., Sussel, L., Henderson, E., and Stein, R. (2003) J. Biol. Chem. 278, 751-756). Human GG2 activator binding activity was present in nuclear extracts prepared from human islets and enriched in those from rodent {beta} cell lines. The human GG2 activator binding factor(s) was shown to be ~38-40 kDa and distinct from other size-matched islet-enriched transcription factors, including Nkx2.2, Pax-4, Cdx2/3, and Isl-1. Combined DNA chromatographic purification and mass spectrometry analysis revealed that the GG2 activator was PDX-1. These results demonstrate that the GG2 element, despite its divergence from the core homeodomain consensus binding motif, is a site for PDX-1 activation in the human insulin gene.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Insulin is a polypeptide hormone critically involved in the control of glucose homeostasis and is synthesized exclusively by pancreatic islet {beta} cells. Tissue-specific expression of the insulin gene has been shown in transgenic animals in vivo to be mediated by 5'-flanking sequences within 350 base pairs of the transcription start site that are ~60% conserved between human and rodent (1-3). A focused analysis of this region has shown that restricted expression is at least partially regulated by the respective binding of islet-enriched PDX-1 (4-6), MafA (7-9), and BETA-2 (10) to conserved insulin A3 (-216/-207 bp), C1 (-125/-116 bp), and E1 (-111/-102 bp) element sequences. Each of these factors represent a distinct transcription factor family with DNA binding mediated by the homeodomain, basic helix-loop-helix, and basic leucine-zipper regions in PDX-1, BETA-2, and MafA, respectively.

Gene ablation studies have revealed that each of the islet-enriched transcriptional activators of the insulin gene also mediate critical steps involved in both endocrine and exocrine pancreas formation (11, 12). Thus, mice and humans lacking PDX-1 are apancreatic apparently due to an early arrest in endocrine and exocrine progenitor cell development (13-15). In contrast, BETA-2 acts downstream of PDX-1 in the islet cell differentiation pathway and is involved in the formation of all islet endocrine cell types ({beta} > {alpha} > {delta} (16)). In addition, the PAX-6 homeodomain protein, which at least binds to and activates rodent insulin C2 (-329/-307 bp)-driven expression (17), is essential for the generation of islet glucagon hormone-producing {alpha} cells (17, 18). The recently isolated MafA protein has not yet been analyzed at this level. Mutations in BETA-2 (19), PDX-1 (20), and PAX-6 (21) have also been linked to forms of human type 2 diabetes likely due to reduced expression of insulin as well as other target genes associated with islet cell function ({beta}-glucokinase (BETA-2 (22), PDX-1 (23-25), and PAX-6 (25)), islet amyloid polypeptide (BETA-2 (25), PDX-1 (25-29), and PAX-6 (17, 25)), glucose transporter type 2 (PDX-1 (30)), glucagon (BETA-2 (31) and PAX-6 (17, 32)), and somatostatin (PDX-1 (33) and PAX-6 (17))). Collectively these observations link essential insulin gene transcription factors with broader functions associated with {beta} cell formation and physiology.

The current work was focused on the GG2 element located between nucleotides -145 and -140 in the human insulin gene. Recently the corresponding region in the rodent gene was found to be negatively regulated by islet-enriched Nkx2.2, a homeodomain transcription factor of the NK-2 class (25). However, earlier studies showed reduced human insulin enhancerdriven reporter activity from a GG2 deletion and block mutant, while in vitro DNase I footprinting indicated that a {beta} cell-enriched factor of roughly 30 kDa was involved in control (34-36). To more precisely examine the mechanism of human GG2-mediated control, a comprehensive series of directed mutations were made and analyzed in the context of a human insulin enhancer-driven reporter. These studies strongly suggested that human GG2 was under positive control by a protein(s) of ~38-40 kDa that was present in nuclear extracts from human islets and enriched in rodent {beta} cell lines. The binding site for the human GG2 activator also appeared to be distinct from other pancreas-enriched transcription factors and incapable of interacting with those of similar size, including Nkx2.2, Pax-4, Cdx2/3, and Isl-1. The GG2 activator was purified from a cultured {beta} cell line by DNA affinity chromatography and identified by mass spectrometry to be PDX-1, a result confirmed by antibody and DNA binding competition analysis. These studies have identified an atypical PDX-1 binding site in the human insulin enhancer and demonstrated a fundamental difference in the regulation of the human and rodent insulin genes.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Transfection Constructs—Insulin GG2-mediated activation was assayed from human insulin enhancer-driven firefly luciferase expression constructs that contained either wild type -251 to +2 bp sequences (-251 Luc WT)1 (37) or GG2 mutations. The -145/-142 block mutant (-155CCAGCACCAGTTCCATGGTCCGGAAA-130, mutated nucleotides are underlined), -144 mut A (-155CCAGCACCAGGTAAATGGTCCGGAAA-130), -144 mut B (-155CCAGCACCAGGCAAATGGTCCGGAAA-130), -141 mut A (-155CCAGCACCAGGGAACTGGTCCGGAAA-130), and -141 mut B (-155CCAGCACCAGGGAAGTGGTCCGGAAA-130) were constructed using the QuikChangeTM site-directed mutagenesis kit (Stratagene, La Jolla, CA). Enzyme restriction digest and DNA sequencing analyses was utilized to determine the correctness of each construct. The -238 Luc WT construct contains rat insulin II sequences from -238 to +2 bp (38), while -238 Luc (-133/-132 mut) contains an A to C change at nucleotides -133 and -132 (25).

Cell Culture and Transfection Analysis—Monolayer cultures of pancreatic islet {beta} ({beta}TC-3 (mouse), Min6 (mouse), HIT T-15 (hamster), and Ins-1 (rat)), {alpha} ({alpha}TC-6 (mouse)), and non-islet (BHK (hamster), HepG2 (human), HeLa (human),and NIH 3T3 (mouse)) cell lines were maintained as described previously (39). The LipofectAMINE reagent (Invitrogen) was used to introduce Insulin-Luc (0.5 µg) and TK-Renilla Luc (phRL-TK, 10 ng) into {beta}TC-3 and Min6 cells. The Luc activity from phRL-TK served as an internal transfection control. The luciferase measurements were made from cell extracts prepared 40-48 h after transfection using the manufacturer's protocol (Promega, Madison, WI). Each experiment was carried out at least three times with two independently isolated DNA preparations.

Electrophoretic Mobility Shift Assay—Human islet and cell line nuclear extracts were prepared by the Schreiber et al. (40) procedure except that 1 mM phenylmethylsulfonyl fluoride was included in the high salt nuclear resuspension buffer. The Juvenile Diabetes Research Foundation Distribution Program at the Washington University Medical School provided human islets. The TNT coupled reticulocyte lysate system (Promega) was used to in vitro transcribe and translate the Nkx2.2, Cdx2/3, and Pax-4 from pNkx2.2 (25), pBAT9.cdx-3 (41), and pPax4 (42), respectively. The binding analysis was performed with double-stranded oligonucleotides to WT human (hum) GG2 (-155CCAGCACCAGGGAAATGGTCCGGAAA-130), hum GG2 -144 mut A, hum GG2 -141 mut A, rat GG2 WT (-145CTAGCACCAGGCAAGTGTTTGGAAA-121), Nkx2.2 Consensus (GGTTTTTAAGTGGTTTTTGGG) (43), Nkx2.2 Consensus M2, Nkx2.2 Consensus M5, human insulin (Ins) A3 (-225GGTTAAGACTCTAATGACCCGCTGGT-200), human Ins A1 (-92ACCCCAGGCCCTAATGGGCCAGGCGG-67), and P6Con, a consensus PAX-6 and PAX-4 binding site (42). The binding reactions (25-µl total volume) were conducted at 4 °C for 30 min with 10 µg of nuclear extract or 5 µl of in vitro translated protein and 400 fmol of 32P-radiolabeled probe in binding buffer containing 10 mM Tris (pH 8), 100 mM NaCl, 1 mM EDTA, 2 mM dithiothreitol, 10% glycerol, and 1 µg of poly(dI-dC). Competition assays were performed under the same conditions except that an excess of competitor DNA to probe was included in the reaction prior to the addition of nuclear extract. Protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide gels run in 1x TGE buffer (50 mM Tris, 380 mM glycine, 2 mM EDTA). Gels were then dried and visualized by autoradiography.

SDS-PAGE Fractionation—{beta}TC-3 nuclear extract (100 µg) was separated on a 4-12% SDS-polyacrylamide gel. The lane containing the fractionated extract was cut horizontally into 3-mm pieces to represent different molecular weight fractions. The proteins were eluted overnight from the crushed gel slice at 4 °C by agitation in 100 µl of renaturation buffer (gel shift binding buffer plus 1% Triton and 1 µg of bovine serum albumin). The gel pieces were pelleted by centrifugation, and the supernatant was analyzed for human GG2 binding in the gel mobility shift assay.

DNA Affinity Chromatography—The oligonucleotide trapping method (44) was modified for use with the Nkx2.2 Consensus M5 sequence containing a single TGTGTGTGTG tail at the 3'-end of the top strand, termed M5(TG)5. All purification steps were carried out at 4 °C. {beta}TC-3 nuclear extract (10 mg) was incubated in 25 ml of gel shift binding buffer containing Tween 20 (5% final concentration) and a protease inhibitor mixture (Roche Applied Science, one tablet/50-ml total volume) and then applied to a column containing 5 ml of Sepharose 4B covalently linked to single-stranded ACACACACAC ((AC)5) DNA. The flow-through and early washes containing all of the human GG2 element binding activity were combined and incubated with M5(TG)5 DNA (200 fmol/10 mg of nuclear extract) and poly(dI-dC) (2 µg/pmol of M5(TG)5 DNA). The reaction was then applied to an (AC)5 DNA column (0.5 ml of Sepharose/µmol of M5(TG)5 DNA), and binding activity was analyzed over a 100 mM-1 M NaCl elution gradient. GG2 activator binding was detected at ~200 mM NaCl. These fractions were combined, and the DNA affinity step was repeated. Proteins in the affinity-purified GG2 binding fractions were precipitated with 20% trichloroacetic acid, resuspended in 1x SDS loading buffer, and separated by 10% SDS-PAGE. The 38-40-kDa protein band(s) detected by Colloidal Blue staining (Invitrogen) was excised and analyzed by mass spectroscopy.

Protein Identification by Mass Spectroscopy—The 38-40-kDa protein band(s) was excised from the lane representing the fractions with peak activity along with a similar band from a neighboring fraction exhibiting no activity to serve as a negative control. Each band was separately cut into cubes, equilibrated in 50 mM NH4HCO3, reduced with dithiothreitol (3 mM in 50 mM NH4HCO3 at 37 °C for 15 min), and alkylated with iodoacetamide (6 mM in 50 mM NH4HCO3 for 15 min). The separate sets of gel cubes were then dehydrated with acetonitrile and rehydrated with 15 µl of 20 mM NH4HCO3 containing 0.01 µg/µl modified trypsin (Promega), and trypsin digestion was carried out for >2 h at 37 °C. Peptides were extracted with 60% acetonitrile, 0.1% trifluoroacetic acid, dried by vacuum centrifugation, and reconstituted in 10 µl of 0.1% trifluoroacetic acid. The peptides were then desalted and concentrated into 2 µl of 60% acetonitrile, 0.1% trifluoroacetic acid using ZipTip C18 pipette tips (Millipore), and then 0.4 µl was applied to a target plate and overlaid with 0.4 µl of {alpha}-cyano-4-hydroxycinnamic acid matrix. Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry and TOF/TOF tandem mass spectrometry were carried out using a Voyager 4700 mass spectrometer (Applied Biosystems, Foster City, CA) operated in reflectron mode.

For intact peptide mass analysis, the mass spectra were calibrated to within 20 ppm using trypsin autolytic peptides present in the sample (m/z = 842.51, 1045.56, and 2211.09 daltons). Peptides unique to the sample generated from the peak activity fraction were used for data base interrogation against the Swiss-Prot and National Center for Biotechnology non-redundant data bases using the MASCOT algorithm. These included m/z = 791.45, 797.42, 863.45, 893.37, 943.55, 1145.62, 1161.61, 1543.86, 1559.86, 1863.86, and 1978.91, which generated an unambiguous match to mouse IPF1/PDX-1 (SwissProt P52946 [GenBank] , MOWSE score = 141 with partial oxidation of methionine and complete carbamidomethylation of cysteine; 29% sequence coverage). Fragmentation spectra generated from the parent ions at m/z = 863.45 (193IWQFNR198), 893.37 (16DPCAFQR22), 1161.61 (116VQLPFPWM*K124), and 1863.86 (133GQWAGGAYRAEPEENKR149) validated the predicted amino acid sequences. Peptide ions present in both the sample and the negative control were derived from heterogeneous nuclear ribonucleoprotein A3 (Swiss-Prot Q8BG05, data not shown).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Identification of GG2 Sequences That Regulate Human Insulin Enhancer-driven Expression—To investigate how the GG2 element influences human insulin gene expression, a series of mutations in GG2 (-145/-140 bp) were constructed in a reporter driven by -251 to +2 bp of the human gene (termed -251 Luc). Human GG2 mutant activity was compared in transfected {beta}TC-3 and Min6 {beta} cells with the rat insulin II GG2 mutant, -238 Luc (-133/-132 mut). A block mutation within human GG2 resulted in an ~80% reduction in reporter activity, whereas the rat element mutant was ~2-3-fold more active (Fig. 1B).



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 1.
GG2 sequences at nucleotides -144 and -141 are important for human insulin-driven activity. A, schematic of the human insulin control region in -251 LUC showing the location of the conserved A3 (-216/-207 bp), GG2 (-155/-130 bp), C1 (-125/-116 bp), and E1 (-111/-102 bp) elements. The sequences surrounding human Ins and rat Ins GG2 is compared with the non-identical bp -144 and bp -141 of human denoted. B, {beta}TC-3 and Min6 cells were transfected with the WT or mutant human (-251 Luc)- or rat (-238 Luc)-driven reporters. Type A and B mutants in bp -144 or bp -141 of -251 Luc represent transversion or rat II conversion mutations, respectively. The rat -238 (-133/-132 mut) is a transversion mutant. The normalized mutant to wild type Insulin-Luc activity ± S.E. is shown. hINS, human insulin.

 
Because of the different regulatory behavior of the human and rat GG2 mutants, site-directed transversion (type A) and rat insulin II conversion (type B) mutants in human -251 Luc were constructed at the non-identical bp -144 and bp -141 sequences (Fig. 1). Both of the bp -141 mutants decreased activity to a level similar to the block mutation. Conversely the bp -144 mutants resulted in 3-4-fold activation over wild type (Fig. 1B). These results suggested that human insulin nucleotides -145 to -141 are part of the functional core of the GG2 element.

An Islet {beta} Cell-enriched Protein(s) Stimulates Human GG2 Activity—Gel mobility shift assays were performed to determine the binding properties of the factor(s) associated with human GG2. Binding to both human and rat II GG2 element sequences was analyzed in {beta}TC-3 nuclear extracts. The islet-enriched Nkx2.2 transcription factor binds to and negatively regulates rat GG2 (25). However, Nkx2.2 did not appear to bind to the human GG2 probe using {beta}TC-3 extracts; instead a unique slower mobility complex was principally formed (Fig. 2A, compare lanes 1 and 2). Furthermore in vitro synthesized Nkx2.2 did not bind human GG2 (Fig. 2B) nor did rat GG2 compete with human GG2 for the slower mobility complex (Fig. 2C). This human-specific complex was not found with either bp -141 mutant, whereas enhanced binding was observed with both bp -144 mutants (Fig. 2A and data not shown). The Nkx2.2 consensus binding sequence also competed very effectively for the human-specific GG2 complex (Fig. 2C, compare Nkx2.2 Cons. with -144 mut).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 2.
Binding properties of the human GG2 activator complex. A, WT and mutant GG2 probe binding was analyzed in {beta}TC-3 nuclear extract in the gel mobility shift assay. Nkx2.2 and GG2 Act are the respective unique binding complexes of rat and human GG2. B, binding assays were conducted with rat GG2, human GG2, and Nkx2.2 Cons. probes in the presence (+) or absence of in vitro translated (IVT) Nkx2.2 or a no DNA control (CTL). Nonspecific binding complexes are labeled with an asterisk. C, WT human GG2 probe binding in {beta}TC-3 nuclear extracts was evaluated in the presence of 50- or 100-fold molar excess of unlabeled human GG2 -144 mut, rat GG2, or Nkx2.2 consensus competitors to probe.

 
Strikingly the roughly 4-fold increase in human-specific complex binding achieved with the bp -144 mutants was also similar to their effect on insulin enhancer-driven activity (Fig. 1B). In contrast, neither bp -141 mutant was capable of competing with wild type human GG2 for binding to this {beta} cell factor(s), while a wild type behavior was observed with divergent bp -138 mutant competitors (data not shown), indicating that nucleotides -145 to -140 contain the principal binding sequences. This competition analysis also demonstrated that there was no regulatory binding specificity to any of the other human GG2 complexes. Importantly, as GG2 complex binding paralleled regulation of -251 Luc in transfection assays, we conclude that this element is a site for positive control in the human insulin gene. The unique human GG2 binding complex was termed GG2 activator, abbreviated GG2 Act.

To obtain insight into the distribution of GG2 Act, nuclear extracts from various islet {beta} and non-{beta} cell lines were analyzed for binding. GG2 Act binding activity was found in all of the tested rodent {beta} cell lines ({beta}TC-3, Min6, Ins-1, and HIT T-15) but not islet {alpha} ({alpha}TC-6), kidney (BHK), liver (HepG2), cervical cancer (HeLa), or fibroblast (NIH 3T3) cell lines (Fig. 3A). Wild type and mutant human GG2 competition analysis was used to distinguish the specific GG2 Act regulatory complex (i.e. {beta} cells) from nonspecific (e.g. HepG2) (data not shown). Human {beta} cell lines have not been isolated, and as a consequence it is not possible to directly determine the presence of GG2 Act in these cells. However, a slightly faster migrating complex (human GG2 Act) was found in human islet nuclear extracts, which would primarily represent {beta} cells and to a lesser extent {alpha}, {delta}, and pancreatic polypeptide (Fig. 3B). Furthermore competition analysis demonstrated that this complex displayed the same binding specificity as GG2 Act of rodent {beta} cell lines (Fig. 3B). Collectively these results suggest that the GG2 Act factor(s) is enriched in mammalian pancreatic islet {beta} cells.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 3.
GG2 Act is enriched in islet {beta} cells. A, human GG2 -144 mut probe binding was analyzed in islet {beta} ({beta}TC-3, Min6, Ins-1, and HIT T-15 (Hit)), islet {alpha} ({alpha}TC-6), kidney (BHK), liver (HepG2), cervical cancer (HeLa), and fibroblast (NIH 3T3) nuclear extracts. Competition assays were performed to identify GG2 Act and nonspecific binding (*) complexes (not shown). B, human islet nuclear extract was used in gel shift binding reactions with the human GG2 -144 mut probe. Binding specificity was determined by competition with a 50-fold excess of the unlabeled GG2 double-stranded oligonucleotide listed. hGG2, human GG2; NE, nuclear extract.

 
GG2 Act Is a 38-40-kDa Factor Distinct from Pax-4, Cdx2/3, and Isl-1—To determine the approximate size of GG2 Act, {beta}TC-3 nuclear extract was first size-fractionated by SDS-PAGE. The lane containing fractionated extract was then cut into slices, each containing proteins representing a particular size range. The proteins eluted from each gel slice were analyzed for GG2 Act activity. A binding activity of around 38-40 kDa was found that co-migrated with GG2 activity in unfractionated {beta}TC-3 nuclear extract (Fig. 4, compare Fraction 11 with unfractionated (UNF)) and displayed the appropriate specificity (data not shown). These data indicated that GG2 Act is composed of one or more proteins of ~38-40 kDa, a similar size range to that previously estimated for the human GG2 activator (34).



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 4.
GG2 Act contains a protein(s) of ~38-40 kDa. {beta}TC-3 nuclear extract was fractionated by SDS-PAGE, and eluted proteins of distinct molecular weights were assayed for human GG2 -144 mut binding activity. Each fraction (1-16) represents a different molecular mass range. Binding specificity was determined by competition with unlabeled WT and mutant human GG2 (not shown). The position of GG2 Act in unfractionated (UNF) {beta}TC-3 nuclear extract is indicated.

 
Of the characterized pancreas-enriched transcription factors, Cdx2/3, Pax-4, and Isl-1 all fall within or near the appropriate size range predicted for the GG2 Act binding factor. To determine whether Pax-4 or Cdx2/3 were capable of binding the human GG2 element, each was in vitro translated and analyzed in gel mobility shift assays. Although neither of these factors bound the human GG2 probe, specific binding to control probes was observed (Fig. 5). In addition, antiserum raised against Isl-1 had no effect on the formation of GG2 Act (data not shown).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 5.
GG2 Act does not contain Cdx2/3 or Pax-4. Binding assays with WT human GG2 were performed with in vitro translated (IVT) Cdx2/3 and Pax-4 and a no DNA control (CTL). GG2 Act formed with {beta}TC-3 nuclear extract is shown. Positive control assays were conducted with in vitro translated Cdx2/3 and Pax-4 and their cognate binding sequences. Their specific complexes are labeled, while nonspecific binding is indicated with an asterisk. The addition of antiserum to Isl-1 did not affect GG2 Act binding activity ({alpha}Isl-1 (Developmental Studies Hybridoma Bank, Iowa City, Iowa), data not shown). The predicted molecular masses of Cdx2/3, Pax-4, and Isl-1 are 35, 38, and 39 kDa, respectively.

 
Biochemical Purification and Identification of GG2 Act by Mass Spectrometry—Since GG2 Act appeared to be regulated by a novel {beta} cell-enriched factor, a DNA affinity chromatography approach was used to determine its identity. Successful isolation of factors via this method requires the use of a high affinity DNA probe for efficient binding complex retention. The Nkx2.2 consensus element appeared to be of use in this process since it competed for GG2 Act binding even more effectively than the bp -144 mutant of human GG2 (Fig. 2C).

One diffuse binding complex was principally formed with the Nkx2.2 consensus probe using {beta}TC-3 nuclear extract (Fig. 6B). However, Nkx2.2 appeared to represent only a fraction of the binding activity as Nkx2.2-specific antibody supershifted only a small portion of the binding complex (Fig. 6B), a pattern unaffected by additional antiserum (data not shown). Support for this broad gel shift band actually being composed of two closely migrating complexes was obtained upon addition of WT human GG2 competitor (Fig. 6B). Additional experiments performed with the Nkx2.2 antiserum and human GG2 competitors demonstrated that the bottom complex contained Nkx2.2 (data not shown) and the top contained GG2 Act (Fig. 6C). Together these data revealed that the Nkx2.2 consensus sequence was capable of effectively and specifically binding to both Nkx2.2 and GG2 Act.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 6.
Nkx2.2 and GG2 Act bind the Nkx2.2 consensus. A, comparison of human GG2 and Nkx2.2 consensus sequences. The non-identical bases within the human GG2 core region are under-lined, and the base changes made to generate the M2 and M5 mutations in the Nkx2.2 consensus are shown. B, binding assays with WT Nkx2.2 consensus were performed with {beta}TC-3 nuclear extract in the presence of Nkx2.2-specific antiserum ({alpha}Nkx2.2) or a 100-fold excess of WT human GG2. C, binding assays with WT Nkx2.2 consensus were performed with {beta}TC-3 nuclear extract in the presence of 50- and 100-fold excess of WT Nkx2.2 Cons., WT human GG2, Nkx2.2 Cons. M5, or Nkx2.2 Cons. M2 competitors. The -141 bp and -144 bp mutants of human GG2 were used as competitors to show that Nkx2.2 M5 bound GG2 Act with the appropriate specificity (data not shown).

 
With the objective of selectively eliminating Nkx2.2 binding to the Nkx2.2 consensus element, the divergent bases corresponding to bp -144 and -141 were individually converted to those found in the human GG2 sequence and termed Nkx2.2 Consensus (Cons.) M2 and Nkx2.2 Cons. M5, respectively (Fig. 6A). The Nkx2.2 Cons. M5 probe competed for GG2 Act binding as well as the Nkx2.2 consensus but was unable to bind Nkx2.2 (Fig. 6C). Conversely Nkx2.2 binding to Nkx2.2 Cons. M2 was uncompromised but failed to interact with GG2 Act (Fig. 6C).

The isolation of the GG2 Act protein was performed by Nkx2.2 Cons. M5 element-based affinity chromatography using an oligonucleotide trapping strategy (8, 44). In this method, a large scale gel shift binding reaction was performed in the presence of an Nkx2.2 Cons. M5 probe containing a single-stranded (TG)5 tail on the 3'-end of one strand. To retain GG2 Act binding, the reaction was applied to a column containing Sepharose 4B cross-linked to a single-stranded (AC)5 sequence complimentary to the (TG)5 overhang of the probe. During column chromatography, the complimentary tails anneal, thus retaining the Nkx2.2 Cons. M5 probe and the GG2 Act protein(s). Binding complexes were eluted with a linear salt gradient, and GG2 Act binding activity was tracked by gel shift analysis. Following an initial Sepharose 4B column step performed in the absence of DNA probe, two successive affinity steps yielded a highly purified 38-40-kDa GG2 Act binding fraction with an overall purification of ~5,000-fold (data not shown).

Gel shift analysis performed with human insulin GG2 and Nkx2.2 consensus competitors revealed that the affinity-purified fraction displayed the specificity of GG2 Act (Fig. 7). This fraction was subjected to SDS-PAGE, and the protein identity of the 38-40-kDa band was determined by MALDI-TOF and MALDI-TOF tandem mass spectrometry analysis. Tryptic peptides corresponding to the {beta} cell-enriched PDX-1 protein were uniquely found in the sample.



View larger version (51K):
[in this window]
[in a new window]
  		FIG. 7.
Binding specificity of affinity-purified GG2 Act. Binding assays were performed with the WT human GG2 probe using the purified GG2 Act fraction obtained from Nkx2.2 consensus M5 affinity column purification. A 50- and 100-fold excess of the listed competitors was used. The asterisk indicates nonspecific binding.

 
PDX-1 Is the {beta} Cell-enriched Human GG2 Binding Factor—To directly test whether GG2 Act was composed of PDX-1, gel shift analysis using crude {beta}TC-3 nuclear extract and affinity-purified GG2 Act binding activity were conducted with bona fide PDX-1 binding site competitors (human insulin A1 and A3) as well as PDX-1 antiserum (Fig. 8A). Both A1 and A3 competed more effectively for GG2 Act binding than did human insulin GG2, while rat insulin GG2 did not compete (Fig. 8B). Furthermore the addition of PDX-1 antiserum specifically prevented formation of the GG2 Act complex, while the Nkx2.2 antibody had no effect (Fig. 8B). Western blot analysis also revealed that PDX-1 co-eluted with GG2 Act binding activity throughout the purification (data not shown). Based upon these results, we conclude that PDX-1 is the human insulin GG2 activator.



View larger version (42K):
[in this window]
[in a new window]
  		FIG. 8.
Human GG2 represents a novel site for PDX-1 regulation. A, comparison of human GG2 to human Ins A1 (-75/-83 bp) and human Ins A3 (-207/-216 bp) sequences. The proposed PDX-1 binding site consensus (55) is also shown with the boxed region containing the TAAT core sequence important in homeodomain binding. B, binding assays were performed with the WT human GG2 probe and either {beta}TC-3 nuclear extract or affinity-purified GG2 Act. The reactions were performed in the presence of PDX-1 antiserum ({alpha}PDX-1), Nkx2.2 antiserum ({alpha}Nkx2.2), or a 50-fold excess of listed competitors. The asterisk denotes nonspecific binding.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Islet {beta} cell-selective and glucose-mediated expression of the insulin gene is mediated by sequences within 350 bp of the transcription start site (1, 2). This region is also the principal area of conservation between mammalian insulin genes with human displaying roughly 60% identity to rodent (3) and greater than 90% identity to other primates (45). The functional characterization of this control region has almost exclusively been performed on the rat insulin genes wherein the islet-enriched PDX-1, BETA-2, and MafA transcription factors have been shown to be essential for control (46, 47). Each of these activator binding sites is also found in the other mammalian genes, suggesting their mechanism of action is critical to proper insulin gene expression. In this study, we defined the basis for regulation of the human insulin GG2 element. Our results revealed that PDX-1 stimulates human GG2-driven activity using sequences dissimilar from the TAAT core motif commonly associated with binding of this important islet activator.

The distinct regulatory properties of human GG2 was revealed upon examination of the functional consequence of mutating the 2 base pairs divergent with the rat site. This analysis showed that bp -144 mutations resulted in a gain of human insulin enhancer-driven reporter activity in {beta} cell lines, while bp -141 mutations reduced expression to GG2 block mutant levels (Fig. 1). As these mutants had identical binding properties to a human islet and a {beta} cell-enriched complex in gel mobility shift assays (Fig. 3), we concluded that the activator (termed GG2 Act) regulated human GG2-mediated expression in {beta} cells. These results also revealed a regulatory distinction between the human and rodent insulin genes as Nkx2.2 acts as a repressor of the corresponding rat and mouse GG2 sequences. Interestingly the GG2 sequence found in the human gene is conserved in many other mammalian genes (e.g. gorilla, chimpanzee, dog, and guinea pig (3, 45)), while only rat and mouse appear capable of binding Nkx2.2 (25).

PDX-1 was associated with GG2 Act after DNA affinity chromatography and mass spectroscopic analysis and was confirmed as the activator by antibody and DNA binding competition analysis. This finding was surprising considering the apparent differences between PDX-1 and GG2 Act in regard to SDS-PAGE-estimated molecular mass (i.e. 46 kDa (6, 48) versus 38-40 kDa (Fig. 4)) and binding properties (CTAATG (PDX-1) versus GAAATG (Fig. 8A)), although PDX-1 has the same {beta}-cell-enriched distribution pattern (4, 5, 33, 49). It is unclear why our molecular weight estimation of PDX-1 is different from previous measurements since only a single PDX-1-immunoreactive band was found in {beta}TC-3 cell extracts by Western analysis (data not shown). PDX-1 also binds to enhancer region sequences of the insulin gene in vivo (25, 50), although a limitation of the chromatin immunoprecipitation assay used for these purposes is the inability to distinguish the occupancy of one site over another (A1 or A3) within a relatively small control region (i.e. ~500 bp).

A modified Nkx2.2 consensus element was used during the purification of GG2 Act as the wild type consensus sequence bound even more effectively than the high affinity GG2 -144 mut. The Nkx2.2 consensus sequence (T(T/C)AAGT(A/G)(C/G)TT) was defined using a PCR-based binding site selection method with a truncated Nkx2.2 protein containing the homeodomain and NK2-specific domain (43). Interestingly the Nkx2.2 central core sequence T(T/C)AAG is quite distinct from the TAAT core of home-odomain proteins, yet PDX-1 binds with comparable efficacy to the A1 and A3 sites of insulin (Fig. 8 and data not shown). In contrast, human GG2 is a noticeably weaker binding site for PDX-1 than either the A1 or A3 sites of the insulin gene (Fig. 8B). Despite this, inactivating GG2 mutants had a similar compromising effect on human insulin enhancer-driven reporter activity to dysfunctional A3 (6), C1 (MafA (37, 39)), and E1 (BETA-2 (37)) site mutants.

The ability of GG2 to function as an activator site in human insulin suggests that this gene is transcribed at higher levels, or at least regulated distinctly, from rat or mouse. The observed concomitant increase in both insulin-enhancer driven and gel shift binding activity in the human -144 mutant also supports this proposal (Figs. 1 and 2). However, it is not possible to readily address this question due not only to sequence differences between rodent and humans within the insulin enhancer region but also to differences between the two non-allelic rat and mouse genes (termed I and II (51)). For example, the islet-enriched BETA-2 protein activates the E2 (-232/-220 bp) element of the rodent I gene but not II (41, 46, 52), while the ubiquitous upstream stimulatory factor protein regulates the human gene (53). Dissimilarities also exist in the organization of the MafA control sites between the human and rat insulin genes (54). Such observations indicate that a concerted effort to identify the regulatory factors of the human gene could provide unique insight into the mechanisms involved in regulating insulin expression under normal and diabetic conditions.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grant RO1 DK50203 (to R. S.), Juvenile Diabetes Research Foundation International Grants 12002775 (to R. S.) and 32001678 (to T.-A. M.), and partial support from the Vanderbilt University Diabetes Research and Training Center Molecular Biology Core Laboratory (Public Health Service Grant P60 DK20593 from the National Institutes of Health). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} Present address: Dept. of Internal Medicine and Therapeutics, Osaka University Graduate School of Medicine, Suita City, Osaka, Japan 565-0871. Back

§ To whom correspondence should be addressed: Dept. of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, 723 Light Hall, Nashville, TN 37215. Tel.: 615-322-7026; Fax: 615-322-7236; E-mail: roland.stein{at}mcmail.vanderbilt.edu.

1 The abbreviations used are: Luc, luciferase; WT, wild type; BHK, baby hamster kidney; TK, thymidine kinase; hum, human; mut, mutant; Ins, insulin; MALDI, matrix-assisted laser desorption/ionization; TOF, time-of-flight; Act, activator; Cons., consensus. Back


   ACKNOWLEDGMENTS
 
We are most grateful to Dr. Kevin Docherty and Dr. Harry Jarrett for helpful comments and criticism and to Dr. David Friedman for technical help in the Vanderbilt University Proteomics Laboratory.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Fromont-Racine, M., Bucchini, D., Madsen, O., Desbois, P., Linde, S., Nielsen, J. H., Saulnier, C., Ripoche, M. A., Jami, J., and Pictet, R. (1990) Mol. Endocrinol. 4, 669-677[Abstract]
  2. Dandoy-Dron, F., Monthioux, E., Jami, J., and Bucchini, D. (1991) Nucleic Acids Res. 19, 4925-4930[Abstract/Free Full Text]
  3. Steiner, D. F., Chan, S. J., Welsh, J. M., and Kwok, S. C. (1985) Annu. Rev. Genet. 19, 463-484[CrossRef][Medline] [Order article via Infotrieve]
  4. Ohlsson, H., Karlsson, K., and Edlund, T. (1993) EMBO J. 12, 4251-4259[Medline] [Order article via Infotrieve]
  5. Peshavaria, M., Gamer, L., Henderson, E., Teitelman, G., Wright, C. V., and Stein, R. (1994) Mol. Endocrinol. 8, 806-816[Abstract]
  6. Petersen, H. V., Serup, P., Leonard, J., Michelsen, B. K., and Madsen, O. D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10465-10469[Abstract/Free Full Text]
  7. Kataoka, K., Han, S. I., Shioda, S., Hirai, M., Nishizawa, M., and Handa, H. (2002) J. Biol. Chem. 277, 49903-49910[Abstract/Free Full Text]
  8. Matsuoka, T. A., Zhao, L., Artner, I., Jarrett, H. W., Friedman, D., Means, A., and Stein, R. (2003) Mol. Cell. Biol. 23, 6049-6062[Abstract/Free Full Text]
  9. Olbrot, M., Rud, J., Moss, L. G., and Sharma, A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 6737-6742[Abstract/Free Full Text]
  10. Naya, F. J., Stellrecht, C. M., and Tsai, M. J. (1995) Genes Dev. 9, 1009-1019[Abstract/Free Full Text]
  11. Schwitzgebel, V. M. (2001) Mol. Cell. Endocrinol. 185, 99-108[CrossRef][Medline] [Order article via Infotrieve]
  12. Edlund, H. (2002) Nat. Rev. Genet. 3, 524-532[CrossRef][Medline] [Order article via Infotrieve]
  13. Stoffers, D. A., Zinkin, N. T., Stanojevic, V., Clarke, W. L., and Habener, J. F. (1997) Nat. Genet. 15, 106-110[CrossRef][Medline] [Order article via Infotrieve]
  14. Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein, R. W., Magnuson, M. A., Hogan, B. L., and Wright, C. V. (1996) Development 122, 983-995[Abstract]
  15. Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H. (1994) Nature 371, 606-609[CrossRef][Medline] [Order article via Infotrieve]
  16. Naya, F. J., Huang, H. P., Qiu, Y., Mutoh, H., DeMayo, F. J., Leiter, A. B., and Tsai, M. J. (1997) Genes Dev. 11, 2323-2334[Abstract/Free Full Text]
  17. Sander, M., Neubuser, A., Kalamaras, J., Ee, H. C., Martin, G. R., and German, M. S. (1997) Genes Dev. 11, 1662-1673[Abstract/Free Full Text]
  18. St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A., and Gruss, P. (1997) Nature 387, 406-409[CrossRef][Medline] [Order article via Infotrieve]
  19. Malecki, M. T., Jhala, U. S., Antonellis, A., Fields, L., Doria, A., Orban, T., Saad, M., Warram, J. H., Montminy, M., and Krolewski, A. S. (1999) Nat. Genet. 23, 323-328[CrossRef][Medline] [Order article via Infotrieve]
  20. Stoffers, D. A., Ferrer, J., Clarke, W. L., and Habener, J. F. (1997) Nat. Genet. 17, 138-139[CrossRef][Medline] [Order article via Infotrieve]
  21. Yasuda, T., Kajimoto, Y., Fujitani, Y., Watada, H., Yamamoto, S., Watarai, T., Umayahara, Y., Matsuhisa, M., Gorogawa, S., Kuwayama, Y., Tano, Y., Yamasaki, Y., and Hori, M. (2002) Diabetes 51, 224-230[Abstract/Free Full Text]
  22. Moates, J. M., Nanda, S., Cissell, M. A., Tsai, M. J., and Stein, R. (2003) Diabetes 52, 403-408[Abstract/Free Full Text]
  23. Watada, H., Kajimoto, Y., Umayahara, Y., Matsuoka, T., Kaneto, H., Fujitani, Y., Kamada, T., Kawamori, R., and Yamasaki, Y. (1996) Diabetes 45, 1478-1488[Abstract]
  24. Watada, H., Kajimoto, Y., Miyagawa, J., Hanafusa, T., Hamaguchi, K., Matsuoka, T., Yamamoto, K., Matsuzawa, Y., Kawamori, R., and Yamasaki, Y. (1996) Diabetes 45, 1826-1831[Abstract]
  25. Cissell, M. A., Zhao, L., Sussel, L., Henderson, E., and Stein, R. (2003) J. Biol. Chem. 278, 751-756[Abstract/Free Full Text]
  26. Bretherton-Watt, D., Gore, N., and Boam, D. S. (1996) Biochem. J. 313, 495-502[Medline] [Order article via Infotrieve]
  27. Carty, M. D., Lillquist, J. S., Peshavaria, M., Stein, R., and Soeller, W. C. (1997) J. Biol. Chem. 272, 11986-11993[Abstract/Free Full Text]
  28. Serup, P., Jensen, J., Andersen, F. G., Jorgensen, M. C., Blume, N., Holst, J. J., and Madsen, O. D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9015-9020[Abstract/Free Full Text]
  29. Watada, H., Kajimoto, Y., Kaneto, H., Matsuoka, T., Fujitani, Y., Miyazaki, J., and Yamasaki, Y. (1996) Biochem. Biophys. Res. Commun. 229, 746-751[CrossRef][Medline] [Order article via Infotrieve]
  30. Waeber, G., Thompson, N., Nicod, P., and Bonny, C. (1996) Mol. Endocrinol. 10, 1327-1334[Abstract]
  31. Dumonteil, E., Laser, B., Constant, I., and Philippe, J. (1998) J. Biol. Chem. 273, 19945-19954[Abstract/Free Full Text]
  32. Ritz-Laser, B., Estreicher, A., Klages, N., Saule, S., and Philippe, J. (1999) J. Biol. Chem. 274, 4124-4132[Abstract/Free Full Text]
  33. Leonard, J., Peers, B., Johnson, T., Ferreri, K., Lee, S., and Montminy, M. R. (1993) Mol. Endocrinol. 7, 1275-1283[Abstract]
  34. Tomonari, A., Yoshimoto, K., Mizusawa, N., Iwahana, H., and Itakura, M. (1999) Biochim. Biophys. Acta 1446, 233-242[Medline] [Order article via Infotrieve]
  35. Tomonari, A., Yoshimoto, K., Tanaka, M., Iwahana, H., Miyazaki, J., and Itakura, M. (1996) Diabetologia 39, 1462-1468[CrossRef][Medline] [Order article via Infotrieve]
  36. Boam, D. S., Clark, A. R., and Docherty, K. (1990) J. Biol. Chem. 265, 8285-8296[Abstract/Free Full Text]
  37. Sharma, A., Fusco-DeMane, D., Henderson, E., Efrat, S., and Stein, R. (1995) Mol. Endocrinol. 9, 1468-1476[Abstract]
  38. Sharma, A., and Stein, R. (1994) Mol. Cell. Biol. 14, 871-879[Abstract/Free Full Text]
  39. Zhao, L., Cissell, M. A., Henderson, E., Colbran, R., and Stein, R. (2000) J. Biol. Chem. 275, 10532-10537[Abstract/Free Full Text]
  40. Schreiber, E., Matthias, P., Muller, M. M., and Schaffner, W. (1989) Nucleic Acids Res. 17, 6419[Free Full Text]
  41. German, M. S., Wang, J., Chadwick, R. B., and Rutter, W. J. (1992) Genes Dev. 6, 2165-2176[Abstract/Free Full Text]
  42. Samaras, S. E., Cissell, M. A., Gerrish, K., Wright, C. V., Gannon, M., and Stein, R. (2002) Mol. Cell. Biol. 22, 4702-4713[Abstract/Free Full Text]
  43. Watada, H., Mirmira, R. G., Kalamaras, J., and German, M. S. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 9443-9448[Abstract/Free Full Text]
  44. Gadgil, H., and Jarrett, H. W. (2002) J. Chromatogr. A 966, 99-110[CrossRef][Medline] [Order article via Infotrieve]
  45. Stead, J. D., Hurles, M. E., and Jeffreys, A. J. (2003) Genome Res. 13, 2101-2111[Abstract/Free Full Text]
  46. Ohneda, K., Ee, H., and German, M. (2000) Semin. Cell Dev. Biol. 11, 227-233[CrossRef][Medline] [Order article via Infotrieve]
  47. Stein, R. (2001) in Handbook of Physiology Section 7: The Endocrine System (Jefferson, L. S., Cherrington, A. D., and Goodman, H. M., eds) Vol. 2, pp. 25-47, Oxford University Press, New York
  48. Marshak, S., Totary, H., Cerasi, E., and Melloul, D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 15057-15062[Abstract/Free Full Text]
  49. Miller, C. P., McGehee, R. E., Jr., and Habener, J. F. (1994) EMBO J. 13, 1145-1156[Medline] [Order article via Infotrieve]
  50. Chakrabarti, S. K., James, J. C., and Mirmira, R. G. (2002) J. Biol. Chem. 277, 13286-13293[Abstract/Free Full Text]
  51. Soares, M. B., Schon, E., Henderson, A., Karathanasis, S. K., Cate, R., Zeitlin, S., Chirgwin, J., and Efstratiadis, A. (1985) Mol. Cell. Biol. 5, 2090-2103[Abstract/Free Full Text]
  52. Melloul, D., Marshak, S., and Cerasi, E. (2002) Diabetologia 45, 309-326[CrossRef][Medline] [Order article via Infotrieve]
  53. Read, M. L., Clark, A. R., and Docherty, K. (1993) Biochem. J. 295, 233-237[Medline] [Order article via Infotrieve]
  54. Matsuoka, T. A., Artner, I., Henderson, E., Means, A., Sander, M., and Stein, R. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 2930-2933[Abstract/Free Full Text]
  55. Liberzon, A., Ridner, G., and Walker, M. D. (2004) Nucleic Acids Res. 32, 54-64[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
S.-i. Han, S. Aramata, K. Yasuda, and K. Kataoka
MafA Stability in Pancreatic {beta} Cells Is Regulated by Glucose and Is Dependent on Its Constitutive Phosphorylation at Multiple Sites by Glycogen Synthase Kinase 3
Mol. Cell. Biol., October 1, 2007; 27(19): 6593 - 6605.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
C. Evans-Molina, J. C. Garmey, R. Ketchum, K. L. Brayman, S. Deng, and R. G. Mirmira
Glucose Regulation of Insulin Gene Transcription and Pre-mRNA Processing in Human Islets
Diabetes, March 1, 2007; 56(3): 827 - 835.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
C. W. Hay and K. Docherty
Comparative Analysis of Insulin Gene Promoters: Implications for Diabetes Research
Diabetes, December 1, 2006; 55(12): 3201 - 3213.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
J. C. Raum, K. Gerrish, I. Artner, E. Henderson, M. Guo, L. Sussel, J. C. Schisler, C. B. Newgard, and R. Stein
FoxA2, Nkx2.2, and PDX-1 Regulate Islet {beta}-Cell-Specific mafA Expression through Conserved Sequences Located between Base Pairs -8118 and -7750 Upstream from the Transcription Start Site
Mol. Cell. Biol., August 1, 2006; 26(15): 5735 - 5743.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
J. Le Lay and R. Stein
Involvement of PDX-1 in activation of human insulin gene transcription
J. Endocrinol., February 1, 2006; 188(2): 287 - 294.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
Y. Nakano, H. Furuta, A. Doi, S. Matsuno, T. Nakagawa, H. Shimomura, S. Sakagashira, Y. Horikawa, M. Nishi, H. Sasaki, et al.
A Functional Variant in the Human Betacellulin Gene Promoter Is Associated With Type 2 Diabetes
Diabetes, December 1, 2005; 54(12): 3560 - 3566.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Iguchi, Y. Ikeda, M. Okamura, T. Tanaka, Y. Urashima, H. Ohguchi, S. Takayasu, N. Kojima, S. Iwasaki, R. Ohashi, et al.
SOX6 Attenuates Glucose-stimulated Insulin Secretion by Repressing PDX1 Transcriptional Actvity and Is Down-regulated in Hyperinsulinemic Obese Mice
J. Biol. Chem., November 11, 2005; 280(45): 37669 - 37680.
[Abstract] [Full Text] [PDF]