Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M401522200 on April 1, 2004

J. Biol. Chem., Vol. 279, Issue 21, 22578-22584, May 21, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/21/22578    most recent
M401522200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Varga, K.
Right arrow Articles by Bebök, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Varga, K.
Right arrow Articles by Bebök, Z.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Efficient Intracellular Processing of the Endogenous Cystic Fibrosis Transmembrane Conductance Regulator in Epithelial Cell Lines*

Károly Varga{ddagger}§, Asta Jurkuvenaite{ddagger}§, John Wakefield¶, Jeong S. Hong{ddagger}§, Jennifer S. Guimbellot§||, Charles J. Venglarik§, Ashutosh Niraj{ddagger}, Marina Mazur§, Eric J. Sorscher§**, James F. Collawn{ddagger}§{ddagger}{ddagger}, and Zsuzsa Bebök{ddagger}§{ddagger}{ddagger}§§

From the Departments of {ddagger}Cell Biology, **Medicine, ||Genetics and §Gregory Fleming James Cystic Fibrosis Research Center, University of Alabama at Birmingham, Birmingham, Alabama 35294 and the Tranzyme Corporation, Birmingham, Alabama 35209

Received for publication, February 11, 2004 , and in revised form, March 22, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The cystic fibrosis transmembrane conductance regulator (CFTR) is a cAMP-dependent protein kinase A-activated chloride channel that resides on the apical surface of epithelial cells. One unusual feature of this protein is that during biogenesis, ~75% of wild type CFTR is degraded by the endoplasmic reticulum (ER)-associated degradative (ERAD) pathway. Examining the biogenesis and structural instability of the molecule has been technically challenging due to the limited amount of CFTR expressed in epithelia. Consequently, investigators have employed heterologous overexpression systems. Based on recent results that epithelial specific factors regulate both CFTR biogenesis and function, we hypothesized that CFTR biogenesis in endogenous CFTR expressing epithelial cells may be more efficient. To test this, we compared CFTR biogenesis in two epithelial cell lines endogenously expressing CFTR (Calu-3 and T84) with two heterologous expression systems (COS-7 and HeLa). Consistent with previous reports, 20 and 35% of the newly synthesized CFTR were converted to maturely glycosylated CFTR in COS-7 and HeLa cells, respectively. In contrast, CFTR maturation was virtually 100% efficient in Calu-3 and T84 cells. Furthermore, inhibition of the proteasome had no effect on CFTR biogenesis in Calu-3 cells, whereas it stabilized the immature form of CFTR in HeLa cells. Quantitative reverse transcriptase-PCR indicated that CFTR message levels are ~4-fold lower in Calu-3 than HeLa cells, yet steady-state protein levels are comparable. Our results question the structural instability model of wild type CFTR and indicate that epithelial cells endogenously expressing CFTR efficiently process this protein to post-Golgi compartments.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Newly synthesized proteins entering the secretory pathway are carefully monitored by the ER1 quality control machinery to ensure that only correctly folded molecules exit and continue their journey to the cell surface. Misfolded membrane and secretory proteins are promptly recognized as such and degraded by the ER-associated degradation pathway (ERAD; reviewed in (1, 2). Understanding this process is critical, since a number of diseases, including cystic fibrosis, congenital hypothyrosis, and familial hypercholesterolemia are caused by protein folding defects that often arise from missense or deletion mutations (3, 4). Despite the fact that many of these mutations result in the production of proteins that retain some biological activity, they are rapidly degraded by ERAD, preventing proper targeting of the proteins to their biologically relevant destinations (reviewed in Ref. 5).

Interestingly, inefficient protein biogenesis appears to occur even for "wild type" proteins, with a number of examples that include the epithelial sodium channels (6), Shaker-type potassium channels (7), major histocompatibility complex class II molecules (8), the {delta} opioid receptor (9, 10), the erythropoietin receptor (11), the erythrocyte anion exchanger 1 (Band 3) (12), and CFTR (13). Many of these proteins, including CFTR, are assembled in the cell membrane as part of a multiprotein complex (14, 15), suggesting that the molecular rationing of the components in these complexes might be regulated during biogenesis.

CFTR is a large transmembrane glycoprotein consisting of two homologous halves, each containing six transmembrane segments (TMD1 and TMD2) and a nucleotide-binding domain (NBD1 and NBD2), that are connected by a regulatory domain (16). The 1480-amino acid protein is a member of the traffic ATPase or ATP binding cassette (ABC) transporter family (17) and functions as a cAMP-regulated Cl- channel (18, 19) that regulates other ion conductive pathways including epithelial Cl-, Na+, and ATP transport (20-22). The most common mutation in CFTR, {Delta}F508, results in the production of a protein that fails to exit the ER (13) and is rapidly degraded by ERAD (23-25). Interestingly, even the wild type protein is substrate for ERAD, with as much as 75% being degraded by the proteasome during biogenesis (13, 24, 25). Since only a small fraction of newly synthesized wild type CFTR reaches the cell surface where it performs its biological function, the question has often arisen as to why CFTR biogenesis so inefficient. A study by Tector and Hartl (26) suggested the possibility that transmembrane segment 6 in TMD1 is unstable due to 3 charged residues within this domain. Substitution of these residues with non-charged amino acids resulted in an increase in protein stability but a loss of chloride transport (26), suggesting that protein stability had been compromised for biological function. This hypothesis has not been evaluated in cells endogenously expressing CFTR.

It has been suggested that an appropriate cellular context may be necessary to support proper membrane protein trafficking (reviewed in Refs. 27 and 28). In addition, it is possible that altered protein trafficking may result from the use of overexpression systems or non-physiological experimental conditions (reviewed in Bertrand et al. (28)). Given that the initial studies of CFTR biogenesis were performed primarily in transfected, heterologous overexpression systems, a careful analysis of endogenous CFTR biogenesis both in the early (ER) and post-Golgi pathways is warranted. Heterologous systems may lack CFTR binding partners such as EBP50, syntaxin 1A, and CAL (15, 29-33), and association of these and other proteins with CFTR may be required for proper maturation and/or trafficking.

In the present studies, we monitored the maturation efficiency of CFTR in two human epithelial cell lines that endogenously expresses CFTR, Calu-3 (34), and T84 cells (35). Metabolic pulse-chase analysis of CFTR in these cells grown under both nonpolarizing and polarizing conditions indicated that core glycosylated (Band B) CFTR is very efficiently (~100%) processed to a maturely glycosylated (Band C) protein that is extremely stable. Moreover, quantitative cell surface biotinylation assays revealed that the CFTR surface pool is substantially elevated in Calu-3 cells compared with heterologous expression systems. Thus, endogenous CFTR maturation differs fundamentally from the patterns reported in recombinant overexpression systems, and these differences extend across multiple cellular compartments. Our findings cast doubt upon the viewpoint that wild type CFTR protein maturation is inefficient.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Culture Conditions—COS-7, Calu-3, and T84 cells were obtained from the ATCC (www.atcc.org) and maintained in the Cystic Fibrosis Research Center at University of Alabama at Birmingham. HeLa cells overexpressing wild type CFTR were transduced and selected as previously described (36, 37), cultured in Dulbecco's modified Eagle's medium (Invitrogen) with 10% FBS at 37 °C in a humidified incubator in 5% CO2. For cell monolayers, Calu-3 cells were seeded on 6.5- or 12-mm diameter Transwell filters (Corning-Costar, Corning, NY). After 2-3 days, the medium containing 10% FBS was exchanged to 2% FBS containing media, and cells were cultured for an additional 7-9 days with liquid both at the apical and the basolateral compartments. Under these conditions, the cells formed monolayers with trans-epithelial resistances of >800 {Omega}·cm2.

Transient Transfection of COS-7 Cells—COS-7 cells were transiently transfected using LipofectAMINE PLUS reagent (Invitrogen) according to the manufacturer's protocol. Transfected cells were cultured for 24-48 h before analysis as described previously (38).

Immunoprecipitation of CFTR—CFTR was immunoprecipitated using the 24-1 anti-C-terminal antibody (ATCC number HB-11947) (38) and phosphorylated with [{gamma}-32P]ATP (PerkinElmer Life Sciences) and cAMP-dependent protein kinase (Promega). Labeled CFTR was analyzed by SDS-PAGE and autoradiography as described previously (39).

Metabolic Pulse-Chase—One hour before addition of radiolabeled amino acids, the tissue culture medium was replaced with methionine/cysteine-free minimal essential medium. After 1 h of methionine starvation at 37 °C, 300 µCi/ml EasyTag Protein Labeling Mixture ([35S]methionine/cysteine, PerkinElmer Life Sciences) was added, and cells were pulse-labeled for 30 min (for the maturation studies) or 60 min (for protein half-life analysis). The radioactive medium was then exchanged with cold, complete medium and cultured for various chase periods. Cells were lysed at the time points indicated and CFTR was immunoprecipitated using the 24-1 monoclonal antibody and protein A+G-agarose (Roche Diagnostics). Immunoprecipitated samples were analyzed by SDS-PAGE (6% gels) and detected using autoradiography (PhosphorImager, Amersham Biosciences). Calculation of protein half-lives was performed as described by Straley et al. (1998) (40). Maturation efficiency was measured by comparing the density of the labeled Band B to the density of the fully glycosylated band C using IPLab software (Scanalytics, Inc.) as described previously (41).

Cell Surface Biotinylation—Cell surface glycoproteins were biotinylated as described previously (38). Total CFTR and biotinylated CFTR was immunoprecipitated and in vitro phosphorylated using [{gamma}-32P]ATP (PerkinElmer Life Sciences) and PKA catalytic subunit (Promega), separated by SDS-PAGE, and detected using autoradiography and PhorphorImager analysis as described previously (38). Biotinylation efficiency was tested by comparing transferrin receptor 125I binding assay with the biotinylated fraction of the transferrin receptor. The efficiency of the cell surface biotinylation in the experiments presented was 75 ± 4%.

Semiquantitative RT-PCR—Total RNA was isolated from each filter using RNeasy mini kit (Qiagen). RNA concentration was calculated based on the absorbance of samples at 260 nm. One tube from the RT-PCR kit (Qiagen) was used to amplify the CFTR mRNA using 1 ng of total RNA as templates. The primers were designed to anneal to two different exons (exon 10 and exon 11) to prevent possible amplification from genomic DNA and pre-mRNA. The sequences of the primers were 5' ACTTCACTTCTAATGATGAT 3'(exon-10F1) and 5' AAAACATCTAGGTATCCAA 3'(exon-11R). Two primers specific for GAPDH were used as controls for each sample (42). RT-PCR was performed as instructed by manufacturer. The number of PCR cycles for this experiment was experimentally determined (28 cycles) to allow semiquantification of PCR products during the log-linear phase of amplification. RNA samples isolated from CFTR-negative HeLa cells were used as control to assure the specificity of the PCR product. The specificity of the GAPDH primers were previously tested (42). Controls with no template or reverse transcriptase were also included. Experiments were repeated two times.

Fluorescence-based Kinetic Real-time PCR—Isolated RNA samples were also analyzed by fluorescence-based kinetic real-time PCR using the ABI PRISM 7900 Sequence Detection System as described previously for other genes (43). One-step RT-PCR was performed on serial dilutions of RNA isolates using Master Mix Reagent kit and Assay-on-Demand Gene Expression Probes (Applied Biosystems, CFTR Assay ID: HS00357011_m1). 6-Carboxylfluorescein was chosen as reporter dye at the 5'-end of the probe and minor groove binder as the quencher at the 3'-end. The 5' nuclease activity of Taq DNA polymerase cleaves the probe and generates a fluorescent signal proportional to the amount of starting target template. Each reporter signal is then divided by the fluorescence of an internal reference dye 5-carboxy-X-rhodamine, to normalize for non-PCR-related fluorescence. The TaqMan RT-PCR reaction was performed in a final volume of 20 µl containing 0.5 µl of RNA, 10 µl of TaqMan One-step RT-PCR master mix (Applied Biosystems), 0.5 µl of Multiscribe/RNase inhibitor, and 1 µl of 20x primer/probe set for CFTR and/or 18 S rRNA as endogenous control. Six 10-fold serial dilutions (100-10-6) of RNA samples isolated from the models cell lines were amplified in duplicates using CFTR and/or 18 S endogenous control. Data were exported from the ABI Prism 7900SDS software into Microsoft Excel where relative standard curves were plotted. Using the Excel Trendline option, a line of best fit was plotted. Data from each cell line were analyzed based on these standard curves and relative quantities were extrapolated. CFTR values were normalized to 18 S by dividing the CFTR values by the corresponding 18 S values from the same sample according to the Applied Biosystems relative quantification method. The specificity and quality of the primers is assured by ABI. Appropriate controls with no RNA, primers, or reverse transcriptase were included in each set of experiments.

Microscopy—Indirect immunofluorescence was performed as described previously (41).

Statistical Analysis—Results were expressed as means ± S.D. Statistical significance among means was determined using the Student's t test (two samples).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Calu-3 Cells Express High Levels of CFTR Compared with Heterologous Expression Systems—To compare CFTR biogenesis in heterologous versus endogenous expression systems, we first determined the relative amounts of CFTR in transiently transfected COS-7 cells, in HeLa cells stably expressing CFTR, and in cells that endogenously express CFTR, Calu-3 cells. COS-7 cells represent a common cell type that has been used extensively to study CFTR biogenesis (13, 38, 44), while HeLa (45) and Calu-3 cells (15, 41, 46, 47) were selected based on their stable, high expression levels of wild type CFTR.

To compare CFTR expression levels in the model cell lines, CFTR was immunoprecipitated from 250 µg of total cellular protein under standardized conditions. Relative amounts of CFTR expressed in each cell type were calculated based on densitometry and are shown in Fig. 1A. In COS-7 cells, CFTR expression levels are dependent upon transfection efficiency, while in HeLa and Calu-3 cells, the expression levels were consistently high. Since the relative expression level in Calu-3 cells was similar to HeLa cells stably expressing wild type CFTR, we selected Calu-3 cells for the initial analysis.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 1.
A, steady-state wild type CFTR protein level is high in Calu-3 cells. In transfected COS-7 cells, wild type CFTR expression levels were analyzed 48 h after transfection. HeLa cells stably expressing CFTR, and Calu-3 cells endogenously expressing the protein, were grown under standard conditions and tested at ~80% confluence. CFTR was immunoprecipitated from 250 µg of total protein from each cell type using an anti-CFTR C-terminal monoclonal antibody, 24-1. Immunoprecipitated CFTR was in vitro phosphorylated with protein kinase A and [{gamma}-32P]ATP and analyzed by SDS-PAGE and autoradiography. A representative gel of four is shown (upper panel). The relative amounts of wild type CFTR expressed in each of the cell lines were calculated based on densitometry (lower panel). The averages ± S.D. were calculated from four independent experiments. B, CFTR mRNA levels are significantly lower in Calu-3 cells than in HeLa cells. CFTR message levels in HeLa and Calu-3 cells were tested using semiquantitative RT-PCR using GAPDH as control (upper panel, representative gel is shown) and TaqMan quantitative PCR using 18 S rRNA as control (lower panel). Results are plotted as CFTR mRNA levels relative to 18 S rRNA, mean and S.D. of four separate samples amplified under the same condition. In contrast to slightly lower CFTR protein levels, CFTR message levels are ~4-fold higher in HeLa cells.

 
The simplest explanation for high CFTR levels both in HeLa and Calu-3 cells is that they have similar CFTR mRNA levels, protein synthetic rates, and stability. To compare CFTR mRNA levels in HeLa and Calu-3 cells, we developed a semiquantitative RT-PCR using GAPDH as an internal control. As shown in Fig. 1B, while GAPDH message levels are similar, CFTR message levels are significantly higher in HeLa cells than in Calu-3 (in contrast to rather similar protein levels (Fig. 1A)). To further assess these differences, we also performed TaqMan Quantitative PCR (Fig. 1C). The results of the real-time experiments establish that CFTR message levels in HeLa cells are 3.5-fold higher than in Calu-3 cells. These findings imply that the high steady-state levels of CFTR in Calu-3 cells must be due to increased translational rate, increased maturation efficiency, extended protein half-life, or some combination of these effects.

CFTR Maturation and Protein Stability Are Enhanced in Calu-3 Cells—To monitor CFTR maturation efficiency and protein half-life in Calu-3 cells and compare these values to previously reported results, we performed metabolic pulse-chase experiments and followed CFTR maturation in COS-7, HeLa, and Calu-3 cells. In these experiments, we compared the amount of the newly synthesized Band B CFTR and its conversion to the fully glycosylated Band C CFTR in each cell type. The results indicate that significantly more CFTR was synthesized in COS-7 and HeLa cells than in Calu-3 cells, as was first described by Cheng et al. (13). The conversion of the immaturely glycosylated CFTR to the maturely glycosylated form was extremely inefficient, with 27 ± 7.1% (mean ± S.D.; n = 7) maturation efficiency in COS-7 cells and 39 ± 5.1% (n = 11) in HeLa (Fig. 2A). In contrast, while the amount of the newly synthesized Band B form of CFTR was the lowest in Calu-3 cells, the maturation efficiency was 92.4 ± 8% (n = 11) after 4 h (Fig. 2B). These results indicate that although less CFTR was being produced in Calu-3 cells, the protein was processed much more efficiently to the mature form. Furthermore, comparing the total densities of Band B and Band C CFTR over the 4-h chase indicated that the total densities remain constant. This suggests that there is no early degradation, and all newly synthesized Band B is converted into Band C, and that the maturation only reaches maximum after 4 h of the pulse.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 2.
CFTR maturation is efficient in Calu-3 cells. COS-7, HeLa, and Calu-3 cells were pulse-labeled with 300 mCi/ml 35S-labeled amino acids (EasyTag Protein Labeling Mixture, PerkinElmer Life Sciences). After the pulse, the [35S]methionine/cysteine-containing medium was replaced with complete medium. Cells were lysed at the time points specified, and CFTR was immunoprecipitated with anti-CFTR 24-1 antibody. Samples were separated by SDS-PAGE on 6% gels and analyzed using a Phosphorimager (Amersham Biosciences). CFTR maturation efficiency was measured by comparing the density of labeled band B (100%) after a 30-min pulse to the density of Band C after 4 h of chase using IPLab software. A, average maturation efficiencies at the end of a 4-h chase in each cell line tested. Results are plotted as percent of newly synthesized Band B converted to Band C by the end of a 4-h chase (average + S.D., n = number of experiments). B, representative pulse-chase experiments are shown for each cell line (left panels). Arrows indicate the core (Band B) and fully glycosylated (Band C) CFTR. Average disappearance of Band B (maturation and/or degradation) and formation of Band C at each time point (right panels). Disappearance of Band B (diamonds) and formation of Band C (squares) were calculated based on densitometry at each chase time point. Results are plotted as percent of band B density at the 0 time point (average + S.D., n = 5).

 
To test whether increased CFTR maturation efficiency alone is responsible for high CFTR levels in Calu-3 cells, we determined the half-life of the fully glycosylated CFTR in each cell line. Using a more extended chase period in the metabolic labeling experiments, we found that CFTR half-lives were 10.8 ± 2.5 h (mean ± S.D.) in COS-7 cells, 12.3 ± 1.7 h in HeLa cells, and 22.0 ± 4.2 h in Calu-3 cells (Fig. 3). The results indicate that CFTR is more stable in Calu-3 cells compared with heterologous cells. Therefore, more efficient CFTR maturation and elongated protein half-lives contribute to the high steady state CFTR levels in these cells.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 3.
CFTR half-life is longer in Calu-3 cells compared with heterologous expression systems. In COS-7 cells, CFTR half-lives were tested 24 h after transfection and in HeLa and Calu-3 cells 24 h after seeding. After a 1-h pulse with [35S]methionine (EasyTag Protein Labeling Mixture) and the indicated chase periods in complete medium, the cells were lysed in radioimmune precipitation assay buffer and CFTR was immunoprecipitated and analyzed as described above. A, average CFTR half-lives were monitored by densitometry (n = number of experiments). Calculation of the protein half-lives was performed as described by Straley et al. (1998) (40). B, representative gels for CFTR half-life measurements are shown below for each of the cell types.

 
ERAD of CFTR Is Insignificant in Calu-3 Cells—Early degradation of wild type CFTR by the proteasome has been described as a common feature of CFTR biogenesis (23, 25, 48). Because CFTR maturation approaches 100% efficiency in Calu-3 cells, we hypothesized that the disappearance of Band B CFTR in these cells is clearly the result of maturation and not degradation by the proteasome. To test this possibility, we compared the effects of two proteasome inhibitors (ALLN (50 µM) (48) and clasto-lactacystin-{beta}-lactone (10 µM) (49)) on the half-lives of Band B CFTR in HeLa and Calu-3 cells. As shown in Fig. 4, while 50 µM ALLN caused a significant increase in the half-life of Band B CFTR in HeLa cells, it had no effect on the stability of the immature CFTR in Calu-3 cells, suggesting that the core-glycosylated protein is not a substrate for ERAD in Calu-3 cells. Similar results were seen when the proteasome was blocked using 10 µM clasto-lactacystin-{beta}-lactone (data not shown). These results support our hypothesis that in Calu-3 cells all newly synthesized, core-glycosylated CFTR is processed to the fully glycosylated form, and therefore, there is no role for the proteasome in the early events of CFTR processing in Calu-3 cells.



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 4.
Proteasome inhibition has no effect on CFTR processing in Calu-3 cells. Metabolic pulse-chase experiments were performed as described in the legend to Fig. 2 on Calu-3 and HeLa in the presence (+) or absence (-) of 50 µM ALLN. In the + samples, ALLN was present in the medium during the entire experiment. Representative gels are shown on the left, and the densities of Band B (triangle and diamond) and Band C (x and square) CFTR at each chase time point is plotted as percent of Band B at the 0 time point. ALLN treatment resulted in an increase of the half-life of Band B in HeLa cells only (top, right panel). A representative of two experiments is shown.

 
Cell Surface CFTR Expression Is Elevated in Calu-3 Cells—To test whether increased CFTR stability translates to a higher percentage of CFTR at the cell surface, we performed quantitative cell surface biotinylation experiments and compared the biotinylated and total pools of CFTR in each of the cell lines. The results shown in Fig. 5A indicate that the biotinylated CFTR pool in COS-7 cells was 11 ± 2.2% (mean ± S.D.), in HeLa was 9.7 ± 1.5%, and in Calu-3 was 20 ± 4.0%. Since Calu-3 cells were grown on plastic dishes under standard tissue culture conditions; we tested whether growing the cells on semipermeable supports as polarized monolayers affects CFTR surface expression. After growing the cells for 9-12 days on 12-mm filters, the cells formed tight monolayers as monitored by measuring transepithelial resistance (>800 {Omega}·cm2). Under these conditions, the biotinylated CFTR fraction was 17 ± 5%, similar to non-polarized cells. These results demonstrate that the surface CFTR pool in Calu-3 cells is higher, but cell polarity does not affect the relative surface pool.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 5.
CFTR distribution in COS-7, HeLa, and Calu-3 cells. A, the relative surface pools of CFTR expressed in COS-7, HeLa, and Calu-3 cells were determined using a surface biotinylation assay (38). In these assays, the total CFTR from 50% of the lysates (T) was compared with the biotinylated fraction (B). Cells were lysed in radioimmune precipitation assay buffer, and CFTR was immunoprecipitated using anti-CFTR C-terminal (24-1) monoclonal antibody. From the other 50% of the lysates, CFTR was immunoprecipitated as described above, eluted, and re-captured using avidin-Sepharose beads (biotinylated CFTR (B)). Total CFTR (T) and biotinylated CFTR (B) were in vitro phosphorylated with protein kinase A and [{gamma}-32P]ATP, separated by SDS-PAGE, and analyzed by Phosphorimaging and densitometry. Representative gels of seven or more experiments are shown. The average percentage of biotinylated CFTR for each cell type was calculated based on densitometry. B, CFTR distribution in Calu-3 monolayers. Calu-3 cells were grown on permeable supports and analyzed after 10-12 days of culture using indirect immunofluorescence. CFTR was labeled with 24-1 monoclonal antibody and anti-mouse IgG, Alexa-Fluor488 (green). Tight junctions were stained using a polyclonal (rabbit) anti-ZO1 antibody (Zymed Laboratories Inc.) and anti-rabbit IgG Alexa-Fluor596 (red). A side view and a top view at the apical membrane domain are shown. CFTR (green) is present at the apical membrane and also intracellularly. Tight junctions are well developed as represented by the organized red staining of ZO1. C, CFTR maturation efficiency in Calu-3 cells grown on filters. Calu-3 cells were grown on 12-mm filters and metabolically labeled, and CFTR maturation efficiency was monitored as described in the legend to Fig. 2. Conversion of the Band B to Band C was compared at each time points of the chase. Results are plotted as percent of Band B at the 30 min (highest density) chase time.

 
The fact that CFTR surface expression is not elevated in polarized cells was somewhat surprising, given that in HT29 cells, a colonic epithelial cell line, CFTR surface expression requires polarization of the colonocytes (50). To confirm that Calu-3 cells had formed polarized monolayers, we monitored the expression a ZO-1, a marker for tight junctions (red) (51), and CFTR (green) localization in the Calu-3 cells using immunocytochemistry (Fig. 5B). The results shown in Fig. 5B indicate that the Calu-3 cells have formed tight monolayers as evidenced by ZO-1 staining (red) close to the apical surface and that CFTR (green) is found both at the cell surface and in intracellular sites. Next, we tested whether the rate and efficiency of CFTR maturation was affected by cell polarity. The results shown in Fig. 5C confirm that similar to conventional tissue culture conditions (Fig. 2, A and B), CFTR maturation is also efficient under polarizing conditions (>90%). Interestingly, these experiments in Calu-3 monolayers suggested that the amount of radiolabeled CFTR dramatically decreased compared with non-polarized conditions and that rates of conversion of newly synthesized (Band B) CFTR to fully glycosylated (Band C) CFTR was slower than under standard conditions. Only ~30% of the newly synthesized (Band B) CFTR was converted into fully glycosylated (Band C) at 2 h, and maturation was completed only after 6 h of chase.

CFTR Maturation Is Efficient in T84 Cells Grown under Standard Tissue Culture Conditions—To determine whether efficient CFTR maturation is a special feature of Calu-3 cells or present in other endogenous CFTR expressing cell lines, we also tested T84 and HT29 colonic epithelial cell lines endogenously expressing wild type CFTR. Fig. 6A indicates that steady state CFTR protein levels are highest in Calu-3 cells. In T84 and HT29 cells, CFTR levels are 3- and >10-fold lower than in Calu-3, respectively (Fig. 6A). TaqMan RT-PCR measurements demonstrated that CFTR message levels in T84 cells are 4-fold and in HT29 are 10-fold lower than in Calu-3 cells grown under the same conditions (Fig. 6B). Because of low transcription and consequent low translation of CFTR in HT29 cells, only T84 cells synthesized sufficient amounts of the protein to effectively follow maturation efficiency. As shown in Fig. 6C, although CFTR synthetic levels were quite low and maturation efficiency in the early chase periods was variable, by the end of the 4th h into the chase, the maturation of the newly synthesized protein was virtually 100% in T84 cells. These results indicate that efficient processing of endogenous wild type CFTR is not a unique feature of Calu-3 cells but also exists in a colonic epithelial cell line.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 6.
CFTR expression and maturation in T84 cells. CFTR protein (A) and mRNA levels (B) were compared in Calu-3, T84, and HT29 cells as described under "Materials and Methods." CFTR maturation efficiency was monitored in T84 cells as described in the legend to Fig. 2 (C). A representative gel (n = 3) is shown (C, left panel). The relative amount of fully glycosylated CFTR (Band C, squares) and core glycosylated CFTR (Band B, diamonds) is plotted as percent of the immature Band B after the pulse (right panel).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
To our knowledge, the experiments shown here represent the first complete analysis of wild type CFTR biogenesis in human epithelial cell lines endogenously expressing the protein and highlight the following important points. First, in contrast to heterologous CFTR-expressing cell lines, CFTR maturation is efficient in Calu-3 and T84 cells. Second, the mature CFTR is very stable and a large portion of it is intracellular. Third, since CFTR biogenesis is efficient, ERAD plays no role in the degradation of the wild type protein. And finally, although CFTR message levels are low in Calu-3 cells compared with transduced cells, the steady-state protein levels are comparable with heterologous expression systems, suggesting that CFTR biogenesis and protein stability are not faithfully reproduced in the heterologous systems. These studies indicate that detailed analysis of endogenous CFTR expressing cell lines is warranted.

Initial studies of CFTR biogenesis described complete and early degradation of the {Delta}F508 CFTR and inefficient maturation of the wild type protein (13, 24, 52). Most of these studies employed heterologous overexpression systems, with one exception (24). Kopito and colleagues (24) compared wild type CFTR maturation efficiency in stable HEK cells to HT29 and T84 cells endogenously expressing wild type CFTR. In these cells, CFTR expression levels were 10-50-fold lower than in HEK, but the maturation efficiency of CFTR was only ~25% after 2 h of chase. In our studies, CFTR maturation in Calu-3 and T84 cells reached the maximum (~100%) only after 4 h. Analysis of CFTR maturation efficiency in COS-7 and HeLa cells suggested that there was no significant increase in Band C levels between the 2- and 4-h chase periods, whereas in Calu-3 cells and T84 cells CFTR maturation was only completed by the end of the 4th h. This slower CFTR processing noted in endogenously expressing cells was even more pronounced in Calu-3 cells grown as polarized monolayers. As a comparison with other cell lines, we found that CFTR mRNA and protein levels were 4- and 10-fold higher in Calu-3 cells than in T84 and HT29 cells. While we were not able to follow the maturation of the protein in HT29 cells, analysis in T84 revealed that CFTR maturation was very efficient and only complete by the end of a 4-h chase.

A more rapid disappearance of Band B CFTR in T84 and HT29 than in HEK cells was also described and attributed only to degradation (24). However, those experiments were completed before the role of the proteasome in early CFTR degradation was described or before protein overexpression was shown to overload the proteasome. Subsequently, it has been demonstrated that either the inhibition of the proteasome (25, 48) or protein overproduction (53) could result in delayed degradation. Therefore, it is now clear that disappearance of Band B could be due to both degradation and maturation. In our studies, proteasome blockade revealed that in Calu-3 cells disappearance of band B was not due to proteasomal degradation, whereas in HeLa cells it partially was.

The increased half-life of the mature CFTR in Calu-3 cells suggests that epithelial factors stabilize CFTR. This finding is supported by studies showing that CFTR half-life in heterologous systems is 8-12 h (38, 52), whereas in LLC-PK1 (54) and in MDCK cells (55), two kidney epithelial cells stably expressing the wild type CFTR, the half-life is significantly longer when the cells are grown under polarized conditions. Increased stability of the mature wild type CFTR in epithelial cells is also consistent with our previous findings that growing MDCK cells as polarized monolayers results in increased steady-state CFTR levels and function. Furthermore, possible cell type-specific differences in wild type CFTR biogenesis and stability are suggested by our findings that cellular polarization in Calu-3 cells did not have a significant effect on total and cell surface CFTR levels in contrast to our previous findings in MDCK cells (56).

Both morphological and cell surface biotinylation studies indicate the existence of a large intracellular CFTR pool in Calu-3 cells. The dynamics and precise cellular localization of this pool remain unclear, but several studies (44, 57-61) have indicated that CFTR is found in endosomal and recycling endosomal compartments. How regulation of surface localized CFTR is accomplished in polarized epithelia and whether there is a physiological role for the intracellular pool remain open questions.

The factors that allow efficient CFTR maturation as well as those that are responsible for stabilizing the mature protein in Calu-3 and T84 cells have not been identified. However, dramatic progress has been made recently in identifying tissue-specific factors that organize the delivery and function of transport proteins to their appropriate membrane domains (27, 62-64). These results suggest that both the cellular context and molecular rationing of transport components are important not only for proper function but also for intracellular trafficking (27, 64). Nevertheless, normal epithelial cell function depends on the accurate delivery of a large number of membrane components to a particular cell surface domain, and defects in this process often lead to disease (3, 4). Therefore, it is crucial to understand how different cell types organize the biogenesis and intracellular processing of key molecules (27, 28). Since CFTR plays a central role in the regulation of epithelial ion transport in multiple organ systems, understanding its biogenesis, cellular distribution, and stability in epithelia may be the first step toward identifying the molecular defects leading to early degradation of otherwise functional mutants, such as {Delta}F508 CFTR.

The importance of elucidating the biogenesis and intracellular journey of wild type CFTR is also underscored by two publications indicating that some {Delta}F508 CFTR can be found at the cell surface in native epithelia (65, 66). These earlier reports raise the possibility that in the correct physiological milieu, even the mutant protein might traffic differently than reported in heterologous expression systems. Furthermore, a number of CFTR-associating proteins have been identified and shown to regulate either the function (32) or the intracellular journey of CFTR (33). Whether these or other yet to be identified proteins have any effect on the biogenesis and stability of the wild type protein in native epithelia remains to be determined. Although endogenous, wild type CFTR synthesis is quite low in many native tissues, our results suggest the usefulness of cell lines endogenously expressing CFTR as powerful tools for investigating cell type-specific differences in CFTR biogenesis and function.


   FOOTNOTES
 
* This work was supported in part by a fellowship from the Research Development Program of the Cystic Fibrosis Foundation (CFF) (to K. V.), an American Lung Association grant (to Z. B.), National Institutes of Health Grant DK60065 (to J. F. C.), and a grant from the Research Development Program of the CFF and the National Institutes of Health (to E. J. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger}{ddagger} This study represents a collaborative effort between the Bebõk and Collawn laboratories, and both investigators contributed equally to the supervision of the experiments. Back

§§ To whom correspondence should be addressed: Dept. of Cell Biology and Gregory Fleming James CF Research Center, University of Alabama at Birmingham, MCLM 760, 1918 University Blvd., Birmingham, AL 35294-0005. Tel.: 205-975-5449; Fax: 205-934-7593; E-mail: bebok{at}uab.edu.

1 The abbreviations used are: ER, endoplasmic reticulum; ERAD, ER-associated degradation; CFTR, cystic fibrosis transmembrane conductance regulator; RT, reverse transcriptase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ALLN, N-acetyl-leucyl-leucyl-norleucinal; MDCK, Madin-Darby canine kidney. Back


   ACKNOWLEDGMENTS
 
We thank the Gregory Fleming James CF Research Center for their support of this research. We also thank Drs. Elizabeth Sztul and Erik Schwiebert for critical reading of the manuscript and for their helpful suggestions.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hampton, R. Y. (2002) Curr. Opin. Cell Biol. 14, 476-482[CrossRef][Medline] [Order article via Infotrieve]
  2. Goldberg, A. L. (2003) Nature 426, 895-899[CrossRef][Medline] [Order article via Infotrieve]
  3. Aridor, M., and Hannan, L. A. (2000) Traffic 1, 836-851[CrossRef][Medline] [Order article via Infotrieve]
  4. Aridor, M., and Hannan, L. A. (2002) Traffic 3, 781-790[CrossRef][Medline] [Order article via Infotrieve]
  5. Kim, P. S., and Arvan, P. (1998) Endocr. Rev. 19, 173-202[Abstract/Free Full Text]
  6. Weisz, O. A., Wang, J. M., Edinger, R. S., and Johnson, J. P. (2000) J. Biol. Chem. 275, 39886-39893[Abstract/Free Full Text]
  7. Liu, T. I., Lebaric, Z. N., Rosenthal, J. J., and Gilly, W. F. (2001) J. Neurophysiol. 85, 61-71[Abstract/Free Full Text]
  8. Sant, A. J., Hendrix, L. R., Coligan, J. E., Maloy, W. L., and Germain, R. N. (1991) J. Exp. Med. 174, 799-808[Abstract/Free Full Text]
  9. Petaja-Repo, U. E., Hogue, M., Laperriere, A., Bhalla, S., Walker, P., and Bouvier, M. (2001) J. Biol. Chem. 276, 4416-4423[Abstract/Free Full Text]
  10. Petaja-Repo, U. E., Hogue, M., Laperriere, A., Walker, P., and Bouvier, M. (2000) J. Biol. Chem. 275, 13727-13736[Abstract/Free Full Text]
  11. Yoshimura, A., Longmore, G., and Lodish, H. F. (1990) Nature 348, 647-649[CrossRef][Medline] [Order article via Infotrieve]
  12. Li, J., Quilty, J., Popov, M., and Reithmeier, R. A. (2000) Biochem. J. 349, 51-57[CrossRef][Medline] [Order article via Infotrieve]
  13. Cheng, S. H., Gregory, R. J., Marshall, J., Paul, S., Souza, D. W., White, G. A., O'Riordan, C. R., and Smith, A. E. (1990) Cell 63, 827-834[CrossRef][Medline] [Order article via Infotrieve]
  14. Sun, F., Hug, M. J., Bradbury, N. A., and Frizzell, R. A. (2000) J. Biol. Chem. 275, 14360-14366[Abstract/Free Full Text]
  15. Sun, F., Hug, M. J., Lewarchik, C. M., Yun, C. H., Bradbury, N. A., and Frizzell, R. A. (2000) J. Biol. Chem. 275, 29539-29546[Abstract/Free Full Text]
  16. Riordan, J. R., Rommens, J. M., Kerem, B., Alon, N., Rozmahel, R., Grzelczak, Z., Zielenski, J., Lok, S., Plavsic, N., Chou, J. L., Drumm, M. L., Iannuzzi, M. C., Collins, F. S., and Tsui, L.-C. (1989) Science 245, 1066-1073[Abstract/Free Full Text]
  17. Hyde, S. C., Emsley, P., Hartshorn, M. J., Mimmack, M. M., Gileadi, U., Pearce, S. R., Gallagher, M. P., Gill, D. R., Hubbard, R. E., and Higgins, C. F. (1990) Nature 346, 362-365[CrossRef][Medline] [Order article via Infotrieve]
  18. Anderson, M. P., Gregory, R. J., Thompson, S., Souza, D. W., Paul, S., Mulligan, R. C., Smith, A. E., and Welsh, M. J. (1991) Science 253, 202-205[Abstract/Free Full Text]
  19. Anderson, M. P., and Welsh, M. J. (1992) Science 257, 1701-1704[Abstract/Free Full Text]
  20. Schwiebert, E. M. (1999) Am. J. Physiol. 276, C1-C8[Medline] [Order article via Infotrieve]
  21. Schwiebert, E. M., Egan, M. E., Hwang, T. H., Fulmer, S. B., Allen, S. S., Cutting, G. R., and Guggino, W. B. (1995) Cell 81, 1063-1073[CrossRef][Medline] [Order article via Infotrieve]
  22. Stutts, M. J., Canessa, C. M., Olsen, J. C., Hamrick, M., Cohn, J. A., Rossier, B. C., and Boucher, R. C. (1995) Science 269, 847-850[Abstract/Free Full Text]
  23. Bebok, Z., Mazzochi, C., King, S. A., Hong, J. S., and Sorscher, E. J. (1998) J. Biol. Chem. 273, 29873-29878[Abstract/Free Full Text]
  24. Ward, C. L., and Kopito, R. R. (1994) J. Biol. Chem. 269, 25710-25718[Abstract/Free Full Text]
  25. Ward, C. L., Omura, S., and Kopito, R. R. (1995) Cell 83, 121-127[CrossRef][Medline] [Order article via Infotrieve]
  26. Tector, M., and Hartl, F. U. (1999) EMBO J. 18, 6290-6298[CrossRef][Medline] [Order article via Infotrieve]
  27. Brown, D. (2000) Am. J. Physiol. 278, F192-F201
  28. Bertrand, C. A., and Frizzell, R. A. (2003) Am. J. Physiol. 285, C1-C18
  29. Short, D. B., Trotter, K. W., Reczek, D., Kreda, S. M., Bretscher, A., Boucher, R. C., Stutts, M. J., and Milgram, S. L. (1998) J. Biol. Chem. 273, 19797-19801[Abstract/Free Full Text]
  30. Peters, K. W., Qi, J., Watkins, S. C., and Frizzell, R. A. (1999) Am. J. Physiol. 277, C174-C180[Medline] [Order article via Infotrieve]
  31. Naren, A. P., and Kirk, K. L. (2000) News Physiol. Sci. 15, 57-61[Abstract/Free Full Text]
  32. Naren, A. P., Nelson, D. J., Xie, W., Jovov, B., Pevsner, J., Bennett, M. K., Benos, D. J., Quick, M. W., and Kirk, K. L. (1997) Nature 390, 302-305[CrossRef][Medline] [Order article via Infotrieve]
  33. Cheng, J., Moyer, B. D., Milewski, M., Loffing, J., Ikeda, M., Mickle, J. E., Cutting, G. R., Li, M., Stanton, B. A., and Guggino, W. B. (2002) J. Biol. Chem. 277, 3520-3529[Abstract/Free Full Text]
  34. Shen, B. Q., Finkbeiner, W. E., Wine, J. J., Mrsny, R. J., and Widdicombe, J. H. (1994) Am. J. Physiol. 266, L493-L501[Medline] [Order article via Infotrieve]
  35. Cohn, J. A., Nairn, A. C., Marino, C. R., Melhus, O., and Kole, J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2340-2344[Abstract/Free Full Text]
  36. Wu, X., Wakefield, J. K., Liu, H., Xiao, H., Kralovics, R., Prchal, J. T., and Kappes, J. C. (2000) Mol. Ther. 2, 47-55[CrossRef][Medline] [Order article via Infotrieve]
  37. Kappes, J. C., Wu, X., and Wakefield, J. K. (2003) Methods Mol. Med. 76, 449-465[Medline] [Order article via Infotrieve]
  38. Peter, K., Varga, K., Bebok, Z., McNicholas-Bevensee, C., Schwiebert, L., Sorscher, E. J., Schwiebert, E. M., and Collawn, J. F. (2002) J. Biol. Chem. 277, 49952-49957[Abstract/Free Full Text]
  39. Bebök, Z., Venglarik, C. J., Panczel, Z., Jilling, T., Kirk, K. L., and Sorscher, E. J. (1998) Am. J. Physiol. 44, C599-C607
  40. Straley, K. S., Daugherty, B. L., Aeder, S. E., Hockenson, A. L., Kim, K., and Green, S. A. (1998) Mol. Biol. Cell 9, 1683-1694[Abstract/Free Full Text]
  41. Bebok, Z., Varga, K., Hicks, J. K., Venglarik, C. J., Kovacs, T., Chen, L., Hardiman, K. M., Collawn, J. F., Sorscher, E. J., and Matalon, S. (2002) J. Biol. Chem. 277, 43041-43049[Abstract/Free Full Text]
  42. Li, J., and Wang, C. C. (1999) J. Biol. Chem. 274, 10790-10794[Abstract/Free Full Text]
  43. Haslett, J. N., Sanoudou, D., Kho, A. T., Bennett, R. R., Greenberg, S. A., Kohane, I. S., Beggs, A. H., and Kunkel, L. M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 15000-15005[Abstract/Free Full Text]
  44. Prince, L. S., Peter, K., Hatton, S. R., Zaliauskiene, L., Cotlin, L. F., Clancy, J. P., Marchase, R. B., and Collawn, J. F. (1999) J. Biol. Chem. 274, 3602-3609[Abstract/Free Full Text]
  45. Bebok, Z., Hicks, J. K., Clancy, J. P., Cobb, B., Sorscher, E. J., Wakefield, J. R., Zheng, R., Kappes, J. C. A., and Wu, X. (1999) Ped. Pulm. Suppl. 19, 218 (Abstr. 191)
  46. Loffing, J., Moyer, B. D., McCoy, D., and Stanton, B. A. (1998) Am. J. Physiol. 275, C913-C920[Medline] [Order article via Infotrieve]
  47. Loffing, J., Moyer, B. D., Reynolds, D., and Stanton, B. A. (1999) Am. J. Physiol. 277, L700-L708[Medline] [Order article via Infotrieve]
  48. Jensen, T. J., Loo, M. A., Pind, S., Williams, D. B., Goldberg, A. L., and Riordan, J. R. (1995) Cell 83, 129-135[CrossRef][Medline] [Order article via Infotrieve]
  49. Dick, L. R., Cruikshank, A. A., Grenier, L., Melandri, F. D., Nunes, S. L., and Stein, R. L. (1996) J. Biol. Chem. 271, 7273-7276[Abstract/Free Full Text]
  50. Morris, A. P., Cunningham, S. A., Tousson, A., Benos, D. J., and Frizzell, R. A. (1994) Am. J. Physiol. 266, C254-C268[Medline] [Order article via Infotrieve]
  51. Coyne, C. B., Vanhook, M. K., Gambling, T. M., Carson, J. L., Boucher, R. C., and Johnson, L. G. (2002) Mol. Biol. Cell 13, 3218-3234[Abstract/Free Full Text]
  52. Lukacs, G. L., Mohamed, A., Kartner, N., Chang, X. B., Riordan, J. R., and Grinstein, S. (1994) EMBO J. 13, 6076-6086[Medline] [Order article via Infotrieve]
  53. Johnston, J. A., Ward, C. L., and Kopito, R. R. (1998) J. Cell Biol. 143, 1883-1898[Abstract/Free Full Text]
  54. Heda, G. D., Tanwani, M., and Marino, C. R. (2001) Am. J. Physiol. 280, C166-C174
  55. Swiatecka-Urban, A., Duhaime, M., Coutermarsh, B., Karlson, K. H., Collawn, J., Milewski, M., Cutting, G. R., Guggino, W. B., Langford, G., and Stanton, B. A. (2002) J. Biol. Chem. 277, 40099-40105[Abstract/Free Full Text]
  56. Bebok, Z., Tousson, A., Schwiebert, L. M., and Venglarik, C. J. (2001) Am. J. Physiol. 280, C135-C145
  57. Silvis, M. R., Picciano, J. A., Bertrand, C., Weixel, K., Bridges, R. J., and Bradbury, N. A. (2003) J. Biol. Chem. 278, 11554-11560[Abstract/Free Full Text]
  58. Bradbury, N. A., Clark, J. A., Watkins, S. C., Widnell, C. C., Smith, H. S. T., and Bridges, R. J. (1999) Am. J. Physiol. 276, L659-L668[Medline] [Order article via Infotrieve]
  59. Bradbury, N. A. (1999) Physiol. Rev. 79, S175-S191[Medline] [Order article via Infotrieve]
  60. Ameen, N. A., van Donselaar, E., Posthuma, G., de Jonge, H., McLaughlin, G., Geuze, H. J., Marino, C., and Peters, P. J. (2000) Histochem. Cell Biol. 114, 219-228[Medline] [Order article via Infotrieve]
  61. Prince, L. S., Workman, R. B., Jr., and Marchase, R. B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5192-5196[Abstract/Free Full Text]
  62. Madrid, R., Le Maout, S., Barrault, M. B., Janvier, K., Benichou, S., and Merot, J. (2001) EMBO J. 20, 7008-7021[CrossRef][Medline] [Order article via Infotrieve]
  63. Li, G., Alexander, E. A., and Schwartz, J. H. (2003) J. Biol. Chem. 278, 19791-19797[Abstract/Free Full Text]
  64. Krumins, A. M., Barker, S. A., Huang, C., Sunahara, R. K., Yu, K., Wilkie, T. M., Gold, S. J., and Mumby, S. M. (2004) J. Biol. Chem. 279, 2593-2599[Abstract/Free Full Text]
  65. Kalin, N., Claass, A., Sommer, M., Puchelle, E., and Tummler, B. (1999) J. Clin. Invest. 103, 1379-1389[Medline] [Order article via Infotrieve]
  66. Penque, D., Mendes, F., Beck, S., Farinha, C., Pacheco, P., Nogueira, P., Lavinha, J., Malho, R., and Amaral, M. D. (2000) Lab. Invest. 80, 857-868[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Cell Physiol.Home page
O. Prokopenko and O. Mirochnitchenko
Ischemia-reperfusion-inducible protein modulates cell sensitivity to anticancer drugs by regulating activity of efflux transporter
Am J Physiol Cell Physiol, May 1, 2009; 296(5): C1086 - C1097.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
M. R. Silvis, C. A. Bertrand, N. Ameen, F. Golin-Bisello, M. B. Butterworth, R. A. Frizzell, and N. A. Bradbury
Rab11b Regulates the Apical Recycling of the Cystic Fibrosis Transmembrane Conductance Regulator in Polarized Intestinal Epithelial Cells
Mol. Biol. Cell, April 15, 2009; 20(8): 2337 - 2350.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Susuki, T. Sato, M. Miyata, M. Momohara, M. A. Suico, T. Shuto, Y. Ando, and H. Kai
The Endoplasmic Reticulum-associated Degradation of Transthyretin Variants Is Negatively Regulated by BiP in Mammalian Cells
J. Biol. Chem., March 27, 2009; 284(13): 8312 - 8321.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
F. Chappe, M. E. Loewen, J. W. Hanrahan, and V. Chappe
Vasoactive Intestinal Peptide Increases Cystic Fibrosis Transmembrane Conductance Regulator Levels in the Apical Membrane of Calu-3 Cells through a Protein Kinase C-Dependent Mechanism
J. Pharmacol. Exp. Ther., October 1, 2008; 327(1): 226 - 238.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
R. Bartoszewski, A. Rab, A. Jurkuvenaite, M. Mazur, J. Wakefield, J. F. Collawn, and Z. Bebok
Activation of the Unfolded Protein Response by {Delta}F508 CFTR
Am. J. Respir. Cell Mol. Biol., October 1, 2008; 39(4): 448 - 457.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
F. Sun, Z. Mi, S. B. Condliffe, C. A. Bertrand, X. Gong, X. Lu, R. Zhang, J. D. Latoche, J. M. Pilewski, P. D. Robbins, et al.
Chaperone displacement from mutant cystic fibrosis transmembrane conductance regulator restores its function in human airway epithelia
FASEB J, September 1, 2008; 22(9): 3255 - 3263.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. Bartoszewski, A. Rab, G. Twitty, L. Stevenson, J. Fortenberry, A. Piotrowski, J. P. Dumanski, and Z. Bebok
The Mechanism of Cystic Fibrosis Transmembrane Conductance Regulator Transcriptional Repression during the Unfolded Protein Response
J. Biol. Chem., May 2, 2008; 283(18): 12154 - 12165.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Rennolds, C. Tower, L. Musgrove, L. Fan, K. Maloney, J. P. Clancy, K. L. Kirk, E. Sztul, and E. Cormet-Boyaka
Cystic Fibrosis Transmembrane Conductance Regulator Trafficking Is Mediated by the COPI Coat in Epithelial Cells
J. Biol. Chem., January 11, 2008; 283(2): 833 - 839.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
L. A. Borthwick, J. Mcgaw, G. Conner, C. J. Taylor, V. Gerke, A. Mehta, L. Robson, and R. Muimo
The Formation of the cAMP/Protein Kinase A-dependent Annexin 2 S100A10 Complex with Cystic Fibrosis Conductance Regulator Protein (CFTR) Regulates CFTR Channel Function
Mol. Biol. Cell, September 1, 2007; 18(9): 3388 - 3397.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
M. W. Wendeler, O. Nufer, and H.-P. Hauri
Improved maturation of CFTR by an ER export signal
FASEB J, August 1, 2007; 21(10): 2352 - 2358.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
R. F. Goldstein, A. Niraj, T. P. Sanderson, L. S. Wilson, A. Rab, H. Kim, Z. Bebok, and J. F. Collawn
VCP/p97 AAA-ATPase Does Not Interact with the Endogenous Wild-Type Cystic Fibrosis Transmembrane Conductance Regulator
Am. J. Respir. Cell Mol. Biol., June 1, 2007; 36(6): 706 - 714.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
S. Heubes and O. Stemmann
The AAA-ATPase p97-Ufd1-Npl4 is required for ERAD but not for spindle disassembly in Xenopus egg extracts
J. Cell Sci., April 15, 2007; 120(8): 1325 - 1329.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
A. Rab, R. Bartoszewski, A. Jurkuvenaite, J. Wakefield, J. F. Collawn, and Z. Bebok
Endoplasmic reticulum stress and the unfolded protein response regulate genomic cystic fibrosis transmembrane conductance regulator expression
Am J Physiol Cell Physiol, February 1, 2007; 292(2): C756 - C766.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
N. A. Bradbury
Freedom of expression. Focus on "Endoplasmic reticulum stress and the unfolded protein response regulate cystic fibrosis transmembrane conductance regulator expression"
Am J Physiol Cell Physiol, February 1, 2007; 292(2): C687 - C688.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Sun, R. Zhang, X. Gong, X. Geng, P. F. Drain, and R. A. Frizzell
Derlin-1 Promotes the Efficient Degradation of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and CFTR Folding Mutants
J. Biol. Chem., December 1, 2006; 281(48): 36856 - 36863.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
T. E. Machen
Innate immune response in CF airway epithelia: hyperinflammatory?
Am J Physiol Cell Physiol, August 1, 2006; 291(2): C218 - C230.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. B. Goldfarb, O. B. Kashlan, J. N. Watkins, L. Suaud, W. Yan, T. R. Kleyman, and R. C. Rubenstein
Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels
PNAS, April 11, 2006; 103(15): 5817 - 5822.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Jurkuvenaite, K. Varga, K. Nowotarski, K. L. Kirk, E. J. Sorscher, Y. Li, J. P. Clancy, Z. Bebok, and J. F. Collawn
Mutations in the Amino Terminus of the Cystic Fibrosis Transmembrane Conductance Regulator Enhance Endocytosis
J. Biol. Chem., February 10, 2006; 281(6): 3329 - 3334.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Oberdorf, D. Pitonzo, and W. R. Skach
An Energy-dependent Maturation Step Is Required for Release of the Cystic Fibrosis Transmembrane Conductance Regulator from Early Endoplasmic Reticulum Biosynthetic Machinery
J. Biol. Chem., November 18, 2005; 280(46): 38193 - 38202.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
F. Golin-Bisello, N. Bradbury, and N. Ameen
STa and cGMP stimulate CFTR translocation to the surface of villus enterocytes in rat jejunum and is regulated by protein kinase G
Am J Physiol Cell Physiol, September 1, 2005; 289(3): C708 - C716.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
I. Ron and M. Horowitz
ER retention and degradation as the molecular basis underlying Gaucher disease heterogeneity
Hum. Mol. Genet., August 15, 2005; 14(16): 2387 - 2398.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
C. M. Farinha and M. D. Amaral
Most F508del-CFTR Is Targeted to Degradation at an Early Folding Checkpoint and Independently of Calnexin
Mol. Cell. Biol., June 15, 2005; 25(12): 5242 - 5252.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
J. Shepshelovich, L. Goldstein-Magal, A. Globerson, P. M. Yen, P. Rotman-Pikielny, and K. Hirschberg
Protein synthesis inhibitors and the chemical chaperone TMAO reverse endoplasmic reticulum perturbation induced by overexpression of the iodide transporter pendrin
J. Cell Sci., April 15, 2005; 118(8): 1577 - 1586.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
M. Sugita, H. Kongo, and Y. Shiba
Molecular Dissection of the Butyrate Action Revealed the Involvement of Mitogen-Activated Protein Kinase in Cystic Fibrosis Transmembrane Conductance Regulator Biogenesis
Mol. Pharmacol., November 1, 2004; 66(5): 1248 - 1259.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/21/22578    most recent
M401522200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Varga, K.
Right arrow Articles by Bebök, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Varga, K.
Right arrow Articles by Bebök, Z.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement