| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 279, Issue 24, 25813-25822, June 11, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Department of Pharmacology and University of Pittsburgh Cancer Institute, and the ¶Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15213, the ||Department of Biochemistry and Molecular Biology and the Stanley S. Scott Cancer Center, Louisiana State University Health Sciences Center, New Orleans, Louisiana 70112
Received for publication, December 10, 2003 , and in revised form, April 5, 2004.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESSRESULTSDISCUSSIONREFERENCES |
|---|
. Increased Ser-216 phosphorylation of Cdc25C upon treatment with SFN was the result of activation of checkpoint kinase 2 (Chk2), which was associated with Ser-1981 phosphorylation of ataxia telangiectasia-mutated, generation of reactive oxygen species, and Ser-139 phosphorylation of histone H2A.X, a sensitive marker for the presence of DNA double-strand breaks. Transient transfection of PC-3 cells with Chk2-specific small interfering RNA duplexes significantly attenuated SFN-induced G2/M arrest. HCT116 human colon cancer-derived Chk2-/- cells were significantly more resistant to G2/M arrest by SFN compared with the wild type HCT116 cells. These findings indicate that Chk2-mediated phosphorylation of Cdc25C plays a major role in irreversible G2/M arrest by SFN. Activation of Chk2 in response to DNA damage is well documented, but the present study is the first published report to link Chk2 activation to cell cycle arrest by an isothiocyanate. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESSRESULTSDISCUSSIONREFERENCES |
|---|
Evidence is accumulating to indicate that SFN can inhibit proliferation of cancer cells in culture by causing apoptosis and/or cell cycle arrest (24-28). The growth-suppressive effect of SFN has been observed against HT29 and LS-174 human colon cancer cells (24, 25), PC-3 and LNCaP human prostate cancer cells (26, 28), and Jurkat T-leukemia cells (27). Apoptosis induction by SFN in Jurkat T-leukemia cells (27) and HT29 human colon cancer cells (24) correlated with overexpression of Bax and/or down-regulation of Bcl-2. Recent studies from our laboratory have indicated involvement of both caspase-8 and caspase-9 pathways in apoptosis induction by SFN in PC-3 cells (28). In addition, we showed that the growth of a PC-3 xenografts in vivo is inhibited significantly upon oral administration of SFN at a concentration that may be generated through dietary intake of cruciferous vegetables (28). Although considerable progress has been made toward our understanding of the mechanism of SFN-induced apoptosis, the sequence of events leading to cell cycle arrest in SFN-treated cells is poorly defined. For example, previous studies have shown that SFN-treated HT29 colon cancer cells and Jurkat T-leukemia cells are arrested in the G2/M phase (24, 27), which may be of importance in the anticarcinogenic effect of SFN, but no attempts were made to define the mechanism of the cell cycle arrest.
In the present study, we demonstrate that SFN treatment causes an irreversible G2/M phase cell cycle arrest in PC-3 cells which is associated with a marked decrease in the expression of key G2/M-regulating proteins, including cyclin B1, cell division cycle 25B (Cdc25B) and Cdc25C. In addition, we provide evidence to indicate that cell cycle arrest in SFN-treated PC-3 cells is caused by the generation of reactive oxygen species (ROS) and ataxia telangiectasia-mutated (ATM)/checkpoint kinase 2 (Chk2)-mediated phosphorylation of Cdc25C at Ser-216. Phosphorylation of Cdc25C in SFN-treated cells leads to its retention in the cytosol through increased binding with 14-3-3. Although activation of ATM/Chk2 in response to DNA damage by ionizing radiation, UV light, or interference with DNA replication is well documented (for review, see Ref. 29), the present study is the first published report to link ATM/Chk2 with cell cycle arrest by an isothiocyanate class of dietary cancer chemopreventive agent.
|
EXPERIMENTAL PROCEDURESS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESSRESULTSDISCUSSIONREFERENCES |
|---|
-Protein phosphatase was from New England Biolabs. The reagents for electrophoresis were from Bio-Rad Laboratories. Antibodies against Cdk1, Cdc25C, ubiquitin, phospho-Cdc25C (Ser-216), Chk2, phospho-Chk2 (Thr-68), phospho-Chk1 (Ser-345), ATM, 
-tubulin, -Ran, and 14-3-3 were from Santa Cruz Biotechnology (Santa Cruz, CA). Antibody against phospho-ATM (Ser-1981) was from Rockland Immunochemicals (Gilbertsville, PA). Antibodies against cyclin B1 and actin were from Oncogene Research Products (Boston). Antibody against phospho-H2A.X (Ser-139) was from Upstate (Charlottesville, VA). Antibody against Chk1 was from Cell Signaling Technology (Beverly, MA). Antibody against Cdc25B was from Pharmingen. Antibody against phospho-Cdk1 (Tyr-15) was from Sigma. Cell Culture and Cell Cycle Analysis—Monolayer cultures of PC-3 cells were maintained in F-12K nutrient mixture (Kaighn's modification) supplemented with 7% (v/v) non-heat-inactivated fetal bovine serum and antibiotics in a humidified atmosphere of 95% air and 5% CO2. Other cell lines including 293 and HCT116-derived Chk2-/- and Chk2+/+ were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and antibiotics. The effect of SFN on cell cycle distribution was determined by flow cytometry after staining the cells with propidium iodide. Briefly, 5 x 105 cells were seeded and allowed to attach overnight. The medium was replaced with fresh complete medium containing the desired concentration of SFN. A stock solution of SFN was prepared in Me2SO, and an equal volume of Me2SO (final concentration 0.02%) was added to controls. After 24 h of incubation at 37 °C, floating and adherent cells were collected, washed with phosphate-buffered saline (PBS), and fixed with 70% ethanol. The cells were then treated with 80 µg/ml RNase A and 50 µg/ml propidium iodide for 30 min. The stained cells were analyzed using a Coulter Epics XL Flow Cytometer. The Chk2+/+ and Chk2-/- HCT116 cells were treated with 20 µM SFN or Me2SO for 48 h prior to analysis of cell cycle distribution.
Western Blotting—After treatment with Me2SO (control) or the desired concentration of SFN for a specified time interval, floating and attached cells were collected and lysed as described by us previously (28). Cell lysate was cleared by centrifugation at 14,000 rpm for 15 min. Lysate proteins were resolved by SDS-PAGE and transferred onto a polyvinylidene fluoride membrane. The membrane was incubated in Tris-buffered saline containing 0.05% Tween 20 and 5% (w/v) nonfat dry milk and then exposed to the desired primary antibody for 1 h at room temperature. After treatment with appropriate secondary antibody, the immunoreactive bands were visualized using the enhanced chemiluminescence method.
Lactacystin Treatment—Cells (106) were plated, allowed to attach overnight, and treated with either Me2SO (control) or 5 µM lactacystin for 2 h at 37 °C. The cells were then exposed to 20 µM SFN for an additional 24 h. Cell lysates were prepared and subjected to immunoblotting for Cdc25C or ubiquitin. In a separate experiment, cells treated with Me2SO (control), SFN alone, and lactacystin plus SFN were processed for determination of cell cycle distribution as described above.
Immunoprecipitation—PC-3 cells were treated with Me2SO or 20 µM SFN for 4 and 24 h, washed twice with ice-cold PBS, and lysed as described above. Aliquots containing 200 µg of lysate protein were incubated overnight at 4 °C with 10 µg of anti-14-3-3 antibody. Protein A-agarose (50 µl, Santa Cruz Biotechnology) was subsequently added to each sample, and the incubation was continued for an additional 3 h at 4 °C with gentle shaking. The immunoprecipitates were subjected to SDS-PAGE followed by immunoblotting using anti-Cdc25C antibody as described above.
Microscopic Analysis for Nuclear/Cytoplasmic Distribution of Cdc25C—PC-3 cells (2 x 104) were grown on coverslips and allowed to attach overnight. Cells were then exposed to Me2SO or 20 µM SFN for 4 or 24 h at 37 °C, washed with PBS, and fixed with 4% paraformaldehyde for 30 min at room temperature. After blocking for 45 min with normal goat serum, cells were treated for 1 h at room temperature with anti-Cdc25C antibody (1:200 dilution with PBS containing 1% bovine serum albumin). After washing, cells were treated with Alexa Fluor 568 secondary antibody for 1 h at room temperature and counterstained with nuclear dye SYTOX® Green (Molecular Probes, Eugene, OR). Slides were mounted and examined under a fluorescence microscope (Olympus Fluoview) at a x60 magnification.
Preparation of Nuclear and Cytoplasmic Fractions—Nuclear and cytoplasmic fractions from control (Me2SO-treated) and SFN-treated (20 µM for 4 h) PC-3 cells were prepared as described previously (30). Briefly, cells were harvested by scraping and rinsed twice in ice-cold PBS. The cells were then swollen in ice-cold hypotonic lysis buffer (20 mM HEPES, pH 7.1, 5 mM KCl, 1 mM MgCl2, 10 mM N-ethylmaleimide, 0.5 mM phenylmethylsulfonyl fluoride, 5 µg/ml pepstatin A, 2 µg/ml chymostatin, 5 µg/ml leupeptin, 5 µg/ml aprotinin, 5 µg/ml antipain) for 10 min. The cells were lysed by 20 strokes in a Dounce homogenizer, and the nuclei were cleared by centrifugation (400 x g, 10 min). After this step, the supernatant (cytosolic fraction) was concentrated and stored at -80 °C. The nuclear extract was prepared using the same lysis buffer and stored at -80 °C prior to Western blot analysis for Cdc25C. The blot was stripped and reprobed with -tubulin or -Ran antibody to ensure equal protein loading as well as to rule out cross-contamination of cytoplasmic and nuclear fractions.
Chk2 Kinase Assay—Approximately 106 cells were plated at a confluence of 
70% and exposed to SFN (20 µM, 4 h) or ionizing radiation (10 Gy, 1 h). Cells were collected, and Chk2 kinase activity was measured by a immunoprecipitation kinase assay using GST-Cdc25C as a substrate as described previously (31). Briefly, control (Me2SO-treated) and SFN-treated cells were lysed in 1 x lysis buffer (20 mM Tris-HCl, pH 7.5, containing 150 mM NaCl, 5 mM EDTA, 0.5% Nonidet P-40, 1 mM NaF, 1 mM dithiothreitol, 1 mM sodium vanadate, and 1 mM leupeptin and aprotinin). Lysates were cleared, adjusted for equal protein content, and 5 µl of monoclonal anti-Chk2 antibody was added, and the mixture was incubated for 2 h. Protein A/G beads (15 µl) were added, and the incubation was continued for an additional 1 h. The immune complexes were washed three times with 1 x lysis buffer containing 500 mM NaCl and twice with 1 x lysis buffer containing 100 mM NaCl. The immune complexes were suspended in 25 µl of kinase buffer (25 mM HEPES, pH 7.5, containing 50 mM NaCl, 5 mM MnCl2, 0.5 mM EDTA, 5 mM dithiothreitol, 2.5 nM phenylmethylsulfonyl fluoride) and incubated with 0.5 µg of GST-Cdc25C in the presence of 50 µCi of [
-32P]ATP and 10 µM cold ATP. Reaction mixtures were incubated at 30 °C for 25 min, and the reaction was terminated by the addition of an equal volume of sample buffer. The proteins were resolved by SDS-PAGE, transferred onto Immobilon-P membrane, and the radiolabeled proteins were visualized by autoradiography. After autoradiography, the membrane was probed with anti-Chk2 antibody to confirm equal protein loading. To determine whether SFN interacts with Chk2 to affect its kinase activity, 5 or 20 µM SFN was directly added to the kinase reaction mixture containing Chk2 immunoprecipitated from control or ionizing radiation-exposed cells.
siRNA Transfection—RNA interference of Chk2 was performed using 21-bp (including a 2-deoxynucleotide overhang) siRNA duplexes purchased from Dharmacon (Lafayette, CO). The coding strand for Chk2 siRNA was GAACCUGAGGACCAAGAACdTdT. For transfection, PC-3 cells were seeded in 6-well plates and transfected at 30% confluence with 200 nM siRNA duplexes using OligofectAMINE (Invitrogen) according to the manufacturer's recommendations. Cells treated with OligofectAMINE (mock) or transfected with a control nonspecific siRNA duplex VIII (Dharmacon; ACUCUAUCUGCACGCUGACUU) were used as controls for direct comparison. After 24 h of transfection, cells were treated with Me2SO or SFN (20 µM) for 24 h. Both floating and adherent cells were collected, washed with PBS, and processed for analysis of cell cycle distribution or immunoblotting.
Measurement of ROS—Generation of intracellular ROS was examined by flow cytometry using H2DCFDA (Molecular Probes). Briefly, PC-3 cells (0.5 x 106) were plated in T25 flasks and allowed to attach overnight. The cells were first exposed to 20 µM SFN for 0, 30 min, 1 h, or 3 h (37 °C) and then treated with 5 µM H2DCFDA for 30 min at 37 °C. Subsequently, the cells were collected by trypsinization, washed twice with PBS, and analyzed for dichlorodihydrofluorescein fluorescence using a Coulter Epics XL Flow Cytometer.
Immunohistochemistry for Histone H2A.X Phosphorylation—PC-3 cells (105) were grown on coverslips and allowed to attach overnight. Cells were then exposed to Me2SO (control) or 20 µM SFN for 1 and 2 h or 20 µM etoposide for 2 h (positive control) at 37 °C. Cells were then washed with PBS and fixed with 2% paraformaldehyde overnight at 4 °C. Subsequently, the cells were permeabilized with 0.1% Triton X-100 for 15 min at room temperature, washed with PBS, and incubated with normal goat serum (1:20 in PBS containing 0.5% (w/v) bovine serum albumin and 0.15% (w/v) glycine (BSA buffer)) for 45 min at room temperature. After washing with BSA buffer, cells were treated with antibodies against phospho-H2A.X (Ser-139) (2 µg/ml) for 1 h at room temperature. Cells were then washed with BSA buffer and incubated with 2 µg/ml goat anti-mouse Alexa Fluor 568 antibody (Molecular Probes) for 1 h at room temperature and counterstained with 10 ng/ml DAPI. Slides were mounted and examined under a fluorescence microscope at x40 (objective lens) magnification.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESSRESULTSDISCUSSIONREFERENCES |
|---|
|
|
|
The function of Cdc25C is negatively regulated by phosphorylation at Ser-216, which creates a binding site for 14-3-3 (36, 37). Binding of Cdc25C with 14-3-3 prevents nuclear localization of this dual specificity phosphatase (36, 37). Therefore, we examined the effect of SFN on Ser-216 phosphorylation of Cdc25C. As can be seen in Fig. 3B, the level of Ser-216-phosphorylated Cdc25C was significantly higher (between 150 and 300% increase over control) in SFN-treated cells compared with control. Increased Ser-216 phosphorylation of Cdc25C over control was evident as early as 1 h after SFN treatment and persisted for the duration of the experiment (24 h post-treatment; Fig. 3B).
Next, we determined whether SFN-induced decline in Cdc25C protein level (Fig. 3A) involved the ubiquitin-proteasome system because arsenic-induced G2/M phase cell cycle arrest was shown to be the result of ubiquitin/proteasome-mediated degradation of Cdc25C (38). We addressed this question by determining the effect of lactacystin, a specific inhibitor of proteasome, on the SFN-induced decline in Cdc25C protein as well as on cell cycle arrest. The decline in Cdc25C protein level upon treatment with SFN was nearly completely blocked in the presence of lactacystin (Fig. 3C). The blot was probed with anti-ubiquitin antibody to determine whether Cdc25C was ubiquitinated. Indeed, high molecular weight polyubiquitin conjugates were evident in the lane containing lysate from cells treated with SFN and lactacystin but not in control lysate (Fig. 3C). To our surprise, however, lactacystin treatment did not protect against SFN-induced G2/M arrest (Fig. 3D). These results indicated that, in our model, the Cdc25C protein level per se did not influence cell cycle arrest caused by SFN.
SFN Promoted Translocation of Cdc25C from the Nucleus to the Cytoplasm—Because Ser-216 phosphorylation of Cdc25C creates a binding site for 14-3-3 (36, 37), we examined the effect of SFN on the binding of Cdc25C with 14-3-3. The lysate proteins from control and SFN-treated cells (20 µM for 4 or 24 h) were immunoprecipitated using anti-14-3-3 antibody, and the immune complex was analyzed for the presence of Cdc25C by immunoblotting. As can be seen in Fig. 4A, SFN treatment resulted in increased binding of Cdc25C with 14-3-3 at the 4 and 24 h time points. These results suggested that SFN treatment might lead to translocation of Cdc25C from the nucleus to the cytoplasm because of increased binding with 14-3-3. We examined this possibility by immunohistochemistry, and the data are shown in Fig. 4B. Cells were treated with Me2SO (control) or 20 µM SFN for 4 or 24 h and then stained with anti-Cdc25C antibody (red) or nucleic acid binding dye SYTOX® Green (green). In Me2SO-treated control cells, Cdc25C was localized in the cytoplasm (red staining surrounding SYTOX® Green-stained nuclei) as well as in the nucleus (brown-black staining in nucleus). In contrast, the nuclei of the cells treated with SFN for 24 h were brightly stained with SYTOX® Green, indicating translocation of Cdc25C from the nucleus to the cytoplasm. In agreement with the results of immunoblotting indicating a decline in Cdc25C protein level in SFN-treated cells (Fig. 3A), a marked decrease in Cdc25C immunostaining (red fluorescence around SYTOX® Green-stained nuclei) was observed in SFN-treated cells (Fig. 4B). SFN-induced decline in the Cdc25C protein level was more pronounced at 24 h than at the 4 h time point after treatment.
|
-tubulin and anti--Ran antibodies to determine cross-contamination, if any, of the nuclear and cytoplasmic fractions and to ensure equal protein loading (Fig. 4C). These results confirmed that SFN treatment, indeed, promoted translocation of Cdc25C from the nucleus to the cytoplasm. SFN Treatment Increased Thr-68 Phosphorylation of Checkpoint Kinase 2 (Chk2)—Several kinases including Chk1 and Chk2 have been implicated in Ser-216 phosphorylation of Cdc25C (36, 39-41). Chk1 and Chk2 are intermediaries of DNA damage checkpoints and activated by phosphorylation on Ser-345/Ser-317 and Thr-68, respectively (42-46). We therefore examined whether SFN treatment affects phosphorylation of Chk1 or Chk2. Representative immunoblots for total and phospho-Chk2 (Thr-68) showed increased Thr-68 phosphorylation of Chk2 over control which was evident as early as 1 h after SFN treatment and persisted for the duration of the experiment (Fig. 5A). The level of Chk2 protein was not affected by SFN treatment. SFN treatment did not affect either the Chk1 protein level or its phosphorylation (data not shown). The kinase activity of Chk2 was determined in the lysates prepared from control (Me2SO-treated) and SFN-treated cells (20 µM for 4 h) using GST-Cdc25C as a substrate. As can be seen in Fig. 5B, the Chk2 kinase activity was significantly higher in SFN-treated cells than in control cells. ATM is an upstream kinase implicated in phosphorylation and hence activation of Chk2 (46). Immunoblotting using an antibody specific for phospho-ATM (Ser-1981) revealed increased phosphorylation of ATM in SFN-treated (20 µM, 4 h) cells. Lysate from 293 cells exposed to 10-Gy ionizing radiation was used as a positive control (Fig. 5C).
|
To determine whether activation of Chk2 persisted even after drug removal, the cells were first treated with Me2SO or 20 µM SFN for 4 h, washed with PBS, and then cultured in drug-free fresh complete medium for 0, 2, 8, or 24 h. The cells were harvested and processed for immunoblotting for phospho-Chk2 (Thr-68), and the results are shown in Fig. 5E. The Thr-68 phosphorylation of Chk2 was evident for up to 24 h after SFN removal.
SFN-induced Phosphorylation of Chk2 Is Not Unique to PC-3 Cells—To rule out a possibility that activation of Chk2 in SFN-treated PC-3 cells was a cell line-specific effect, we examined 293 cells for SFN-induced Chk2 activation. Similar to the results obtained in PC-3 cells, SFN caused activation of Chk2 at the 1, 16, and 24 h time points (Fig. 5F). Additionally, SFN-induced phosphorylation of Cdc25C (Ser-216) and accumulation of Tyr-15-phosphorylated Cdk1 was also observed in 293 cells. Although IR and UV light induced phosphorylation of Chk1, SFN failed to activate Chk1 (Fig. 5F). These results clearly indicated that SFN-induced activation of Chk2 was not unique to the PC-3 cell line.
siRNA-mediated Down-regulation of Chk2 Partially Blocked SFN-induced G2/M Arrest—To experimentally verify the role of Chk2 in SFN-induced cell cycle arrest, we used siRNA technology to suppress Chk2 protein expression. As can be seen in Fig. 6A, transfection with a siRNA targeted to Chk2 suppressed Chk2 protein expression by >70% compared with the mock control. The expression of Chk2 was not affected in cells transfected with a nonspecific control siRNA (Fig. 6A). Chk2 siRNA-transfected cells and control cells (mock and control siRNA-transfected cells) were then treated with SFN, and their cell cycle distribution was assessed after 24 h (Fig. 6B). Treatment of control siRNA-transfected cells with SFN (20 µM for 24 h) resulted in about a 2.2-fold increase in G2/M phase cells (Fig. 6B). A similar effect of SFN on cell cycle distribution was observed in mock-transfected cells. The SFN-induced G2/M block was partially but statistically significantly attenuated in cells transfected with Chk2 siRNA (Fig. 6B).
|
|
-protein phosphatase prior to immunoblotting (data not shown). These results indicated that the slower migrating bands were phosphorylated forms of Cdc25C. HCT116-derived Chk2-/- Cells Were Significantly More Resistant to SFN-induced G2/M Arrest than Wild Type Cells—The role of Chk2 in cell cycle arrest by SFN was investigated further using HCT116-derived Chk2-/- and Chk2+/+ human colon cancer cells. As can be seen in Fig. 8A, the G2/M blockade induced by SFN was relatively more pronounced in Chk2+/+ HCT116 cells than in the HCT116-derived Chk2-/- cells. Consistent with the results in PC-3 and 293 cells, SFN treatment (20 µM for 24 h) caused phosphorylation of Chk2 (Thr-68) and accumulation of Tyr-15-phosphorylated Cdk1 in Chk2+/+ cells (Fig. 8B). These observations provided additional support to the conclusion that Chk2 plays an important role in SFN-induced cell cycle arrest. Because SFN caused a significant increase in fraction of cells with G2/M DNA content in both Chk2-/- and Chk2+/+ HCT116 cells (Fig. 8A), compensatory Chk2-independent mechanisms are likely to contribute to the cell cycle arrest in Chk2-/- HCT116 cells.
|
SFN Treatment Generated ROS and Promoted Ser-139 Phosphorylation of Histone H2A.X—SFN is an electrophilic molecule capable of reacting with cellular nucleophiles including glutathione (47), which raised the question whether SFN generates ROS to cause DNA damage. ROS generation in SFN-treated cells was monitored by flow cytometry using H2DCFDA, which is hydrolyzed by nonspecific cellular esterases and oxidized in the presence of ROS (48). As shown in Fig. 9A, SFN treatment (20 µM) resulted in a time-dependent increase in fluorescence, indicating ROS generation. Because ROS can cause DNA damage directly as well as oxidize nucleotides that can be converted to double-strand breaks during DNA replication (49, 50), we examined whether SFN treatment caused DNA double-strand breaks by monitoring Ser-139 phosphorylation of H2A.X, which has emerged as a sensitive marker for the presence of DNA double-strand breaks (51). Phosphorylation of H2A.X in SFN-treated cells was clearly evident at the 2 h time point as determined by immunoblotting using phospho-specific H2A.X antibody (Fig. 9B). Immunohistochemical analysis further confirmed Ser-139 phosphorylation of H2A.X in SFN-treated as well as in etoposide-treated (positive control) PC-3 cells (Fig. 9C). Collectively, these results indicated that SFN treatment caused ROS-mediated DNA double-strand breaks to activate ATM/Chk2.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESSRESULTSDISCUSSIONREFERENCES |
|---|
Cell cycle arrest in the presence of SFN has been demonstrated previously in other cellular models, but the results are inconsistent. For example, a net increase in the percentage of G2/M phase cells upon treatment with SFN was observed in HT29 human colon cancer cells as well as in Jurkat T-leukemia cells (24, 27). The mechanism of G2/M arrest was not investigated thoroughly in any of the above studies, but an increase in the level of cyclin A and cyclin B protein was reported in SFN-treated HT29 cells (24). In contrast, Chiao et al. (26) showed that treatment of LNCaP human prostate cancer cells with 3-50 µM SFN resulted in an enrichment of G1 phase cells. Although the reasons for this discrepancy are not yet clear, the inconsistency could be caused by differences in the genetic background of the cells. For example, PC-3 cells do not require androgen for growth and lack functional p53, whereas LNCaP cells are androgen-responsive and contain wild type p53. It would be of interest to determine whether p53 status influences SFN-induced cell cycle arrest.
The activity of Cdc25C is negatively regulated by phosphorylation at Ser-216, which creates a binding site for 14-3-3 (36, 37). The binding with 14-3-3 hinders nuclear accumulation of Cdc25C, which is required for activation of the Cdk1·cyclin B kinase complex in the nucleus (36, 37). Therefore, phosphorylation of Cdc25C on Ser-216 represents an important regulatory mechanism by which cells delay or block mitotic entry under normal conditions as well as in response to DNA damage (36, 37). In our model, SFN treatment caused an increase in Ser-216 phosphorylation of Cdc25C which was evident as early as 1 h after treatment and persisted for the duration of the experiment (24 h after the SFN treatment). We also observed an increase in binding of Cdc25C with 14-3-3 in SFN-treated cells compared with control (Fig. 4A). Immunohistochemistry and immunoblotting confirmed that SFN treatment promotes cytoplasmic sequestration of Cdc25C (Fig. 4, B and C). Because cell cycle arrest by SFN was not significantly affected upon restoration of the Cdc25C protein level, cytoplasmic translocation of Cdc25C caused by increased binding with 14-3-3 appears to be the main mechanism of cell cycle arrest by SFN in our model.
Chk1 and Chk2, which are important intermediaries of DNA damage checkpoint pathways, are implicated in Ser-216 phosphorylation of Cdc25C (39, 40). Chk1 and Chk2 are activated in response to DNA damage by IR and/or UV light and by interference with DNA replication (29, 39-46). Chk1 is activated by ATR (ATM and Rad3-related protein kinase), whereas ATM-dependent phosphorylation at Thr-68 leads to activation of Chk2 (42-46). The results of the present study indicate that increased Ser-216 phosphorylation of Cdc25C in SFN-treated cells is associated with ATM-dependent activation of Chk2. Phosphorylation of ATM (Ser-1981) and Chk2 (Thr-68) was very low in Me2SO-treated control PC-3 cells but increased rapidly and dramatically upon treatment with SFN (Fig. 5). The time course for phosphorylation of Cdc25C upon treatment with SFN mirrored that of Chk2 phosphorylation (Figs. 3B and 5A). The kinase assays using immunoprecipitated Chk2 clearly indicated an increase in Chk2 kinase activity in SFN-treated cells compared with the control. Moreover, transfection of PC-3 cells with Chk2-specific siRNA not only reduced expression of Chk2 protein but also caused a marked decrease in SFN-induced phosphorylation of both Chk2 (Thr-68) and Cdc25C (Ser-216) (Fig. 7). SFN-induced G2/M arrest was partially but statistically significantly attenuated in Chk2 siRNA-transfected cells (Fig. 6B). SFN-induced cell cycle arrest in Chk2 siRNA-transfected cells was only partially blocked probably because Chk2 siRNA did not fully eliminate Chk2 protein expression. Such a finding raises another possibility that Chk2-independent mechanisms may also contribute to SFN-induced cell cycle arrest. Consistent with this possibility, SFN-induced G2/M phase arrest was observed in Chk2-null HCT116 cells. Nonetheless, the results of the present study clearly indicate that the Chk2 protein level affects sensitivity of cells to SFN-induced G2/M arrest.
It is widely accepted that activation of checkpoints in response to DNA damage leads to cell cycle arrest; but in the case of severe damage, the cell cycle arrest leads to apoptotic cell death. The effects of SFN are compatible with this model. SFN treatment caused generation of ROS which was associated with increased phosphorylation of H2A.X at Ser-139, suggesting the presence of DNA double-strand breaks. The results shown in Fig. 2B indicated a significant enrichment of G2/M phase cells upon treatment with SFN with very little cells in the sub-G0/G1 phase (apoptotic cells). The induction of cell cycle arrest in the absence of cell death clearly shows that cell cycle arrest is not a secondary event; rather it leads to apoptosis because culture of SFN-treated (G2/M arrested) cells in drug-free medium led to a >5-fold increase in sub-G0/G1 fraction (Fig. 2D).
The SFN-induced decline in Cdc25C protein level was blocked by about 50% in Chk2 siRNA-transfected cells (Fig. 7, bottom panel) compared with mock-transfected cells. Because Chk2 depletion also led to a reduction in SFN-induced phosphorylation of Cdc25C, it is possible that Ser-216 phosphorylation of Cdc25C regulates its degradation. Results in HCT116-derived Chk2-/- cells also support this possibility because the SFN-induced decline in the Cdc25C protein level was relatively more severe in Chk2+/+ than in HCT116-derived Chk2-/- cells (Fig. 8C). It is important to mention that Chk1-dependent phosphorylation of Cdc25A has been shown to regulate its stability (52). Specifically, these investigators showed that loss of Chk1 resulted in the accumulation of a hypophosphorylated form of Cdc25A protein, and Chk1-deficient cells failed to degrade Cdc25A after ionizing radiation treatment (52).
A fundamental question, which remains unanswered, is how SFN treatment causes DNA damage to activate ATM/Chk2. One possibility is that SFN reacts directly with the nucleophilic sites in DNA to cause damage, which is probable because SFN is a highly electrophilic molecule capable of reacting with nucleophiles such as GSH (47). Alternatively, SFN treatment may cause transient oxidative stress and subsequent DNA damage because of its reaction with cellular antioxidant GSH. Even though further studies are needed to explore the above mentioned possibilities, data presented in this paper demonstrate an increase in ROS upon treatment of PC-3 cells with SFN.
In conclusion, the results of the present study indicate that SFN-treated PC-3 cells are irreversibly arrested in G2/M phase because of ROS-mediated activation of ATM/Chk2 leading to Ser-216 phosphorylation and cytoplasmic sequestration of Cdc25C.
|
FOOTNOTES |
|---|
To whom correspondence should be addressed: Hillman Cancer Center, Research Pavilion Suite 2.32A, University of Pittsburgh Cancer Institute, 5117 Center Ave., Pittsburgh, PA 15213. Tel.: 412-623-3263; Fax: 412-623-7828; E-mail: singhs{at}msx.upmc.edu.
1 The abbreviations used are: SFN, sulforaphane; ATM, ataxia telangiectasia-mutated; Cdc25B, cell division cycle 25B; Cdc25C, cell division cycle 25C; Cdk1, cyclin-dependent kinase 1; Chk, checkpoint kinase; GST, glutathione S-transferase; Gy, gray; H2DCFDA, 6-carboxy-2',7'-dichlorodihydrofluorescein diacetate, di(acetoxymethyl ester); Me2SO, dimethyl sulfoxide; PBS, phosphate-buffered saline; ROS, reactive oxygen species; siRNA, small interfering RNA.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESSRESULTSDISCUSSIONREFERENCES |
|---|
